1

JA Spencer et al. Nature 000, 1-5 (2014) doi:10.1038/nature13034 Variation in BM p O 2 according to vessel diameter and distance from the endosteal surface.

JA Spencer et al. Nature 000 , 1 - 5 (201 4 ) doi:10.1038/nature 13034

Download PPT Report

Upload
wang-hodges
View
21
Download
1

Embed Size (px)

DESCRIPTION

Variation in BM p O 2 according to vessel diameter and distance from the endosteal surface. JA Spencer et al. Nature 000 , 1 - 5 (201 4 ) doi:10.1038/nature 13034. - PowerPoint PPT Presentation

Citation preview

Page 1: JA Spencer et al. Nature 000 , 1 - 5 (201 4 ) doi:10.1038/nature 13034

JA Spencer et al. Nature 000, 1-5 (2014) doi:10.1038/nature13034

Variation in BM pO2 according tovessel diameter and distance from the endosteal surface.

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

Documents

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Documents

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

Documents

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

Documents

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Documents

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

Documents

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Documents

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A

Documents

H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

Documents

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

Documents

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Documents

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Documents

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

Documents

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

Documents

Nature Immunology: doi:10.1038/ni · assignment of cells from each population across at least 2 out of 3 plates. Nature Immunology: doi:10.1038/ni.3688. Supplementary Figure 2 Temporal

Nature Immunology: doi:10.1038/ni · assignment of cells from each population across at least 2 out of 3 plates. Nature Immunology: doi:10.1038/ni.3688. Supplementary Figure 2 Temporal

Documents

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Documents

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Documents

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Documents

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Documents

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

Documents

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

Documents

Nature Reviews Drug Discovery Volume 13 Issue 10 2014 [Doi 10.1038%2Fnrd4391]

Nature Reviews Drug Discovery Volume 13 Issue 10 2014 [Doi 10.1038%2Fnrd4391]

Documents

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

Documents

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Documents

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

Documents

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

Documents

P. van der Harst et al. Nature 000 , 1 - 7 (2012) doi:10.1038/nature 11677

P. van der Harst et al. Nature 000 , 1 - 7 (2012) doi:10.1038/nature 11677

Documents

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Documents