1

H Uoyama et al. Nature 492, 234-238 (2012) doi:10.1038/nature11687 Photoluminescence of the CDCB series.

H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

Download PPT Report

Upload
elgin
View
50
Download
0

Tags:

Embed Size (px)

DESCRIPTION

Photoluminescence of the CDCB series. H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687. - PowerPoint PPT Presentation

Citation preview

Page 1: H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

H Uoyama et al. Nature 492, 234-238 (2012) doi:10.1038/nature11687

Photoluminescence of the CDCB series.

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Documents

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Documents

Published in Nature Materials (2016) doi:10.1038/nmat4569

Published in Nature Materials (2016) doi:10.1038/nmat4569

Documents

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Documents

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Documents

Nature Biotechnology: doi:10.1038/nbtruminant host shown on individual circles around the tree. Nature Biotechnology: doi:10.1038/nbt.4110 Author Andrew Gordon Created Date 3/12/2018

Nature Biotechnology: doi:10.1038/nbtruminant host shown on individual circles around the tree. Nature Biotechnology: doi:10.1038/nbt.4110 Author Andrew Gordon Created Date 3/12/2018

Documents

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

Documents

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Documents

O Jagoutz & MD Behn Nature 504 , 131 - 134 (201 3 ) doi:10.1038/nature 12758

O Jagoutz & MD Behn Nature 504 , 131 - 134 (201 3 ) doi:10.1038/nature 12758

Documents

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Documents

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Documents

Nature Biotechnology: doi:10.1038/nbt · Nature Biotechnology: doi:10.1038/nbt.4136. ... Each compound was run in a cell culture plate from three independent wells and each bar represents

Nature Biotechnology: doi:10.1038/nbt · Nature Biotechnology: doi:10.1038/nbt.4136. ... Each compound was run in a cell culture plate from three independent wells and each bar represents

Documents

DWJ Thompson et al. Nature 491 , 692-697 (2012) doi:10.1038/nature 11579

DWJ Thompson et al. Nature 491 , 692-697 (2012) doi:10.1038/nature 11579

Documents

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

Documents

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

Documents

Nature Immunology: doi:10.1038/ni · assignment of cells from each population across at least 2 out of 3 plates. Nature Immunology: doi:10.1038/ni.3688. Supplementary Figure 2 Temporal

Nature Immunology: doi:10.1038/ni · assignment of cells from each population across at least 2 out of 3 plates. Nature Immunology: doi:10.1038/ni.3688. Supplementary Figure 2 Temporal

Documents

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

Documents

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

Documents

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Documents

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Documents

RA Boon et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11919

RA Boon et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11919

Documents

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Documents

G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

Documents

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

Documents

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

Documents

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Documents

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Documents

B Nystedt et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 12211

B Nystedt et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 12211

Documents