1

AB Russell et al. Nature 000, 1-5 (2013) doi:10.1038/nature12074 Tle GXSXG-type proteins are antibacterial phospholipase effectors delivered by the T6SS.

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

Download PPT Report

Upload
germaine-rush
View
27
Download
1

Tags:

ab russell

Embed Size (px)

DESCRIPTION

Tle GXSXG-type proteins are antibacterial phospholipase effectors delivered by the T6SS. AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074. - PowerPoint PPT Presentation

Citation preview

Page 1: AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

AB Russell et al. Nature 000, 1-5 (2013) doi:10.1038/nature12074

Tle GXSXG-type proteins are antibacterial phospholipaseeffectors delivered by the T6SS.

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

Documents

Nature Biotechnology: doi:10.1038/nbtruminant host shown on individual circles around the tree. Nature Biotechnology: doi:10.1038/nbt.4110 Author Andrew Gordon Created Date 3/12/2018

Nature Biotechnology: doi:10.1038/nbtruminant host shown on individual circles around the tree. Nature Biotechnology: doi:10.1038/nbt.4110 Author Andrew Gordon Created Date 3/12/2018

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Documents

Published in Nature Materials (2016) doi:10.1038/nmat4569

Published in Nature Materials (2016) doi:10.1038/nmat4569

Documents

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Documents

$Nature Biotechnology: doi:10.1038/nbt...sensitivity to detect MS indels decreases markedly at low allele fractions. Nature Biotechnology: doi:10.1038/nbt.3966 log 10 (KS t est ) log$

Nature Biotechnology: doi:10.1038/nbt...sensitivity to detect MS indels decreases markedly at low allele fractions. Nature Biotechnology: doi:10.1038/nbt.3966 log 10 (KS t est ) log

Documents

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

Documents

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

Documents

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Documents

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Documents

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

Documents

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

Documents

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Documents

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Documents

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Documents

RA Boon et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11919

RA Boon et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11919

Documents

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Documents

Nature Immunology: doi:10.1038/ni · assignment of cells from each population across at least 2 out of 3 plates. Nature Immunology: doi:10.1038/ni.3688. Supplementary Figure 2 Temporal

Nature Immunology: doi:10.1038/ni · assignment of cells from each population across at least 2 out of 3 plates. Nature Immunology: doi:10.1038/ni.3688. Supplementary Figure 2 Temporal

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Documents

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

Documents

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3107 Supplementary Figure 3 Distribution of P values from multiple-association analyses at 55 SNPs having a prior

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3107 Supplementary Figure 3 Distribution of P values from multiple-association analyses at 55 SNPs having a prior

Documents

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

Documents

G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

Documents

Nature Biotechnology: doi:10.1038/nbt · Nature Biotechnology: doi:10.1038/nbt.4136. ... Each compound was run in a cell culture plate from three independent wells and each bar represents

Nature Biotechnology: doi:10.1038/nbt · Nature Biotechnology: doi:10.1038/nbt.4136. ... Each compound was run in a cell culture plate from three independent wells and each bar represents

Documents

Nature Genetics: doi:10.1038/ng - David Reich...The gray dashed line denotes the diagonal (n = 11) . Nature Genetics: doi:10.1038/ng.3952 8 Supplementary Figure 8 Comparison of autosomal

Nature Genetics: doi:10.1038/ng - David Reich...The gray dashed line denotes the diagonal (n = 11) . Nature Genetics: doi:10.1038/ng.3952 8 Supplementary Figure 8 Comparison of autosomal

Documents

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

Documents

Nature Reviews Drug Discovery Volume 13 Issue 10 2014 [Doi 10.1038%2Fnrd4391]

Nature Reviews Drug Discovery Volume 13 Issue 10 2014 [Doi 10.1038%2Fnrd4391]

Documents

O Jagoutz & MD Behn Nature 504 , 131 - 134 (201 3 ) doi:10.1038/nature 12758

O Jagoutz & MD Behn Nature 504 , 131 - 134 (201 3 ) doi:10.1038/nature 12758

Documents

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Documents

H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

Documents