1

C Kim et al. Nature 000, 1-6 (2013) doi:10.1038/nature11799 Induction of pathognomonic features of ARVD/C using mutant PKP2-iPSCs.

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

Download PPT Report

Upload
yeva
View
54
Download
5

Tags:

mutant pkp2ipscs

Embed Size (px)

DESCRIPTION

Induction of pathognomonic features of ARVD/C using mutant PKP2 -iPSCs. C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799. - PowerPoint PPT Presentation

Citation preview

Page 1: C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

C Kim et al. Nature 000, 1-6 (2013) doi:10.1038/nature11799

Induction of pathognomonic features of ARVD/C using mutant PKP2-iPSCs.

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A

Documents

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Documents

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

Documents

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

Documents

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

Documents

B Nystedt et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 12211

B Nystedt et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 12211

Documents

Nature Biotechnology: doi:10.1038/nbt

Nature Biotechnology: doi:10.1038/nbt

Documents

P. van der Harst et al. Nature 000 , 1 - 7 (2012) doi:10.1038/nature 11677

P. van der Harst et al. Nature 000 , 1 - 7 (2012) doi:10.1038/nature 11677

Documents

Nature Genetics: doi:10.1038/ng - David Reich...The gray dashed line denotes the diagonal (n = 11) . Nature Genetics: doi:10.1038/ng.3952 8 Supplementary Figure 8 Comparison of autosomal

Nature Genetics: doi:10.1038/ng - David Reich...The gray dashed line denotes the diagonal (n = 11) . Nature Genetics: doi:10.1038/ng.3952 8 Supplementary Figure 8 Comparison of autosomal

Documents

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Documents

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Documents

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Documents

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

Documents

Nature Biotechnology: doi:10.1038/nbt · Nature Biotechnology: doi:10.1038/nbt.4136. ... Each compound was run in a cell culture plate from three independent wells and each bar represents

Nature Biotechnology: doi:10.1038/nbt · Nature Biotechnology: doi:10.1038/nbt.4136. ... Each compound was run in a cell culture plate from three independent wells and each bar represents

Documents

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Documents

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Documents

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Documents

O Jagoutz & MD Behn Nature 504 , 131 - 134 (201 3 ) doi:10.1038/nature 12758

O Jagoutz & MD Behn Nature 504 , 131 - 134 (201 3 ) doi:10.1038/nature 12758

Documents

Nature Immunology: doi:10.1038/ni · assignment of cells from each population across at least 2 out of 3 plates. Nature Immunology: doi:10.1038/ni.3688. Supplementary Figure 2 Temporal

Nature Immunology: doi:10.1038/ni · assignment of cells from each population across at least 2 out of 3 plates. Nature Immunology: doi:10.1038/ni.3688. Supplementary Figure 2 Temporal

Documents

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Documents

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

Documents

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Documents

H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

Documents

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

Documents

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

Documents

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Documents

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

Documents

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Documents