Biochimie (1996) 78, 1035-1042 © Soci6t6 fran~;aise de biochimie et biologie mol6culaire / Elsevier, Paris

Differential contributions of two elements of rho-independent terminator to transcription termination and mRNA stabilization

H Abe, H Aiba*

Department of Molecular Bioiog3, School of Science, Nagoya Universi~.; Chikusa, Nagoya 464-01, Japan

(Received 3 December 1996: accepted 12 December 1996)

Summary - - The hallmark features of rho-independent transcription terminators are a G+C-rich dyad symmetry sequence followed by a run of T residues on a sense strand. Both of these structural elements are required for efficient transcription termination. Besides its primary function, rho-independent terminators are also known to enhance expression of an upstream gene by stabilizing RNA in a few cases. The Escherichia coli crp gene encoding cAMP receptor protein (CRP) contains a typical rho-independent terminator. To gain further insight into the roles of the G+C-rich dyad symmetry sequence and the poly(T) tract both in transcription termination and mRNA stabilization, we constructed a series of variant crp terminators and analyzed their abilities regarding these two functions. Disruption of the G+C-rich dyad symmetry sequence almost completely eliminated terminator activity while disruption of the poly(T) tract reduced terminator activity signi- ficantly but not completely. Thus, the contribution of the G+C-rich dyad symmetry sequence to transcription termination is larger than that of the poly(T) tract. Disruption of the G+C-rich dyad symmetry region reduced expression of the upstream cip gene by accelerating the rate of mRNA degradation. However, disruption of the poly(T) sequence had no effect on the stability of the crp mRNA, indicating that the poly(T) tract plays no role in mRNA stabilization. When the crp terminator was replaced by terminators derived from other genes, the fusion genes expressed the crp mRNA at the same level as did the native crp gene, suggesting that the mRNA stabilization effect is probably a general nature of rho-independent terminators.

rho-independent terminator / transcription termination / mRNA stability / poly(T) tract / stem-b~op structure

i n t roduc t ion

Rho-independent transcription terminators, also called fac- tor-independent or intrinsic terminators, specify the 3' ends of many transcription units in prokaryotes [ ! ]. They arc also used as regulatory signals before structural genes in a num- ber of operons to modulate transcription of the downstream genes [2]. The terminators consist of a G+C-rich dyad sym- metry sequence immediately followed by a poly(T) tract on the sense strand, yielding an RNA with a stem-loop struc- ture followed by a run of U residues. While mutational studies on several rho-independent terminators have re- vealed that both of these structural elements are required for efficient termination [3-7], how these elements are involved in transcription termination is not fully understood. In par- ticular, the role of the poly(T) tract is rather , ,~ :overs ia l . In a classical two-step model, the 3' tail of the nascent tran- script is assumed to stimulate release of the RNA due to the low stability of the dA-rU hybrid after the formation of the G+C-rich RNA hairpin [3, 8, 9]. However, the role of the

*Correspondence and reprints

instability of the dA-rU base pairs in transcription termina- tion has been questioned since there is no simple correlation of termination efficiency with the length of poly(T) tract [10]. An alternative model argues that transcription termi- nation is closely coupled with inchworm movements of RNA polymerase and the poly(T) tract may act as an inch- worming signal for elongating RNA polymerase [11 ]. Thus, the role of the poly(T) tract in rho-independent terminators remains to be an important subject for further studies.

Besides transcription termination, rho-independent ter- minators are known to enhance gene expression by stabiliz- ing upstream mRNA in some cases such as the E coli ti'p operon [12] and the lambda phage int gene [I 3]. However, only a small number of rho-independent terminators have been characterized regarding the mRNA stabilization effect. In other words, it has not yet been established whether the mRNA stabilization effect is generally applicable to other rho-independent terminators. Furthermore, structural deter- minants of mRNA stabilization have been poorly studied. For example, there is no report that addressed the role of the poly(T) tract in mRNA stabilization.

The terminator of the Escherichia coli crp gene encoding cAMP receptor protein (CRP) fits closely the paradiem of a rho-independent terminator [14]. We showed previously that the ctp terminator acts efficiently to terminate tran- scription both in vitro and in vivo [15]. We also demon-

1036

strated that the crp terminator functions to increase the crp expression by stabilizing the crp mRNA [15]. In this report, we have investigated the relative contributions of the G+C- rich dyad symmetry sequence and the poly(T) tract to tran- scription termination and to mRNA stabilization using the crp gene as a model system. This is the first systematic study that addresses how two elements of rho-independent terminators contribute to both transcription termination and mRNA stabilization. We show that the contribution of the G+C-rich dyad symmetry sequence to transcription termi- nation is more important than that of the poly(T) tract al- though both of these elements are required for efficient termination. In contrast, we found that the poly(T) tract plays no role in mRNA stabilization. In other words, the G+C-rich dyad symmetry sequence is solely responsible for mRNA stabilization. Thus, the structural determinant for mRNA stabilization does not coincide with that for tran- scription termination. We also demonstrate that several he- terologous terminators can act an RNA stabilizer when placed downstream of the crp structural gene instead of the crp terminator.

Materials and methods

Construction of terminator variants

The parent plasmid used in this study is pHA7 in which the crp gene is under the control of the bin promoter [ 141. A unique BssHil site is located in the dyad symmetry region of the crp terminator (see fig 1 ). Two new restriction sites ~'ere introduced in the flankin~ regions of the crp terminator by PCR mutagenesis: a SpI! site downstream of the translation termination codon of the c~p and a Sinai site downstream of the poly(T) tract. The resulting plasmid was designated pHA7M0. DNA fragments corresponding to each terminator variant with Sinai and Spll or BssHll half-sites at the ends were prepared by annealing complementary synthetic oligonucleotides. To construct variants with the dyad symmetry region (stem mutants), the DNA region between the Spli and Sinai sites was replaced by each of the synthetic SpII-Smal DNA frag- ments. To construct variants with the poly(T) tract (T tract mu-

. I t I 'Ill' t I i ~ pHA7

4 8 8 . b p 333-bp

Fig 1. Diagram of the crp region in pHA7. The relevant restriction sites are shown. The black bar indicates the ceding region of the crp which is under the control of the bla promoter. The arrow indicates the start site and direction of transcription. The major transcript is shown schematically below the restriction map. The 333-bp Haelll fragment was used for b~ vivo termination assay. The 488-bp Hpall fragment was used as a DNA probe for S I assay.

tants), the DNA sequence between the BssHll and Smal sites was replaced by each of the BssHll-Smal DNA fragments. To construct pHA7 derivatives in which the crp structural gene is fused to he- terologous terminators, an additional restriction site (Mlul) was created near the translation termination codon in pHA7M0. The Mhd and Sinai regions of the resulting plasmid were replaced by synthetic DNA fragments corresponding to the trp attenuator (opAL T7 early terminator (T7Te), and rrnB terminator (rrnBTl) [10l with Mhd and Smal half-sites. The sequences of variant ter- minators were verified by direct DNA sequence analysis. The names and sequences of terminator variants are given in figure 2.

Construction of tetTninator-galK filsion plasmids and termination assay

Termination efticiencies of terminator variants were measured by using plasmid vector pKG!00, designed to quantitate terminator activity in vivo !161. The Haelll fragments containing each of the crp terminator variants were prepared from pHA7 derivativ~ s and ligated into the Smal site of pKGI00 (see fig 3). The resulting pKG i 00 derivatives in which the terminator was placed in the cor- rect orientation were introduced into gall(- strain, R594 (gal-I gal- 2 lac rpsL s,pO) 1171. Cells harboring each of the pKGI00 derivatives were grown in LB medium containing 50 lag/mL of ampicillin at 37°C to an OD~,()0 of 0.8. Galactokinase activities were assayed according to the procedure of Adhya and Miller [ 18]. Each sample was assayed in triplicate, and the specific activities were calculated and averaged.

Analysis of protein

TP2339 cells (F- xyl ih,A argHi AlacX74 Acva AcqJ) 1191 harbor- ing each of the pHA7 derivatives were grown in LB medium con- taining 50 lag/mL of ampicillin at 37°C. At ODt,,0 = 0.8, cells equivalent to 1.00D~,q,) were centrifuged and the pellets were sus- pended in 50 HL of H20. Tt~ solubilize cells, the cell suspensions were mixed with 50 laL of 2 x loading buffer (4% SDS, 10% 2- mercaptoethanol, 125 mM Tris-HCI, pH 8.0, 20% glycerol, 0.2% bromophenol blue) and heated for 5 min at 90°C. Total proteins equivalent to 0. ! ODt, o~ were loaded onto 0. 1% SDS-15% polyac- rylamide gels and electrophoresed. After electrophoresis, the gels were stained with Coomassie brilliant blue. To quantify the amount of CRE the stained gels were scanned with an LKB UItrascan XL laser densitometer.

Analysis of RNA

The pHA7 derivatives containing the terminator variants were in- troduced into TP2339. The crp mRNA levels were analyzed by a quantitative S I nuclease assay as described [20]. Cells harboring each of the pHA7 derivatives were grown in I 0 mL of LB medium containing 50 ~g/mL of ampicillin at 37°C. Ai ODt,00 = 0.8, cells were harvested and total cellular RNAs were prepared. Tile lower strand of the 488-bp Hpall fragment labeled at its 5' end with 32p was hybridized with each of the RNA samples and treated with S I nuclease. Products of S l digestion were analyzed by electro- phoresis on 6% polyacrylamide-8 M urea gels. To determine the degradation rate of the t'q~ mRNA, cells harboring each of the pHA7 derivatives were grown in 100 mL of LB medium containing 50 pg/mL of ampicillin at 37°C. At OD600 = 0.8, rifampicin was added to 200 pg/mL and incubation was continued. Total cellular RNAs were isolated at time intervals after the addition of rifam-

103/

M0

BssHH CACTCG~TCCCGTCGGAGTGGCGCGTTACCTGGTA~CATTTTGTTTCCCCCGA

Sp~ Sm~ CACTCG~TCCCGTACGGAGTGGCGCGTTACCTGGTAGCGCGC_CATTTTGTTTCCCGG_.G_GA

MI CACTCGq~------~TCCCGTACGGAGTGGCGCGTTACCTGGTAGCGCGCCATTTTGTTCCCCGGGA

M2 CACTCGq~--~TCCCGTACGGAGTGGCGCGTTACCTGGTAGCGCGCCATTTTGTCC~CCGGGA

M3 CACTCG~TCCCGTACGGAGTGGCGCGTTACCTGGTAG .GCG~_CA FTTTGCCCCCCGGGA

M4 CACTCGZ~TCCCGTACGGAGTGGCGCGTTACCTGGTAGCGCGCCAGAGAGCCCCCCOa.~QA

M5 CACTCGq~-~TCCCGTACGGAGTGGCGCGTTACCTGGTAGCGCGCCAAAAAAAAACCCGGGA

M6 CACTCG~TCCCGTACG-AGTTTATATGGAAATGGTAGCGCGCCATTTTGTTTCCCGGGA

M7 CACTCG~TCCCGTACGGAGTTTATATTTAAATTTTAGATATAAATTTTGTTTCCCGGGA

M8 CACTCGq~--~TCCCGTACG-AGTTTATATGGAAATGGTAGCGCGCCAAAAAAAAACCCGGGA

trpA Mlui

CACGCG~TCAGATACCCAGCCCGCCTAATGAGCGGGCTTTTTTTTCCCGGGA

rrnBT1

77Te

CACGCG~TAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTCCC-G-C~A

CACOC~GTAATCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTAT~A

Fig 2. The nucleotide sequences around the wild-type crp terminator and its variants. The mutational changes in the crp terminator are indicated as bold letters. Bold italic lettzrs indicate the sequences derived from trI,A, rrnBT i, and T7Te. Translation termination codon (TAA) of the crp gene is boxed. The relevant restriction sites are underlined. The inverted repeat sequences are shown by horizontal arrows.

picin. The RNA samples were subjected to S! nuclease assay and the S I digestion products were analyzed by electrophoresis on 6% polyacrylamide-8 M urea gels. DNA bands protected from S I di- gestion were visualized by autoradiography and quantified by Bio- image Analyzer BAS2000 (Fujix).

Results

Structures o f the crp terminator and its variants

DNA sequences of variant terminators used in this study are shown in figure 2. M0 is a control terminator which retains

the wild-type terminator sequence and has two base sub- stitutions in the flanking region of the terminator. As shown later, these base changes did affect neither transcription ter- mination nor mRNA stability. Variants M I, M2 and M3 are T cluster mutants tha. have one, two and three T to C changes in the distal ~'egion of the poly(T) tract, respec- tively. M4 and M5 are T cluster mutants in which the T cluster has been completely substituted by a random se- quence without T and by an A cluster, respectively. Variants M6 and M7 are stem mutants which have base substitutions in the dyad symmetry region. Variant M6 has several base changes which completely disrupt the hairpin-forming se- quence. M7 is a variant in which the G+C-rich stein has

1038

Haelll terminator HaeUl

I - - ! "%°',.,..o. ,..o°" "..%. .°..,"°°°°

Sinai ....'""

Pgal galK

pKG100 i v

A

Fig 3. Clonings of the crp terminator variants into the pKGI00 vector. The Haelll terminator fragments taken from pHA7 or its derivatives were cloned into the Smal site between the gal promoter and galK gene.

been converted to an A+T-rich stem. Finally, M8 is a double mutant in which both the G+C-rich stem and T cluster se- quences have been totally disrupted by base substitutions.

Termination efficiencies of variant terminators in vivo

To assess the roles of the G+C-rich dyad symmetry se- quence and the poly(T) tract in transcription termination, we measured the termination efficiencies of the mutated terminators by using the galK plasmid system. Haelll DNA fragments containing the terminator variants were inserted between the gal promoter and the galK reporter gene of pKGI00. The resulting plasmids (pKGI00 derivatives) were introduced into the gall(,- cells, and galactokinase ac- tivities of the cells were determined to monitor terminator activity of inserted fragments. The results are presented in table I. The galactokinase activity was significantly reduced when each of the terminator variants was inserted. It should be noted that even M8 DNA fragment in which two ele- ments of the rho-independent terminator were totally elimi- nated exhibited about 50% reduction in galactokinase

activity compared to the control plasmid pKG 100. This re- duction would be caused by possible rho-dependent and/or non-specific terminations within the inserted fragment. In any case, we used the pKGI00M8 as a terminator-deficient control to evaluate the effect of mutations on the termina- tion. Namely, the expression of galactokinase from this plasmid was set as 100% read-through or 0% termination. The termination efficiency for the wild-type crp terminator was calculated to be 87%. Variant M0 retained the termina- tion efficiency similar to the wild-type terminator, indicat- ing that the introduction of two restriction sites in the flanking regions has little effect on transcription termina- tion. The complete disruption of the dyad symmetry se- quence by base substitutions (M6) essentially eliminated terminator activity. When the G+C-rich stem was converted to an A+T-rich stem (M7), terminator activity was also heavily impaired The data clearly indicate that the G+C-rich dyad symmetry sequence makes a crucial contribution to transcription termination, as expected. We next analyzed the effect of the mutations in the poly(T) tract region on termi- nation. The substitution of the last T residue in the poly(T) tract to C residue (variant M l) reduced termination effi- ciency to 56%. Further substitutions of T residue to C residue (M2 or M3) caused little reductions in termination efficiency. Furthermore, variants M4 and M5 in which the T tract is totally disrupted showed termination efficiency that is only slightly lower than variant M 1. In other words,

Table 1. hz vivo transcription termination efficiencies of the crp terminator variants. The derivatives of pKGI00 carrying the termi- nator fragments were introduced in R594 cells and the galactoki- nase activities of the transformants were determined. The galactokinase units are expressed as nanomoles of galactose phos- phorylated per min/A600..~. The percent termination is calculated from the ratio of the galactokinase units of each plasmid to that of pKG 100M8.

Table.1. Termination efliclencies of the crp terminator variants

Plasmids Galacfokinase units % Transcription termination

pBR322 <1 pKG100 235.4

pKG-WT ~ ) 15.4 87.2 pKG-M0 -JLu)n 16.0 66.7

pKG-M1 52.7 56.0 pKG-M2 C ) 56.9 50.9 pKG-M3 ._]k ° 52.3 56.4 pKG-M4 72.7 39.4 pKG-M5 74.7 37.7

pKG-M6 ~ 109.1 9.0 pKG-M7 ~ ) n 109.4 8.8

pKG-M8 ~ , 119.9 0

significant termination activity was retained even without the poly(T) tract. Taken together, we conclude that the poly(T) tract certainly plays an important role in transcrip- tion termination but its contribution is less prominent com- pared to that of the G+C-rich dyad symmetry sequence at the crp terminator.

Effects o f terminator mutations on the expression qf upstream gene

To examine the effects of terminator mutations on ex- pression of the crp, pHA7 derivativies were introduced in crp- cells. Total proteins prepared from cells harboring each plasmid were analyzed by SDS-PAGE. In this assay, the CRP protein was easily detected on a gel stained with Coomassie brilliant blue. As shown in figure 4, the levels of CRP in cells harboring stern mutants were about four- fold less compared to the wild-type terminator while the mutations in the poly(T) tract did not affect the level of CRP. We also examined the effects of mutations of the terminator region on the levels of crp mRNA by a quantitative S! nu- clease assay by using the lower strand of the 488-bp Hpall fragment 32p-labeled at its 5' end as a DNA probe. In this assay an S l-resistant DNA of about 380 bases which corre- spond to the crp mRNA was produced. As shown in figure 5, the disruption of the stem region significantly reduced

! 039

CRP ===

r ~ ] r i F - - - - 7

WT MO M'l U2 U5 M6 M7 M8

N . . ~ . -

2 3 4 s e- "~ 8 9 lo

Fig 4. Effects of terminator mutations on the expression of CRE Total proteins from TP2339 cells harboring pHA7 derivatives were analyzed by SDS-PAGE using a 15% polyacrylamide gel as de- scribed in Materials and methods. The arrowhead indicates the CRP bands. Lane 1 is 0.5 lag of purified CRP. Lane 2 represents total proteins of cells harboring a control plasmid pBR322.

the crp mRNA level. The reduction of S i-resistant DNA in stem mutants was estimated to be about four-fold. On the other hand, all of the T tract mutations did not affect the

[ i w j F - - ' - - ' - - ' 7

WT MO M1 M2 M5 M6 M7 M8

p r o b e h=~

crp mRNA ~ . ..... ~i!~ . . . . . i~,~i!~!ii~ ~¸

1 2 3 4 5 6 7 8 9

Fig 5. Effects of terminator mutations on the expression of the crp mRNA. The pHA7 derivatives carrying the terminator variants were introduced in TP2339 cells. Total RNAs (30 lag) prepared from each transformant were subjected to S! assay as described in Materials and methods. Lane i is a DNA probe witheut S i treatment.

1040

levels of crp mRNA. The levels of csp mRNA were well correlated with CRP levels. The data clearly indicate that the G+C-rich stem-loop but not T tract sequences is respon- sible for the enhanced expression of upstream gene.

Effects o f terminator mutations on mRNA stability

To test the effects of terminator mutations on the stability of the upstream mRNA, the decay rate of the crp mRNAs was determined. Cells harboring pHA7 derivatives were grown to exponential phase and rifamipicin was added to prevent further initiation of transcription. Cellular RNAs were isolated at various times after the addition of rifam- picin and subjected to an El nuclease assay. As shown in figure 6, the mutations in the stem region significantly ac- celerated the degradation rate of crp mRN,,~. The radioac- tivity of the S l-resistant DNA band in each lane was quantified to determine the rate of mRNA degradation. The half-lives of crp mRNAs of M6 and M8 were estimated tc be about I min while the half-life of the wild-type c~7~ mRNA was about 3 min. The half-life of M5 crp mRNA was essentially the same with that of the wild-type. Simi- larly, all of the other T tract mutations had little effect on the stability of crp mRNA (data not shown). We conclude that the poly(T) tract which is required for efficient tran- scription termination plays no role in mRNA stabilization of the upstream gene.

Heterologous terminators can stabilize the ctp mRNA

To examine the generality of the mRNA stabilization effect of rho-independent terminators, we constructed fusion genes in which the ctp terminator was replaced by other terminators. DNA fragments corresponding to three well-

characterized rho-independent terminators (oT)A, T7Te, and rrnBTl were prepared by DNA synthesis and inserted be- tween the Mlul and Sinai sites of a variant of pHA7M0 which carries a Mhd site near the termination codon. We examined how the heterologous terminators affect the crp mRNA levels by S I assay. As shown in figure 7, all three fusion genes expressed efficiently the upstream crp mRNA as did the wild-type crp gene, indicating that three termina- tors can act to stabilize the upstream mRNA. These results strongly suggest that rho-independent terminators generally can confer stability to the upstream mRNA. It should be noted that the~e is no simple correlation between the ther- modynamic stability (AG) of the RNA secondary structure and the magnitude of enhancement in expression of the up- stream gene.

Discussion

The primary role of rho-independent terminators is to spec- ify the 3' end of transcription units or to attenuate transcrip- tic'a thereby controll ing the level of transcription of downstream genes. Another less characterized function of rho-independent terminators is to stabilize the upstream RNA. In this paper, we have addressed a question of how two elements of rho-in(~ependent terminators contribute to transcription termination and to RNA stabilization of the upstream gene. For this, the effects of various mutations in the crp terminator on the transcription termination and on the stability of upstream clp mRNA have been investigated. Our data can be summarized as follows: I ) disruption of the dyad symmetry sequence of the crp terminator dramatically reduced termination eMciency; 2) conversion of the G+C- ,'ich to A+T-rich dyad symmetry sequences also eliminated

WT M5

Time (rain) Time (rain)

0 2 4 8 0 2 4 8

crp mRNA ,.~ - - crp mRNA ,~ ~ ~ _ _

~ l O O ~ . ~ : 3 m l n ] ~ , o o ~ = 3 m l n 1

- 0 2 4 6 8 ' 1 time(mini timelmin)

M6 Time (min)

0 2 4 8

arp mRNA ~ ~ , ~ ......

"" 1 0 0 ~ tl/2=lmin

.=

°- ' i 1 \ " 0 2 i i i k

time(rain)

U8

Time (rain) 0 2 4 8 r ...... ~ : ~ : ~2~

cm mnNA-- ~ L ~ ...............

" I O 0 ~ i l / 2 : l m i n

"~: 101 .N ~ ]o z 4 6 k

time(rain) Fig 6. Stability of the crp mRNAs expressed in cells harboring pHA7 derivatives. TP2339 cells harboring plasmids were grown to OD600 = 0.8 and total RNA was extracted at the times indicated after the addition of rifampicin (200 lag/mL). Total RNA (50 lag) was subjected to S I assay. The DNA bands were quantified using Bioimage Analyzer BAS2000 (Fuji). Semilogarithmic plots of the radioactivity of S l-resistant DNA versus time are shown below the autoradiograms. The halt-life (t ]/:,) of the each mRNA was determined based on these plots.

probe

crp mRNA

1 2 3 4 5 6

i

!04 !

WT M8 trpA rrnBT1 TTTe

AG(kcai/mol) -21.1 =2.4 -14.8 -29.5 -18.8

Fig 7. Effects of heterologous terminators on the expression of the cq~ mRNA. The pHA7 derivatives containing the opA, rrnBTl, and T7Te were introduced into TP2339 cells. Total RNAs (30 tag) prepared from each trans|k)rmant were subjected to S ! assay as described in Materials and methods. The free energies of the predicted terminator RNA hairpins, calculated by the method of Zuker and Stiegler [21 ], were shown below the lanes.

termination efficiency; 3) partial or complete disruption of the poly(T) sequence significantly but not completely re- duced termination efficiency; 4) disruption of the G+C-rich dyad symmetry region markedly reduced expression of the upstream crp gene through its influence on mRNA stability; 5) disruption of the poly(T) sequence did not affect the sta- bility of the upstream RNA; and 6) rho-independent termi- nators derived from other operons enhanced expression of the crp gene when they were placed downstream of the o7, structural gone.

Based on these results, we conclude th¢~ two structural elements of the rho-independent terminato~ contribute dif- ferentially to transcription termination and to mRNA sta- bilization. Namely, the G+C-rich dyad symmetry sequence but not the poly(T) tract is essential for mRNA stabilization while both elements are required for efficient transcription termination. Examples are known in which dyad symmetry sequences that can form a stem-loop structure act to in- crease expression of an upstream gene by stabilizing mRNA. Evidence for this phenomenon have been most thoroughly documented with the repetitive e.~tragenic pa- lindromic (REP) seq~:ences [22]. It is generally believed that stem-loop structures stabilize upstream mRNA by ac- ting as a barrier against 3'-5' exonucleolytic attack [22]. Rho-independent terminators are probably the most widely distributed dyad symmetry sequences in the E coli genome. However, only a few rho-independent terminators have been actually shown to stabilize upstream RNA. The first dem- onstration that a rho-independent terminator may act to en- hance expression of an upstream gone came from studies on the phage lambda int gene [13]. The int gene is expressed efficiently from a transcript that terminates at a rho-inde

pendent terminator whereas a second read-through tran- script expresses very little int gene due to the rapid degra- dation of int mRNA triggered by the removal of the terminator hairpin by RNAase Ill. Subsequently, mRNA stabilization by rho-independent terminators was demon- strated in the E coli trp operon [I 2], the Bacillus thuring- iensis co' gene [23], a bacteriophage ~X174 [24], and the E coli cq~ gene J 15 ]. We demonstrated here that three well- known rho-independent terminators exhibit the ability to stabilize cq~ mRNA when they are placed downstream ol' the crp structural gone. The RNA stabilization effect of rho- independent terminators does not appear to be directly correlated with the thermodynamic stability (AG) of the RNA hairpin. However, it is apparent that the stem-loop structure, which consisted of only A-T base pair'.~, has no ability to stabilize the upstream RNA. It is also known that there is no simple correlation between the stability of RNA secondary structure and the efficiency of transcription ter- mination [ ! 0]. Our results strongly support the view that the mRNA stabiliz.-tion effect is an important general function of rho-independent terminators.

An~:~ther implication ~f the present sludy is that :'~c con- trJbu|ion of the G~-C-rich dyad symmetry sequence is more important than that of the poly(T) tract at the crp terminator although both elements are required for efficient termina- tion. This finding is consistent ,,,ith the fact that the require- ment of the number of T resid~aes varies depending on the terminator. For example, it is known tha.~ partial deletions of the poly(T) tract drastically reduce termination efficiency in some terminators while there are strong terminators with only a few T residues [10]. On the other hand, there is an example in which a stretch of A residues in the template

1042

strand without an RNA hairpin structure acts as an efficient terminator in vitro [251. A classical model concerning the mechanism of transcription termination postulates that the G+C-rich RNA hairpin first causes the RNA polymerase to pause in elongation and subsequently the U-rich 3'-tail stimulates release of the RNA transcript due to the low sta- bility of the dA-rU hybrid [3, 8, 9]. However, recent studies have revealed that interactions between RNA and RNA polymerase play a major role in transcription termination [10, 26]. In particular, findings about structural rearrange- ments of elongating RNA polymerase resembling the move- ments of an inchworm [27-301 have led to an alternative model in which transcription termination is coupled with straining and relaxation of elongating RNA polymerase [i 11. This model assumes that formation of an RNA hairpin reduces the RNA-RNA polymerase interaction and the poly(T) tract acts as an inchworming signal. The different requirements of the poly(T) tract at different terminators can be easily ex- plained by the inchworming model since it is known that se- quences without a run of T residues can be used as inchworming signals [291. Although the structural features of these sequences are not defined yet, they could substitute for the poly(T) tract in some terminators. It is interesting to examine whether rho-independent terminators containing an inchworming signal other than the poly(T) tract naturally exist.

Acknowledgment

This work was supported in part by Special Project Research Funds from the Ministry of Education, Science, Sports and Cul- ture o f Japan.

References

I d'Aubenton Carafa Y, Brody E, Thermes C (!090) Pr,_'diction of rho- independent Escherichia colt transcription terminators: A statistical analysis of their RNA stem-loop structures. J Mol Biol 216, 835-858

2 Landick R, Turnbough CL, Yanofsky, C (1996) Transcription attenua- tion. hz: Escherichia colt and Sahnonelh~ typhimuriunc Celhdar and Molecular Bioloh:v (Neidhardt FC, Curtiss !11 R, Ingraham JL, Lin ECC, Low KB, Magasanik B, Reznikoff WS, Riley M, Schaechter M, Umbarger HE, eds) American Society for Microbiology, Washington DC, 2nd edn, vol I, 1263 p

3 Platt T (1981) Termination of transcription anta its regulation in the tryptophan operon of E colt. Cell 24, 10-23

4 Lynn SP, Kasper LM, Gardner JF (1988) Contributions of RNA secondary structure and length of the thymidine tract to transcrip- tion termination at the thr operon attenuator. J Biol Chem 263, 472-479

5 Cheng S-WC, Lynch EC, Leason KR, Court DL, Shapiro BA, Friedman D! (1991) Functional importance of sequence in the stem-loop of a transcription terminator. Science 254, 1205- i 207

6 Wilso~ KS, yon Hippel PH (1995) Transcription termination at intrinsic termi.'~ators: The role of the RNA hairpin. Ptoc Natl Acad Sci USA 92, 8793-8797

7 Yang M-T, Scott !I HB, Gardner JF (1995) Transcription termination at the thr attenuator: Evidence that the adenine residues upstream of the stem and loop structure are not required for termination. J Biol Chem 270, 23330-23336

8 Platt T (1986) Transcription termination and the regulation of gene expression. Allnu Rev Biochem 55, 339-372

9 Yager TD, yon Hippel, PH { 1987) Transcription elongation and termi- nation in Escherichia colt. In: Escherichia colt and Sahnonelhl ty- phimuriun~: Celhdvr and Molecuho" Biology. (Neidhardt FC, Ingraham SL, Low KB, Magasanik B, Schaechter M, Umbarger HE, eds) Ameri- can Society for Microbiology, Washington DC, Vol 2, 1241 p

10 Reynolds R, Bermudez-Cruz RM, Chamberlin MJ (1992) Parameters af- fecting transcription ternfination by Escherichia colt RNA polymerase: I. Analysis of 13 rho-independent terminators. J Mol Bio1224, 31-51

11 Nudler E, Kashlev M, Nikiforov V, Goldfarb A (1995) Coupling be- tween transcription termination and RNA polymerase inchworming. Cell 81, 35 !-357

12 Mott JE, Galloway JL, Platt T (1985) Maturation of Escherichia colt tryptophan operon mRNAs: Evidence for 3' exonucleolytic processing after rho-independent termination. EMBO J 4, 1887-1891

13 Guarneros G, Montanez C, Hernandez T, Court D { 1082) Posttranscrip- tional control of bacteriophage ~, int gene expres fion from a site distal to the gene. Proc Natl 4cad Sci USA 79, 238-242

14 Aiba H, Fujimoto S, and Ozaki N (1982) Molecular cloning and nucle- otide sequencing of the gene for E colt cAMP receptor protein. Nucleic Acids Res I O, 1345- ! 36 I

15 Aiba H, Hanamura A, Yamano H (1991) Transcription terminator is a positive regulatory element in the expression of the Escherichia colt crp gene. J Biol Chem 266, 172 I- ! 727

16 McKenney K, Schimatake H, Court D, Schmeissner U, Rosenberg M t 1981 ) A system to study promoter and terminator signals recognized by Escherichh~ colt RNA polymerase, hi: Gene Ampl~/?cation and Analysis. Analysis of Nucleic Acids Enzymatic Methods (Chirikjian JC, Papas, TS, eds) Elevier/North Holland Publishing Co, Amster- dam, Vol 2, 383 p

17 Campbell A ( 1961 ) Sensitive mutants of bacteriophage k. Virology 14, 22-32

18 Adhya S, Miller W (19791 Modulation of two promoters of the galac- tose operon of Escherichia colt. Nanoe 279, 492---494

19 Roy A, Haziza C, Danchin A (1983) Regulation of adenylate cyclase synthesis in Escherichia colt: nucleotide sequence of the control re- gion. EMBO J 2, 791-797

2t) Mort K, Aiba H (1985) Evidence for negative control of t3,tl transcrip- tion by cAMP and cAMP receptor protein in intact Escherichia colt cells. ,I Biol Chem 260, 14838-14843

21 Zuker M, Stiegler P (1981) Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res 9, 133-148

22 H iggins CE Causton HC, Dance GSC, Mudd EA (1993) The role of the 3' end in mRNA stability and decay, h~: Conool of Messenger RNA Stabili~ (Bela~o J, Brawennan G, eds) Academic Press Inc, New York, 13 p

23 Wong HC. Hayashi M (1986) Identification of a positive retroregulator that stabilizes mRNAs in bacteria. Pioc NatlAcad Sci USA 83, 3233-3237

24 Hayashi MN, Hayasr, i M (1985) Cloned DNA sequences that deter- mine mRNA stability of bacteriophage ~XI74 in vivo are functional. Nucleic Acids Res 13, 5937-5948

25 Tomizawa J, Masukata H (1987) Factor-independent termination of transcription in a stretch of deoxyadenosine residues in the template DNA. Cell 51,623-630

26 Reynolds R, Chamberlin MJ {1992) Parameters affecting transcription termination by Escherichia colt RNA polymerase: It. Construction and analysis of hybrid terminators. J Mol Biol 224, 53-63

27 Krummel B, Chambedin MJ (1992) Structural analysis of ternary com- plexes of Escherichia colt RNA polymerase: individual complexes halted along different transcription units have distinct and unexpected biochemical properties. J Mol Biol 225, 221-237

28 Krummel B, Chamberlin MJ (1992) Structural analysis of ternary com- plexes of Escherichia colt RNA polymerase: deoxyribonuclease I foot- printing of defined complexes. J Mol Biol 225, 239-250

29 Nudler E, Goldfarb A, Kashlev M (1994) Discontinuous mechanism '~f transcription elongation. Science 265, 793-796

30 Wang D, Meier TI, Chan CL, Feng G, Lee DN, Landick R (1995) Dis- continuous movements of DNA and RNA in RNA polymerase accompany formation of a paused transcription complex. Cell 81,341-350