1

Semaphorin 3A stimulates neurite extension and regulates gene expressionin PC12 cells

Jens C. Schwamborn‡, Roberto Fiore‡, Dominique Bagnard§, Joachim Kappler¶,Christian Kaltschmidt||, and Andreas W. Püschel‡**

‡Institut für Allgemeine Zoologie und Genetik, Westfälische Wilhelms-Universität Münster,Schloßplatz 5, D-48149 Münster, Germany§INSERM U575 - Physiopathologie du Système Nerveux, Groupe de PhysiologieMoléculaire de la Régénération Nerveuse (PMRN), Centre de Neurochimie - 5, Rue BlaisePascal, 67084 Strasbourg, France¶Institut für Physiologische Chemie, Rheinische Friedrich-Wilhelms-Universität Bonn,Nussallee 11, D-53115 Bonn, Germany||Institut für Neurobiochemie, Universität Witten/Herdecke, Stockumer Str. 10, D-58448Witten, Germany

**To whom correspondence should be addressed at:Institut für Allgemeine Zoologie und GenetikWestfälische Wilhelms-UniversitätSchloßplatz 5D-48149 MünsterGermanyTel.: +49- 251-83-23872FAX: +49- 0251-83-24723e-mail: apuschel@uni-muenster.de

Running title: Sema3A stimulates neurite extension

Footnotes:* This work was supported by grants from the DFG (SFB 492, to A.W.P.) and a BoehringerIngelheim Foundation fellowship (J.C.S.).

Acknowledgments:We thank Dr. J.H. Prehn (Münster, Germany) for PC12 cells.

Abbreviations:GAP, GTPase-activating protein; MAPK, mitogen-activated protein kinase; NGF, nervegrowth factor; ROS, reactive oxygen species; Sema3A, semaphorin 3A; Sema4D, semaphorin4D; RT, reverse transcriptase; MPP+, 1-methyl-4-phenylpyridinium; NAC, N-Acetyl-L-Cysteine

JBC Papers in Press. Published on May 20, 2004 as Manuscript C400082200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

2

SUMMARY

The secreted semaphorin 3A is a member of a large family of proteins that act as guidance

signals for axons and dendrites. While the receptors and signalling pathways that mediate the

repulsive effects of semaphorins are beginning to be understood in some detail, the

mechanisms that are responsible for the ability of Sema3A to stimulate the extension of

dendrites remain to be elucidated. Here we show that PC12 cells, a model widely used to

study neuronal differentiation, can be used to dissect this pathway. Sema3A is as effective as

NGF in stimulating the extensions of neurites from PC12 cells. We show that Sema3A is able

to regulate gene expression and identify mitochondria as a novel target of Sema3A signalling.

Pharmacological block of mitochondrial reactive oxygen species (ROS) production abolishes

the extension of neurites in response to Sema3A. These results show that the characterization

of transcripts that are regulated by axon guidance signals may help to identify novel

components of their signalling pathways.

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3

INTRODUCTION

The semaphorins are a large family of secreted and membrane-bound proteins that act as

guidance signals for axons and dendrites (reviewed in 1). The secreted semaphorin 3A

(Sema3A) acts as a chemorepellent for many types of axons including sensory and cortical

axons and as an attractant for cortical dendrites (2). The repulsive effects of the secreted class

3 semaphorins are mediated by a receptor complex that contains neuropilin-1 (Nrp-1) or -2 as

the ligand binding subunit and an A-type plexin as the signal-transducing subunit (1).

Activation of the Sema3A receptor in sensory growth cones results in the depolymerization of

actin filaments and the loss of substrate adhesion (1). Although several components of the

pathways activated by semaphorins have been identified, many details of the signalling

cascades linked to the Sema3A receptor remain to be elucidated. The molecules implicated in

semaphorin signalling include the kinases Fyn, Cdk5, and Fes and members of the Crmp

family of microtubule-binding proteins (1). In addition, two types of oxygenases are involved

in mediating the repulsive effects of Sema3A, the putative flavoprotein monooxygenases of

the MICAL family and lipoxygenase (3, 4).

In addition to its repulsive effects, Sema3A acts as an attractive signal for the apical dendrites

of pyramidal neurons (2). In Sema3a knockout mice, the dendrites of cortical pyramidal

neurons are disoriented (2). While mice with a mutation in Nrp-1 that abolishes the binding of

semaphorins do not display defects in the orientation of apical dendrites, they show a

reduction in the growth of basal dendrites (5). Application of recombinant Sema3A to cortical

slice cultures increases the extension and branching mainly of basal dendrites (6). The effects

of Sema3A depend on the intracellular cGMP concentration in the target cells (7). Elevation

of cytosolic cGMP converts the repulsion of axons by Sema3A into an attraction and blocks

the collapse of sensory growth cones, suggesting that these pathways have at least some

components in common. However, with the exception of cGMP, the factors responsible for

mediating the attractive or stimulatory effects of semaphorins remain to be elucidated.

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4

Sema3A and Sema3E are both able to stimulate the mitogen-activated protein kinase (MAPK)

pathway while Sema3F antagonizes the activation of p38 activation by NGF (8-10). In

Xenopus retinal ganglion cell growth cones, local translation and p42/p44 MAPK activation

are required for the response to Sema3A (11). MAPKs are central elements in signalling

pathways that regulate gene expression in response to extracellular signals. The ability to

activate MAPKs suggests that semaphorins may also be able to modulate gene expression.

Here we show that in PC12 cells, a cell line that is widely used as a model for neuronal

differentiation (12), Sema3A induces the extension of neurites and regulates gene expression.

Starting from the observation that the targets of Sema3A include several transcripts encoding

mitochondrial proteins we obtained evidence for a role of mitochondrial ROS production in

Sema3A-induced neurite extension. Our results show that characterization of transcripts

regulated by Sema3A allows the identification of new components of the signaling cascades

mediating its effects.

EXPERIMENTAL PROCEDURES

Cell Culture - PC12 cells were cultured on fibronectin (Sigma) in RPMI 1640 medium

supplemented with 100 units/mL penicillin, 10% fetal calf serum (FCS) and 5% horse serum

(Invitrogen). 293T cells were grown in minimal essential medium supplemented with 100

units/mL penicillin and 10% FCS (Invitrogen). AP-Flag-Sema3A was produced by a stably

transfected cell line (cell line 293-717; 13) and added to cultures of PC12 cells or

hippocampal neurons as conditioned medium. Conditioned medium was obtained by

incubating the cells for 48 h with serum-free medium and supplemented subsequently with

1.5% FCS. Medium conditioned by 293T cells was used as a control. The induction of

neurites was quantified by staining the cells with rhodamine-phalloidin and determining the

total length of neurites per cell using the UTHSCSA ImageTool v3.00 software.

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

5

Binding assay - 2x104 PC12 cells were seeded onto fibronectin-coated coverslips in a 24-well

plate. After 24 h of culture the cells were incubated with Sema3A or control medium for 1h,

fixed with 4% formaldehyde in phosphate buffered saline (PBS), and stained with the anti-

Flag M2 antibody (1:200 dilution; Sigma) to detect Sema3A and rhodamine-phalloidin (1:350

dilution; Molecular Probes). The goat Alexa Fluor 488 anti-mouse antibody (Molecular

Probes) was used at a dilution of 1:1000.

Semi-quantitative PCR - RNA was isolated from PC12 cells using the peqGOLD-Kit

(peqLab) according to manufacturer's instructions. Semi-quantitative PCR was performed

with gene specific primers (supplemental Table 1) as described (14). Samples were taken after

25, 30 and 35 cycles, separated by electrophoresis, and stained with ethidium-bromide. The

ratio of induction or repression was calculated from the fluorescence intensity values which

were determined using the BioDocAnalyze software (Biometra). The blocking anti-Nrp-1

antibody was directly added to the conditioned medium at a concentration of 1.25 µg/ml (15).

Hippocampal neurons from E18 rat embryos were cultured as described before (16).

Western Blot analysis - PC12 cells were lysed in 2% TritonX-100 in PBS and solubilized by

incubation at 4°C for 30 minutes. The samples were seperated by SDS-PAGE, transferred to

nitrocellulose membranes (Schleicher&Schüll), and Western blots developed using the

Vectastain ABC Kit (Vector Laboratories) according to manufactor's instructions. The

following primary antibodies were used: anti-Sema5A (1:2000), anti-Crmp2 (1:1000), and

anti-Crmp4 (1:1000) (17). The anti-Sema5A antibody was raised against the C-terminal 130

amino acids expressed in bacteria using the expression vector pQE-30 (Qiagen). Recombinant

protein was purified by affinity chromatography on Ni-NTA agarose (Qiagen) and used as

antigen to immunize rabbits (Eurogentech). Biotinylated anti-rabbit and horse-radish

peroxidase coupled anti-mouse antibodies (MoBiTec) were used at a dilution of 1:10,000. To

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

6

analyze the activation of the MAPK pathway cell lysates were incubated overnight at 4°C

with immobilized anti-phospho-p42/p44 antibody (Cell Signaling Technology). Bound

proteins were eluted with SDS sample buffer and analyzed by Western-Blot using the anti-

phospho-tyrosine antibody P-Tyr-100 (Cell Signaling Technology). Loading of comparable

amounts of protein was confirmed with an anti-α-tubulin antibody (clone 6-113-1; Sigma,).

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

7

RESULTS

Sema3A induces the extension of neurites by PC12 cells

Assays with recombinant Sema3A confirmed the presence of Sema3A-binding sites on PC12

cells (data not shown). Incubation with Sema3A for 12 h induced the extension of neurites to

a similar extent as NGF (Fig. 1A, B). The formation of neurites was seen only after prolonged

treatment with Sema3A for 12 hours but not when Sema3A was removed after one hour of

culture and replaced by normal medium (data not shown). Neurite extension in response to

Sema3A but not to NGF was completely abolished by a blocking anti-Nrp-1 antibody (Fig.

1A, B). To exculde an indirect effect of Sema3A on neurite extension by increasing the

sensitivity of PC12 cells for the low amount of endogeneously produced NGF as shown for

Sema4D (18), we treated PC12 cells with Sema3A or NGF and an inhibitor of the NGF

receptor TrkA (K-252a). The stimulation of neurite extension by NGF was completely

blocked by K-252a while the length of neurites induced by Sema3A was not affected (Fig.

1B).

Activation of the MAPK pathway by NGF is crucial for the differentiation of PC12 cells (12).

In Western blots an anti-phospho-tyrosine antibody detected a transient activation of p42/p44

MAPK in PC12 cells that was maximal at 15 min after addition of Sema3A or NGF (Fig. 1C).

No activation was detected in cells treated with control medium without Sema3A. This effect

was selective for p42/p44 MAPK as the phosphorylation of p38 was not changed by Sema3A

(data not shown). The MAPK inhibitor PD98059 (19) completely blocked the stimulation of

neurite extension by NGF and Sema3A showing that activation of MAPK is essential for the

effects of Sema3A (Fig. 1B).

Sema 3A regulates gene expression in PC12 cells and neurons

The activation of the MAPK pathway suggested that Sema3A may induce neurites not only

by its effects on the cytoskeleton but also by regulating transcription. To address this question

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

8

in the absence of obvious target genes for Sema3A, we monitored the response to Sema3A by

using cDNA microarrays. PC12 cells were incubated for 12 hours with Sema3A or control

medium, RNA isolated, and reverse-transcribed cDNA hybridized to two cDNA microarrays

with largely non-overlapping sets of 7500 human (array 1) and 3500 mouse genes of known

function (array 2) (20). Of the 2681 (array 1) and 3306 genes (array 2) expressed in PC12

cells Sema3A regulated the expression of 130 (array 1: 97 up- and 49 downregulated) and 146

genes (array 2: 50 up- and 80 downregulated), respectively (supplemental Tables 2 - 5).

Interestingly, several genes coding for factors known to be involved in mediating or

modulating the effects of semaphorins signaling were induced two- to fivefold by Sema3A

(supplemental Table 5). These included Plxna1 (encoding Plexin-A1), CRMP4 (Crmp4), and

GUCY1A3 (guanylate cyclase). The RNA levels for other components of the Sema3A

signalling pathway like the ligand-binding subunit Nrp-1 were unchanged. On the other hand,

the expression of several transcripts for mitochondrial proteins such as different NADH-

dehydrogenase subunits (NDUFB3, NDUFS2) was repressed between 2- and 12-fold

(supplemental Table 5). However, not all mRNAs for mitochondrial proteins were affected.

Only two (NDUFB3, NDUFS2) out of 15 transcripts coding for different subunits of NADH-

dehydrogenase (array 1: 12, array 2: 3 cDNAs) and expressed in PC12 cells were regulated by

Sema3A.

Based on the results of the microarray experiments, the regulation of selected genes by

Sema3A and NGF was analyzed by semi-quantitative PCR. These also included transcripts,

like Crmp2 or Sema5a, that were not present on the microarrays. The semi-quantitative PCR

confirmed that expression of Plxna1, Crmp2, Crmp4, and Gucy1a3 was induced 2- to 8-fold

by Sema3A while that of Sema5a and Ndufb3 was decreased. Although the extent of

induction or repression differed from the microarray hybridization data, the regulation of all

transcripts analyzed was confirmed by PCR (Table 1; Fig. 2A). Sema5a was the only among

10 semaphorin genes monitored whose expression was regulated by Sema3A and was

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

9

strongly down-regulated. Addition of a blocking antibody for Nrp-1 inhibited the effect of

Sema3A on the expression of all genes tested (Table 1).

The expression level of several mRNAs (Crmp2, Crmp4, Nck, Vegfa) showed similar changes

after treatment with Sema3A or NGF. These transcripts may respond to a signalling pathway

activated by both Sema3A and NGF. Alternatively, the changes in their expression may be a

consequence of neuronal differentiation. By contrast, Gucy1a3, Ndufb3, Pdhx, Plexna1, and

Sema5a did not respond to NGF and, thus, are specific for the response to Sema3A (Table 1).

To confirm that the increase in mRNA levels is also reflected at the protein level, PC12 cells

were cultured for 16h in medium with or without Sema3A and analyzed by Western blot.

Incubation with Sema3A strongly increased Crmp2 and Crmp4 and reduced Sema5A

expression (Fig. 2B). The expression of α-tubulin was used as a control and showed no

changes. These results confirm that the regulation of gene expression by Sema3A can be

detected both at the RNA and the protein level.

To investigate whether Sema3A is able to regulate gene expression not only in a cell line but

also in neurons, cultures of hippocampal neurons isolated from E18 rat embryos were

incubated at 4 days in vitro with Sema3A for 12 h. A comparison of expression levels to

neurons cultured in control medium by semiquantitative PCR confirmed that all analyzed

genes were regulated as described for PC12 cells and differed only in the ratios of induction

or repression (Fig. 2A; Table 1).

Mitochondrial ROS production is required for Sema3A-induced neurite extension

Interestingly, Sema3A reduced the levels of 17 transcripts encoding mitochondrial proteins

(Table 1, supplemental Table 2-5). The repression of one of these, Ndufb3, was also

confirmed in hippocampal neurons. Mitochondria are the most important source of ROS

production (21). ROS are involved in different signalling pathways and can be accompanied

by changes in mitochondrial metabolism (22, 23). The regulation of several transcripts

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

10

encoding mitochondrial proteins suggested an involvement of ROS production in the response

to Sema3A. To test this possibility, PC12 cells were incubated with Sema3A or NGF and the

production of ROS inhibited by rotenone or MPP+. For these experiments, a concentration of

the inhibitors was chosen that did not induce apoptosis (supplemental Fig. S1) (24).

Pharmacological inhibition of ROS production completely blocked the extension of neurites

in response to Sema3A while it did not interfere with neurite induction by NGF (Fig. 3A, B).

Incubation with the radical scavenger NAC blocked the extension of neurites in response to

Sema3A but not to NGF (Fig. 3).

DISCUSSION

In addition to its repulsive effects, Sema3A has the ability to stimulate the extension of

dendrites by cortical neurons (2, 6). Here we show that PC12 cells can serve as a model

system to dissect the pathways that mediate the stimulatory effect of Sema3A. Sema3A is as

potent as NGF in the induction of neurite extension by PC12. This effect was seen only after

prolonged incubation with Sema3A suggesting that, in contrast to the collapsing activity of

Sema3A, the stimulation of neurite extension involves effects in addition to the direct

modulation of the cytoskeleton. Our results demonstrate that Sema3A has long term effects by

regulating gene expression and identify some of its targets. Gene expression in PC12 cells is

probably regulated through MAPKs, as Sema3A selectively activated the p42/p44 MAPK.

Prolonged treatment with Sema3A was required to induce neurite extension but did not result

in a sustained activation of p42/p44 MAPK, indicating that additional pathways are involved

in the response to Sema3A.

The Sema3A-responsive transcripts in PC12 cells and primary hippocampal neurons include

mRNAs for components or modulators of the Sema3A signalling pathway such as Plexin-A1,

members of the Crmp family, and guanylate cyclase. In retinal ganglion cells from Xenopus

embryos, the stimulation of translation by Netrin-1 and Sema3A through the p38 and p42/p44

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

11

MAPK pathways, respectively, is required for their effects on growth cones (11, 25, 26).

However, the identity of the transcripts involved and how they contribute to the response to

axon guidance signals remains unknown. Stimulation of translation via the MAPK pathway is

required for the resensitization of axons that lose their responsiveness over time in a netrin-1

gradient (26). A similar feedback pathway may be involved in the response to Sema3A and

include the increased expression of Sema3A receptor subunits and other components of the

signaling pathway. Sema3A stimulates endocytosis and the redistribution of the Sema3A

receptor to vesicles in sensory growth cones (27). The endocytosis of membrane-bound

proteins is the first step in the degradation of activated receptors. An increased production of

Plexin-A1 and Crmps could be a mechanisms to replenish degraded receptor subunits and

components of the signalling cascade to sustain the responsiveness of cells to Sema3A. The

intracellular concentration of cyclic nucleotides determines the response to guidance signals

(7). High cGMP concentrations convert the repulsion of axons by Sema3A to an attraction.

An increased production of guanylate cyclase would, therefore, also promote the extension of

neurites.

The ability of cGMP to determine the direction of the response to Sema3A suggests that the

pathways mediating repulsion and attraction have at least some components in common.

Although many proteins have been identified that interact directly or indirectly with

semaphorin receptors, it is likely that additional components remain to be identified. Here we

identify a novel target of Sema3A and show that ROS production by mitochondria is required

for Sema3A-dependent neurite extension. Sema3A may directly regulate genes encoding

mitochondrial proteins through MAPKs as shown for cytokines (28). Alternatively, the down-

regulation may represent an indirect effect of Sema3A and reflect a response to the increase in

ROS production which can be accompanied by changes in mitochondrial metabolism (23).

The effects of Sema3A on the cytoskeleton are mediated in part by small GTPases (1, 29).

Activation of the Sema3A pathway changes the balance of Rho and Rac activity leading to the

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

12

collapse of growth cones (1). Rho and Rac also regulate the extension and retraction of

neurites (29). Active Rac promotes extension while Rho activation induces retraction. Rac

down-regulates Rho through the stimulation of ROS production (22). ROS inactivate the low-

molecular-weight protein tyrosine phosphatase LMW-PTP by oxidizing its catalytic residue

leading to an increase in tyrosine phosphorylation and activation of p190RhoGAP (30, 31).

Stimulation of mitochondrial ROS production by Sema3A might inhibit Rho activity which

would favor neurite extension.

In summary, the identification of Sema3A target genes not only suggests a role for the

regulation of gene expression in the response to axon guidance signals but also allows the

identification of possible new components of the signalling pathways mediating their effects.

This approach allowed us to reveal mitochondrial ROS production as a component of the

Sema3A signalling pathway.

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

13

REFERENCES

1. Fiore, R., and Püschel, A. W. (2003) Front. Biosci. 8, 484-499

2. Polleux, F., Morrow, T., and Ghosh, A. (2000) Nature 404, 567-573

3. Mikule, K., Gatlin, J. C., de la Houssaye, B. A., and Pfenninger, K. H. (2002) J.

Neurosci. 22, 4932-4941

4. Terman, J. R., Mao, T., Pasterkamp, R. J., Yu, H.-H., and Kolodkin, A. L. (2002) Cell

109, 887-900

5. Gu, C., Rodriguez, E. R., Reimert, D. V., Shu, T., Fritzsch, B., Richards, L. J.,

Kolodkin, A. L., and Ginty, D. D. (2003) Dev. Cell 5, 45-57

6. Fenstermaker, V., Chen, Y., Ghosh, A., and Yuste, R. (2004) J. Neurobiol. 58, 403-

412

7. Song, H., Ming, G., He, Z., Lehmann, M., McKerracher, L., Tessier-Lavigne, M., and

Poo, M. (1998) Science 281, 1515-1518

8. Atwal, J. K., Singh, K. K., Tessier-Lavigne, M., Miller, F. D., and Kaplan, D. R.

(2003) J. Neurosci. 23, 7602-7609

9. Bagnard, D., Sainturet, N., Meyronet, D., Perraut, M., Miehe, M., Roussel, G., Aunis,

D., Belin, M. F., and Thomasset, N. (2004) Mol. Cell. Neurosci. 25, 722-731

10. Sakai, T., Furuyama, T., Ohoka, Y., Miyazaki, N., Fujioka, S., Sugimoto, H.,

Amasaki, M., Hattori, S., Matsuya, T., and Inagaki, S. (1999) J. Biol. Chem. 274,

29666-29671

11. Campbell, D. S., and Holt, C. E. (2003) Neuron 37, 939-952

12. Vaudry, D., Stork, P. J., Lazarovici, P., and Eiden, L. E. (2002) Science 296, 1648-

1649

13. Zanata, S. M., Hovatta, I., Rohm, B., and Püschel, A. W. (2002) J. Neurosci. 22, 471-

477

14. Ruan, H., Miles, P. D., Ladd, C. M., Ross, K., Golub, T. R., Olefsky, J. M., and

Lodish, H. F. (2002) Diabetes 51, 3176-3188

15. Bagnard, D., Vaillant, C., Khuth, S. T., Dufay, N., Lohrum, M., Püschel, A. W., Belin,

M. F., Bolz, J., and Thomasset, N. (2001) J. Neurosci. 21, 3332-33341

16. Bradke, F., and Dotti, C. G. (1999) Science 283

17. Franken, S., Junghans, U., Rosslenbroich, V., Baader, S. L., Hoffmann, R.,

Gieselmann, V., Viebahn, C., and Kappler, J. (2003) J. Biol. Chem.. 278, 3241-3250

18. Fujioka, S., Masuda, K., Toguchi, M., Ohoka, Y., Sakai, T., Furuyama, T., and

Inagaki, S. (2003) Biochem. Biophys. Res. Commun. 301, 304-310

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14

19. Pang, L., Sawada, T., Decker, S. J., and Saltiel, A. R. (1995) J. Biol. Chem.. 270,

13585-11358 13588

20. Schwamborn, J., Lindecke, A., Elvers, M., Horejschi, V., Kerick, M., Rafigh, M.,

Pfeiffer, J., Prullage, M., Kaltschmidt, B., and Kaltschmidt, C. (2003) BMC Genomics

4, 46

21. Boveris, A., Oshino, N., and Chance, B. (1972) Biochem. J. 128, 617-630

22. Chiarugi, P., and Cirri, P. (2003) Trends Biochem.. Sci. 28, 509-514

23. Nemoto, S., Takeda, K., Yu, Z. X., Ferrans, V. J., and Finkel, T. (2000) Mol. Cell.

Biol. 20, 7311-7318

24. Hartley, A., Stone, J. M., Heron, C., Cooper, J. M., and Schapira, A. H. (1994) J.

Neurochem.. 63, 1987-1990

25. Forcet, C., Stein, E., Pays, L., Corset, V., Llambi, F., Tessier-Lavigne, M., and

Mehlen, P. (2002) Nature 417, 443-447

26. Ming, G. L., Wong, S. T., Henley, J., Yuan, X. B., Song, H. J., Spitzer, N. C., and

Poo, M. M. (2002) Nature 417, 411-418

27. Fournier, A. E., Nakamura, F., Kawamoto, S., Goshima, Y., Kalb, R. G., and

Strittmatter, S. M. (2000) J. Cell Biol. 149, 411-422

28. Puigserver, P., Rhee, J., Lin, J., Wu, Z., Yoon, J. C., Zhang, C. Y., Krauss, S., Mootha,

V. K., Lowell, B. B., and Spiegelman, B. M. (2001) Mol. Cell 8, 971-982

29. Luo, L. (2000) Nature Rev. Neurosci. 1, 173-180

30. Nimnual, A. S., Taylor, L. J., and Bar-Sagi, D. (2003) Nat. Cell Biol. 5, 236-241

31. Xu, D., Rovira, II, and Finkel, T. (2002) Dev. Cell 2, 251-252

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

15

FIGURE LEGENDS

FIG. 1. Sema3A induces the extension of neurites by PC12 cells. (A, B) Incubation with

NGF (100ng/mL) or Sema3A for 12 hr induces the extension of neurites by PC12 cells. A

blocking anti-Nrp-1 antibody prevents the induction of neurites by Sema3A but not by NGF.

(B) PC12 cells were incubated with NGF or Sema3A and DMSO, a blocking anti-Nrp-1

antibody, the TrkA inhibitor K-252a (3nM), or the MAPK inhibitor PD98059 (0.05mM) for

12 h, stained with rhodamine-phalloidin and the total length of neurites extended per cell

determined. (C) PC12 cells were treated for 15 minutes, 1 h, or 12 h with Sema3A, NGF or

control medium. Active p42/44 MAPK was immunoprecipitated with an antibody specific for

phosphorylated p42/p44 and analyzed by Western blot using an anti-phospho-tyrosine

antibody. The amount of tubulin was used as a control for equal loading of the gel.

FIG. 2. Sema3A regulates expression of CRMP2, -4 and Sema5A. (A) PC12 cells were

cultured for 12 h in medium containing Sema3A (+ Sema3A) or control medium (- Sema3A).

RNA was isolated after 12 h and used for semiquantitative PCR for the indicated genes. The

PCR product after 25 cycles are shown. The mRNA for α-tubulin was used as control. (B)

PC12 cells were cultured for 12 h in medium containing Sema3A (+ Sema3A) or control

medium (- Sema3A) and the expression of the indicated proteins analyzed by Western blot.

The amount of α-tubulin was not affected by Sema3A.

FIG. 3. Mitochondrial ROS production is required for neurite induction by Sema3A. (A,

B) Treatment of PC12 cells with the mitochondrial complex I (NADH-CoQ reductase)

inhibitors rotenone (20nM) and MPP+ (1µM) or the radical scavenger NAC blocked the

induction of neurites by Sema3A but not by NGF.

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

16

TABLE 1

Sema 3A regulates gene expression in PC12 cells and hippocampal neurons.

PC12 cells or hippocampal neurons were cultured for 12 h in medium containing Sema3A,

NGF, or control medium. RNA was isolated and used for semiquantitative RT-PCR. The

ratios of the mRNA amounts in treated and control cells is listed. The value for Actb was 1.1

(the amount of RNA was identical in both samples) and the transcript for β-Actin was used as

a control. Addition of a blocking anti-Nrp-1 antibody (+ α-Nrp-1) abolished the effects of

Sema3A on gene expression. N/A not analyzed.

Transcript (Protein) PC12

+ Sema3A

PC12 + Sema3A

+ α-Nrp-1

PC12

+ NGF

Neurons

+ Sema3A

Actb (β-Actin) 1.1 (± 0.3) 1.0 (± 0.1) 1.2 (± 0.2) 1.0 (± 0.3)

Vegfa (VEGF-A) 2.0 (± 0.2) 1.1 (± 0.1) 2.5 (± 0.4) 1.7 (± 0.6)

Crmp2 (Crmp2) 8.0 (± 1.1) 1.2 (± 0.3) 9.6 (± 1.2) 9.0 (± 3.1)

Crmp4 (Crmp4) 2.0 (± 0.6) 0.9 (± 0.1) 4.3 (± 0.8) 5.0 (± 1.8)

Plxna1 (Plexn-A1) 5.0 (± 1.6) 1.3 (± 0.1) 1.1 (± 2.1) 5.9 (± 2.8)

Gucy1a3 (Guanylate cyclase 1) 1.7 (± 0.3) 1.1 (± 0.2) 1.0 (± 0.2) 1.7 (± 0.5)

Cacna1c (L-Type calciumchannel)

-4 (± 0.5) 1.2 (± 0.3) - 3.1 (± 0.6) -3.2 (± 1.3)

Sema5a (Sema 5A) -2 (± 0.4) 1.3 (± 0.3) 1.1 (± 0.1) N/A

Nck1 (Nck) - 1.6 (± 0.3) 0.8 (± 0.1) -3.2 (± 0.9) - 1.4 (± 0.8)

Ndufb3 (NADH dehydrogenase) -5.3 (± 1.2) 1.2 (± 0.3) -1.1 (± 0.3) - 2.3 (± 0.9)

Pdhx (Pyruvat dehydrogenase) -5.5 (± 0.9) - 0.8 (± 0.2) 1.2 (± 0.4) - 2.6 (± 0.7)

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

0

5

10

15

20

25

30

35

-

+S

ema3

A

+N

GF

+S

ema3

A

+N

GF

+S

ema3

A

+N

GF

+S

ema3

A

+N

GF

A+ NGF + Sema 3A

+ α

NR

P- α

NR

P

B

C

α-Nrp1 K-252a PD98059

Phospho p42/p44

Tubulin

15m 1h 12h

+NGF15m 1h 12h 15m 1h 12h

+Sema3A -Sema3A

Figure 1

Neu

rite

leng

th (µ

m)

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Sema5A

Crmp 4

Crmp 2

Tubulin

- +

Sema5A

Crmp 4

Crmp 2

Tubulin

BA Sema3A-

Sema3A

+

Figure 2

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

- Sema 3A + Sema 3A

+ R

oten

one

- R

oten

one

A B

0

5

10

15

20

25

-

+S

ema3

A

+S

ema3

A

+N

GF

+S

ema3

A

+N

GF

+S

ema3

A

+N

GF

+Rotenone +MPP+ +NAC

Figure 3

Neu

rite

leng

th (

µm

)

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

1

SUPPLEMENTAL DATA

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Microarray hybridization. RNA was isolated from PC12 cells using the peqGOLD-Kit

(peqLab) following the manufacturer's instructions. DNA microarrays were produced and

hybridized as described previously (1). Briefly, cDNA was synthesized with oligo-dT primers

(0.5 µg/µl) and a nucleotide mix containing 0.4 mM dUTP, 0.6 mM dTTP, 1 mM dCTP, 1

mM dGTP, 1 mM dATP. The cDNA was labelled with Cy5 (cDNA from cells treated with

Sema3A) or Cy3 (cDNA from control cells) and hybridized to the microarrays overnight at

65°C. These conditions were previously shown to allow the hybridization of microarrays with

cDNA prepared from other mammalian species (1). Data from scanned arrays and signal

ratios were obtained using the GenePix software package (Axon Instruments) (1). We

included various quality control parameters (e.g. diameter of the spot > 60 mm; intensity over

local background > 2.5; for details see 1). DNA spots of bad quality or areas of the array with

obvious defects were flagged manually. Spots which did not pass the quality criteria were

excluded from the analysis. After an intensity-dependent normalization (2), significantly

regulated genes were determined based on a confidence value of 96% (p-value < 0.04) and a

threshold of 2 for upregulation (induction) and –2 for downregulation (at least two-fold

repression).

Cleaved caspase-3 assay. PC12 cells grown for 24 hours on fibronectin-coated coverslips

were treated with rotenone (20nM and 40µM) or DMSO for 12h. Cells were fixed in 3%

paraformaldehyde and the activation of caspase-3 detected using an antibody specific for

active caspase-3 antibody according to manufactor's instructions (Cell Signaling Technology).

The Alexa Fluor 488 anti rabbit antibody (Molecular Probes) was used as secondary antibody.

In addition, the cells were stained with rhodamine-phalloidin and Hoechst 33258 (Molecular

Probes).

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

2

SUPPLEMENTAL FIGURE LEGENDS

FIG. S1. Induction of apoptosis by rotenone. Treatment of PC12 cells with DMSO or 20nM

rotenone for 12 hours does not induce apoptosis, as indicated by the absence of a signal for

caspase-3 activation. By contrast, incubation with 40µM rotenone for 12h results in the

induction of apoptosis as indicated by a strong signal for cleaved caspase-3 in most cells.

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3

SUPPLEMENTAL TABLE 1

Primers used for semi-quantitative PCR

Transcript Primer

Actb AAACTGGAACGGTGAAGGC GCTGCCTCAACACCTCAAC

Vegfa TGTACCTCCACCATGCCAAGT TTCCTGCAGCCTGGCTCA

Crmp2 GGATGTCTGTCATTTGGGATAAAG TGAGCCTTCCGTGACATGCAA

Crmp4 TGACCGAGGCCTATGAAAAGTGG TTCCAGAGAGCTGCAGATCTCCA

Plxna1 AGAAGGTGAGTGGCAATGGATGC AGATTCTGGTGGACCTGGCAAA

Gucy1a3 AATTGCGGCAGGTGTCCCA TGATGCCGCTAAATGTCTGGTT

Cacna1c CCTTAGCAATCTATATTCCCTTTCCG AACACCGTCAGCATGGCGAA

Sema5a CGGTACCCTAGTATTCATCATAATTGTT CGGATCCCAGAGGTACCAGCAGCAGTC

Nck1 GAATGGTGGAAATGCAGGAAAATC TTCTACACGAGATGCACTGCCTAT

Ndufb3 TCCCTTCGAATCATCGAACAGT TCCAAATACAATATCCTGGGTGCC

Pdhx TCGAGGGGTCTTCACTAAAGAG TGCTGAGAGAGTGCTTGGAGGA

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4

SUPPLEMENTAL TABLE 2

Regulated genes from array 1

The complete list of all genes that were found to be regulated on arrray 1 (human) is shown.

Regulated genes were determined as described in material and methods with an intensity-

dependent normalization and a p-value of 0.04. Down-regulated genes (Ratio < 1) are shown

in green, up-regulated (Ratio > 1) in red.

GenBankAcc. No.

Norm. Ratioof Medians

M60828 keratinocyte growth factor 0,09U72355 Hsp27 ERE-TATA-binding protein (HET) 0,10

AF093419 multi PDZ domain protein MUPP1 0,17U82328 pyruvate dehydrogenase complex protein X 0,19L27476 ZO-2 0,19

AF047183 NADH-ubiquinone oxidoreductase subunit CI-B12 0,20AF000571 KvLQT1 0,22M32373 arylsulfatase B 0,22

AF057036 acetylcholinesterase collagen-like tail subunit 0,22X14046 CD37 0,22U02020 pre-B cell enhancing factor 0,22

AF055993 mSin3A associated polypeptide p30 0,26X55110 neurite outgrowth-promoting protein 0,2633088 FANCF 0,26

AJ004832 neuropathy target esterase 0,2633541 stathmin 2 0,26

D83781 Nup160 0,26AF025438 Opa-interacting protein OIP2 0,26

X60708 dipeptidyl peptidase IV 0,26AF004668 Sia alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase 0,26

243687 Transaminase A 0,28AB008430 FERM, p63RhoGEF 0,28AL009266 RNA-binding protein 9 0,29

U01120 glucose-6-phosphatase 0,31U46569 aquaporin-5 0,31

AB011141 KIAA0569 0,31M30185 cholesteryl ester transfer protein 0,31X03100 HLA-SB(DP) 0,31M38180 3-beta-hydroxysteroid dehydrogenase 0,31

AF004884 neuronal calcium channel alpha 1A subunit isoform A-1 0,31Y00644 FcRII 0,31X79888 AUH 0,31

AB002369 KIAA0371 0,32M31013 nonmuscle myosin heavy chain (NMHC) 0,32

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

5

M22632 mitochondrial aspartate aminotransferase 0,32Z15114 protein kinase C gamma 0,32U84404 E6-AP/ubiquitin-protein ligase 0,32206827 RNA-binding protein 9 0,32

AF059611 nuclear matrix protein NRP/B 0,37AF060502 peroxisome assembly protein PEX10 0,37

U47413 cyclin G1 0,37X52943 ATF-a 0,37U90841 SSX4 0,37

AF026029 poly(A) binding protein II 0,37AJ223953 Securin 0,37D87074 KIAA0237, Rim3 0,37U88964 HEM45 0,37

AB020710 KIAA0903, alpha actinin 1 0,37S80310 acidic epididymal glycoprotein homolog 0,37X79444 endonuclease G 0,37X55122 GATA-3 transcription factor 0,39

AB018278 KIAA0735 0,40Z26308 isoform 1 gene for L-type calcium channel 0,40

AF117106 IGF-II mRNA-binding protein 1 0,40X17576 nck 0,40

AB020628 KIAA0821 0,40Z50781 leucine zipper protein 0,40X79781 Rab-35 0,41D43948 KIAA0097 0,44U57961 hypothetical protein CG003 0,44S79895 cathepsin O2 0,44

AB007891 KIAA0431 0,44AF048849 erythroid differentiation and denucleation factor 1 0,44AF090989 E6TP1 0,44AF004849 PKY protein kinase 0,44AB020629 KIAA0822 0,44AB000509 TRAF5 0,44M33519 HLA-B-associated transcript 3 (BAT3) 0,44M23294 beta-hexosaminidase beta-subunit (HEXB) 0,44212791 DKFZP586M1523 protein 0,44D13315 lactoyl glutathione lyase 0,44375979 hypothetical protein FLJ10759 0,44X67697 HE2 0,44

AF050640 NADH-ubiquinone oxidoreductase NDUFS2 0,44AF000982 dead box, X isoform (DBX) 0,44AF018253 receptor activator of nuclear factor-kappa B (RANK) 0,44

L08187 cytokine receptor (EBI3) 0,44X54486 C1-inhibitor 0,44

AB014554 KIAA0654 0,44X15875 cAMP response element (CRE-BP1) binding protein 0,44M58525 catechol-O-methyltransferase 2,24X92110 hcgVIII 2,24

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

6

M83554 CD30 2,2449822 gamma actin 2,24

211215 FBX09 2,32L19183 MAC30 2,34X59841 PBX3 2,34X76770 poly(A)polymerase 2,36

AB001928 cathepsin V 2,36U43746 breast cancer susceptibility (BRCA2) 2,40

AF041254 Tim44 2,40D55636 smallest subunit of ubiquinol-cytochrome c reductase 2,50267541 hypothetical protein FLJ20303 2,52289794 C12 Orf2 2,52U43672 IL-1Rrp 2,52

AF019382 mannose-binding protein-A pseudogene 2,52D49489 protein disulfide isomerase-related protein P5 2,52U59185 putative monocarboxylate transporter 2,52135010 ARHGAP4, RhoGAP4 2,61M59305 atrial natriuretic peptide clearance receptor 2,61U19718 microfibril-associated glycoprotein 2,61X15187 tra1 2,64

AF006464 muscle specific tyrosine kinase receptor 2,64AJ011733 synaptogyrin 4 2,67L40407 thyroid receptor interactor 2,67347484 hypothetical protein MGC 4248 2,67

AF057164 organic cation transporter OCTN2 2,67AF039916 CD39L2 2,67M34181 cAMP-dependent protein kinase 2,71M36821 GRO-gamma 2,89M62783 alpha-N-acetylgalactosaminidase 2,89Y15723 soluble guanylyl cyclase 2,95X68486 A2a adenosine receptor 3,00U55885 paraoxonase 3,04U25849 red cell-type low molecular weight acid phosphatase (ACP1) 3,04X60188 ERK1 3,06

AF093118 UP50 3,31D17652 HBp15/L22 3,31D87969 CMP-sialic acid transporter 3,31M81652 semenogelin II 3,33M17446 Kaposi's sarcoma oncogene fibroblast growth factor 3,36U43374 normal keratinocyte mRNA 3,36

AF104118 urotensin II 3,36M15796 cyclin 3,3828150 Crmp 4, dihydropyrimidase like 3 3,94

AF022795 TGF beta receptor associated protein-1 3,96M19720 L-myc 4,9423344 adenovirus 5 E1A binding protein 6,22

L14812 retinoblastoma related protein (p107) 6,46L40400 Zap3 14,49

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

7

SUPPLEMENTAL TABLE 3

Regulated genes from array 2

The complete list of all genes that were found to be regulated on arrray 2 (mouse) is shown.

Regulated genes were determined as described in material and methods with an intensity-

dependent normalization and a p-value of 0.04. Down-regulated genes (Ratio < 1) are shown

in green, up-regulated (Ratio > 1) in red.

GenBankAcc. No.

Norm. Ratioof Medians

AA123238 Ksp-cadherin (Cdh16) 0,08AI195976 cathepsin D 0,18AI226667 long-chain acyl-CoA dehydrogenase 0,20AA105999 protein tyrosine kinase (BSK) 0,20AA498281 lamin B 0,23AI196274 ARF4 0,34AI173974 mSTI1 0,41AA544796 homer-3 0,42W80115 TWIK-1 K+ channel 0,42

AA105730 sodium bicarbonate cotransporter 0,43AA271821 carbonic anhydrase I (CAI) 0,43W81922 Trithorax protein 0,46W40884 Six1 0,46

AI227078 CD98 heavy chain 0,48AA143988 lymphoid enhancer binding factor 1 0,49AA111369 Mpv17 0,49W78306 ventricular alkali myosin light chain 0,51W34620 prorenin-converting enzyme (mK13b) 0,51W12577 troponin C 0,51

AA154020 homeodomain-interacting protein kinase 1 0,51AI173490 elongation factor 2 (ef-2) 0,53W12009 putative G-protein (GP-1) 0,54W29590 neural cell adhesion molecule (NCAM) 0,54W98015 thymine-DNA glycosylase TDGb isoform 0,54

AI173194 musashi-1 gene for RNA-binding protein 0,54W81741 serum inducible kinase (SNK) 0,55W63822 homeobox-containing protein (Hox-1.11) 0,55W13561 Jagged 2 0,56

AI256513 bone morphogenetic protein. 0,57W30609 elongation factor-1 alpha (MS1) 0,57

AA462767 Vgr-1 0,57

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

8

AI227253 fatty acid transport protein 5 0,57AI116455 clathrin-associated AP-2 complex AP50 subunit 0,57AI265256 prothrombin 0,58AI226714 glutathion peroxidase 0,58W12364 aspartic protease-like protein 0,59

AA049107 selenoprotein W (mSelW) 0,59AA044475 p45 NF-E2 related factor 2 (Nrf 2) 0,59W97011 sox-4 0,59W29596 30kDa adipocyte complement-related protein Acrp30 0,60

AA462692 quaking type I (QKI) 0,60W08839 cytokeratin No. 19 0,61W18045 schwannoma-associated protein (SAM9) 0,61W41435 Cyp4a-12 0,62

AI119342 microsomal expoxide hydrolase (Eph1) 0,62AI194997 ribosomal protein L5 0,62W09918 serine proteinase inhibitor (SPI3) 0,62

AI119645 nuclear dual specificity kinase T-Sty (sty) 0,62AA028727 Supt4h 0,62AA260192 G-protein-coupled receptor, 2 (Edg2 1,63AI227199 selenophosphate synthetase 2 1,63AA691413 myosin-I beta 1,63AA049343 unc-18 homologue 1,63W42226 cysteine-rich intestinal protein (CRIP) 1,63

AA030317 gamma-actin 1,64W41934 neuronal protein 4.1 1,64W75828 Ymp 1,64

AI195703 gamma-glutamylcysteine synthetase 1,64AI121141 67-kDa type II keratin 1,65W14486 c-H-ras gene 1,66

AI226909 MPS1 1,66AI195175 Cux 1,67AI156808 alpha-actin 1,68AA060392 uterine-specific proline-rich acidic protein 1,69AI196909 stearoyl-CoA desaturase (SCD2) 1,69AI286393 initiation factor eIF-4AI 1,69AI046562 lactate dehydrogenase-X 1,70AA261176 p162 protein 1,70AA420175 ecotropic viral integration site 2 (Evi-2) ORF 1,70AA726944 Flt4 ligand J7 1,70AA388870 CD1 integrin alpha v subunit 1,70AA511105 Tat-interacting protein TIP30 1,70AI131697 keratin type II (EndoA) 1,71AI226771 heterogenous nuclear ribonucleoprotein A2 1,71W97013 syndecan-1 (synd-1) 1,71

AI226750 t-complex protein (Tcp-1x) 1,71AI197742 elav-type RNA-binding protein 1,72AI119515 argininosuccinate synthetase (Ass) 1,72AA754882 IAP homolog A (MIHA) 1,73

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

9

AI266986 ferrochelatase 1,74AA691759 CXC chemokine (angie2) 1,74AA793641 putative pheromone receptor (VR4) 1,75AA726333 apg-2 1,76AI151912 phospholipase C-alpha (PLC-alpha) 1,78AI267136 diazepam-binding inhibitor 1,78AA734490 PXMP1-L (PMP69, P70R) 1,79AA097740 uroguanylin mRNA, complete cds. 1,80AI118978 epidermal keratin subunit. 1,81AA269747 pyruvate carboxylase 1,81AI195406 urate oxidase 1,81AA389479 translocase of inner mitochondrial membrane (Tim44) 1,82W75612 ras-GTPase-activating protein SH3-domain binding protein 1,82

AI119496 ornithine aminotransferase 1,82AI151889 lipoprotein lipase 1,83AA793036 vascular endothelial growth factor 1,83AA596919 BCL-W (Bcl-w) 1,83AI196905 cytochrome P-450IIIA 1,85W83259 exostosis protein (EXT2) 1,86

AA682155 PCTAIRE-3 mRNA encoding protein kinase. 1,86AA038864 E1B 19K 1,89AI131649 adrenomedullin precursor 1,90W13596 rat translocon-associated protein delta homolog 1,90

AA107505 interleukin 1 receptor accessory protein 1,90AA204026 CAAT-box binding protein NF-YA 1,90AI225725 Mus musculus chromosome 24p3 gene, partial cds. 1,90W30091 periplakin (ppl) 1,91

AI256517 microsomal triglyceride transfer protein 1,92W99873 cystatin B (Stfb) 1,92

AI115052 ribonucleotide reductase M2 subunit 1,92AA111666 deoxyribonuclease I 1,92AA109060 rck for protein kinase 1,93W89518 calpactin I heavy chain (p36) 1,96

AA290052 2-5 A synthetase L2 1,97W20834 alpha-actinin-2 associated LIM protein 1,97

AA098166 PlGF 1,97AA458182 CDK-activating kinase assembly factor p36 1,98AI226861 aromatic L-amino acid decarboxylase 1,99AA014525 26S proteasome regulatory subunit 8 2,03AI151808 CD44 2,04AI157294 lactate dehydrogenase 1 2,05AI255192 plexin 1 2,06AA108219 Adam2 2,06AI195699 glutathione S-transferase class mu (GST1-1) 2,07AI196079 beta-galactoside binding lectin 2,07W30343 heme oxygenase 1 2,09

AI255272 Cytochrom P450 2A5 2,10AI265508 type 1 procollagen C-proteinase enhancer protein 2,11

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

10

AA270005 calreticulin 2,12W59352 cytohesin 1 2,15

AI196475 tra1 2,15W57230 thrombospondin-4 2,19W59207 myelin basic protein 2,20

AI256506 putative RNA helicase RCK 2,23W47723 focal adhesion kinase (Fadk) 2,25

AI255902 cytosolic thymidine kinase 2,29AA754968 tryptophan hydroxylase (Tph) 2,35AI115557 proteasome 26S subunit ATPase 3, interacting protein 2,37AA509756 gamma2-adaptin (G2ad) 2,46AI226687 glutathione S-transferase class M5 2,50AA389076 gamma-actin 2,54AA003450 RNA binding protein TIAR 2,57AI195559 Wiscott-Aldrich Syndrome protein homolog (N-3AP1) 2,65AI121195 connexin 31.1 3,00W75537 GOS2-like protein 3,11

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

11

SUPPLEMENTAL TABLE 4

Distribution of regulated genes

Using the SOURCE database (3) all regulated genes from the cDNA microarrays were

grouped into the different functional classes shown here. Only those genes were taken into

account that clearly fall into one of the classes.

Category percentage

Apoptosis 1.3%

Cell-adhesion and cell-cell contact 3.8%

Cell cycle 0.8%

Chaperon 2.5%

Cytokine 2.5%

Cytoskeleton 11.4%

DNA/RNA binding proteins 8.4%

Extracellular matrix proteins 4.6%

Glycosylation 2.1%

Growth factors 3.4%

GTPases 3.4%

Hypothetical proteins 4.6%

Metabolism 7.2%

Oxidoreductases 9.3%

Kinases and phosphatases 6.8%

Protein degradation 5.5%

Protein synthesis 3.0%

Transcription factors 10.5%

Transporter 8.0%

Protein-protein interaction 0.8%

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

12

SUPPLEMENTAL TABLE 5

Sema 3A regulates gene expression in PC12 cells

PC12 cells were cultured for 12 h in medium containing Sema3A or control medium. RNA

was isolated after 12 h, reverse-transcribed into cDNA, labelled with Cy3 (control medium) or

Cy5 (Sema3A), and hybridized to two cDNA microarrays containing 7500 human (array 1)

and 3500 mouse genes of known function (array 2). The expression of 146 genes was

significantly regulated by Sema3A (threshold 2 for up- and –2 for down-regulation; n=; a p

>0.04). The gene name, accession number and fold regulation for selected transcripts are

listed.

Gene (encoded protein, array no.)

GenBank

accession no.

fold induction/

repression

CRMP4 (Crmp4, 1) BC039006 3.9

GUCY1A3 (Guanylat cyclase 1, 1) Y15723 3.0

Actg2 (γ-Actin, 1 and 2) AA030317 2.5

Vegfa (VEGF-A, 2) AA793036 2.0

Plxna1 (Plexin-A1, 2) AI255192 2.0

NDUFS2 (NADH-Dehydrogenase subunit, 1) AF050640 -2

CACNA1C (L-Type calcium channel, 1) Z26308 -2.5

Nck1 (Nck, 1) X17576 -2.5

NDUFB3 (NADH-Dehydrogenase subunit, 1) AF047183 -5

Cadh16 (Cadherin 16, 1) AA123238 -12.5

Pdhx (Pyruvat dehydrogenase) U82328 -5.3

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

13

SUPPLEMENTARY REFERENCES

1. Schwamborn, J., Lindecke, A., Elvers, M., Horejschi, V., Kerick, M., Rafigh, M.,

Pfeiffer, J., Prullage, M., Kaltschmidt, B., and Kaltschmidt, C. (2003) BMC Genomics

4, 46

2. Yang, Y. H., Dudoit, S., Luu, P., Lin, D. M., Peng, V., Ngai, J., and Speed, T. P.

(2002) Nucleic Acids Res. 30, e15

3. Diehn, M., Sherlock, G., Binkley, G., Jin, H., Matese, J. C., Hernandez-Boussard, T.,

Rees, C. A., Cherry, J. M., Botstein, D., Brown, P. O., and Alizadeh, A. A. (2003)

Nucleic Acids Res. 31, 219-223

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

DM

SO20

nM R

oten

one

40µ

M R

oten

one

Cleaved Caspase-3Cleaved Caspase-3/ Hoechst / Actin

Supplemental Figure 1

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Kaltschmidt and Andreas W. PüschelJens C. Schwamborn, Roberto Fiore, Dominique Bagnard, Joachim Kappler, Christian

cellsSemaphorin 3A stimulates neurite extension and regulates gene expression in PC12

published online May 20, 2004J. Biol. Chem. 

  10.1074/jbc.C400082200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2004/05/26/C400082200.DC1

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from