1

DJ Ferguson et al. Nature 499, 70-73 (2013) doi:10.1038/nature12292 Results of REE and rifting models.

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

Download PPT Report

Upload
gambhiri-naveen
View
18
Download
2

Tags:

Embed Size (px)

DESCRIPTION

Results of REE and rifting models. DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292. - PowerPoint PPT Presentation

Citation preview

Page 1: DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

DJ Ferguson et al. Nature 499, 70-73 (2013) doi:10.1038/nature12292

Results of REE and rifting models.

Nature Biotechnology: doi:10.1038/nbt

Nature Biotechnology: doi:10.1038/nbt

Documents

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

Documents

P. van der Harst et al. Nature 000 , 1 - 7 (2012) doi:10.1038/nature 11677

P. van der Harst et al. Nature 000 , 1 - 7 (2012) doi:10.1038/nature 11677

Documents

Nature Biotechnology: doi:10.1038/nbt · Nature Biotechnology: doi:10.1038/nbt.4136. ... Each compound was run in a cell culture plate from three independent wells and each bar represents

Nature Biotechnology: doi:10.1038/nbt · Nature Biotechnology: doi:10.1038/nbt.4136. ... Each compound was run in a cell culture plate from three independent wells and each bar represents

Documents

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

Documents

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

Documents

RA Boon et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11919

RA Boon et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11919

Documents

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Documents

Published in Nature Materials (2016) doi:10.1038/nmat4569

Published in Nature Materials (2016) doi:10.1038/nmat4569

Documents

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Documents

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Documents

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

Documents

B Nystedt et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 12211

B Nystedt et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 12211

Documents

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Documents

G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

Documents

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Documents

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Documents

Nature Reviews Drug Discovery Volume 13 Issue 10 2014 [Doi 10.1038%2Fnrd4391]

Nature Reviews Drug Discovery Volume 13 Issue 10 2014 [Doi 10.1038%2Fnrd4391]

Documents

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

Documents

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Documents

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3107 Supplementary Figure 3 Distribution of P values from multiple-association analyses at 55 SNPs having a prior

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3107 Supplementary Figure 3 Distribution of P values from multiple-association analyses at 55 SNPs having a prior

Documents

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A

Documents

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

Documents

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

Documents

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

Documents

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

Documents

$Nature Biotechnology: doi:10.1038/nbt...sensitivity to detect MS indels decreases markedly at low allele fractions. Nature Biotechnology: doi:10.1038/nbt.3966 log 10 (KS t est ) log$

Nature Biotechnology: doi:10.1038/nbt...sensitivity to detect MS indels decreases markedly at low allele fractions. Nature Biotechnology: doi:10.1038/nbt.3966 log 10 (KS t est ) log

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Documents

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Documents

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Documents