SepiapterinReductaseMediatesChemicalRedoxCyclingin ... · (0.1 ml) contained 50 mM phosphate buffer, pH 7.8, 25 M Amplex-Red, 0.1 unit of horseradish peroxidase, 0.2 mM NADPH,22.5

Sepiapterin Reductase Mediates Chemical Redox Cycling inLung Epithelial Cells*

Received for publication, July 25, 2012, and in revised form, April 18, 2013 Published, JBC Papers in Press, May 2, 2013, DOI 10.1074/jbc.M112.402164

Shaojun Yang‡, Yi-Hua Jan§, Joshua P. Gray¶, Vladimir Mishin§, Diane E. Heck�, Debra L. Laskin§,and Jeffrey D. Laskin‡1

From the ‡Department of Environmental and Occupational Medicine, University of Medicine and Dentistry of New Jersey-RobertWood Johnson Medical School, Piscataway, New Jersey 08854, the §Department of Pharmacology and Toxicology, RutgersUniversity, Piscataway, New Jersey 08854, the ¶Department of Science, United States Coast Guard Academy, New London,Connecticut 06320, and the �Department of Environmental Health Science, New York Medical College, Valhalla, New York 10595

Background: Enzymes mediating chemical redox cycling in the lung are poorly defined.Results: Sepiapterin reductase was identified as a key mediator of redox cycling and was analyzed using inhibitors and site-directed mutagenesis.Conclusion: Sepiapterin reductase generates reactive oxygen species during redox cycling in a mechanism distinct fromsepiapterin reduction.Significance: This is the first report demonstrating that sepiapterin reductase mediates chemical redox cycling.

In the lung, chemical redox cycling generates highly toxicreactive oxygen species that can cause alveolar inflammationand damage to the epithelium, as well as fibrosis. In this study,we identified a cytosolic NADPH-dependent redox cyclingactivity in mouse lung epithelial cells as sepiapterin reductase(SPR), an enzyme important for the biosynthesis of tetrahydro-biopterin. Human SPR was cloned and characterized. In addi-tion to reducing sepiapterin, SPR mediated chemical redoxcycling of bipyridinium herbicides and various quinones; thisactivity was greatest for 1,2-naphthoquinone followed by 9,10-phenanthrenequinone, 1,4-naphthoquinone, menadione, and2,3-dimethyl-1,4-naphthoquinone. Whereas redox cyclingchemicals inhibited sepiapterin reduction, sepiapterin had noeffect on redox cycling. Additionally, inhibitors such as dicou-marol, N-acetylserotonin, and indomethacin blocked sepia-pterin reduction, with no effect on redox cycling. Non-redoxcycling quinones, including benzoquinone and phenylquinone,were competitive inhibitors of sepiapterin reduction but non-competitive redox cycling inhibitors. Site-directedmutagenesisof the SPR C-terminal substrate-binding site (D257H) com-pletely inhibited sepiapterin reduction but had minimal effectson redox cycling. These data indicate that SPR-mediated reduc-tion of sepiapterin and redox cycling occur by distinct mecha-nisms. The identification of SPR as a key enzyme mediatingchemical redox cycling suggests that it may be important ingenerating cytotoxic reactive oxygen species in the lung. Thisactivity, together with inhibition of sepiapterin reduction byredox-active chemicals and consequent deficiencies in tetrahy-drobiopterin, may contribute to tissue injury.

The lung is highly sensitive to redox-active chemicals,including bipyridyl herbicides such as paraquat, nitroaromaticcompounds, and various quinones (1, 2). High doses of thesechemicals can induce alveolar inflammation, epithelial celldamage, pneumonia, pulmonary hypertension, and fibrosis (2).Toxicity is thought to result from an accumulation of thesechemicals in lung cells and subsequent enzyme-mediated redoxcycling. In the redox cycling process, one electron reduction ofa redox-active chemical generates radical ions. Under aerobicconditions, these radicals rapidly react with oxygen generatingsuperoxide anion and the parent compound (3–5). Spontane-ous and enzyme-mediated dismutation of superoxide anionleads to the formation of hydrogen peroxide (H2O2). In thepresence of trace metals, H2O2 generates highly toxic hydroxylradicals (6). The reaction of superoxide anion with nitric oxidecan also generate peroxynitrite, a potent oxidant known tocause tissue injury (7). These reactive nitrogen and reactiveoxygen species (ROS)2 can damage many intracellular compo-nents, including DNA, lipids, and proteins resulting in nitrosa-tive and oxidative stress and toxicity (7, 8).The complement of enzymes in the lung that participate in

chemical redox cycling has not been clearly established. Severalflavin-containing enzymes known to mediate redox cycling arepresent in lung tissues, including cytochrome P450 reductase,cytochrome b5 reductase, xanthine oxidase, and various formsof nitric-oxide synthase (9–13). These enzymes requireNADPH or NADH as the source of reducing equivalents.NADPH-cytochrome P450 reductase, which contains bothFAD and FMN as cofactors, is the best characterized enzymemediating redox cycling (9, 10). It appears that the ability ofFAD to accept single electrons from NADPH is critical forredox cycling. This is supported by findings that the redoxcycling process is blocked by diphenyleneiodonium, a selective* This work was supported, in whole or in part, by National Institutes of Health

Grants R01GM034310, R01ES004738, R01CA132624, U54AR055073, andP30ES005022.

1 To whom correspondence should be addressed: Dept. of Environmentaland Occupational Medicine, UMDNJ-Robert Wood Johnson MedicalSchool, 170 Frelinghuysen Rd., Piscataway, NJ. Tel.: 848-445-0176; Fax: 732-445-0119; E-mail: [email protected].

2 The abbreviations used are: ROS, reactive oxygen species; SPR, sepiapterinreductase; m, mouse; h, human; Ni-NTA, nickel-nitrilotriacetic acid; BH4,tetrahydrobiopterin; BH2, dihydrobiopterin; DTPA, diethylenetriamine-pentaacetic acid; F, forward; R, reverse.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 288, NO. 26, pp. 19221–19237, June 28, 2013© 2013 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

JUNE 28, 2013 • VOLUME 288 • NUMBER 26 JOURNAL OF BIOLOGICAL CHEMISTRY 19221

by guest on September 2, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

flavoenzyme inhibitor (9, 14). Cytochrome P450 reductase andcytochrome b5 reductase are microsomal enzymes, whereasxanthine oxidase and nitric-oxide synthase are cytoplasmicenzymes; nitric-oxide synthases are also localized in cell mem-branes (7, 15–18). Localized concentrations of redox-activechemicals in cells, enzymes that mediate their redox cycling,and levels of ROS generated are key factors leading to lunginjury (19).In earlier studies, we demonstrated that the cytoplasm of

lung epithelial cells is a rich source of enzymes capable ofmedi-ating chemical redox cycling (20). One important enzymeinvolved in this process is thioredoxin reductase, a homodi-meric flavoprotein that catalyzes the reduction of oxidized thi-oredoxin, as well as other redox-active proteins, and plays a keyrole in maintaining cellular redox homeostasis (20, 21). In thisstudy, we identified sepiapterin reductase as another highlyactive cytoplasmic enzyme that mediates redox cycling in lungcells. Sepiapterin reductase is an NADPH-dependent enzymethat catalyzes the formation dihydrobiopterin (BH2), a precur-sor for tetrahydrobiopterin (BH4), a cofactor critical in aro-matic amino acid metabolism and nitric oxide biosynthesis(22–24) (see Fig. 1 for schematic depicting reactions catalyzedby sepiapterin reductase). Using recombinant human enzyme,sepiapterin reductase was found to be highly efficient in medi-ating chemical redox cycling and generatingROS. Interestingly,redox cycling markedly reduced the ability of the enzyme togenerate BH2. Unlike other enzymes that mediate redoxcycling, sepiapterin reductase does not contain flavins or otherco-factors suggesting that it functions by a unique mechanism.Our results are novel as they identify a flavin-independent path-way mediating chemical redox cycling in lung epithelial cells.Moreover, they demonstrate that redox cycling chemicals cancontrol a key enzyme required for the biosynthesis of a cofactorimportant in generating mediators that regulate lung function.

EXPERIMENTAL PROCEDURES

Chemicals and Reagents—Restriction enzymes were pur-chased from New England Biolabs (Ipswich, MA). T4 DNAligase, Amplex Red reagent, and Ni-NTA-agarose wereobtained from Invitrogen. A pGEMT TA cloning kit was fromPromega (Madison, WI), and Pfu Easy A polymerase was fromStratagene (La Jolla, CA). L-Sepiapterin was from CaymanChemical (Ann Arbor, MI). Horseradish peroxidase, menadi-one (2-methylnaphthalene-1,4-dione), NADPH, proteaseinhibitor mixture 1, and other chemicals were from Sigmaunless otherwise indicated. Protease inhibitor mixture 1 con-tained 4-(2-aminoethyl) benzenesulfonyl fluoride, pepstatinA, E-64 (trans-epoxysuccinyl-L-leucylamido-(4-guanidino)butane), bestatin, leupeptin, and aprotinin. Oligonucleotideswere synthesized by Integrated DNA Technologies (Coralville,IA).Assays for Sepiapterin Reductase Activity and Redox Cycling—

Sepiapterin reductase activity was assayed by measuringdecreases in sepiapterin absorbance at 420 nm as described byKatoh (25) with some modifications. Standard reaction mixescontained 100mM potassium phosphate buffer, pH 6.4, 100 �M

NADPH, 50 �M sepiapterin, and 2 �g of enzyme protein in afinal volume of 200 �l. Changes in absorbance were monitoredusing a Spectramax M5 microplate reader (Molecular Devices,Sunnyvale, CA). NADPH, quinones, and cofactors hadminimalabsorbances at 420 nm and did not interfere with the sepia-pterin reductase assay. In some experiments, sepiapterin reduc-tase activity was assayed as described by Ferre and Naylor (26).In the assay, BH2, the reduction product of sepiapterin by sepi-apterin reductase, is oxidized by iodine to the highly fluorescentbiopterin, which is then quantified by HPLC with fluorescencedetection. For the assay, standard reaction mixes were supple-mented with an NADPH-regenerating system consisting of 10mM glucose 6-phosphate and 0.5 units/ml glucose-6-phosphatedehydrogenase, and 0.2�g of sepiapterin reductase. After incu-bating the reactions at 37 °C for 1 h in the dark, 25 �l of amixture of 33 mM iodine and 100 mM KI in 1 M HCl was added.After standing for 10min at room temperature, the precipitatedproteinswere removedby centrifugation at 15,000� g for 3minat room temperature, and excess iodine was reduced by theaddition of 25 �l of 57 mM ascorbic acid to the reaction mix.Biopterin formed in the assaywas separated using a JascoHPLCsystem (Easton, MD) fitted with a Maxsil-10 250 � 4-mm C18column (Phenomenex, Torrance, CA). The mobile phase con-sisted of 5% methanol in water, and the flow rate was set at 1.5ml/min. Fluorescence was monitored using a Jasco FP-2020spectrofluorometer with excitation and emission wavelengthsset at 362 and 435 nm, respectively. The chromatographicpeaks were integrated using the Jasco ChromNAV software.ROS generated by chemical redox cycling were assayed by

measuring the formation of superoxide anion, H2O2, andhydroxyl radicals. Superoxide anionwasmeasured spectropho-tometrically by the reduction of acetylated cytochrome c at 550nm as described by Fussell et al. (27). Typical reaction mixescontained 100 mM potassium phosphate buffer, pH 7.8, 0.05mM acetylated cytochrome c, 0.2 mMNADPH, 0.5 mMmenadi-one, and 20�g of sepiapterin reductase in a final volumeof 1ml.

FIGURE 1. Schematic depicting reactions catalyzed by sepiapterin reduc-tase. Upper panel, reduction of sepiapterin by sepiapterin reductase gener-ates dihydrobiopterin. Additional cellular reductases convert dihydrobio-pterin to tetrahydrobiopterin. Lower panel, in the presence of redox cyclingchemicals such as menadione, sepiapterin reductase generates reactive oxy-gen species.

Sepiapterin Reductase and Redox Cycling

19222 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 288 • NUMBER 26 • JUNE 28, 2013


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

H2O2 production was assayed using Amplex-Red/horseradishperoxidase as described previously (20, 28). Standard reactions(0.1 ml) contained 50 mM phosphate buffer, pH 7.8, 25 �M

Amplex-Red, 0.1 unit of horseradish peroxidase, 0.2 mM

NADPH, 22.5 �g of cell cytosolic proteins, or 1 �g of recombi-nant sepiapterin reductase and appropriate concentrations ofredox-active chemicals. Reactions were initiated by the addi-tion of proteins to the mix. The fluorescent product, resorufin,was recorded as relative fluorescence units using themicroplatereader with excitation and emission wavelengths set at 530 and587 nm, respectively. In experiments using recombinant sepi-apterin reductase, the concentration of H2O2 generated in thereactions was calculated from a calibration curve preparedusing appropriate standards. H2O2 formation was found to belinear for at least 30 min using 0.1 �g of recombinant sepia-pterin reductase.When catalase was added to the redox cyclingreactions, it degradedH2O2 as it was formed; it did not alter theability of the enzyme to reduce sepiapterin. We also found thatreduced biopterin did not react directly with quinones such asmenadione or 9,10-phenanthrenequinone to generate H2O2.

Hydroxyl radicals were measured by monitoring the forma-tion of 2-hydroxyterephthalate from terephthalate in enzymeassays as described previously (29). In these assays, 4.5 �g ofrecombinant sepiapterin reductase/100�l of reactionmixwereused. In some experiments, oxygen utilization in enzyme reac-tions during redox cycling was measured using a Clark-typeoxygen electrode as described previously (27). In these assays,16 �g of recombinant sepiapterin reductase/0.8 ml of reactionmix were used. Kinetic parameters of the enzyme were calcu-lated from linear portions of reaction curves using Lineweaver-Burk plots.Isolation and Characterization of a Redox Cycling Activity

from Lung Epithelial Cells—MLE-15 murine lung epithelialcells, kindly provided by Dr. Jacob Finkelstein at the Universityof Rochester, New York (30), and A549 lung epithelial cells(American Type Culture Collection, Manassas, VA) weremaintained in Dulbecco’s modified Eagle’s medium supple-mented with 10% fetal bovine serum, penicillin (100 units/ml),and streptomycin (100�g/ml) at 37 °Cwith 5%CO2 in a humid-ified incubator. MLE-15 cell cytosolic fractions were preparedby suspending the cells (3 � 108) in 1.0 ml of phosphate buffer(50 mM, pH 7.0) containing protease inhibitors and sonicatingon ice.After centrifugation in anEppendorf 5417R centrifuge at12,000 � g for 10 min to remove debris, membranes and mito-chondrial fractions, supernatants were centrifuged in a Beck-man L7–55 ultracentrifuge (100,000 � g, 1 h) to obtain post-microsomal supernatant fractions. NADPH-binding proteinswere then purified by affinity chromatography using 2�,5�-ADP-agarose columns as described by Wolff et al. (31).NADPH eluates from the columns were concentrated using anAmicon ultracentrifugal filter (Millipore, Billerica, MA) andthen fractionated by size exclusion chromatography on aSuperose 12 HR 10/30 column (GE Healthcare) in phosphate-buffered saline containing 0.1% Nonidet P-40, pH 7.4, at a flowrate of 0.3 ml/min. Fractions were monitored for absorbance at280 nm and redox cycling activity over 30 min using theAmplex-Red/horseradish peroxidase assay. Two activity peakswere collected and analyzed on 10% SDS-polyacrylamide gels

using silver staining. AnMr �28,000 band, which was detectedin both fractions, was cut from the gel of the peak II fraction,subjected to in-gel digestion with trypsin, and analyzed usingMALDI-TOF/TOF (Alphalyse, PaloAlto, CA).A combinedMSand MS/MS search was performed against the NCBI databaseusing an in-house MASCOT server. Six peptide fragmentsmatched the sequence of mouse sepiapterin reductase.Formetabolism studies, A549 lung epithelial cells, grown to a

density of 4 � 105 cells/well in 6-well culture dishes, were pre-treated with control medium or medium containing 500 �M

menadione. After 2 h, sepiapterin (100 �M final concentration)was added to the cultures. After an additional 2 h, cells werelysed in PBS containing 0.5% Nonidet P40 and analyzed forbiopterin content by HPLC as described above (26).Cloning of the Mouse and Human SPR Genes into a pET28a

Expression Vector—Total RNA was isolated from either mouseMLE-15 cells or human A549 lung epithelial cells using theTRIzol reagent (Invitrogen). cDNAs were synthesized usingreverse transcription with Superscript II RNase H-RT accord-ing to the manufacturer’s instructions (Invitrogen). The full-length sepiapterin reductase gene was amplified by PCR usingPfu Easy A polymerase (Stratagene) with the primer pairshSPR-F and hSPR-R or mSPR-F and mSPR-R (Table 1). For-ward primers (hSPR-F and mSPR-F) contain an NdeI restric-tion site and 15 nucleotides at the 5�-end of sepiapterin reduc-tase, and reverse primers (hSPR-R and mSPR-R) contain aBamHI restriction site and 13 nucleotides at the 3�-end of sepi-apterin reductase according to the published human sepia-pterin reductase sequence (accession number NM_003124,PubMed) and the mouse sepiapterin reductase sequence(accession number NM_011467, PubMed). The PCR productswere purified using a PCR purification kit (Qiagen, Valencia,CA), cloned into the TA vector pGEMT (Stratagene), andtransformed into Escherichia coli DH10B cells. The pGEMT-hSPR was isolated using a plasmid miniprep kit (Qiagen),digested with NdeI and BamHI restriction enzymes, and thensubcloned into the NdeI and BamHI sites of pET28a, whichcarries a hexa-histidine tag coding sequence (Novagen, Madi-son, WI). The positive clones were selected and verified bysequence analysis (DNA Core facility, UMDNJ-Robert WoodJohnson Medical School, Piscataway, NJ).Site-directed Mutagenesis—To generate the human sepia-

pterin reductase mutants G14S, G18R, R42G, N99A, S157A,K147L, M205G, and D257H, primer-mediated two-step PCRwas used because the mutation sites are located in the centralregion of the gene. Mutation points were designed in the com-plementary forward and reverse primers. pET-hSPR containingthe wild type human sepiapterin reductase gene was used as atemplate to perform site-directed mutagenesis. In the firstround, left arm PCR fragments were obtained using hSPR for-ward primer and mutation reverse primers (G14S-R, G18R-R,R42G-R, N99A-R, S157A-R, K174L-R, M205G-R, and D257H-R), and right arm PCR fragments were obtained usingmutationforward primers (G14S-F, G18R-F, R42G-F, N99A-F, S157A-F,K174L-F, M205G-F, and D257H-F) and hSPR reverse primer.Purified left arm and right arm fragments were mixed to formpartial duplex structures in complementary regions that werethen used as templates for a second round of PCR with the




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

primers hSPR-F and hSPR-R to generate the full-length muta-tion PCR fragments. For mutants D257H, Y259A, and �257–261, the full-length mutant PCR fragments were produced byone-step PCR using an hSPR-F primer paired with a D257H-Rprimer, Y259A-R primer, or �257–261-R primer, respectively,to produce full-length D257H, Y259A, and �257–261 PCRfragments because the mutation points are very close to the Cterminus and therefore the mutation points were designed inreverse primers. The full-length mutant PCR products werecloned into the pET28a vector between the NdeI and BamHIrestriction sites. The mutations were confirmed by sequenceanalysis.Expression and Purification of Recombinant Sepiapterin

Reductase—The expression vector containing wild type ormutant sepiapterin reductase genes was transformed intoE. coli BL21 (DE3). In this system, the expressed recombinantproteins contain six histidines at the N terminus for nickelaffinity (Ni-NTA) purification. The cloneswere picked and cul-tured inTerrific Brothmediumcontaining 25mg/liter kanamy-cin at 37 °C. The recombinant sepiapterin reductase proteinswere inducedwith 0.5mM isopropyl�-D-thiogalactopyranosidefor 4 h at 37 °C when the absorbance of the cultures reached 0.6at 600 nm. The cell pellets from low speed centrifugation(6,000 � g for 20 min) were resuspended in buffer A (50 mM

NaH2PO4/Na2HPO4, pH 7.0, 300 mM NaCl), sonicated on ice,and then centrifuged at 20,000� g for 30min. The recombinantproteins in supernatants were purified using a nickel affinitychromatography column (Invitrogen) under native conditions.Briefly, after loading the crude extracts, the Ni-NTA affinitycolumn was equilibrated with buffer A and then washed withbuffer B (buffer A with 20 mM imidazole). Finally, the recombi-nant enzymes were eluted with buffer C (buffer A containing150mM imidazole and 10%glycerol). Eluted fractionswere con-centrated using VivaSpin 6 column (VWR, West Chester, PA)and analyzed for protein using the DC Protein Assay Reagent(Bio-Rad) with bovine serum albumin as the standard. Recom-binant enzymes were analyzed on 12.5% SDS-polyacrylamidegels usingCoomassie Brilliant Blue R-25 staining. Recombinantwild type human sepiapterin reductase was 3-fold more active

on sepiapterin reduction and redox cycling than recombinantwild type mouse sepiapterin reductase and was used in all fur-ther experiments to characterize the enzyme.

RESULTS

Identification of Sepiapterin Reductase as a Mediator ofRedox Cycling in Lung Epithelial Cells—Diquat and paraquatwere found to readily stimulate the generation of H2O2 in cyto-solic fractions of lung epithelial cells (Fig. 2, panel A). Thisactivity was NADPH-dependent (data not shown); greater than95% of redox cycling activity could be recovered followingADP-affinity purification (Fig. 2, panel B). Two main peaks ofactivity (peaks I and II) were obtained following size exclusionchromatography of the affinity-purified material (Fig. 2, panelC). A common distinct protein band (Mr �28,000) wasdetected in both peak fractions following SDS-PAGE (Fig. 2,panel C, inset). The protein band in peak II was cut from the gel,analyzed using MALDI-TOF/TOF MS, and identified as sepi-apterin reductase. To confirm that sepiapterin reductase pos-sesses redox cycling activity, the human and mouse genes werecloned into a hexahistidine-tagged vector, expressed in E. coli,and purified by nickel affinity chromatography (Fig. 2, panel D,inset, and data not shown). The enzymes, which appeared assingle bands on SDS-polyacrylamide gels (Mr �30,000),reduced sepiapterin to BH2, as measured by decreases inabsorption of sepiapterin at 420 nm (25) and by the formationof BH2 by HPLC (26). Similar enzyme activity was detected inboth assays (Figs. 2, panel D, and 3, panels A andB, and data notshown). In these assays, sepiapterin was reduced in a time-de-pendent manner with a stoichiometric (1:1) increase in BH2(Fig. 3, panel B). Using the HPLC assay, the kinetics of theenzymes was measured (Km � 25.4 �M, kcat � 97.0 min�1,kcat/Km � 3.8 min�1 �M�1 for the human enzyme, and Km �44.2 �M, kcat � 48.4 min�1, kcat/Km � 1.1 min�1�M�1, for themouse enzyme). For both the human and mouse enzymes, thereaction was NADPH-dependent; NADH did not supportenzyme activity (Fig. 2, panels D and E, and data not shown).In further studies, we characterized sepiapterin reductase-

mediated redox cycling using human recombinant enzyme.

TABLE 1PCR primers used in cloning of SPR and site-directed mutagenesis

Primer Sequence

hSPR-F CCGCGCGGCAGCCATATGGAGGGCGGGCTGhSPR-R CGAATTCGGATCCTTATCATTTGTCATAGAAGTCmSPR-F CCGCGCGGCAGCCATATGGAGGCAGGCGGmSPR-R CGAATTCGGATCCTTATCAGTCATAGAAGTCCACG14S-F GCTTGCTGACCAGCGCCTCCCGCGGCG14S-R GCCGCGGGAGGCGCTGGTCAGCAAGCG18D-F GGCCTCCCGCGACTTCGGCCGGACGG18D-R CGTCCGGCCGAAGTCGCGGGAGGCCR42G-F GTCCTTAGCGCCGGCAACGACGAGGCR42G-R GCCTCGTCGTTGCCGGCGCTAAGGACN99A-F GCTTATCAACGCCGCGGGCTCTCTTGN99A-R CAAGAGAGCCCGCGGCGTTGATAAGCS157A-F GTTAACATCTCGGCCCTCTGTGCCCTGCS157A-R GCAGGGCACAGAGGGCCGAGATGTTAACK174L-F GTACTGTGCAGGACTGGCTGCTCGTGK174L-R CACGAG CAGCCAGTCC TGCACAGTACM205G-F GGACACAGACGGGCAGCAGTTGGCM205G-R GCCAACTGCTGCCCGTCTGTGTCCD257H-R CGAATTCGGATCCTTATCATTTGTCATAGAAGTGCACGTGGGCTCCDEL257-R CGAATTCGGATCCTTATCACACGTGGGCTCCY259A-R CGAATTCGGATCCTTATCATTTGTCAGCGAAGTCCACGTGGGCTCC




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Recombinant sepiapterin reductase was found to readilymediate redox cycling of diquat (Fig. 2, panel F), as well as anumber of quinones known to redox cycle, including 9,10-phenanthrenequinone, menadione, 2,3-dimethoxy-1,4-naphthoquinone, 1,2-naphthoquinone, and 1,4-naphthoqui-none (Fig. 4, panel A, and Table 2), as measured by theformation of H2O2 in enzyme assays. The reaction of each ofthese redox cycling chemicals was time-, concentration-,and NADPH-dependent (Fig. 4, panel B, and data notshown). The most active redox cycling quinone based onkcat/Km was 1,2-naphthoquinone followed by 9,10-phenan-threnequinone, 1,4-naphthoquinone, menadione, and 2,3-

dimethoxy-1,4-naphthoquinone (Table 2), which is gener-ally consistent with previous reports on the redox potentialsof these compounds (32–34). In contrast, two related quino-nes, p-benzoquinone (1,4-benzoquinone) and phenylqui-none (2-phenyl-1,4-benzoquinone), did not redox cycle withsepiapterin reductase (Fig. 4, panel C, inset).

The mouse enzyme also mediated redox cycling, althoughless efficiently that the human enzyme (Km� 8.8�M, kcat� 37.7min�1, kcat/Km � 4.3 min�1 �M�1 for the human enzyme, andKm � 6.3�M, kcat � 13.3min�1, kcat/Km � 2.1min�1 �M�1, forthe mouse enzyme, using 9,10-phenanthrenequinone as theredox cycling chemical).

FIGURE 2. Identification of sepiapterin reductase as a mediator of chemical redox cycling. Panel A, redox cycling activity, assessed by the formation ofH2O2, was quantified in 100,000 � g supernatant fractions from MLE-15 cells in the presence of 500 �M paraquat or diquat. Arrow indicates initiation of thereaction following the addition of supernatant. Panels B and C, paraquat-stimulated redox cycling activity in cytosolic fractions of MLE-15 cells purified by ADPaffinity and size exclusion chromatography, respectively. Panel C, inset, SDS-PAGE analysis of total cell lysate and the two peaks (I and II) of redox cycling activityfollowing size exclusion chromatography. The major band in peak II of SDS-PAGE (shown by the arrow) was analyzed by MALDI-TOF/TOF and identified assepiapterin reductase. Panel D, dihydrobiopterin (BH2) formation from sepiapterin by human recombinant sepiapterin reductase. Sepiapterin reductaseactivity required sepiapterin, NADPH, and purified recombinant SPR. Formation of BH2 in enzyme assays was analyzed by HPLC. Inset, SDS-PAGE analysis ofrecombinant human sepiapterin reductase expressed in E. coli, lane 1, crude extract of E. coli containing sepiapterin reductase induced with 0.5 mM isopropyl�-D-thiogalactopyranoside; lane 2, sample collected from flow-through fraction from the Ni-NTA column; lane 3, sample of imidazole eluted fraction fromnickel-affinity column. The arrow indicates the purified enzyme. Panel E, reduction of sepiapterin by purified recombinant sepiapterin reductase was depend-ent on NADPH, but not NADH. Inset, comparison of NADH and NADPH oxidation by sepiapterin reductase. Enzyme activity was analyzed by changes inabsorbance of sepiapterin at 420 nm. Panel F, purified recombinant sepiapterin reductase mediates redox cycling of diquat.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Because the buffers and recombinant enzymes used in ourstudies contain trace redox metals that could contribute to theformation of H2O2 in enzyme assays, we analyzed redox cyclingin enzyme assays containing diethylenetriaminepentaaceticacid (DTPA). We found that DTPA had no effect on the rate ofH2O2 formation, indicating that there was no or only aminimalcontribution of trace metals to the sepiapterin reductase redoxcycling reaction (Fig. 3, panel C).It is also possible that oxidation of BH2 or BH4 contributes to

the formation ofH2O2 by sepiapterin reductase. Fig. 3 (panelD)comparesH2O2 formation generated by chemical redox cyclingand via oxidation of the biopterin cofactors. Under our assayconditions, BH4 was found to generate H2O2, whereas onlyminimal amounts were generated from BH2 (Fig. 3, panel D,

inset). Much greater amounts of H2O2 were generated by thechemical redox cycling reaction (Fig. 3, panel D). These dataindicate that oxidation of BH2 and BH4 do not contribute sig-nificantly to H2O2 formed in the chemical redox cycling assays.During redox cycling, one electron reduction of a redox-

active chemical generates radical ions. Under aerobic condi-tions, these radicals are rapidly oxidized back to the parentcompounds generating superoxide anion. Spontaneous andenzyme-supported dismutation of superoxide anion generatesH2O2. Using menadione, we found that redox cycling byrecombinant human sepiapterin reductase readily generatedsuperoxide anion, as measured by the reduction of acetylatedcytochrome c; the accumulation of this ROS was inhibited bysuperoxide dismutase (Fig. 5, panel A). The formation of super-

FIGURE 3. Assays for sepiapterin reduction and redox cycling activity of sepiapterin reductase. Panel A, changes in the absorbance spectra of sepiapterinin the sepiapterin reductase assay. Note the decrease in absorption of sepiapterin over time. Standard reaction mixes in a total volume of 0.2 ml contained 50mM phosphate buffer, pH 7.8, 200 �M NADPH, 50 �M sepiapterin, and 1 �g/ml sepiapterin reductase and were analyzed after 0 min (curve a), 1 min (curve b), 2min (curve c), and 3 min (curve d). Controls contained the standard reaction mix without the enzyme and sepiapterin (curve e), with the standard reaction mixbuffer plus 250 �M menadione (curve f), or with the standard reaction mix buffer plus 50 �M BH2 (curve g). Panel B, comparison of sepiapterin consumption andBH2 production in sepiapterin reductase enzyme assays. Both sepiapterin reduction reactions were run under the conditions indicated above. Sepiapterinreduction was measured by decreases in absorbance at 420 nm and was presented as micromolar concentrations of the substrate remaining in the assay overtime. BH2 was measured using HPLC as described under “Experimental Procedures” and was presented as micromolar concentrations of the product formedin the assay over time. Panel C, effects of DTPA on H2O2 formation by sepiapterin reductase. Redox cycling was run in standard reaction mixes withoutsepiapterin and supplemented with 5 �M 9,10-phenanthrenequinone without (open triangles) and with 250 �M DTPA (closed triangles). In control experiments,sepiapterin reductase was left out of reaction mixes without (open circles) and with DTPA (closed circles). Panel D, comparison of H2O2 production by sepiapterinreductase redox cycling and autooxidation of BH2 and/or BH4. H2O2 production in the redox cycling reaction was compared with autooxidation of 50 �M BH2,50 �M BH4, or the combination of BH2 and BH4. Autooxidation reactions were run in the buffer of the standard reaction mix. Inset, enlarged scale forautooxidation reactions run over 10 min. Note that the redox cycling reaction generated much greater amounts of H2O2 when compared with the autooxi-dation reactions.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

oxide anion in reaction mixes during redox cycling was associ-ated with an accumulation of H2O2; this was inhibited by cata-lase (Fig. 5, panel B). In the presence of iron, redox cycling bysepiapterin reductase also generated hydroxyl radicals (data notshown). The accumulation of these ROS was inhibited by

DMSO, a scavenger of hydroxyl radicals. The addition of 9,10-phenanthrenequinone, but not sepiapterin, to reaction mixesreadily increased oxygen utilization (Fig. 6, panels A and B).This is consistent with the fact that sepiapterin reduction bysepiapterin reductase is not an oxygen-requiring reaction.

FIGURE 4. Characterization of redox cycling by human recombinant sepiapterin reductase. Panel A, redox cycling of different quinones by sepiapterinreductase. H2O2 formation was measured in the absence or presence of 5 �M 9,10-phenanthrenequinone, 500 �M menadione, or 500 �M dimethoxy-1,4-naphthoquinone. Data are the average of three independent measurements. SPR was added at the indicated time. Panel B, effects of increasing concentrationsof NADPH on menadione redox cycling; inset, effects of increasing concentrations of menadione on redox cycling activity. Panel C, inhibition of menadioneredox cycling by 100 �M benzoquinone or phenylquinone; inset, inability of benzoquinone and phenylquinone to redox cycle with sepiapterin reductase. PanelD, effects of benzoquinone and phenylquinone on sepiapterin reductase activity. Enzyme activity was analyzed by changes in absorbance of sepiapterin at 420nm.

TABLE 2Redox cycling activity of quinones by sepiapterin reductase

Chemicals Kma kcat kcat/Km Redox potential (E, mVb)

�M min�1 min�1 �M�1

1,2-Naphthoquinone 2.1 16.60 7.91 �899,10-Phenanthrenequinone 8.8 37.67 4.28 �1241,4-Naphthoquinone 27.0 2.83 0.105 �140Menadione 87.2 0.96 0.011 �2062,3-Dimethoxyl-1,4-naphthoquinone 86.0 0.31 0.004 �240

a Kinetic parameters of sepiapterin reductase redox cycling were assayed by quantifying the formation of H2O2 in enzyme assays in the presence of 200 �M NADPHb Data are from Refs. 32–34.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

As indicated above, the reduction of sepiapterin by sepia-pterin reductase required NADPH, but not NADH. Unexpect-edly, we found that redox cycling by human recombinant sepi-apterin reductase also utilized NADH. The Km and kcat valuesfor NADPH in the reaction was 30.2 �M and 0.74 min�1,respectively, and for NADHwas 110�M and 0.2min�1, respec-tively. Thus, NADPH was significantly more efficient in sup-porting the reaction (kcat/Km � 0.025min�1 �M�1 for NADPHversus 0.002 min�1 �M�1 for NADH). In these studies, redoxcycling was measured by quantifying the formation of H2O2 inenzyme assays containing 0.5 mM menadione and increasingconcentrations of NADPH or NADH.The measured ratio of NADPH utilization to oxygen con-

sumption to H2O2 formation in our assays was found to be2.0:2.6:1.2 (Table 3). H2O2 formationwas significantly differentfromNADPH utilization and oxygen consumption. These dataare close to the theoretical stoichiometry of 1:1:0.5 or 2:2:1 forthe redox cycling reaction. It is important to note that redoxcycling in our assays was measured under normoxic conditions(�240 �M oxygen in solution in vitro). Levels of oxygen areoften 10 times lower in vivo, which lowers ROS formation dur-ing redox cycling. Using our in vitro assay, we found thatdecreasing oxygen tension 10-fold resulted in an �50%decrease inH2O2 formation during redox cycling (Fig. 7). Thesedata indicate that oxygen is in excess in the redox cycling reac-tion and that high levels of ROS can be formed even at reducedtissue oxygen concentrations. It is important to point out, how-ever, that the one electron reduction of redox-active chemicalsby sepiapterin reductase is not an oxygen-requiring reaction.Atlow oxygen tension, radical ions generated by this process arestabilized. They are by themselves highly reactive and can con-tribute to toxicity (35).Effects of Inhibitors on theReduction of Sepiapterin andRedox

Cycling by Sepiapterin Reductase—A number of aldo-ketoreductase inhibitors have been reported to block the activity ofpurified rat sepiapterin reductase, including dicoumarol, indo-methacin, ethacrynic acid, and the flavonoid glycoside rutin, aswell as the indoleamine, N-acetylserotonin (36, 37). Each ofthese compounds was found to inhibit sepiapterin reduction

mediated by recombinant human sepiapterin reductase. Themost potent inhibitor was dicoumarol followed by N-acetylse-rotonin, indomethacin, ethacrynic acid, and rutin (Fig. 8 andTable 4). Whereas dicoumarol, ethacrynic acid, and rutin werenoncompetitive inhibitors of the enzyme, N-acetylserotoninand indomethacin were competitive inhibitors (Ki values � 0.9and 2.7�M, respectively, see Table 4). In contrast, none of theseinhibitors affected sepiapterin reductase-mediated redoxcycling (Table 4 and Fig. 6, panel D). These data suggest that thereduction of sepiapterin and chemical redox cycling occur bydistinct mechanisms. This is supported by our findings thatsepiapterin, at concentrations �1 mM, also failed to inhibitredox cyclingmediated by sepiapterin reductasewith any of theredox-active quinones (data not shown). Diphenyleneiodo-nium, an inhibitor of flavin-containing oxidoreductases, whichhas been reported to inhibit redox cycling by NADPH-cyto-chrome P450 reductase and thioredoxin reductase (9, 20), wasalso unable to inhibit either the reduction of sepiapterin orredox cycling by sepiapterin reductase (Table 4 and data notshown), a finding consistent with the fact that the enzyme doesnot require flavin cofactors for activity.Effects of Redox Cycling Compounds on Sepiapterin Reduc-

tase Activity—Each of the quinones that redox cycles with sepi-apterin reductase was found to inhibit the ability of the enzymeto reduce sepiapterin (Fig. 9, panel A, and Table 4). 9,10-Phenanthrenequinone was the most potent inhibitor followedby 1,2-naphthoquinone, 1,4-naphthoquinone, menadione, and2,3-dimethoxy-1,4-naphthoquinone. The relative inhibitoryeffect of these quinones was proportional to their kcat values(Table 2 and Fig. 9, panel C). All of the inhibitors were noncom-petitivewith respect to sepiapterin (Fig. 9,panel B, andTable 4).Interestingly, p-benzoquinone and phenylquinone, which didnot redox cycle with sepiapterin reductase (Fig. 4, panel C,inset), inhibited both the ability of sepiapterin reductase toreduce sepiapterin and to mediate redox cycling (Fig. 4, panelsC and D, and Table 4), as measured by the production of ROSand oxygen utilization (Fig. 6, panel C, and data not shown).p-Benzoquinone and phenylquinone were competitive inhibi-tors of sepiapterin reductase-mediated reduction of sepiapterin

FIGURE 5. Ability of human recombinant sepiapterin reductase to generate ROS. Reaction mixes contained sepiapterin reductase, 200 �M NADPH, and 500�M menadione. Panel A, menadione stimulated superoxide anion production by sepiapterin reductase. Menadione was added to reaction mixes to stimulatesuperoxide anion formation as indicated by the arrow. Superoxide anion was measured spectrophotometrically by monitoring superoxide dismutase inhib-itable changes in absorbance of acetylated cytochrome c at 550 nm. Reactions were run in the absence and presence of SPR. SOD (40 units), which dismutatessuperoxide anion, was added to the reactions as indicated by the arrowheads. Panel B, menadione stimulated H2O2 production by sepiapterin reductase.Menadione was added to reaction mixes to stimulate H2O2 production. Catalase (2000 units), which breaks down H2O2, was added to the reactions as indicatedby the arrowheads.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

but noncompetitive inhibitors of redox cycling (Table 4). Thesedata indicate that redox cycling is not required for quinones toinhibit sepiapterin reduction and further support the idea thatmechanisms underlying sepiapterin reduction and redoxcycling by sepiapterin reductase are distinct.

Because redox cycling inhibited reduction of sepiapterin bypurified recombinant sepiapterin reductase, we next deter-mined whether sepiapterin reductase could be inhibited in vivoby redox cycling chemicals. Fig. 10 shows that in A549 human

FIGURE 6. Oxygen consumption by human recombinant sepiapterin reductase during chemical redox cycling. A Clark-type oxygen electrode was usedto quantify oxygen consumption during redox cycling. The reaction was run in the presence of 200 �M NADPH and an NADPH-regenerating system. Afterestablishing a stable base line, SPR or sepiapterin was added. Panels A and B, 5 �M 9,10-phenanthrenequinone (9,10-PQ), but not sepiapterin (200 �M), initiatedoxygen consumption by sepiapterin reductase. Panels C and D, 200 �M phenylquinone, but not 200 �M N-acetylserotonin, inhibited 9,10-phenanthrenequi-none-induced oxygen consumption.

FIGURE 7. Effects of oxygen on H2O2 production by 9,10-phenanthrene-quinone-induced redox cycling with sepiapterin reductase. Reactionswere run in Oxygraph reaction cells in a total volume of 0.6 ml and contained50 mM phosphate buffer, pH 7.8, 5 �M 9,10-phenanthrenequinone, and 200�M NADPH. To generate reduced oxygen levels, the reaction cell was purgedwith 100% nitrogen gas, and levels of oxygen were monitored with the Oxy-graph. To initiate the redox cycling reactions, 0.3 �g of sepiapterin reductasewas injected into the reaction cells. Samples were removed at different timepoints; the reactions were stopped by the addition of acetonitrile at a finalconcentration of 30%, and the H2O2 concentration was determined by theAmplex red assay.

FIGURE 8. Effects of N-acetylserotonin and dicoumarol on sepiapterinreduction and redox cycling by human recombinant sepiapterin reduc-tase. Sepiapterin reductase activity was measured by decreases in sepia-pterin absorbance at 420 nm. Redox cycling was measured by the formation ofsuperoxide anion in enzyme assays in the presence of 100 �M menadione. Notethat both N-acetylserotonin and dicoumarol inhibit sepiapterin reduction (IC50 �2.6 and 0.2 �M, respectively) but not redox cycling activity. Sepiapterin reductionwas analyzed by changes in absorbance of sepiapterin at 420 nm.

TABLE 3Stoichiometry of the chemical redox cycling reaction of sepiapterin reductase

Stoichiometry NADPH consumeda Oxygen consumed H2O2 formed

Enzyme activity (�mol/min/mg protein) 1.8 0.2 (11.3) 2.3 0.4 (14.5) 1.1 0.1 (7.1)Measured ratio 2.0 0.2 2.6 0.3b 1.2 0.1dTheoretical ratioc 2 2 1

a Reactions contained 5 �M 9,10-phenanthrenequinone as the redox cycling chemical. The number in parentheses is the �M concentration of NADPH or oxygen consumedor H2O2 formed after the first 3 min of incubation. Each value represents the mean S.E. (n � 3 for NADPH and oxygen consumption and 7 for H2O2 formation).

b Not significantly different from NADPH consumption; significantly different (p � 0.05) from H2O2 formation (t test).c The theoretical stoichiometry is based on the fact that two oxygen molecules (O2) and two electrons from two NADPH molecules (each of which acts as a one-electron do-nor) are needed to generate one H2O2 molecule.

d Significantly different (p � 0.05) from NADPH and oxygen consumption (t-test).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

lung epithelial cells, treatment with sepiapterin readily gener-ates BH2 and BH4, a finding that confirms that these cellsexpress sepiapterin reductase. Menadione completely pre-vented the formation of BH2 and BH4. These data demonstratethat menadione redox cycling in vivo can suppress sepiapterinreductase activity.Site-directed Mutagenesis Defines Distinct Sites on Sepia-

pterin Reductase for the Reduction of Sepiapterin and RedoxCycling—Previous studies have shown that sepiapterin reduc-tase contains an active center conserved region important for

NADPH binding and a substrate transfer site (38–41). In fur-ther studies we used site-directed mutagenesis to investigatethe role of the different functional domains of the enzyme in itssepiapterin reduction and redox cycling activities. In thehuman enzyme, the catalytic center has been defined by a con-served Ser-157–Tyr-170–Lys-174 triad (38). We found thatmutations in Ser-157 or Lys-174 in this region reduced bothsepiapterin reduction and redox cycling activity by 80–95%(Fig. 11). The catalytic efficiencies (kcat/Km) for sepiapterinreduction of S157A and K174L decreased to 1.8 and 0.8% of

FIGURE 9. Effects of quinones on human recombinant sepiapterin reductase activity. Panel A, effects of quinones (9,10-phenanthrenequinone (9,10-PQ),1,2-naphthoquinone (1,2-NQ), 1,4-naphthoquinone (1,4-NQ), menadione (MD), and dimethoxy-1,4-naphthoquinone (DMNQ)) on sepiapterin (SP) reduction byhuman recombinant sepiapterin reductase. Panel B, Lineweaver-Burk analysis of menadione inhibition of sepiapterin reduction. Note that menadione is anoncompetitive inhibitor. Panels A and B, sepiapterin reduction was measured by changes in absorbance of sepiapterin at 420 nm. Panel C, correlation betweenthe kcat for redox cycling, as measured by H2O2 production, and the ability to inhibit reduction of sepiapterin. Data are presented as the IC50 value for inhibitionof sepiapterin reduction. Panel D, correlation between kcat/Km for redox cycling by sepiapterin reductase and redox potential for various quinones.

TABLE 4Ability of various compounds to inhibit sepiapterin reduction and redox cycling by sepiapterin reductase

InhibitorSepiapterin reductiona Redox cycling

Inhibition type IC50 Ki Inhibition type IC50

�M �M �M

Non-redox cycling agentsDicoumarol Noncompetitive 0.2 NIbN-Acetylserotonin Competitive 2.6 0.9 NIIndomethacin Competitive 8.1 2.7 NIEthacrynic acid Noncompetitive 22.9 NIRutin Noncompetitive 24.0 NIDiphenyleneiodonium NIc NIcBenzoquinone Competitive 2.8 0.9 Noncompetitive 3.4Phenylquinone Competitive 1.6 0.5 Noncompetitive 3.2

Redox cycling agents9,10-Phenanthrenequinone Noncompetitive 3.61,2-Naphthoquinone Noncompetitive 8.91,4-Naphthoquinone Noncompetitive 71.4Menadione (2-methyl-1,4-naphthoquinone) Noncompetitive 164.32,3-Dimethoxyl-1,4-naphthoquinone Noncompetitive 304.6

a Sepiapterin reduction was measured by decreases on absorbance of sepiapterin at 420 nm as described under “Experimental Procedures.”b NI means not inhibitory at concentrations up to 100-fold higher than the IC50 for sepiapterin reduction inhibition.c NI means not inhibitory at concentrations up to 1 mM.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

wild type sepiapterin reductase, respectively, and for redoxcycling to 6.8 and 1.4%, respectively (Table 5). Similarly, muta-tions in Gly-14 and Gly-18 in the NADPH-binding motif ofsepiapterin reductase resulted in almost complete loss of theability to reduce sepiapterin and a 65–75% decrease in redoxcycling (Fig. 11, panel B). For both of these mutations, the cat-alytic efficiencies for redox cycling decreased to 0.2% of wildtype sepiapterin reductase (Table 5). Mutation in Asp-42,which is thought to be important in the selectivity of theenzyme for NADPH (42), led to a 90% reduction in sepiapterinreduction activity and a 50% reduction in redox cycling activity(Fig. 11, panel B). The catalytic efficiencies for this mutantdecreased to 2 and 7% of wild type sepiapterin reductase forsepiapterin reduction and redox cycling, respectively (Table 5).These data confirm the importance of the catalytic center andthe NADPH binding regions in mediating the activities of sepi-apterin reductase. Residues Asn-99 andMet-205 are conservedamino acids in human, mouse, and rat sepiapterin reductasesand may play important roles in maintaining the structure ofthe enzyme (40), and mutations in these amino acids alsocaused marked reductions in the activities of both sepiapterinreduction and redox cycling (Fig. 11, panel B). The catalyticefficiency of N99A and M205G for sepiapterin reductiondecreased to �1 and 5%, respectively, and for redox cycling, 5and 25%, respectively, when compared with the wild typeenzyme (Table 5).

The C-terminal region of sepiapterin reductase has beenreported to be critical for binding of sepiapterin to the enzyme(40). Deletion of the C-terminal five amino acids almost com-pletely eliminated enzyme activity (Fig. 11, panel B). For redoxcycling, the catalytic efficacy decreased to less than 1% of thewild type enzyme (Table 5). Interestingly, mutation of Asp-257to histidine eliminated sepiapterin reduction activity but hadminimal effects on redox cycling activity (Fig. 11, panel B).Thus, the catalytic efficiency of D257H for sepiapterin reduc-tion and redox cycling decreased to �4 and 80% of wild typeenzyme activity, respectively (Table 5). Phosphorylation hasalso been reported to regulate sepiapterin reductase activity(43). Mutation of Tyr-259, a unique potential phosphorylationsite in the C-terminal substrate transfer motif, had no majoreffects on sepiapterin reduction and redox cycling activity (Fig.11, panel B, and Table 5).

DISCUSSION

This study demonstrates that sepiapterin reductase is amediator of chemical redox cycling in lung epithelial cells.Active substrates include bipyridinium herbicides, as well asvarious redox-active quinones. The one electron reduction ofthese substrates by sepiapterin reductase readily generatesROS, including superoxide anion and H2O2, at the expense of areduced nicotinamide adenine dinucleotide cofactor. Theredox cycling reaction consumes oxygen and utilizes eitherNADPHorNADH;NADPH is significantlymore efficient thanNADH in supplying electrons to the reaction. This is in contrastto enzyme-mediated reduction of sepiapterin, an obligateNADPH-dependent reaction. The phosphate group in the ade-nine nucleotide is presumably important in cofactor recogni-tion by the enzyme during sepiapterin reduction; in contrast,the redox cycling reaction also allows electrons fromNADH tomediate the one electron reduction of redox-active substrates,possibly due to less stringent requirements for binding of thecofactor to the enzyme (44). Our findings that NADH canmediate redox cycling are in accord with reports that otherenzymes catalyzing this process, including cytochrome b5reductase and ubiquinone oxidoreductase, preferentially utilizeNADH (44, 45).Sepiapterin reductase is widely distributed in tissues, includ-

ing the lung, kidneys, and brain (25). Thus, chemical redoxcycling by sepiapterin reductase and consequent ROS genera-tion may contribute to tissue injury in a manner dependent onlocalized concentrations of the enzyme, reduced pyridinenucleotide cofactors, oxygen, and redox-active chemicals. Itshould be noted that chemical redox cycling by sepiapterinreductase is flavin cofactor-independent. For flavin-containingenzymes such as cytochrome P450 reductase, cytochrome b5reductase, xanthine oxidase, and various forms of nitric-oxidesynthase, the flavin cofactor is thought to participate in chem-ical redox cycling because of its ability to accept single electronsfrom the pyridine nucleotide cofactor, which are presumablyused for the one electron reduction of the redox-active chemi-cals. This reaction is blocked by the flavin inhibitor diphenyle-neiodonium (14). The fact that sepiapterin reductase is not aflavin-containing enzyme and is not blocked by diphenylenei-odonium suggests that there aremultiplemechanisms bywhich

FIGURE 10. Inhibition of dihydrobiopterin and tetrahydrobiopterin for-mation by menadione in A549 lung epithelial cells. Cells were pretreatedwith control medium or medium containing 500 �M menadione. After 2 h,sepiapterin (100 �M final concentration) was added to the cultures. After anadditional 2 h, cells were extracted and analyzed for BH2 and BH4 content byHPLC. The upper and middle tracings were from cells treated with sepiapterinalone or sepiapterin and menadione. The lower tracing is from control cellsthat were not treated with sepiapterin or menadione.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

enzymes can mediate chemical redox cycling. Recent studieshave shown that aldo-keto reductases also mediate chemicalredox cycling in the absence of a flavin cofactor (46, 47). At thepresent time, the precisemechanismmediating flavin-indepen-dent redox cycling is not known. It is possible that binding ofredox-active chemicals in an appropriate orientation in prox-imity to the pyridine nucleotide cofactor is sufficient to allowsingle electron transfers. Further studies are needed to explorethis possibility.Redox-active quinones were found to vary in their activity

with respect to redox cycling with sepiapterin reductase with1,2-naphthoquinone displaying the greatest activity, followedby 9,10-phenanthrenequinone, 1,4-naphthoquinone, menadi-one, and 2,3-dimethoxy-1,4-naphthoquinone. The catalyticactivity of these quinones was tightly correlated (R2 � 0.91)with their redox potentials. Of note is our finding that each ofthe redox cycling agents was an effective noncompetitive inhib-

itor of sepiapterin reduction. These data indicate that there aredistinct mechanisms underlying sepiapterin reduction andredox cycling. The efficient inhibition of sepiapterin reductionby the quinones is likely due to their ability to divert electronflux from sepiapterin; this is supported by the observation thatthe IC50 values of the quinones for inhibition of sepiapterinreductase were correlated with their Km values for NADPHoxidation. A similarmechanism for quinone inhibition of disul-fide substrate reduction has been suggested for thioredoxinreductase (48). Earlier studies have identified a number of sub-strates of purified rat erythrocyte sepiapterin reductase, includ-ing dicarbonyl compounds, quinones, aldehydes, and ketonesin assays measuring the NAD(P)H oxidase activity of theenzyme (36). Although this activity was ascribed to the “car-bonyl reductase” or “aldo-keto reductase” activity of sepia-pterin reductase, one cannot exclude the possibility that theseenzyme activities were due, at least in part, to redox cycling.

FIGURE 11. Site-directed mutagenesis of human recombinant sepiapterin reductase. Panel A, schematic drawing of recombinant sepiapterin reductaseand mutant enzymes. The human recombinant sepiapterin reductase used in this investigation contains a hexahistidine tag at the N terminus and the 261original full-length amino acids. The NADPH-binding motif, active center, and substrate transfer motif are indicated. The mutated positions are labeledseparately. Panel B, sepiapterin reduction and redox cycling activity of sepiapterin reductase and mutant enzymes were assayed as described under “Experi-mental Procedures.” Data are presented as percentage of the wild type control enzyme activity. Sepiapterin reduction was assayed in the presence of 50 �M

sepiapterin and measured by changes in absorbance of sepiapterin at 420 nm. Redox cycling was assayed in the presence of 500 �M menadione.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Additional studies are required to identify specific enzymeproducts and reaction mechanisms that could distinguish non-sepiapterin reduction and non-redox cycling activities of sepi-apterin reductase with different chemical substrates.Earlier work has identified inhibitors of sepiapterin reduc-

tase largely based on structural similarities with natural sub-strates for the enzyme (i.e. sepiapterin or pyruvoyltetrahydro-pterin), in particular, N-acetylserotonin, N-acetyldopamine,and N-acetyl-m-tyramine (37). These compounds were allcompetitive inhibitors of the enzyme substrates. Similarly,using human recombinant enzyme, we found that N-acetylse-rotonin was a competitive inhibitor of sepiapterin utilization.These data are consistentwith crystallographic studies showingsimilarities in the structures of substrates and inhibitors boundto sepiapterin reductase (40). Sueoka and Katoh (36) showedthat aldo-keto reductase inhibitors, including indomethacin,ethacrynic acid, rutin, and dicoumarol, were inhibitors of raterythrocyte sepiapterin reductase.Our findings that these com-pounds are potent inhibitors of human recombinant sepia-pterin reductase are in accord with this report. Notably, thesecompounds blocked sepiapterin reduction by the enzyme, butnot redox cycling, further supporting the idea that the two cat-alytic enzyme activities are distinct. Indomethacin, like N-ace-tylserotonin, was found to be a competitive inhibitor, whereasdicoumarol, ethacrynic acid, and rutin were noncompetitiveinhibitors; these data indicate that the various inhibitors ofsepiapterin reduction also function by distinct mechanisms. Ingeneral, inhibitors of sepiapterin reductase are structurallydiverse; further studies are needed to better define the mecha-nisms by which they selectively block substrate reduction bysepiapterin reductase.Of interest was our finding that benzoquinone and phe-

nylquinone, two non-redox cycling quinones, inhibited thereduction of sepiapterin, as well as quinone redox cycling bysepiapterin reductase. Although both compounds were com-petitive inhibitors of sepiapterin reduction, they were noncom-petitive inhibitors of redox cycling, providing additional evi-dence that the active sites on the enzyme for sepiapterinreduction and redox cycling are unique. At present, it is notknown if the inhibitory activities of the quinones are due tobinding to different or overlapping sites on sepiapterin reduc-tase. Both reactions require the adenine nucleotide co-factor

suggesting that their active sites on the enzyme are in closeproximity. The fact that benzoquinone and phenylquinoneinhibit sepiapterin reduction without redox cycling indicatesthat the production of superoxide anion is not required forinhibition of sepiapterin reduction.Our data demonstrate that A549 lung epithelial cells contain

sepiapterin reductase and that the enzyme is active and readilygenerates BH2 and BH4 from sepiapterin. Of note was ourobservation that menadione, a highly effective redox cyclingchemical, inhibited this process. Thus, chemical redox cyclingcan suppress the formation of BH4 in intact cells. These datasuggest that chemical redox cycling can inhibit sepiapterinreductase in vivo.Based on sequence alignment showing a conserved N-termi-

nal motif (15GXXXGXG21 in the mouse enzyme and14GXXXGXG20 in the human enzyme) for NADPH binding,referred to as a “Rossmann-fold,” and an active site motif(YXXXK), sepiapterin reductase has been classified as a mem-ber of the short chain-dehydrogenase reductase family (38, 49).This has been confirmed by crystallographic studies with themouse enzyme in which sepiapterin reductase was identified asa homodimeric protein with each monomer containing anNADPH and a sepiapterin-binding site in close proximity (seeFig. 12 for structure). These latter studies showed that Arg-43(Arg-42 in the human enzyme) functions as a critical anchoringsite for the adeninemoiety inNADPH (40, 41). This amino acidis thought to exist only in short chain-dehydrogenase reductasefamilymembers that preferentially utilizeNADPH (42). In con-trast, Met-206 in the mouse enzyme (Met-205 in the humanenzyme) functions tomaintain a critical hydrophobic pocket inproximity to the nicotinamide moiety of NADPH (40). To fur-ther understand the role of these amino acids in sepiapterinreductase functioning, we performed site-directed mutationalanalysis. Initially, we analyzed mutations in the human enzymeNADPH binding domain, including G14S, G18D, R42G, andM205G (see Figs. 11 and 12 for summaries). Mutations in gly-cine addmore polar structure to the enzyme at positions whereadenine binds in the NADPH binding pocket and can decreaseinteractions of the protein with adenine. A similar change inadenine binding can result from the arginine mutation, whichprevents hydrogen bonding with adenine, adding a less polar,more neutral amino acid to the NADPH binding pocket. Incontrast, the methionine mutation significantly decreaseshydrophobic interactionswith nicotinamide, which can disruptelectron transfer to sepiapterin. We found that these pointmutations caused major losses (90–98%) in the ability of sepi-apterin reductase to reduce sepiapterin confirming that in thewild type enzyme these amino acids bind tightly to NADPH,generating a unique structural conformation that is essentialfor substrate reduction. These data are also consistent withthe requirement for the adenine nucleotide for optimalenzyme activity (25). Interestingly, NADPH-binding sitemutant sepiapterin reductase enzymes still retained 25–55%of their redox cycling activity. Although each of the pointmutations appear to alter the alignment of the nicotinamidewith respect to sepiapterin, a process that limits electrontransfer to the substrate, NADPH appears to remain in closeenough proximity to the redox cycling chemicals allowing

TABLE 5Kinetic parameters of wild type and mutant sepiapterin reductases

SPRKm kcat kcat/Km

SPRa Redoxb SPR Redox SPR Redox

�M min�1 min�1 �M�1

Wt-hSPR 25.4 8.8 97.0 37.67 3.82 4.28G14S NDc 50.1 ND 0.34 ND 0.01G18D ND 464.1 ND 2.90 ND 0.01R42G 45.7 50.1 3.2 5.90 0.07 0.32N99A 94.1 126.0 3.3 17.40 0.04 0.14S157A 50.3 3.2 3.5 0.92 0.07 0.29K174L 169.8 27.7 5.4 1.79 0.03 0.06M205G 133.8 13.4 25.7 13.45 0.19 1.08D257H 60.6 1.9 9.4 6.44 0.16 3.39�257–261 ND 116.0 ND 0.35 ND 0.01Y259A 25.5 19.6 36.2 48.30 1.42 2.46

a Sepiapterin reduction activity was assayed by the formation of BH2 fromsepiapterin by HPLC as described under “Experimental Procedures.”

b Redox cycling was assayed using 9,10-phenanthrenequinone.c NDmeans not determined.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

for partial activity. These data are in accord with our inhib-itor studies and indicate that redox cycling occurs at a site onthe enzyme distinct from sepiapterin reduction. Presumably,NADPH remains bound to the Rossmann-fold containingpocket in the mutant enzymes. Thus, as long as redox cyclingchemicals are in proximity to the nicotinamide moiety,redox cycling reactions occur, although with reduced effi-ciency. However, further studies are needed to rule out the

possibility of altered binding of redox cycling chemicals tothe mutant enzymes, which may also reduce enzyme activity.Another highly conserved sequence motif in sepiapterin

reductase is the catalytic site. In mouse sepiapterin reductase,this site is composed of several hydrophobic amino acids,including Leu-105, Leu-159, Tyr-165, Trp-168, Tyr-171, Met-206, and Cys-160 (40). Tyr-171 is a key active site residue; thephenyl ring hydroxyl group of Tyr-171 is situated in an orien-tation for proton transfer between theC4�NofNADPHand theC1�-carbonyl function of the substrate. Arg-178, which is out-side the active site cavity, is thought to act in concert with Lys-175, to facilitate proton transfer from the hydroxyl function ofTyr-171 to the substrate’s carbonyl oxygen, although Ser-158stabilizes the orientation of the substrate (42, 50, 51). Thus, acritical triad pocket in sepiapterin reductase composed of Ser-158, Tyr-171, and Lys-175 is formed and serves a key functionin stabilizing the protein structure, maintaining cofactor/sub-strate proximity, and proton transfer (40). Three highly con-served asparagine residues (Asn-100, Asn-128, and Asn-155)are also located within hydrogen bonding distance to the gua-nidinium moiety of Arg-178 and are thought to be importantfor maintaining this amino acid in an orientation required forfunctional interactions with Tyr-171 (40). Previous site-di-rected mutagenesis studies with rat sepiapterin reductase haveconfirmed that Ser-158, Tyr-171, and Lys-175 play key roles inthe function of the enzyme (38, 39).We found thatmutations inSer-157 and Lys-174 in the human enzyme (corresponding toSer-158 and Lys-175 in the mouse enzyme) resulted in an80–85% loss in the ability of sepiapterin reductase to mediatereduction of sepiapterin. This is likely due to the fact thathydrogen bonds cannot form between the substituted aminoacids and the substrate in the mutated enzymes. Interestingly,low levels (15–20%) of redox cycling activity remained. Thesedata indicate that, despite mutations at critical functional sites,the active site on the enzymemediating redox cycling is close tothe active site triad, allowing for low level activity. As observedwith mutants in the NAD(P)H binding pocket, active site triadmutants are able to position redox cycling chemicals closeenough to NAD(P)H to permit low levels of redox cycling. Sim-ilar decreases in sepiapterin reduction and chemical redoxcycling were observed with the Asn-99 mutant (correspondingto Asn-100 in the mouse enzyme). These data further supportthe idea that this amino acid is critical formaintaining the func-tional activity of the active site triad.Analysis of the crystal structure of mouse sepiapterin reduc-

tase reveals that the pterin substrate is positioned in the activesite anchored with its guanidine moiety to Asp-258 (40). Thisamino acid, which is located at the C terminus of the enzyme, isthought to play a key role in positioning the pterin substrateside chain C1�-carbonyl group near the hydroxyl group in Tyr-171 and NADPH C4�N in the active site of the enzyme (40).This study shows that mutation in this aspartate residue(D257H) in the human enzyme (corresponding to Asp-258 inthemouse enzyme) caused a loss of sepiapterin reduction activ-ity, with minimal effects on its chemical redox cycling activity.It appears that decreases in sepiapterin reduction are due to areduced affinity for the substrate resulting in lower catalyticefficiency. However, with respect to redox cycling, the D257H

C

B

A

NADP+

sepiapterin

Ser157

Tyr170

Lys174

Arg42

Gly14

Asn99

Lys174

Ser157Asp257

Tyr259sepiapterinGly18

Met205

NADP+

3.0

3.1

3.0

3.1

3.5

FIGURE 12. Molecular models of sepiapterin reductase complexed withNADP� and sepiapterin. Panel A, superposition of human and mouse sepia-pterin reductase. Human sepiapterin reductase is shown in violet (ProteinData Bank code 1Z6Z) and mouse sepiapterin reductase in cyan (Protein DataBank code 1SEP). The NADP cofactor and sepiapterin substrate complexedwith mouse sepiapterin reductase are shown in red and green, respectively.NADP bound with human sepiapterin reductase is shown in yellow. Panel B,close-up of the active site of the NADP-sepiapterin-sepiapterin reductasecomplex. Key residues in the active site are represented as blue sticks. Panel C,interactions of sepiapterin and NADP with the active site of human sepiap-terin reductase. Protein residues selected for site-directed mutagenesis areshown as blue sticks. Hydrogen bonds are shown by broken lines, and thecorresponding distances (Å) are indicated.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

substitution, which changes the amino acid residue from nega-tively charged to positively charged, caused an increase in Kmand a decrease in kcat for the reaction. Thus, although the netresult did not alter apparent redox cycling activity, this substi-tution changed the kinetics of the reaction, possibly due to con-formational changes in the active site of the enzyme. Theseresults indicate that Asp-257 is important in generating BH2;however, substitutions do allow redox cycling. These data alsosupport the idea that sepiapterin reduction and redox cyclingby sepiapterin reductase occur by distinct mechanisms.Deletion of the last five amino acids in theC terminus (�257–

261) of the enzyme abolished sepiapterin reductase activity anddecreased redox cycling by �70%. These findings confirm arole for Asp-257 in sepiapterin reduction and suggest that theCterminus of the enzyme is required for optimal chemical redoxcycling.Katoh et al. (43) showed that serine/threonine phosphoryla-

tion of rat sepiapterin reductase by Ca2�/calmodulin-depen-dent protein kinase II or protein kinase C modified the kineticproperties of the enzyme. TheC terminus of human sepiapterinreductase contains a single tyrosine residue (Tyr-259) in prox-imity to the active site that has the potential to control enzymeactivity. We found that mutation of this amino acid (Y259A)had no major effects on sepiapterin reduction or on chemicalredox cycling indicating that this tyrosine residue is notrequired for enzyme activity. It remains to be determinedwhether phosphorylation of this or other tyrosine residuesand/or serine or threonine residues in sepiapterin reductase isimportant in controlling its enzymatic activities.BH4 is a key cofactor for a number of aromatic amino acid

hydroxylases important in synthesizing catecholamines, neu-rotransmitters, and indoleamines, as well as for nitric-oxidesynthases. Deficiencies in BH4 result in movement disorderssuch as dystonia and Parkinson disease, Alzheimer disease, andatypical phenylketonuria (53–55). Specific mutations in sepia-pterin reductase, which compromise its ability to generate BH4,are associated with these diseases. For example, the mutationK251X, which causes the deletion of C-terminal amino acids,including the critical Asp-257, results in delayed psychomotordevelopment and a complex movement disorder (56, 57). Earlyonset Parkinson disease and other neurological deficits havealso been described in patients with point mutations in sepia-pterin reductase (e.g. R150G), deletion mutations (e.g.Q119X),as well as splicing mutations (IVS2–2A�G) (57, 58). That sepi-apterin reductase is crucial for neuronal functioning has beenhighlighted recently by findings that sepiapterin reductaseknock-out mice have reduced levels of neurotransmitters andthat this is associated with a variety of movement disorders (59,60).Our data showing that redox cycling chemicals can inhibit

sepiapterin reductase suggest a mechanism leading to deficien-cies in BH4 and consequent disease pathologies. Sepiapterinreductase transfers electrons from NADPH to sepiapterin.Both endogenous and exogenous redox cyclers preferentiallyutilize these electrons, at the expense of their supply to sepia-pterin, a process that effectively blocks the formation of BH4. Inmany tissues, including the brain and lung, this process couldcompromise BH4-containing enzymes and lead to neurological

deficits and/or aberrant pulmonary functioning. In this regard,epidemiological studies have demonstrated that exposure toparaquat, which we have shown redox cycles with sepiapterinreductase, leads to increased risk of Parkinson disease (61).Moreover, neonatal exposure of mice to paraquat results indopaminergic cell loss and the development of a Parkinson dis-ease phenotype (52). In the lung, altered levels of BH4 can leadto pulmonary hypertension and fibrosis (2). However, it shouldbe noted that exposure to redox cycling chemicals may only befor short periods of time, and this may not be sufficient toreduce BH4 levels below those needed to sustain aromaticamino acid hydroxylases and nitric-oxide synthases. Becausechemical redox cycling by sepiapterin reductase also generatescytotoxic ROS,which can contribute to altered cell functioning,this may be a more important short term toxic mechanism.Additional studies are needed to determine whether exposureto paraquat or other redox cycling chemicals can lead to BH4deficiencies and the production of cytotoxic concentrations ofROS in human tissues.

REFERENCES1. Kovacic, P., and Somanathan, R. (2009) Pulmonary toxicity and environ-

mental contamination: radicals, electron transfer, and protection by anti-oxidants. Rev. Environ. Contam. Toxicol. 201, 41–69

2. Kimbrough, R. D., andGaines, T. B. (1970) Toxicity of paraquat to rats andits effect on rat lungs. Toxicol. Appl. Pharmacol. 17, 679–690

3. Rashba-Step, J., and Cederbaum, A. I. (1994) Generation of reactive oxy-gen intermediates by human liver microsomes in the presence of NADPHor NADH.Mol. Pharmacol. 45, 150–157

4. Bonneh-Barkay, D., Reaney, S. H., Langston, W. J., and Di Monte, D. A.(2005) Redox cycling of the herbicide paraquat inmicroglial cultures.Mol.Brain Res. 134, 52–56

5. Dicker, E., and Cederbaum, A. I. (1991) NADH-dependent generation ofreactive oxygen species by microsomes in the presence of iron and redoxcycling agents. Biochem. Pharmacol. 42, 529–535

6. Winterbourn, C. C. (1995) Toxicity of iron and hydrogen peroxide: theFenton reaction. Toxicol. Lett. 82, 969–974

7. Pacher, P., Beckman, J. S., and Liaudet, L. (2007) Nitric oxide and per-oxynitrite in health and disease. Physiol. Rev. 87, 315–424

8. Radak, Z., Zhao, Z., Goto, S., and Koltai E. (2011) Age-associated neuro-degeneration and oxidative damage to lipids, proteins, and DNA. Mol.Aspects Med. 32, 305–315

9. Wang, Y., Gray, J. P.,Mishin, V., Heck, D. E., Laskin, D. L., and Laskin, J. D.(2008) Role of cytochrome P450 reductase in nitrofurantoin-induced re-dox cycling and cytotoxicity. Free Radic. Biol. Med. 44, 1169–1179

10. Wang, Y., Gray, J. P.,Mishin, V., Heck, D. E., Laskin, D. L., and Laskin, J. D.(2010) Distinct roles of cytochrome P450 reductase inmitomycin C redoxcycling and cytotoxicity.Mol. Cancer Ther. 9, 1852–1863

11. Marín, A., López de Cerain, A., Hamilton, E., Lewis, A. D., Martinez-Peñuela, J. M., Idoate, M. A., and Bello, J. (1997) DT-diaphorase and cyto-chrome b5 reductase in human lung and breast tumours. Br. J. Cancer 76,923–929

12. Osman, A. M., and van Noort, P. C. (2003) Evidence for redox cycling oflawsone (2-hydroxy-1,4-naphthoquinone) in the presence of the hypox-anthine/xanthine oxidase system. J. Appl. Toxicol. 23, 209–212

13. Day, B. J., Patel, M., Calavetta, L., Chang, L. Y., and Stamler, J. S. (1999) Amechanismof paraquat toxicity involving nitric oxide synthase.Proc.Natl.Acad. Sci. U.S.A. 96, 12760–12765

14. O’Donnell, B. V., Tew, D. G., Jones, O. T., and England, P. J. (1993) Studieson the inhibitory mechanism of iodonium compounds with special refer-ence to neutrophil NADPH oxidase. Biochem. J. 290, 41–49

15. Backes, W. L., and Kelley, R. W. (2003) Organization of multiple cyto-chrome P450s with NADPH-cytochrome P450 reductase in membranes.Pharmacol. Ther. 98, 221–233




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

16. Kubota, S., Yoshida, Y., and Kumaoka, H. (1977) Studies on the micro-somal electron-transport system of anaerobically grown yeast. IV. Purifi-cation and characterization of NADH-cytochrome b5 reductase.J. Biochem. 81, 187–195

17. Agarwal, A., Banerjee, A., and Banerjee, U. C. (2011) Xanthine oxi-doreductase: a journey from purine metabolism to cardiovascular excita-tion-contraction coupling. Crit. Rev. Biotechnol. 31, 264–280

18. Fulton, D., Gratton, J. P., and Sessa, W. C. (2001) Post-translational con-trol of endothelial nitric oxide synthase: why isn’t calcium/calmodulinenough? J. Pharmacol. Exp. Ther. 299, 818–824

19. Park, H. S., Kim, S. R., and Lee, Y. C. (2009) Impact of oxidative stress onlung diseases. Respirology 14, 27–38

20. Gray, J. P., Heck, D. E., Mishin, V., Smith, P. J., Hong, J. Y., Thiruchelvam,M., Cory-Slechta, D. A., Laskin, D. L., and Laskin, J. D. (2007) Paraquatincreases cyanide-insensitive respiration in murine lung epithelial cells byactivating anNAD(P)H:paraquat oxidoreductase: identification of the en-zyme as thioredoxin reductase. J. Biol. Chem. 282, 7939–7949

21. Holmgren, A., and Lu, J. (2010) Thioredoxin and thioredoxin reductase:current research with special reference to human disease. Biochem. Bio-phys. Res. Commun. 396, 120–124

22. Thöny, B., Auerbach, G., and Blau, N. (2000) Tetrahydrobiopterin biosyn-thesis, regeneration and functions. Biochem. J. 347, 1–16

23. Werner, E. R., Blau, N., and Thöny, B. (2011) Tetrahydrobiopterin: bio-chemistry and pathophysiology. Biochem. J. 438, 397–414

24. Crabtree, M. J., and Channon, K. M. (2011) Synthesis and recycling oftetrahydrobiopterin in endothelial function and vascular disease. NitricOxide 25, 81–88

25. Katoh, S. (1971) Sepiapterin reductase from horse liver: purification andproperties of the enzyme. Arch. Biochem. Biophys. 146, 202–214

26. Ferre, J., and Naylor, E. W. (1988) Sepiapterin reductase in human amni-otic and skin fibroblasts, chorionic villi, and various blood fractions. Clin.Chim. Acta 174, 271–282

27. Fussell, K. C., Udasin, R. G., Gray, J. P., Mishin, V., Smith, P. J., Heck, D. E.,and Laskin, J. D. (2011) Redox cycling and increased oxygen utilizationcontribute to diquat-induced oxidative stress and cytotoxicity in Chinesehamster ovary cells overexpressing NADPH-cytochrome P450 reductase.Free Radic. Biol. Med. 50, 874–882

28. Zhou, M., Diwu, Z., Panchuk-Voloshina, N., and Haugland, R. P. (1997) Astable nonfluorescent derivative of resorufin for the fluorometric determi-nation of trace hydrogen peroxide: applications in detecting the activity ofphagocyte NADPH oxidase and other oxidases. Anal. Biochem. 253,162–168

29. Mishin, V. M., and Thomas, P. E. (2004) Characterization of hydroxylradical formation by microsomal enzymes using a water-soluble trap, te-rephthalate. Biochem. Pharmacol. 68, 747–752

30. Barrett, E. G., Johnston, C., Oberdörster, G., and Finkelstein, J. N. (1998)Silica-induced chemokine expression in alveolar type II cells is mediatedby TNF-�. Am. J. Physiol. 275, L1110–L1119

31. Wolff, D. J., Lubeskie, A., and Li, C. (1997) Inactivation and recovery ofnitric oxide synthetic capability in cytokine-induced RAW 264.7 cellstreated with “irreversible” NO synthase inhibitors. Arch. Biochem. Bio-phys. 338, 73–82

32. Butler, J., and Hoey, B. M. (1993) The one-electron reduction potential ofseveral substrates can be related to their reduction rates by cytochromeP-450 reductase. Biochim. Biophys. Acta 1161, 73–78

33. Roginsky, V. A., Barsukova, T. K., and Stegmann, H. B. (1999) Kinetics ofredox interaction between substituted quinones and ascorbate under aer-obic conditions. Chem. Biol. Interact. 121, 177–197

34. Ham, S. W., Choe, J. I., Wang, M. F., Peyregne, V., and Carr, B. I. (2004)Fluorinated quinoid inhibitor: possible “pure” arylator predicted by thesimple theoretical calculation. Bioorg. Med. Chem. Lett. 14, 4103–4105

35. Cohen, G. M., and d’Arcy Doherty, M. (1987) Free radical mediated celltoxicity by redox cycling chemicals. Br. J. Cancer Suppl. 8, 46–52

36. Sueoka, T., and Katoh, S. (1985) Carbonyl reductase activity of sepiapterinreductase from rat erythrocytes. Biochim. Biophys. Acta 843, 193–198

37. Smith, G. K., Duch, D. S., Edelstein, M. P., and Bigham, E. C. (1992) Newinhibitors of sepiapterin reductase. Lack of an effect of intracellular tetra-hydrobiopterin depletion upon in vitro proliferation of two human cell

lines. J. Biol. Chem. 267, 5599–560738. Fujimoto, K., Hara,M., Yamada, H., Sakurai,M., Inaba, A., Tomomura, A.,

and Katoh, S. (2001) Role of the conserved Ser-Tyr-Lys triad of the SDRfamily in sepiapterin reductase. Chem. Biol. Interact. 130, 825–832

39. Fujimoto, K., Ichinose, H., Nagatsu, T., Nonaka, T., Mitsui, Y., and Katoh,S. (1999) Functionally important residues tyrosine-171 and serine-158 insepiapterin reductase. Biochim. Biophys. Acta 1431, 306–314

40. Auerbach, G., Herrmann, A., Gütlich, M., Fischer, M., Jacob, U., Bacher,A., and Huber, R. (1997) The 1.25-Å crystal structure of sepiapterin re-ductase reveals its binding mode to pterins and brain neurotransmitters.EMBO J. 16, 7219–7230

41. Supangat, S., Seo, K.H., Choi, Y. K., Park, Y. S., Son,D., Han, C.D., and Lee,K. H. (2006) Structure ofChlorobium tepidum sepiapterin reductase com-plex reveals the novel substrate binding mode for stereospecific produc-tion of L-threo-tetrahydrobiopterin. J. Biol. Chem. 281, 2249–2256

42. Tanaka, N., Nonaka, T., Nakanishi,M., Deyashiki, Y., Hara, A., andMitsui,Y. (1996) Crystal structure of the ternary complex of mouse lung carbonylreductase at 1.8 Å resolution: the structural origin of coenzyme specificityin the short-chain dehydrogenase/reductase family. Structure 4, 33–45

43. Katoh, S., Sueoka, T., Yamamoto, Y., and Takahashi, S. Y. (1994) Phos-phorylation by Ca2�/calmodulin-dependent protein kinase II and proteinkinase C of sepiapterin reductase, the terminal enzyme in the biosyntheticpathway of tetrahydrobiopterin. FEBS Lett. 341, 227–232

44. Yubisui, T., and Takeshita, M. (1980) Characterization of the purifiedNADH-cytochrome b5 reductase of human erythrocytes as a FAD-con-taining enzyme. J. Biol. Chem. 255, 2454–2456

45. King, M. S., Sharpley, M. S., and Hirst, J. (2009) Reduction of hydrophilicubiquinones by the flavin in mitochondrial NADH:ubiquinone oxi-doreductase (complex I) and production of reactive oxygen species. Bio-chemistry 48, 2053–2062

46. Matsunaga, T., Shinoda, Y., Inoue, Y., Shimizu, Y., Haga, M., Endo, S.,El-Kabbani, O., and Hara, A. (2011) Aldo-keto reductase 1C15 as a qui-none reductase in rat endothelial cell: its involvement in redox cycling of9,10-phenanthrenequinone. Free Radic. Res. 45, 848–857

47. Shultz, C. A., Quinn, A. M., Park, J. H., Harvey, R. G., Bolton, J. L., Maser,E., and Penning, T. M. (2011) Specificity of human aldo-keto reductases,NAD(P)H:quinone oxidoreductase, and carbonyl reductases to redox-cy-cle polycyclic aromatic hydrocarbon diones and 4-hydroxyequilenin-o-quinone. Chem. Res. Toxicol. 24, 2153–2166

48. Mau, B. L., and Powis, G. (1990) Inhibition of thioredoxin reductase (E.C.1.6.4.5.) by antitumor quinones. Free Radic. Res. Commun. 8, 365–372

49. Jörnvall, H., Persson, B., Krook, M., Atrian, S., Gonzàlez-Duarte, R., Jef-fery, J., and Ghosh, D. (1995) Short-chain dehydrogenases/reductases(SDR). Biochemistry 34, 6003–6013

50. Tanaka, N., Nonaka, T., Tanabe, T., Yoshimoto, T., Tsuru, D., andMitsui,Y. (1996) Crystal structures of the binary and ternary complexes of 7-�-hydroxysteroid dehydrogenase from Escherichia coli. Biochemistry 35,7715–7730

51. Oppermann, U. C., Filling, C., Berndt, K. D., Persson, B., Benach, J., Lad-enstein, R., and Jörnvall, H. (1997) Active site-directed mutagenesis of3�/17�-hydroxysteroid dehydrogenase establishes differential effects onshort-chain dehydrogenase/reductase reactions. Biochemistry 36, 34–40

52. Nisticò, R., Mehdawy, B., Piccirilli, S., and Mercuri, N. (2011) Paraquat-and rotenone-induced models of Parkinson’s disease. Int. J. Immuno-pathol. Pharmacol. 24, 313–322

53. Curtius, H. C., Niederwieser, A., Levine, R., andMüldner, H. (1984) Ther-apeutic efficacy of tetrahydrobiopterin in Parkinson’s disease. Adv. Neu-rol. 40, 463–466

54. Tani, Y., Fernell, E., Watanabe, Y., Kanai, T., and Långström, B. (1994)Decrease in 6R-5,6,7,8-tetrahydrobiopterin content in cerebrospinal fluidof autistic patients. Neurosci. Lett. 181, 169–172

55. Blau, N., Hennermann, J. B., Langenbeck, U., and Lichter-Konecki, U.(2011) Diagnosis, classification, and genetics of phenylketonuria and tet-rahydrobiopterin (BH4) deficiencies.Mol. Genet. Metab. 104, S2–S9

56. Verbeek, M. M., Willemsen, M. A., Wevers, R. A., Lagerwerf, A. J., Abel-ing, N.G., Blau,N., Thöny, B., Vargiami, E., andZafeiriou, D. I. (2008) TwoGreek siblings with sepiapterin reductase deficiency. Mol. Genet. Metab.94, 403–409




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

57. Bonafé, L., Thöny, B., Penzien, J. M., Czarnecki, B., and Blau, N. (2001)Mutations in the sepiapterin reductase gene cause a novel tetrahydrobi-opterin-dependent monoamine-neurotransmitter deficiency without hy-perphenylalaninemia. Am. J. Hum. Genet. 69, 269–277

58. Farrugia, R., Scerri, C. A., Montalto, S. A., Parascandolo, R., Neville,B. G., and Felice, A. E. (2007) Molecular genetics of tetrahydrobio-pterin (BH4) deficiency in the Maltese population.Mol. Genet. Metab.90, 277–283

59. Yang, S., Lee, Y. J., Kim, J.M., Park, S., Peris, J., Laipis, P., Park, Y. S., Chung,

J. H., and Oh, S. P. (2006) A murine model for human sepiapterin-reduc-tase deficiency. Am. J. Hum. Genet. 78, 575–587

60. Homma, D., Sumi-Ichinose, C., Tokuoka, H., Ikemoto, K., Nomura, T.,Kondo, K., Katoh, S., and Ichinose, H. (2011) Partial biopterin deficiencydisturbs postnatal development of the dopaminergic system in the brain.J. Biol. Chem. 286, 1445–1452

61. Mandel, J. S., Adami, H. O., and Cole, P. (2012) Paraquat and Parkinson’sdisease: an overview of the epidemiology and a review of two recent stud-ies. Regul. Toxicol. Pharmacol. 62, 385–392




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Laskin and Jeffrey D. LaskinShaojun Yang, Yi-Hua Jan, Joshua P. Gray, Vladimir Mishin, Diane E. Heck, Debra L.Sepiapterin Reductase Mediates Chemical Redox Cycling in Lung Epithelial Cells

doi: 10.1074/jbc.M112.402164 originally published online May 2, 20132013, 288:19221-19237.J. Biol. Chem.

10.1074/jbc.M112.402164Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/288/26/19221.full.html#ref-list-1

This article cites 61 references, 13 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M112.402164

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;288/26/19221&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/288/26/19221

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=288/26/19221&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/288/26/19221

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/288/26/19221.full.html#ref-list-1

http://www.jbc.org/

Documents

SepiapterinReductaseMediatesChemicalRedoxCyclingin ... · (0.1 ml) contained 50 mM phosphate buffer, pH 7.8, 25 M Amplex-Red, 0.1 unit of horseradish peroxidase, 0.2 mM NADPH,22.5