Transformacion de Geobacillus

J. Microbiol. Biotechnol. (2012), 22(9), 1279–1287http://dx.doi.org/10.4014/jmb.1203.03023First published online May 19, 2012pISSN 1017-7825 eISSN 1738-8872

Genetic Transformation of Geobacillus kaustophilus HTA426 by ConjugativeTransfer of Host-Mimicking Plasmids

Suzuki, Hirokazu1* and Ken-ichi Yoshida

2

1Organization of Advanced Science and Technology, Kobe University, Hyogo 657-8501, Japan2Department of Agrobioscience, Graduate School of Agricultural Science, Kobe University, Hyogo 657-8501, Japan

Received: March 12, 2012 / Revised: May 3, 2012 / Accepted: May 10, 2012

We established an efficient transformation method for

thermophile Geobacillus kaustophilus HTA426 using

conjugative transfer from Escherichia coli of host-mimicking

plasmids that imitate DNA methylation of strain HTA426

to circumvent its DNA restriction barriers. Two conjugative

plasmids, pSTE33T and pUCG18T, capable of shuttling

between E. coli and Geobacillus spp., were constructed.

The plasmids were first introduced into E. coli BR408,

which expressed one inherent DNA methylase gene (dam)

and two heterologous methylase genes from strain

HTA426 (GK1380-GK1381 and GK0343-GK0344). The

plasmids were then directly transferred from E. coli cells

to strain HTA426 by conjugative transfer using pUB307

or pRK2013 as a helper plasmid. pUCG18T was introduced

very efficiently (transfer efficiency, 10-5-10

-3 recipient

-1).

pSTE33T showed lower efficiency (10-7-10

-6 recipient

-1)

but had a high copy number and high segregational stability.

Methylase genes in the donor substantially affected the

transfer efficiency, demonstrating that the host-mimicking

strategy contributes to efficient transformation. The

transformation method, along with the two distinguishing

plasmids, increases the potential of G. kaustophilus HTA426

as a thermophilic host to be used in various applications

and as a model for biological studies of this genus. Our

results also demonstrate that conjugative transfer is a

promising approach for introducing exogenous DNA into

thermophiles.

Keywords: Geobacillus kaustophilus, transformation, mimicking,

conjugative transfer, restriction-modification

The genus Geobacillus comprises aerobic or facultatively

anaerobic, Gram-positive, thermophilic bacilli that were

reclassified from the genus Bacillus in 2001 [20].

Members of this genus have been isolated from various

land and marine hot environments and also from cool soil

environments, thereby demonstrating their wide distribution

[14]. These bacteria are able to grow at temperatures above

45oC and have historically served as important sources of a

wide variety of thermostable enzymes [14]. Moreover,

Geobacillus spp. have attracted considerable interest in the

field of microbial bioprocessing. Bioprocessing at elevated

temperatures has many practical advantages [30]; the

Geobacillus genus includes several promising species,

such as those showing ethanol tolerance [5] or arsenate

resistance [6] and these capable of long-chain alkane

degradation [9, 13] or metabolizing herbicide [14]. Genetic

engineering plays important roles in the study and exploitation

of these properties, as demonstrated in ethanol production

by genetically engineered Geobacillus thermoglucosidasius

[5]. However, the use of genetic engineering in this genus,

even for essential plasmid transformation, has been

reported only in Geobacillus stearothermophilus [7, 17-

19, 31] and G. thermoglucosidasius [5, 29].

Previously, we reported an efficient transformation

method for Streptomyces griseus IFO 13350 using host-

mimicking plasmids that imitate DNA methylation of this

bacterium to circumvent the restriction barriers of its

restriction-modification (R-M) systems [25]. R-M systems

defend the host bacterium against invasion by exogenous

DNA, such as bacteriophage DNA, and thus hamper

genetic transformation of bacteria. All four types (types I-

IV) of R-M systems digest exogenous DNA selectively by

differentiating from host-endogenous DNA on the basis of

host-specific DNA methylation [21]. Thus, host-mimicking

plasmids circumvent restriction barriers, allowing efficient

transformation.

*Corresponding authorPhone: +81 92 642 7609; Fax: +81 92 642 3053;E-mail: [email protected] address: Hirokazu Suzuki, Department of Bioscience andBiotechnology, Faculty of Agriculture, Graduate School, KyushuUniversity, Fukuoka 812-8581, Japan

1280 Suzuki and Yoshida

In this study, the host-mimicking strategy was applied to

establish a plasmid transformation method for G. kaustophilus

HTA426. This thermophile, isolated from a deep-sea

sediment of the Mariana Trench [26], is able to grow under

aerobic conditions between 42oC and 74oC (optimally at

60oC) [27, 28]. Bacterial growth is observed even in media

containing 3% (w/v) NaCl [26, 27]. The publication of the

entire genome sequence [28] has also provided excellent

opportunities for widening biological understanding and

practical applications of this strain. Here we report the

efficient transformation of G. kaustophilus HTA426 using

conjugative transfer of host-mimicking plasmids from

Escherichia coli. The successful implementation of our

method increases the potential of strain HTA426 as a

thermophilic host in various applications and a model in

biological studies of this genus. It also demonstrates the

benefits of the host-mimicking strategy and conjugative

transfer as a promising approach for introducing exogenous

DNA into thermophiles.

MATERIALS AND METHODS

Bacterial Strains, Culture Conditions, Plasmids, and Primers

Table 1 lists the bacterial strains and plasmids used in this study.

Table 2 lists the primers used. E. coli strains were grown in Luria-

Bertani (LB) medium at 37oC. Ampicillin (50 µg/ml), kanamycin

(25 µg/ml), chloramphenicol (12.5 µg/ml), and tetracycline (6.5 µg/ml)

were used when necessary. E. coli JM109 and plasmid pCR4Blunt-

TOPO were used for DNA manipulation. G. kaustophilus was

grown at 60oC in LB medium. Kanamycin (5 µg/ml) was added when

necessary. The solid medium contained 2% (w/v) agar. The E. coli-

Table 1. Strains and plasmids used in this study.

Strain or plasmid Relevant description(s)a

Reference or source

G. kaustophilus strains

HTA426 Wild type JCM 12893

MK24 Strain HTA426 harboring pSTE33T This study

MK30 Strain HTA426 harboring pUCG18T This study

E. coli strains

JM109 Strain used for DNA manipulation in E. coli Takara Bio

ER1793 F-, e14-(mcrA-), ∆(mrr-hsdRMS-mcrBC)114::IS10, dcm+, dam+ New England Biolabs

IR27 F-

, e14-

(mcrA-

), ∆(mrr-hsdRMS-mcrBC)114::IS10, ∆dcm::lacZ, ∆dam::metB [25]

IR24 F-, e14-(mcrA-), ∆(mrr-hsdRMS-mcrBC)114::IS10, ∆dcm::lacZ, dam+ This study

BR397 Strain IR27 harboring pUB307 and pIR207 This study



BR409 Strain ER1793 harboring pUB307 and pIR408 This study

KR397 Strain IR27 harboring pRK2013 and pIR207 This study



Plasmids

pCR4Blunt-TOPO Cloning vector, ColE1 replicon, AmpR, KmR Invitrogen

pUB307 Derivative of IncP-1 plasmid RP1, Tra+, oriV, oriT, Km

R, Tet

R[3]

pRK2013 Derivative of IncP-1 plasmid RK2, Tra+, ColE1 replicon, oriT, KmR [10]

pSTE33 E. coli-Geobacillus shuttle plasmid, pSTK1 replicon, KmR (TK101), AmpR [18]

pSTE33T pSTE33 carrying oriT This study

pUCG18 E. coli-Geobacillus shuttle plasmid, pBST1 replicon, KmR (TK101), AmpR [29]

pUCG18T pUCG18 carrying oriT This study

pIR200 Derivative of pACYCDuet-1, p15A replicon, CmR

[25]

pIR201 Derivative of pACYCDuet-1, lac promoter, p15A replicon, CmR [25]

pIR207 Derivative of pACYCDuet-1, hsp70 promoter, p15A replicon, CmR This study

pIR380 pIR207 carrying GKP08 This study

pIR399 pIR207 carrying GK0343-GK0344 This study

pIR401 pIR207 carrying GK1380-GK1381 This study

pIR408 pIR207 carrying GK0343-GK0344 and GK1380-GK1381 This study

aAmp

R, Cm

R, Km

R, and Tet

R denote genes coding for resistance to ampicillin, chloramphenicol, kanamycin, and tetracycline, respectively. Km

R (TK101)

denotes TK101 encoding thermostable kanamycin nucleotidyltransferase.

PLASMID TRANSFORMATION OF G. KAUSTOPHILUS 1281

Geobacillus shuttle plasmids pSTE33 and pUCG18 were provided

by Dr. Issay Narumi and Dr. David J. Leak, respectively.

DNA Methylation Analysis

Chromosomal DNA (100 µg) was purified by ultracentrifugation

and degraded to deoxynucleosides by sonication followed by enzymatic

degradation using nuclease P1 (Wako Pure Chemicals) and E. coli

alkaline phosphatase (Takara Bio) [8, 25]. The resulting deoxynucleosides

were passed through Microcon YM-3 filters (Millipore) and analyzed

by reversed-phase high-performance liquid chromatography (HPLC).

The operating conditions were as follows: column, Pegasil-B

(4.6 × 250 mm; Senshu Kagaku); column temperature, 40oC; flow

rate, 1 ml/min; solvent A, 50 mM sodium acetate, pH 5.0; solvent B,

methanol; detection wavelengths, 260 and 280 nm. After injection,

the column was isocratically developed with 95% solvent A for

3 min followed by a linear 95%-10% solvent A gradient for 15 min.

N6-methyl-2'-deoxyadenosine (N6mA) and 5-methyl-2'-deoxycytidine

were purchased from Sigma-Aldrich and Wako Chemicals, respectively.

N4-Methyl-2'-deoxycytidine-5'-triphosphate (TriLink Biotechnologies)

was dephosphorylated using E. coli alkaline phosphatase to obtain

N4-Methyl-2'-deoxycytidine.

Construction of E. coli Strains Deficient in R-M Genes

The dam gene in E. coli ER1793 was disrupted by double crossover

between the dam locus in the chromosome and a PCR fragment

comprising the dam upstream (2.0 kb), ∆dam::metB, and dam

downstream fragments (2.2 kb). The resulting clones were grown on

minimal media lacking L-methionine to obtain E. coli IR21. E. coli

IR24 and IR27 were constructed from strains ER1793 and IR21,

respectively, by double crossover between the dcm locus in the

chromosome and a PCR fragment comprising the dcm upstream

(2.0 kb), ∆dcm::lacZ, and dcm downstream fragments (2.1 kb). The

transformants were selected by the ability to grow on minimal

media containing lactose (2 g/l) as the sole carbon source. DNA

methylation analysis by HPLC confirmed that the IR21 and IR24

chromosomes had no N6m

A and 5-methyl-2'-deoxycytidine, respectively,

and that the IR27 chromosome had no methylated deoxynucleosides.

Construction of Plasmids pIR207, pIR380, pIR399, pIR401, and

pIR408

Fig. 1 shows a schematic representation of the plasmid construction

procedure. Site-directed mutations were performed using a QuikChange

site-directed mutagenesis kit (Stratagene). The lac promoter region

in pIR201 was amplified by PCR using the primers 202F and 202R,

trimmed with BamHI and EcoRI, and cloned between the BglII and

EcoRI sites of pIR200. To obtain the plasmid pIR203, a BamHI site

was introduced into the resulting plasmid by site-directed mutagenesis

using the primers 203F and 203R. pIR203 was digested with

BamHI and NdeI to excise the lac promoter region, and a DNA

fragment containing the E. coli hsp70 promoter [1] was amplified

using the primers 207F and 207R and trimmed using BamHI and

NdeI. The two resulting fragments were ligated to obtain pIR207.

Table 2. Primers used in this study.

Primer Sequence (5'-3')

202F AACGGATCCATTTAAATCTGGTCACTAGGTATTAC

202R GGCGAATTCATTTAAATGATGGGACTAGTGACCAGATTTCTC

203F AAATCTGGTCACTAGGGATCCCCGCCTTTGAGTGAG

203R CTCACTCAAAGGCGGGGATCCCTAGTGACCAGATTT

207F GCCGGATCCTAGTTTACTGCTGATAAAG

207R GGCCATATGAACGTCTCCACTATATATTC

P08F GCCCATATGAAACCACAGGCTTCAGAAG

P08R GCCGGATCCTTAAAATCCGACAAATAG

1380F CATATGACTGTAAAAGCAGAC

1380R CTTCTCTCCACTCACTCATCACATCAATCCCTC

1381F GAGGGATTGATGTGATGAGTGAGTGGAGAGAAG

1381R GGATCCTTAAAGTACTTCTTCTAC

nde1F TTGGGCCGTACATACGAGTATTTTATTAGTTC

nde1R CTTTTGGGGTAATAACGTATGTTCGCTGATATG

0343F CATATGCTCACAGGCGAATTG

0343R CTAGGGATACTTTTCTCATCACTTTATTAAGTC

0344F GACTTAATAAAGTGATGAGAAAAGTATCCCTAG

0344R GGATCCTTATCTTACATTACACAAAATTC

nde2F TTTGAAGCCGCCCACATGTACGATGTCGTG

nde2R AAAACCGTAGAACATGTGGTTATTAAAATG

oriTF GCCGAATTCCCGCCTTTTCCTCAATCGCTC

oriTR GCCGAATTCAATGAAATAAGATCACTACC

ampF TGCTGAAGATCAGTTGGGTG

ampR TAGTTGCCTGACTCCCCGTC

M13F GTAAAACGACGGCCAGT

M13R CAGGAAACAGCTATGAC


GKP08 was amplified using primers P08F and P08R. The PCR

product was trimmed with NdeI and BamHI and cloned between the

NdeI and BglII sites of pIR207 to obtain pIR380.

GK1380 was amplified using primers 1380F and 1380R. GK1381

was amplified using primers 1381F and 1381R. The two PCR

fragments were combined by overlap extension PCR [12] to

produce the GK1380-GK1381 fragment in which the two genes

were overlapped by the sequence 5'-TGATG-3' (GK1380 stop codon

underlined, GK1381 start codon in italics) for translational coupling.

The resulting fragment was cloned in pCR4Blunt-TOPO. Two NdeI

sites in the GK1380-GK1381 region were removed by site-directed

mutagenesis using double-stranded DNA that had been amplified

with the primers nde1F and nde1R from the GK1380-GK1381

region. The NdeI site-free GK1380-GK1381 sequence was excised

by NdeI and BamHI digestions and cloned between the NdeI and

BglII sites of pIR207 to provide pIR401. This plasmid contained the

GK1380-GK1381 expression cassette driven by the hsp70 promoter.

Following a procedure similar to that for pIR401 construction, we

constructed plasmid pIR399 containing the GK0343-GK0344 expression

cassette driven by the hsp70 promoter. GK0343 was amplified using

primers 0343F and 0343R. GK0344 was amplified using 0344F and

0344R. The amplified fragments were combined and cloned into

pCR4Blunt-TOPO. Two NdeI sites in the GK0343-GK0344 region

were removed by site-directed mutagenesis using double-stranded

DNA that had been amplified using the primers nde2F and nde2R

from the GK0343-GK0344 region. The NdeI site-free GK0343-

GK0344 sequence was excised and cloned in to pIR207 to obtain

pIR399. To produce pIR408, a SmiI fragment carrying the GK0343-

GK0344 expression cassette was excised from pIR399 and integrated

into the SpeI site of pIR401 using an In-Fusion PCR Cloning Kit

(Clontech). The resulting pIR408 contained two expression cassettes

for GK1380-GK1381 and GK0343-GK0344 in tandem.

Construction of Conjugative Plasmids pSTE33T and pUCG18T

The oriT region of pRK2013 was amplified using the primers oriTF

and oriTR, trimmed with EcoRI, and cloned in the EcoRI sites of

pSTE33 and pUCG18, to obtain pSTE33T and pUCG18T, respectively.

Conjugative Transfer of pSTE33T and pUCG18T

The E. coli donors were grown on LB plates. The colonies were

collected, washed once with LB medium, and inoculated in

antibiotic-free LB medium at an OD600 of 0.1. The donor cells were

grown with shaking until an OD600 of 0.5 was achieved. Concurrently,

the recipient G. kaustophilus HTA426 was grown in LB medium

until an OD600 of 0.5 was achieved. The donor (1 ml) and recipient

(9 ml) cultures were mixed and passed through a nitrocellulose

membrane (0.22 µm) by filtration under reduced pressure. The cells

accumulated on the membrane were incubated on LB plate at 37oC

overnight for conjugation and then suspended in LB medium. The

suspension was spread on LB plates containing kanamycin and

incubated at 60oC to isolate kanamycin-resistant transformants. An

aliquot of this suspension was incubated on LB agar plates to

determine the recipient cell number. The transfer efficiency was

expressed as the number of transformants per total number of

recipients.

Characterization of G. kaustophilus Transformants

Plasmids in transformants were isolated using the Wizard Plus SV

Minipreps DNA Purification System (Promega) after incubating

Fig. 1. Construction of plasmids pIR207, pIR380, pIR399,pIR401, and pIR408.pIR207 was constructed from plasmids pIR200 and pIR201 and used for

constructing pIR380 to express GKP08, pIR399 to express GK0343-

GK0344, and pIR401 to express GK1380-GK1381. pIR408 was

constructed by recombination at site 1 (r1) and site 2 (r2) between SpeI-

digested pIR401 and SmiI-digested expression cassette for GK0343-

GK0344 excised from pIR399. The restriction sites of BamHI, BglII,

DraI, EcoRI, HindIII, NdeI, SmiI, SpeI, and XhoI are abbreviated as Bm,

Bg, Dr, Ec, Hd, Nd, Sm, Sp, and Xh, respectively. cat, Chloramphenicol

resistance gene; p15A, replicon from p15A; Plac, lac promoter; Phsp70,

hsp70 promoter.


cells at 37oC for 15 min with lysozyme (1 mg/ml) in the cell

suspension buffer. Plasmid copy numbers under selection pressure

were determined according to Wu and Welker [31]. Plasmid

segregational stability was verified by determining the ratio of

kanamycin-resistant cells to total cell number after incubation at

60oC for 24 h in kanamycin-free LB medium.

RESULTS

R-M Genes Encoded in the HTA426 Genome

Among four types of R-M systems [21], type II consists

of restriction endonuclease and DNA methylase. The

endonuclease cuts exogenous DNA at specific sites but not

endogenous DNA already methylated by the methylase.

Types I and III cut exogenous DNA using a similar

mechanism; these R-M types form protein complexes.

Type I consists of restriction (R), methylase (M), and

specificity (S) subunits. Type III comprises R and M

subunits. Type IV, known as a methyl-specific restriction

system, restricts DNA carrying heterologously methylated

nucleobases.

According to the REBASE database [22], the G.

kaustophilus HTA426 genome contains two sets of type I

genes: GK0343 (M subunit)-GK0344 (S subunit)-GK0346

(R subunit) and GK1380 (M subunit)-GK1381 (S subunit)-

GK1382 (R subunit); and three type IV genes: GK1378,

GK1379, and GK1390. The large plasmid pHTA426

harbored in the strain contains one set of type II genes:

GKP09 (endonuclease)-GKP08 (methylase). GKP09 and

GKP08 are homologous to AlwI (identity, 40%) and

M.AlwI (identity, 58%) of Acinetobacter lwoffii, respectively.

GK1416, GK2905, and GK2906 encode putative M or S

subunits, but these are probably the components of

nonfunctional R-M systems, as judged by the lack of

cognate R subunit genes.

DNA Methylation in G. kaustophilus HTA426

Deoxynucleosides were prepared from the HTA426

chromosome and analyzed by HPLC to reveal that the

chromosome contains N6mA but not 5-methyl-2'-deoxycytidine

or N4-methyl-2'-deoxycytidine. The composition ratio ofN6mA to deoxyadenosine (N6mA ratio) was 2.0 mol%. The

result implied that strain HTA426 harbored functional R-

M systems involving N6mA.

Because GKP08 is homologous to M.AlwI, we examined

AlwI digestion of the HTA426 chromosome. The chromosome

was completely resistant to AlwI and partially resistant to

DpnII but sensitive to DpnI (Fig. 2), showing 5'-

GGN6mATC-3' and 5'-GN6mATCC-3' methylations in the

HTA426 chromosome. The chromosome from E. coli

IR27 harboring pIR380 was also completely resistant to

AlwI and DpnII (Fig. 2). This suggested that GKP08 was

responsible for 5'-GGN6mATC-3' and 5'-GN6mATCC-3'

methylations in strain HTA426. Although the DpnII

resistivity indicated that pIR380 actually directed 5'-

GN6mATC-3' methylations in E. coli, in addition to 5'-

GGN6mATC-3' and 5'-GN6mATCC-3', this may have been

caused by GKP08 overexpression.

DNA Methylation by pIR408

DNA methylation of type I R-M systems is performed by

the cooperation of M and S subunits [21]. To reconstruct

the DNA methylation patterns of the two type I R-M

systems from strain HTA426 in E. coli, we constructed

plasmid pIR408 to express GK0343 (M subunit)-GK0344

(S subunit) and GK1380 (M subunit)-GK1381 (S subunit)

under the control of the hsp70 promoter. To verify that

DNA methylation was conducted by pIR408 in E. coli, the

methyl-free E. coli IR27 strain was transformed by pIR408

and subjected to DNA methylation analysis by HPLC. By

culturing at 37oC for 24 h, the chromosome was methylated

with the N6mA ratio of 0.21 mol%. The N6mA ratios in E. coli

Fig. 2. Restriction enzyme mapping of chromosomal DNA from G. kaustophilus HTA426, E. coli IR27 (methyl-free), E. coli IR24(dam+), E. coli IR27 harboring pIR380, and E. coli IR27 harboring pIR408.DNA (1 µg) was digested using individual enzymes, separated on 1% agarose gel by electrophoresis, and visualized using ethidium bromide. Sau3AI cuts

5'-GATC-3' and 5'-GN6m

ATC-3'. DpnI cuts 5'-GN6m

ATC-3' but not 5'-GATC-3'. DpnII cuts 5'-GATC-3' but not 5'-GN6m

ATC-3'. AlwI cuts 5'-GGATC-3' and 5'-

GATCC-3' but not 5'-GGN6m

ATC-3' and 5'-GN6m

ATCC-3'.


IR27 carrying pIR399 to express GK0343-GK0344 and

pIR401 to express GK1380-GK1381 were 0.08 and

0.10 mol%, respectively. These results showed that the

GK0343-GK0344 and GK1380-GK1381 sequences were

responsible for DNA methylation in E. coli and that

pIR408 directed both methylations. Culturing at 45oC for

24 h had no effect on the N6mA ratios. The exact sites

methylated by the type I R-M systems could not be

determined because of the absence of a facile analytical

method for type I methylation sites [2, 11, 16, 23].

However, the methylation site obviously differed from the

site methylated by GKP08, because the chromosome from

E. coli IR27 harboring pIR408 was sensitive to DpnII and

resistant to DpnI, similar to the chromosome from strain

IR27 (Fig. 2).

Plasmid Transformation of Strain HTA426

E. coli BR408 (strain IR24 harboring pIR408 and

pUB307) was constructed for plasmid transformation of G.

kaustophilus HTA426. E. coli BR408 contained dam,

responsible for 5'-GN6mATC-3' methylation (including 5'-

GGN6mATC-3' and 5'-GN6mATCC-3' observed in the HTA426

chromosome), but did not contain other intrinsic genes for

DNA methylation (i.e., dcm and hsd). pIR408 was used for

reconstructing DNA methylation patterns governed by the

type I R-M systems of strain HTA426. pUB307 was used

as a helper plasmid to mediate conjugative transfer of oriT-

containing plasmids. Conveniently, E. coli IR24 lacked the

F plasmid inhibiting conjugative transfer mediated by

pUB307 [15]. Replication origins of pIR408 (p15A origin),

pUB307 (oriV), and the shuttle plasmids pSTE33T and

pUCG18T (pUC origin) were compatible in E. coli IR24.

The plasmid transfer ability of E. coli BR408 was

examined using pSTE33T and pUCG18T. These plasmids

were introduced into E. coli BR408 and then directly

transferred to strain HTA426 by conjugative transfer,

providing kanamycin-resistant transformants (Fig. 3). Since

pUCG18 (lacking oriT) provided no transformants,

kanamycin resistance evidently arose from oriT-dependent

Fig. 3. Kanamycin resistance of strain HTA426 and its transformants.Strain HTA426 and its transformants MK24 and MK30 were incubated

for 24 h on LB plate supplemented with or not supplemented with 5 µg/ml

kanamycin.

Fig. 4. Plasmid analysis in strains MK24 and MK30.BamHI, EcoRI, PvuI, PvuII, and SacI sites are abbreviated as Bm, Ec, PI,

PII, and Sc, respectively. (A) Plasmid map of pSTE33T and pUCG18T

represented as linear structures. Ampicillin resistance gene (open arrow),

pUC origin (open box), TK101 (solid arrow), replicon functional in

Geobacillus spp. (solid box; pSTK1 origin in pSTE33T and pBST1 origin

in pUCG18T), and oriT (gray box) are indicated with theoretical PCR

fragments amplified by primers ampF and ampR (AmpR), and M13F and

M13R (M13). (B) PCR analysis of plasmid DNA isolated from strains

HTA426, MK24, and MK30 overnight cultures (25 ml). One fifth of

plasmid solution (Plasmid) and PCR fragments amplified using primers

ampF and ampR (AmpR) and M13F and M13R (M13) were analyzed by

1% agarose gel electrophoresis. Strain HTA426 was used as a negative

control. (C) Restriction enzyme mapping of plasmid DNA isolated from

strain MK24.The results are identical to those for pSTE33T. (D) Copy

number analysis of pSTE33T. Total DNA was extracted from strain MK24

and analyzed by 0.8% agarose gel electrophoresis. Band signals of

chromosomal DNA (solid arrow) and pSTE33T (open arrow) were

quantified using an image processing program (ImageJ, National Institutes

of Health) and used for copy number determination.


conjugational plasmid transfer, not from chromosomal

mutations. The plasmids were isolated from the transformants

and analyzed. The pSTE33T identity (Fig. 4A) was

confirmed by PCR analysis (Fig. 4B) and restriction

enzyme mapping (Fig. 4C). Using Wu and Welker’s

method [31], the pSTE33T copy number in strain MK24

was determined as 16 per chromosome (Fig. 4D). After

incubation under nonselective conditions, 95% of cells of

strain MK24 maintained pSTE33T, which suggested its

high segregational stability.

In contrast to pSTE33T, the pUCG18T identity was

unclear after agarose gel electrophoresis (Fig. 4A). Several

pUCG18T transformants showed the similar phenotype.

Because of its low abundance, we could not determine

the copy number for pUCG18T. However, PCR analysis

(Fig. 4B) indicated its presence in the DNA sample. This

was also confirmed by the fact that E. coli harboring

pUCG18T was readily obtained by introducing the DNA

sample into E. coli JM109. The possible reasons for the

low abundance of pUCG18T include its low copy number,

its instability caused by heterologous genes (e.g., oriT), and

chromosomal integration through heterologous recombination.

pUCG18T was actually unstable and maintained in only

0.1% of MK30 cells after incubation under nonselective

conditions. Even after incubation under selective conditions,

>90% of cells lost pUCG18T. These results show that

pUCG18T is readily lost from the transformants and that

the instability would be one reason for its low abundance.

To verify the effects of DNA methylation on the

transformation, conjugative transfers from strains BR397,

BR398, and BR409 were examined (Table 3). Both pSTE33T

and pUCG18T plasmids were efficiently transferred from

the dam+ donors to strain HTA426. E. coli BR408 with

pIR408 showed the transfer efficiency comparable to or

higher than E. coli BR398. E. coli BR409 with dcm

showed lower transfer efficiency than E. coli BR408

lacking dcm. Conjugative transfers using pRK2013 as the

helper plasmid were generally less efficient than those

using pUB307 (Table 3).

DISCUSSION

In this study, we demonstrated an efficient plasmid

transformation of G. kaustophilus HTA426, achieved using

conjugative transfer of host-mimicking plasmid from E.

coli BR408. The transfer efficiencies of plasmid pUCG18T

from the dam+ donors were extremely higher than those

from dam donors (Table 3), showing that the Dam

methylation contributes to efficient transformation, probably

by circumventing the GKP09 restriction barrier in strain

HTA426. Moreover, methylation by pIR408 enhanced the

transfer efficiency, which suggests that the type I R-M

systems are functional in strain HTA426. Generally,

recognition sites for type I R-M systems are infrequent; the

low N6mA ratio found in E. coli IR27 carrying plasmid

pIR408 confirms this observation. Although it appears that

the efficiency enhancement by Dam methylation is more

substantial than pIR408 methylation, this could be

attributed to relatively few recognition sites for the type I

R-M systems on the plasmids. It is also noteworthy that the

dcm deficiency in E. coli BR408 enhanced the transfer

efficiency, probably by circumventing type IV restriction

systems in strain HTA426. Thus, we can confirm that the

host-mimicking strategy contributes to efficient transformation

of strain HTA426, as reported previously for S. griseus [25].

In addition to the host-mimicking strategy, conjugative

transfer was an important factor in establishing efficient

transformation. This study presents the first example of

genetic transformation in thermophiles by conjugative

transfer. Although electroporation has been used for

transformation in G. stearothermophilus [17-19] and G.

thermoglucosidasius [5, 29], our attempts to introduce

pSTE33 and pUCG18 (isolated from E. coli strains JM109

and BR408) by electroporation, according to Narumi et al.

[18], have been unsuccessful. Here we performed conjugative

transfer by incubating mixtures of donor and recipient

cells. The recipient cells were readily distinguishable from

donor cells after incubation at 60oC without antibiotics. It

is possible that electroporation can be successfully employed

Table 3. Conjugative transfer efficiencies of pSTE33T and pUCG18T from E. coli donors to G. kaustophilus HTA426.

Donor strain Relevant methylase geneTransfer efficiency (recipient-1)a

pSTE33T pUCG18T

BR397 dam-

, dcm-

<1 × 10-8

(2.9 ± 2.6) × 10-8

BR398 dam+, dcm- (6.0 ± 4.2) × 10-8 (3.1 ± 1.9) × 10-3

BR408 dam+, dcm-, pIR408 (4.8 ± 4.0) × 10-7 (1.2 ± 0.5) × 10-3

BR409 dam+, dcm

+, pIR408 <1 × 10

-8(1.3 ± 1.1) × 10

-4

KR397 dam-, dcm- <1 × 10-8 <1 × 10-8

KR398 dam+, dcm- <1 × 10-8 (6.4 ± 2.9) × 10-6

KR408 dam+, dcm

-

, pIR408 (5.3 ± 3.8) × 10-6

(2.9 ± 1.2) × 10-5

aTransfer efficiencies are expressed as the number of kanamycin-resistant transformants per total number of recipients. Results are expressed as the mean ±

SD (n = 4).


in G. kaustophilus transformation; however, our results

demonstrate that conjugative transfer is a simple and practical

approach to DNA introduction into Geobacillus spp.

Some transformation methods have been developed for

thermophiles capable of growth at temperatures above 60°C,

particularly for Thermus thermophilus and Thermococcus

kodakaraensis [4, 24]. T. thermophilus is a Gram-negative,

aerobic bacterium whose optimal temperature for growth

is 75°C. T. kodakaraensis is a hyperthermophilic, anaerobic

archaeon capable of growth at temperatures above 80oC.

When compared with these two thermophiles, Geobacillus

spp. have several advantages in practical applications, such

as rapid growth under aerobic or facultatively anaerobic

conditions, with low nutrient requirements and the ability

to secrete various proteins. In fact, strain HTA426 grew

rapidly in LB medium with a doubling time of 19 min,

similar to E. coli and B. subtilis, and utilized various

carbon sources including glycerol, casamino acids, hexoses

(D-glucose, D-galactose, D-mannose, and myo-inositol),

pentoses (L-arabinose and D-xylose), oligosaccharides

(cellobiose, maltose, sucrose, soluble starch, and

xylooligosaccharide), and alcohols (ethanol, 2-propanol,

and n-butanol). Growth was observed even in LB medium

containing 4% (w/v) NaCl, with a doubling time of 41 min.

This feature should permit culturing in sea water. Moreover,

the genome sequence for this Geobacillus strain is readily

available [28]. The expanding biological research on

related bacilli, such as B. subtilis, is also an important

advantage because it allows easy prediction of gene

functions for strain HTA426. The transformation method

established in this study, along with the creation of the high

copy number plasmid pSTE33T and the high transfer

efficiency plasmid pUCG18T, should help to exploit these

advantages and thereby utilize strain HTA426 as a

thermophilic host in various applications and as a model in

biological studies of the genus.

Acknowledgments

We wish to thank Dr. Issay Narumi and Dr. David J. Leak

for providing us with the plasmids pSTE33 and pUCG18,

respectively. This work was supported by the Special

Coordination Funds for Promoting Science and Technology

under the project of Creation of Innovation Centers for

Advanced Interdisciplinary Research Areas (Innovative

Bioproduction Kobe), MEXT, Japan and in part by

KAKENHI (22310130).

REFERENCES

1. Arsene, F., T. Tomoyasu, and B. Bukau. 2000. The heat shock

response of Escherichia coli. Int. J. Food Microbiol. 55: 3-9.

2. Bart, A., M. W. J. van Passel, K. van Amsterdam, and A. van

der Ende. 2005. Direct detection of methylation in genomic

DNA. Nucleic Acids Res. 33: e124.

3. Bennett, P. M., J. Grinsted, and M. H. Richmond. 1977.

Transposition of TnA does not generate deletions. Mol. Gen.

Genet. 154: 205-211.

4. Cava, F., A. Hidalgo, and J. Berenguer. 2009. Thermus

thermophilus as biological model. Extremophiles 13: 213-231.

5. Cripps, R. E., K. Eley, D. J. Leak, B. Rudd, M. Taylor, M.

Todd, S. Boakes, S. Martin, and T. Atkinson. 2009. Metabolic

engineering of Geobacillus thermoglucosidasius for high yield

ethanol production. Metab. Eng. 11: 398-408.

6. Cuebas, M., D. Sannino, and E. Bini. 2011. Isolation and

characterization of an arsenic resistant Geobacillus kaustophilus

strain from geothermal soils. J. Basic Microbiol. 51: 364-371.

7. De Rossi, E., P. Brigidi, N. E. Welker, G. Riccardi, and D.

Matteuzzi. 1994. New shuttle vector for cloning in Bacillus

stearothermophilus. Res. Microbiol. 145: 579-583.

8. Ehrlich, M., G. G. Wilson, K. C. Kuo, and C. W. Gehrke. 1987.

N4-Methylcytosine as a minor base in bacterial DNA. J. Bacteriol.

169: 939-943.

9. Feng, L., W. Wang, J. Cheng, Y. Ren, G. Zhao, C. Gao, et al.

2007. Genome and proteome of long-chain alkane degrading

Geobacillus thermodenitrificans NG80-2 isolated from a deep-

subsurface oil reservoir. Proc. Natl. Acad. Sci. USA 104: 5602-

5607.

10. Figurski, D. H. and D. R. Helinski. 1979. Replication of an

origin-containing derivative of plasmid RK2 dependent on a

plasmid function provided in trans. Proc. Natl. Acad. Sci. USA

76: 1648-1652.

11. Flusberg, B. A., D. R. Webster, J. H. Lee, K. J. Travers, E. C.

Olivares, T. A. Clark, et al. 2010. Direct detection of DNA

methylation during single-molecule, real-time sequencing. Nat.

Methods 7: 461-467.

12. Higuchi, R., B. Krummel, and R. K. Saiki. 1988. A general

method of in vitro preparation and specific mutagenesis of

DNA fragments: Study of protein and DNA interactions.

Nucleic Acids Res. 16: 7351-7367.

13. Kato, T., A. Miyanaga, S. Kanaya, and M. Morikawa. 2010.

Gene cloning and characterization of an aldehyde dehydrogenase

from long-chain alkane-degrading Geobacillus thermoleovorans

B23. Extremophiles 14: 33-39.

14. McMullan, G., J. M. Christie, T. J. Rahman, I. M. Banat, N. G.

Ternan, and R. Marchant. 2004. Habitat, applications and

genomics of the aerobic, thermophilic genus Geobacillus.

Biochem. Soc. Trans. 32: 214-217.

15. Miller, J. F., E. Lanka, and M. H. Malamy. 1985. F factor

inhibition of conjugal transfer of broad-host-range plasmid RP4:

Requirement for the protein product of pif operon regulatory

gene pifC. J. Bacteriol. 163: 1067-1073.

16. Nagaraja, V., M. Stieger, C. Nager, S. M. Hadi, and T. A.

Bickle. 1985. The nucleoside sequence recognized by the

Escherichia coli D type I restriction and modification enzyme.


17. Nakayama, N., I. Narumi, S. Nakamoto, and H. Kihara. 1992.

A new shuttle vector for Bacillus stearothermophilus and

Escherichia coli. Biotechnol. Lett. 14: 649-652.

18. Narumi, I., N. Nakayama, S. Nakamoto, T. Kimura, T.

Yanagisawa, and H. Kihara. 1993. Construction of a new shuttle


vector pSTE33 and its stabilities in Bacillus stearothermophilus,

Bacillus subtilis, and Escherichia coli. Biotechnol. Lett. 15:

815-820.

19. Narumi, I., K. Sawakami, S. Nakamoto, N. Nakayama, T.

Yanagisawa, N. Takahashi, and H. Kihara. 1992. A newly

isolated Bacillus stearothermophilus K1041 and its transformation

by electroporation. Biotechnol. Tech. 6: 83-86.

20. Nazina, T. N., T. P. Tourova, A. B. Poltaraus, E. V. Novikova,

A. A. Grigoryan, A. E. Ivanova, et al. 2001. Taxonomic study

of aerobic thermophilic bacilli: Descriptions of Geobacillus

subterraneus gen. nov., sp. nov. and Geobacillus uzenensis sp.

nov. from petroleum reservoirs and transfer of Bacillus

stearothermophilus, Bacillus thermocatenulatus, Bacillus

thermoleovorans, Bacillus kaustophilus, Bacillus thermoglucosidasius

and Bacillus thermodenitrificans to Geobacillus as the new

combinations G. stearothermophilus, G. thermocatenulatus, G.

thermoleovorans, G. kaustophilus, G. thermoglucosidasius and

G. thermodenitrificans. Int. J. Syst. Evol. Microbiol. 51: 433-

446.

21. Roberts, R. J., M. Belfort, T. Bestor, A. S. Bhagwat, T. A.

Bickle, J. Bitinaite, et al. 2003. A nomenclature for restriction

enzymes, DNA methyltransferases, homing endonucleases and

their genes. Nucleic Acids Res. 31: 1805-1812.

22. Roberts, R. J., T. Vincze, J. Posfai, and D. Macelis. 2010.

REBASE - a database for DNA restriction and modification:

Enzymes, genes and genomes. Nucleic Acids Res. 38: D234-

D236.

23. Ryu, J. and E. Rowsell. 2008. Quick identification of Type I

restriction enzyme isoschizomers using newly developed pTypeI

and reference plasmids. Nucleic Acids Res. 36: e81.

24. Sato, T., T. Fukui, H. Atomi, and T. Imanaka. 2005. Improved

and versatile transformation system allowing multiple genetic

manipulations of the hyperthermophilic archaeon Thermococcus

kodakaraensis. Appl. Environ. Microbiol. 71: 3889-3899.

25. Suzuki, H., S. Takahashi, H. Osada, and K. Yoshida. 2011.

Improvement of transformation efficiency by strategic circumvention

of restriction barriers in Streptomyces griseus. J. Microbiol.

Biotechnol. 21: 675-678.

26. Takami, H., A. Inoue, F. Fuji, and K. Horikoshi. 1997.

Microbial flora in the deepest sea mud of the Mariana Trench.

FEMS Microbiol. Lett. 152: 279-285.

27. Takami, H., S. Nishi, J. Lu, S. Shinamura, and Y. Takaki. 2004.

Genomic characterization of thermophilic Geobacillus species

isolated from the deepest sea mud of the Mariana Trench.

Extremophiles 8: 351-356.

28. Takami, H., Y. Takaki, G. J. Chee, S. Nishi, S. Shimamura, H.

Suzuki, et al. 2004. Thermoadaptation trait revealed by the

genome sequence of thermophilic Geobacillus kaustophilus.


29. Taylor, M. P., C. D. Esteban, and D. J. Leak. 2008.

Development of a versatile shuttle vector for gene expression in

Geobacillus spp. Plasmid 60: 45-52.

30. Wiegel, J. and L. G. Ljungdahl. 1986. The importance of

thermophilic bacteria in biotechnology. Crit. Rev. Biotechnol. 3:

39-108.

31. Wu, L. J. and N. E. Welker. 1989. Protoplast transformation of

Bacillus stearothermophilus NUB36 by plasmid DNA. J. Gen.

Microbiol. 135: 1315-1324.

Documents

Transformacion de Geobacillus