lable at ScienceDirect

Plant Physiology and Biochemistry 109 (2016) 199e208

Contents lists avai

Plant Physiology and Biochemistry

journal homepage: www.elsevier .com/locate/plaphy

Research article

Overexpressing Arabidopsis ABF3 increases tolerance to multipleabiotic stresses and reduces leaf size in alfalfa

Zhi Wang a, Guoxia Su a, Min Li a, Qingbo Ke b, Soo Young Kim c, Hongbing Li a,Jin Huang a, Bingcheng Xu a, Xi-Ping Deng a, Sang-Soo Kwak b, *

a State Key Laboratory of Soil Erosion and Dryland Farming on the Loess Plateau, Institute of Soil and Water Conservation, Northwest A&F University,Yangling, PR Chinab Plant Systems Engineering Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Daejeon, Republic of Koreac Department of Biotechnology, Chonnam National University, Gwangju, Republic of Korea

a r t i c l e i n f o

Article history:Received 1 August 2016Received in revised form28 September 2016Accepted 30 September 2016Available online 1 October 2016

Keywords:AlfalfaAtABF3Drought stressOxidative stress salt stressSWAP2 promoter

* Corresponding author. Plant Systems EngineerResearch Institute of Bioscience and BiotechnologYuseong-gu, Daejeon 305-806, Republic of Korea.

E-mail address: sskwak@kribb.re.kr (S.-S. Kwak).

http://dx.doi.org/10.1016/j.plaphy.2016.09.0200981-9428/© 2016 Elsevier Masson SAS. All rights re

a b s t r a c t

Arabidopsis ABSCISIC ACID-RESPONSIVE ELEMENT-BINDING FACTOR 3 (ABF3), a bZIP transcription factor,plays an important role in regulating multiple stress responses in plants. Overexpressing AtABF3 in-creases tolerance to various stresses in several plant species. Alfalfa (Medicago sativa L.), one of the mostimportant perennial forage crops worldwide, has high yields, high nutritional value, and good palat-ability and is widely distributed in irrigated and semi-arid regions throughout the world. However,drought and salt stress pose major constraints to alfalfa production. In this study, we developed trans-genic alfalfa plants (cv. Xinjiang Daye) expressing AtABF3 under the control of the sweetpotato oxidativestress-inducible SWPA2 promoter (referred to as SAF plants) via Agrobacterium tumefaciens-mediatedtransformation. After drought stress treatment, we selected two transgenic lines with high expression ofAtABF3, SAF5 and SAF6, for further characterization. Under normal conditions, SAF plants showed smallerleaf size compared to non-transgenic (NT) plants, while no other morphological changes were observed.Moreover, SAF plants exhibited enhanced drought stress tolerance and better growth under droughtstress treatment, which was accompanied by a reduced transpiration rate and lower reactive oxygenspecies contents. In addition, SAF plants showed an increased tolerance to salt and oxidative stress.Therefore, these transgenic AtABF3 alfalfa plants might be useful for breeding forage crops with enhancedtolerance to environmental stress for use in sustainable agriculture on marginal lands.

© 2016 Elsevier Masson SAS. All rights reserved.

1. Introduction

Indiscriminate development due to rapid industrialization andeconomic development has led to worsening environmentalproblems, such as global warming, desertification, soil acidification,and a loss of biodiversity. Water deficit conditions such as droughtand high salinity have become the primary environmental factorsthat limit crop growth and productivity worldwide, causing severedamage and reducing the average yields of most major crop plantsby more than 50% (Wang et al., 2003; Marris, 2008; Yoshida et al.,2010; Fujita et al., 2013; Nakashima and Yamaguchi-Shinozaki,

ing Research Center, Koreay (KRIBB), 125 Gwahak-ro,

served.

2013; Roychoudhury et al., 2013).One of themost important adjustments plantsmake in response

to stress conditions is to alter their abscisic acid (ABA) levels. ABA isa key phytohormone that plays a crucial role in plant development(including seed dormancy, germination, embryogenesis, and rootelongation and growth) and adaptation to various biotic and abioticstresses, particularly drought and salt stress (Kim et al., 2004a;Raghavendra et al., 2010; Ji et al., 2013; Cai et al., 2014; Zhanget al., 2014; Yoshida et al., 2015). ABA accumulates in plants inresponse to abiotic stress, inducing various physiological andbiochemical changes in plant cells, such as promoting guard cellclosure, reprogramming stress-responsive gene expression,enhancing the biosynthesis of functional metabolites, sugars, andlate embryogenesis abundant (LEA) proteins, and increasing anti-oxidant enzyme activity (Kim et al., 2004a; Vysotskii et al., 2013;Luo et al., 2016). Regulating the expression of genes involved inABA signaling represents an efficient way to enhance plant

Z. Wang et al. / Plant Physiology and Biochemistry 109 (2016) 199e208200

tolerance to abiotic stresses. Hence, great efforts have beenmade toinvestigate ABA metabolic pathways.

ABA-responsive element-binding factors (ABFs) are pivotalregulators of ABA signaling that are induced in vegetative tissues inresponse to ABA and osmotic stress and activate the antioxidantdefense response in plants under abiotic stress conditions (Choiet al., 2000; Kang et al., 2002; Kim et al., 2004b; Liu and Howell,2010; Wang et al., 2010; Fujita et al., 2013; Ji et al., 2013;Vysotskii et al., 2013; Luo et al., 2016). ABF subfamily genes havebeen extensively investigated in many plant species, such as Ara-bidopsis, barley, wheat, rice, tomato and potato (Casaretto and Ho,2005; Kobayashi et al., 2008; Hossain et al., 2010; Hsieh et al.,2010; Muniz Garcia et al., 2012; Muniz Garcia et al., 2014). Over-expressing AREB/ABF genes can increase plant resistance to envi-ronmental stress (Roychoudhury et al., 2013). In particular, ABF3,encoding amember of the ABF/AREB subfamily of bZIP transcriptionfactors, is induced by ABA and osmotic stresses such as water deficitand high salinity (Sirichandra et al., 2010; Fujita et al., 2013; Ji et al.,2013; Roychoudhury et al., 2013; Yoshida et al., 2015; Zandkarimiet al., 2015). ABF3 is required for normal ABA/stress responsesand is a critical factor in plant growth and productivity (Choi et al.,2000; Kim et al., 2004b). Transgenic plants harboring ArabidopsisABF3 (AtABF3), such as rice, lettuce, and Agrostis mongolica, as wellas Arabidopsis plants overexpressing this gene, exhibit enhancedtolerance to multiple stresses (including dehydration, cold, hightemperature, and oxidative stress) (Kang et al., 2002; Kim et al.,2004a; Oh et al., 2005; Abdeen et al., 2010; Choi et al., 2012).Furthermore, overexpressing ABF genes from Poncirus trifoliata andNicotiana in transgenic tobacco has shown that ABF regulatesstress-responsive genes and contributes to abiotic stress tolerance(Huang et al., 2010; Luo et al., 2016). Therefore, ABF3 can be utilizedto engineer plants with improved stress tolerance.

Alfalfa (Medicago sativa L.), a perennial legume, is one of themost important forage crops worldwide. Due to its outstandingnutritional value, strong adaptability to various environmentalconditions, and good productivity (Radovi�c et al., 2009;Wang et al.,2015), alfalfa represents a highly important crop for solving thefood, energy, and environmental problems that we are facing in the21st century. However, drought and soil salinization impose majorlimitations on alfalfa growth (Li et al., 2014; Wang et al., 2015). Tohelp alleviate yield and quality losses during alfalfa production,great efforts have been made to develop novel alfalfa cultivars withimproved adaptability to various abiotic stresses. Recent de-velopments in transgenic technology have led to the developmentof an efficient technique for alfalfa improvement. Since the firstreport of genome modification in alfalfa (Deak et al., 1986), enor-mous progress has been made in molecular breeding for enhancedtolerance to environmental stress. However, to date, there are noreports about the use of AtABF3 to enhance the adaptability of al-falfa via genetic engineering.

We previously demonstrated that the SWPA2 promoter, anoxidative stress-inducible peroxidase promoter from sweetpotato,is strongly induced by various abiotic stress treatments includingH2O2, wounding, and UV (Kim et al., 2003). The SWPA2 promoterhas been successfully applied to a variety of crops, such as sweet-potato, potato, rice, tobacco, barley, tall fescue, alfalfa, poplar, andArabidopsis (Kim et al., 2003; Seong et al., 2007; Um et al., 2007;Kim et al., 2011; Cheng et al., 2013; Chu et al., 2013; Li et al.,2014; Wang et al., 2014; Park et al., 2015). Compared to constitu-tive promoters such as the CaMV 35S promoter, genetically modi-fied plants harboring various genes under the control of theoxidative stress-inducible SWPA2 promoter exhibit better growthand resistance to environmental stresses. Therefore, the SWPA2promoter is suitable for efficiently expressing foreign genes in cellsto enhance plant tolerance to environmental stresses.

In this study, to improve the adaptability of alfalfa to deterio-rating environmental conditions, we generated transgenic alfalfaplants expressing AtABF3 under the control of the oxidative stress-inducible SWPA2 promoter (referred to as SAF plants) via Agro-bacterium-mediated transformation. We characterized the abioticstress tolerance of SAF plants at the whole plant level. Expression ofAtABF3 conferred alfalfa with enhanced resistance to MV-mediatedoxidative and salt stress, as well as drought stress. Meanwhile, theSAF plants exhibited smaller leaf size compared to non-transgenic(NT) plants.

2. Materials and methods

2.1. Plant material and growth conditions

The alfalfa (Medicago sativa L) cv. Xinjiang Daye was used togenerate transgenic plants expressing AtABF3, which were previ-ously shown to exhibit the best stress adaptability and yield per-formance among the six alfalfa cultivars examined (Wang et al.,2009). The alfalfa seeds (cv. Xinjiang Daye) were provided by Pro-fessor Bo Zhang from Xinjiang Agriculture University, China.Transgenic plants were generated under sterile conditions in Petridishes containing MS medium supplemented with 5 mg L�1 glu-fosinate ammonium (Murashige and Skoog, 1962). To evaluatestress tolerance, plantlets rooted on half-strengthMSmediumweretransferred to pots filled with equal quantities of soil and grown in agrowth chamber under a 16 h photoperiod with a light intensity of200 mmol m�2 s�1 and 60% (w/v) relative humidity at 25 �C.

2.2. Vector construction and plant transformation

A vector was generated for expressing AtABF3 (Kang et al., 2002)under the control of the oxidative stress-inducible SWPA2 promoterfrom sweetpotato (Kim et al., 2003) and containing the CaMV 35Sterminator in the binary vector pCAMBIA3300. To facilitate selec-tion of transgenic lines, the bar gene, encoding the selectablemarker phosphinothricin acetyl transferase, was inserted betweenthe CaMV 35S promoter and the 35S terminator. The resultingvector was transferred into Agrobacterium tumefaciens for use inalfalfa transformation via a freeze-thawmethod (Wise et al., 2006).

Alfalfa seeds were surface sterilized using 0.5% sodium hypo-chlorite solution and germinated on half-strength MS medium (pH5.7) under a 16/8 h light/dark cycle, with a light intensity of350 mmol m�2 s�1 and a relative humidity of 65% at 25 �C. Alfalfatransformation was performed as previously described with minormodifications (Wang et al., 2015). In brief, after 5 days of germi-nation, the hypocotyls were excised and used as explants. Thetransformed cells were selected on Schenk and Hildebrandt (SH)medium containing 2.0 mg L�1 2,4-dichlorophenoxyacetic acid(2,4-D), 0.2 mg L�1 kinetin, 250 mg L�1 cefotaxime, and 5 mg L�1

glufosinate ammonium (Schenk and Hildebrandt, 1972). Shootswere regenerated from the calli by transferring to SH mediumcontaining 1.0 mg L�1 benzylaminopurine (BAP), 0.3 mg L�1 1-naphthylaceticacid (NAA), 250 mg L�1 cefotaxime, and 5 mg L�1

glufosinate ammonium. Throughout the experiments, the cultureswere maintained in a culture room at 25 ± 2 �C under a 16 hphotoperiod. Regenerated shoots were transferred to half-strengthMS medium for rooting. The rooted plantlets were acclimated insoil in the greenhouse for 1 week and transferred to pots.

2.3. PCR analysis

Genomic DNA was extracted from alfalfa leaves as previouslydescribed (Kim and Hamada, 2005). The PCR was conducted withpurified genomic DNA in PCR premix (Cat. no. K-2012, Bioneer,

Z. Wang et al. / Plant Physiology and Biochemistry 109 (2016) 199e208 201

Korea) using two convergent primers complementary to the AtABF3gene. The amplification conditions consisted of 94 �C for 5 min (1cycle), followed by 32 cycles of 94 �C for 45 s, 60 �C for 45 s, and72 �C for 45 min, and a final extension cycle of 7 min at 72 �C. ThePCR products were separated on a 1% agarose gel, stained withethidium bromide, and visualized under UV light. All subsequentexperiments were conducted on the T0-generation of transgenicplants.

2.4. Stress treatments

Four-week-old similarly sized alfalfa plants grown at 25 �C in agrowth chamber (60% relative humidity, 16/8 h [light/dark]photoperiod with light supplied at an intensity of 150 mmol m�2

s�1) were utilized for stress tolerance analysis.Oxidative stress tolerancewas assayed using six leaf discs (8mm

diameter) collected from alfalfa plants at the same position asdescribed previously (Kwon et al., 2002). The excised leaf discswere floated on a solution containing 0.4% (w/v) sorbitol and5 mMMV, kept in the dark for 12 h to allow diffusion of MV into theleaves, and subjected to continuous light treatment (150 mmol m�2

s�1) at 25 �C. For the salt stress tolerance assay, alfalfa plants weretreated with 250 mM NaCl solution at 2 day intervals for 1 week.For drought stress treatments, water was withheld from the plants.Prior to treatment, the plants were irrigated with the same quantityof water in trays placed underneath the pots for 1 week. After 1week of drought stress treatment, the plants were re-watered andallowed to recover from the drought stress conditions.

2.5. Gene expression analysis

For transcript analysis of the targeted genes, similarly sizedplants treatedwith abiotic stress (including 5 mMMV, 250mMNaClsolution, and withholding water for 1 week) were utilized to acti-vate the SWPA2 promoter to induce AtABF3 expression. Total RNAwas extracted from leaves collected from alfalfa plants at the sameposition with TRIzol reagent (Invitrogen, Carlsbad, CA), followed byextensive treatment with RNase-free DNase I to remove anycontaminating genomic DNA. For quantitative expression analysisof AtABF3 in alfalfa, 2 mg of total RNA was used to produce first-strand cDNA following the manufacturer's instructions with a RT-PCR kit (TOPscript™ RT Dry MIX). Quantitative reverse-transcription PCR (qRT-PCR) was carried out in a fluorometricthermal cycler (DNA Engine Opticon 2, MJ Research, USA) using thefluorescent dye Ever-Green (BioFACT, Seoul, Korea) according to themanufacturer's protocol. Transcript levels were calculated relativeto the actin control. Data represent means and standard errors ofthree repeats. The gene-specific primers for the AtABF3 and actingenes used for qRT-PCR are listed in Table 1.

2.6. Relative water content

Relative water content (RWC) was measured as described byAhmad et al. (2008). The following formula was used: RWC(%) ¼ [(FW-DW)/(TW-DW)] � 100, where FW ¼ the weight offreshly collected leaves (measured immediately after collection),

Table 1Gene-specific primers used for genomic and qRT-PCR analysis.

cDNA Forward primer

AtABF3 (Genomic PCR) GGATCCATGGGGTCTAGATTAAACTTAtABF3 (qRT-PCR) ACGGCGGTGGTAACAACATBar CGGTCTGCACCATCGTCAACCActin (JQ028730.1) TCCTAGGGCTGTGTTTCCAAGT

TW¼ the turgid weight of leaves after incubation inwater for 6 h at20 �C in the light, and DW¼ the dry weight of the same leaves afterdrying at 80 �C for 48 h. RWC% was measured using the fourth fullyexpanded leaf from the shoot apical meristem.

2.7. Chlorophyll contents

The chlorophyll contents of intact fully expanded fifth leaves(from the shoot apical meristem) of individual plants weremeasured using a portable chlorophyll meter (SPAD-502, KonicaMinolta, Japan). Relative chlorophyll contents after stress treat-ments were determined compared with the chlorophyll contentsunder normal conditions (16 h photoperiod at a light intensity of100 mmol m�2 s�1 and 60% [w/v] relative humidity at 25 �C).

2.8. Ion leakage analysis

The loss of cytoplasmic solutes following MV treatment, basedon the electrical conductance of the solution, was measured withan ion conductivity meter (model 455C, Istek Co., Seoul, Korea) at a12 h interval from 0 to 24 h and compared with the total conduc-tivity of the solution following tissue destruction. The extent ofcellular damage was quantified by measuring ion leakage, which isconsidered to represent an indicator of membrane disruption.

2.9. Malondialdehyde contents

Lipid peroxidation was estimated by measuring malondialde-hyde (MDA) contents via a modified thiobarbituric acid (TBA)method (Wang et al., 2015). Approximately 0.1 g of leaf tissue wasground in 10ml of 10% trichloroacetic acid (TCA) using amortar andpestle. The homogenate was centrifuged at 10,000 rpm for 20 min.The reaction mixture (containing 2 ml of extract and 2 ml of TBA)was heated at 100 �C for 30 min, quickly cooled on ice, andcentrifuged at 10,000 rpm for 20 min. The absorbances at 450, 532,and 600 nm were determined using an ultraviolet spectropho-tometer (Spectronic, Genesys™2, USA). Three biological replicateswere performed.

2.10. Plant growth measurements

Plant growth was determined by measuring the stem lengthfrom the top of the shoot apex to the base of the stem. Various plantparts were divided and dried in an oven at 80 �C for dry weightmeasurements. Leaf area was analyzed using Image J. Five biolog-ical repeats were performed for each measurement.

2.11. Statistical analysis

The data were statistically analyzed via standard one-wayANOVA using SPSS 17. Subsequent multiple comparisons wereperformed based on the least significant difference (LSD) test;statistical significance was set at *p < 0.05 and **p < 0.01.

Reverse primer Amplicon size (bp)

GGATCCCTACCAGGGACCCGTCAATGT 1000GCTCCTTCCAGACATCATCAAC 122GTCCAGCTGCCAGAAACCCAC 443TGGGTGCTCTTCAGGAGCAA 200

Z. Wang et al. / Plant Physiology and Biochemistry 109 (2016) 199e208202

3. Results and discussion

3.1. Generation of transgenic SAF alfalfa plants

To investigate whether AtABF3 is functionally conserved in al-falfa, we transformed hypocotyls from 5-day-old alfalfa seedlingswith the binary vector pCAMBIA3300 harboring AtABF3 (Fig.1A) viaour previously described Agrobacterium-mediated transformationmethod with minor modifications (Wang et al., 2014, 2015). Usingthe bar gene as a selection marker, which confers herbicide resis-tance in plants, several putative transgenic alfalfa plants expressingAtABF3 under the control of the oxidative stress-inducible SWPA2promoter (referred to as SAF plants) were successfully generated.The in vitro regenerated putative transgenic lines were grown in agrowth chamber for 4 weeks after 1 week of acclimatization andutilized for further analysis. We verified the insertion of the AtABF3and bar genes in the transgenic lines using genome PCR confir-mation. We obtained seven independent herbicide-resistanttransgenic lines harboring integrated transgenes, whereas noamplified band was detected in NT plants (Fig. 1B).

To analyze AtABF3 transcript levels, we subjected plants fromthe seven confirmed transgenic alfalfa lines to drought stresstreatments. RNA from leaves was used for quantitative RT-PCR

Fig. 1. Development of transgenic alfalfa plants expressing AtABF3 under thecontrol of the SWPA2 promoter (SAF). (A) Diagram of the oxidative stress-inducibleSWPA2 promoter:AtABF3 construct used for alfalfa transformation; (B) Genomic DNAPCR analysis of the AtABF3 and bar genes from transgenic plants. M, 1 kb plus sizemarkers; PC, positive control; NT, non-transgenic plants; Numbers (1e7), independenttransgenic lines; (C) Quantitative RT-PCR analysis of seven transgenic lines exhibitingstable AtABF3 integration following 2 days of drought treatment. The expression levelsof AtABF3 were normalized to that of the alfalfa actin gene as the internal control. Dataare expressed as the mean ± SD of three replicates. Asterisks indicate a significantdifference between NT and SAF plants at *p < 0.05 or **p < 0.01 by t-test.

analysis with a pair of AtABF3 gene-specific primers (listed inTable 1). After withholding water for 2 days, AtABF3 expressionwasdetected in the leaves of all seven transgenic lines, but not in NTplants (Fig. 1C). Among the transgenic lines, AtABF3 was the mosthighly induced in lines SAF5 and SAF6. We therefore selected thesetwo transgenic lines for further analysis.

3.2. Morphological changes in SAF plants

SAF and NTalfalfa seedlings rooted on half-strengthMSmediumwere transferred to pots filled with equal quantities of soil in agrowth chamber to investigate the physiological characters of theseplants. Similarly sized SAF and NT alfalfa plants were selected afteracclimatization in a growth chamber for 1 week and used foranalysis. Interestingly, the expression of AtABF3 has different effectson plant growth in different crops. In the current study, after 1month of growth, all transgenic alfalfa lines were indistinguishablefrom NT plants in terms of plant height and root length (Fig. 2A).However, all SAF plants had reduced leaf size compared to NTplants (Fig. 2B): the leaf area (second to the sixth leaf from the top)of SAF5 and SAF6 plants was 0.73e0.82 and 0.67e0.78 times that ofNT plants, respectively (Fig. 2C), perhaps because AtABF3 is mainlyexpressed in vegetative tissues under abiotic stress conditions(Choi et al., 2000; Kang et al., 2002; Kim et al., 2004b; Fujita et al.,2011). We also measured the dry biomass of the aerial parts androots of the plants. As shown in Fig. 2D, the dry weights of the aerialportions of SAF5 and SAF6 were lower than that of NT plants by 41%and 45%, respectively, while there was no significant difference inroot dry weight between lines. The smaller leaf area in SAF5 and 6may help reduce the leaf transpiration rate in these plants, therebyreducing water consumption. By contrast, transgenic rice plantsexpressing AtABF3 do not exhibit obvious phenotypic changes orgrowth inhibition compared to the wild type, whereas transgenicArabidopsis plants overexpressing AtABF3 exhibit minor growthretardation (Kang et al., 2002; Oh et al., 2005). The reduced leaf sizein SAF alfalfa plants may help these plants adapt to droughtconditions.

3.3. Increased drought stress tolerance in SAF plants

Since AtABF3 is a master transcription factor that regulates theABRE-dependent expression of drought stress-responsive genes inthe ABA signaling pathway and can improve plant tolerance tomultiple environmental stresses (Kim et al., 2004a; Yoshida et al.,2010), we analyzed the stress tolerance of SAF5 and SAF6 plantsin a growth chamber compared to NT plants, including drought,salt, and oxidative stress tolerance. Before carrying out these stresstreatments, the plants were supplied with similar quantities ofwater.

For the drought tolerance assay, we subjected 1-month-old NTand SAF plants towater-withholding treatment for 7 days, followedby re-watering for 7 days. Under normal growth conditions, the SAFlines showed no obvious difference in performance compared to NTplants, except for reduced leaf size (upper panel of Fig. 3A). How-ever, after withholding water for 4 days, numerous NT leaves weredehydrated, and the NT plants wilted more quickly than SAF plants,which exhibited much less wilting under this condition (middlepanel of Fig. 3A). To allow the treated alfalfa plants to recover fromdehydration after drought treatment, the plants were re-wateredfor 1 week. Most branches of NT plants were almost withered,with little leaf recovery observed. By contrast, the SAF plants wereturgid and continued to grow normally (bottom panel of Fig. 3A).

Overexpressing AtABF3 facilitates guard cell closure to reducetranspiration, thereby increasing plant tolerance to water deficitconditions (Kang et al., 2002; Yoshida et al., 2010; Choi et al., 2012).

0

200

400

600

800

1000

1200

1400

Leaf

are

a (m

m2

)

NT SAF5 SAF6

2nd 3rd 4th 5th 6th

Leaf position

NT

SAF5

SAF6

(A)

(B)

(C)

0

20

40

60

80

100

120

NT SAF5 SAF6

Plan

t hei

ght a

nd ro

ot le

ngth

(c

m)

Root length Plant height

* *

0

0.2

0.4

0.6

0.8

1

1.2

1.4

NT SAF5 SAF6S

hoot

and

root

bio

mas

s (g

)

Root biomass Shoot biomass(D)

Fig. 2. Phenotypes of non-transgenic (NT) and transgenic (SAF) plants after 1 month of growth under normal conditions. (A) Plant height and root length; (B) Leaf phenotype;(C) Leaf area; (D) Shoot and root biomass (dry weights). Data are expressed as the mean ± SD of five biological replicates. Asterisks indicate a significant difference between NT andSAF plants at *p < 0.05 or **p < 0.01 by t-test.

(B)

(C)

(A)

** **

0

20

40

60

80

100

120

Control Drought (3 d)

Rel

ativ

e w

ater

con

tent

s (%

)

NT SAF5 SAF6NT SAF5 SAF6

Con

trol

Dro

ught

(4 d

)R

ecov

ery

(7 d

)

40

50

60

70

80

90

100

110

0 60 120 180 240

Leaf

wei

ght (

%)

Time (min)

NT

SAF5

SAF6

** **

0

20

40

60

80

100

120

140

Control Drought (3 d)

Rel

ativ

e ch

loro

phyl

con

tent

s (fo

lds) NT SAF5 SAF6

****

0

10

20

30

40

50

60

70

Control Drought (3 d)

MD

A c

onte

nts

(mm

ol/g

FW

) NT SAF5 SAF6

(D)

(E)

Fig. 3. Drought stress analysis of non-transgenic (NT) and transgenic (SAF) plants. (A) Plant growth before drought stress treatment (upper panel), after withholding water for 4days (middle panel), and after rehydration for 1 week (lower panel); (B) Relative water contents of NT and SAF plants after withholding water for 3 days; (C) Fresh weight of excisedleaves from the same position of NT and SAF plants measured at the indicated times after detachment; (D) Malondialdehyde (MDA) contents in leaves after 3 days of droughttreatment; (E) Relative chlorophyll contents of NT and SAF plants after 3 days of drought stress treatment. Data are expressed as the mean ± SD of five biological replicates. Asterisksindicate a significant difference between NT and SAF plants at *p < 0.05 or **p < 0.01 by t-test.

Z. Wang et al. / Plant Physiology and Biochemistry 109 (2016) 199e208 203

Z. Wang et al. / Plant Physiology and Biochemistry 109 (2016) 199e208204

RWC is an important indicator of the cell turgidity maintained inplants. Therefore, to further evaluate the drought stress tolerance oftransgenic alfalfa plants, we measured RWC and water loss rates inleaves of plants from the same position before and after 3 days ofwithholding water (Fig. 3B and C). The RWC in leaves of NTdecreased from approximately 92%e64% from day 0 to day 3 ofdrought stress treatment, whereas that in leaves of SAF5 and SAF6plants decreased from 91.5 to 92.2% to approximately 87.1e90.3%(Fig. 3B). In agreement with the results of RWC analysis, throughmonitoring the weight change in excised leaves at 1 h intervalsfrom 0 to 4 h, we found that the leaf water loss rates of SAF5 andSAF6 plants were significantly lower than that of NT plantsthroughout the analysis (Fig. 3C). These results indicate that over-expressing AtABF3 reduces the transpiration rates of SAF plants.These reduced transpiration rates might be an important factor inthe enhanced drought stress tolerance of these plants.

MDA, a spontaneous product of lipid peroxidation due toaccelerated reactive oxygen species (ROS) production (Hodgeset al., 1999), is a crucial indicator of the degree of cell membranedamage under stress conditions (Auer et al., 1995). Under normalconditions, the MDA contents of NT and SAF plants were similar.However, after withholding water for 3 days, higher levels of MDAwere detected in NT plants than in SAF plants (Fig. 3D). The cellmembrane damage was more serious in NT plants than in SAFplants under drought stress. These results suggest that the presenceof AtABF3 in the SAF lines inhibits or eliminates the accumulation ofROS in the cell. Indeed, lower levels of ROS might be attributed tothe regulatory effects of ABF3 on the biosynthesis of osmotic pro-tectants (Nakashima and Yamaguchi-Shinozaki, 2013). In addition,we also measured the chlorophyll contents in the leaves of eachplant. Although there was no significant difference in chlorophyllcontent in NT versus SAF plants before drought stress treatment,after three days of treatment, the two SAF lines had higher levels ofchlorophyll (4.4e9.3% reduction) than NT plants (20.3e23.4%reduction; Fig. 3E). These results indicate that the expression ofAtABF3 increases drought stress tolerance in alfalfa plants.

Extreme drought seriously threatens crop growth and produc-tivity, which poses a major limitation to growth in alfalfa (Wanget al., 2015). Expressing ABF3 improves drought tolerance inplants (Nakashima and Yamaguchi-Shinozaki, 2013). The droughttolerance of transgenic alfalfa overexpressing AtABF3 observed inthe present study is in accordance with that of other plant species,such as Arabidopsis, rice, tobacco, lettuce, and Agrostis mongolica(Kang et al., 2002; Kim et al., 2004a; Oh et al., 2005; Vanjildorj et al.,2005, 2006; Abdeen et al., 2010; Choi et al., 2012). ExpressingAtABF3 in creeping bentgrass plants also leads to enhanced droughttolerance due to increased stomatal closure and reduced water loss(Choi et al., 2012). Moreover, AtABF3 plays a vital role in plant stressresponses by regulating the expression of diverse stress-responsivegenes (Abdeen et al., 2010). Analysis of Arabidopsis abf mutantsindicated that AtABF3 helps regulate ABA-responsive and multiplestress-responsive genes, such as LEA protein genes, which enhancecellular adaptation to water stress (Yoshida et al., 2010). LEA pro-teins might help maintain water balance and macromolecule sta-bility in plant cells under drought conditions (Nakashima andYamaguchi-Shinozaki, 2013). Our results suggest that over-expressing AtABF3 represents a useful strategy for increasingdrought stress tolerance in alfalfa plants to help stabilize cropproduction under drought stress conditions.

3.4. Enhanced salt tolerance in SAF plants

Salinization, another major limiting factor in alfalfa production,has numerous adverse effects on the yield and quality of this crop(Radovi�c et al., 2009; Wang et al., 2014). In particular, the area

affected by salinification is increasing rapidly, with an annualgrowth rate of 1.0e1.5 million ha worldwide, accounting forapproximately 10% of total land area (Sun et al., 2014). In addition todehydration and ABA treatment, AtABF3 expression is induced byhigh salinity in vegetative tissues, which may contribute to plantsalt stress tolerance (Yoshida et al., 2010). However, there are fewreports about the effects of expressing AtABF3 on plant tolerance tosalt stress.

To determine whether AtABF3 expression increases salt stresstolerance in alfalfa, we assessed the status of 4-week-old SAF andNT plants subjected to irrigation with 250 mM NaCl solution every3 days for 7 days. Under normal conditions, no obvious differenceswere observed between NT and SAF plants (upper panel of Fig. 4A).After 4 days of high salt treatment, the growth of NT plants wasseverely inhibited, and the degree of chlorosis in leaves was greaterin these plants than in SAF plants. Both SAF lines exhibited only afew slightly yellow leaves (middle panel of Fig. 4A). At day 7 of NaCltreatment, the SAF plants exhibited less damage than NT plants,which showed severe chlorosis and were almost dead (bottompanel of Fig. 4A).

To obtain further insights into the improved salt stress tolerancein transgenic AtABF3 alfalfa plants, we subjected leaves of plantsfrom the same position to 2 days of 250 mM NaCl treatment, fol-lowed by qRT-PCR. AtABF3 expressionwas not detected in NT plantsbefore or after salt stress treatment, whereas, in both SAF5 andSAF6 plants, AtABF3 expression was clearly induced by salt stresstreatment (Fig. 4B). Furthermore, notable AtABF3 expression wasdetected in SAF plants even under normal conditions, perhaps dueto the growth environment and the strong sensitivity of the abioticstress-inducible SWPA2 promoter. We also examined the chloro-phyll and MDA contents of the plants as biochemical and physio-logical parameters of salt stress tolerance. Before treatment, therewas no obvious difference in chlorophyll content between NT andSAF plants. When the plants were irrigated with 250 mM NaClsolution for 3 days, the chlorophyll levels of all SAF and NT plantsdecreased. However, the SAF lines exhibited higher levels of chlo-rophyll, with only a 12.6e21.6% decline compared to normal con-ditions, whereas the chlorophyll level in NT plants was onlyapproximately 64.4% that under normal conditions (Fig. 4C). SinceMDA is an end product of lipid peroxidation and is an importantindicator of the extent of cell membrane damage under stressconditions (Auer et al., 1995; Hodges et al., 1999), we also measuredMDA levels to evaluate the salt stress tolerance of the plants. Under3 days of 250 mM NaCl treatment, MDA levels were significantlylower in SAF5 and SAF6 than in NT plants (Fig. 4D). Therefore, therewas a lower degree of cell membrane damage in SAF plants than inNT plants under salt stress treatment. The transgenic plants dis-played improved membrane and chlorophyll stability, indicatingthat the presence of AtABF3 can inhibit or eliminate the harmfuleffects of ROS in the cell and reduce cell membrane damage in SAFalfalfa plants. Therefore, the results demonstrate that AtABF3expression is highly effective at promoting salt stress tolerance inalfalfa plants.

Osmotic stresses, such as drought and salinity, are often inter-connected, and they induce the biosynthesis of ROS at the cellularlevel (including superoxide anion radical, hydroxyl radical, andhydrogen peroxide) (Nakashima and Yamaguchi-Shinozaki, 2013).AtABF3, a transcription factor that regulates the expression of ABA-responsive genes, plays an important role in stress responses andfunctions in osmotic stress signaling (Choi et al., 2000; Nakashimaand Yamaguchi-Shinozaki, 2013). Osmotic adjustment is animportant physiological mechanism associated with tolerance towater deficit conditions such as drought and salt stress (Pruthviet al., 2014). Transcriptome analysis of areb1 areb2 abf3 triple mu-tants revealed that AtABF3 is a master transcription factor that

**

**

**

**

0

1

2

3

4

5

6

7

8

Control 250 mM NaCl (2 d)

Rel

ativ

e ex

pres

sion

leve

ls (f

olds

)

NT SAF5 SAF6(A) NT SAF5 SAF6

250

mM

NaC

l (4

d)

Con

trol

250

mM

NaC

l (7

d)

(B)

(C)

****

0

10

20

30

40

50

60

Control 250 mM NaCl (3 d)

MD

A c

onte

nts

(mm

ol/g

FW

) NT SAF5 SAF6(D)

** **

0

20

40

60

80

100

120

Control 250 mM NaCl (3 d)Rel

ativ

e ch

loro

phyl

l co

nten

ts (f

olds

)

NT SAF5 SAF6

Fig. 4. Salt stress analysis of non-transgenic (NT) and transgenic (SAF) plants. (A) Plant growth under normal conditions (upper panel) and under 250 mM NaCl treatment for 4and 7 days (middle and lower panel, respectively). (B) Relative transcript levels of AtABF3 in leaves; (C) Relative chlorophyll contents of alfalfa plants after 3 days of salt treatment;(D) Chlorophyll contents in leaves before salt treatment and after 250 mM NaCl treatment for 4 days. Data are expressed as the mean ± SD of five biological replicates. Asterisksindicate a significant difference between NT and SAF plants at *p < 0.05 or **p < 0.01 by t-test.

Z. Wang et al. / Plant Physiology and Biochemistry 109 (2016) 199e208 205

cooperatively adjusts the expression of ABRE-dependent genesinvolved in ABA signaling under osmotic stress conditions (Yoshidaet al., 2010). Transgenic peanuts expressing AtABF3 exhibitimproved salinity tolerance due to the regulatory effects of AtABF3on oxidative stress-related gene expression (Pruthvi et al., 2014).Here, analysis of MDA contents revealed that both SAF5 and SAF6exhibited reduced ROS biosynthesis and increased ROS scavengingability under salt and drought stress compared to NT plants. Theseresults suggest that the improved membrane and chlorophyll sta-bility in transgenic SAF lines could be attributed to the role ofAtABF3 in osmotic adjustment, providing evidence that ABF3, amember of the bZIP family, plays an important role in activatingROS scavenging machinery (Pruthvi et al., 2014).

3.5. Increased oxidative stress in SAF plants

To investigate the effects of AtABF3 expression on oxidativestress tolerance in alfalfa, we exposed leaf discs (from the sameposition) of 1-month-old SAF and NT plants to 5 mMMV solution forvarious periods of time (0, 12, and 24 h). MV is a non-selectiveherbicide that causes massive ROS bursts in plants, which in-crease membrane permeability and even lead to cell death. Thedegree of cellular damage based on solute ion leakage is used as an

indicator of membrane stability against oxidative stress (Bowleret al., 1991).

After exposure to 5 mMMV solution for 24 h, distinct differencesin the extent of damage were observed between SAF and NT plants.Serious chlorosis was detected in leaf discs fromNT plants, whereasleaf discs of the SAF lines remained green, with little necrosis(Fig. 5A). Quantitative measurements revealed that the ion leakagecontents of lines SAF5 and SAF6 (15.6% and 17.0%, respectively)were significantly lower than that of NT plants (32.4%) at 12 h ofMVtreatment (Fig. 5B). The SAF plants maintained better membranestability than NT plants under MV-mediated oxidative stress con-ditions. We then carried out qRT-PCR to survey AtABF3 transcriptlevels in leaves induced by treatment with the radical-generatingchemical MV for 12 h. AtABF3 expression levels were significantlyhigher in the two SAF lines than in NT plants under both normaland oxidative stress conditions (Fig. 5C). After MV-mediatedoxidative stress treatment, AtABF3 expression levels increasedapproximately 2-fold in SAF plants compared to normal conditions.These results indicate that the expression of AtABF3 increasesoxidative stress resistance in SAF alfalfa plants compared to NTplants.

As mentioned above, AtABF3 is involved in removing excess ROSand is an important regulator of the oxidative stress defense

Fig. 5. Effect of methyl viologen (MV)-mediated oxidative stress on the leaves ofnon-transgenic (NT) and transgenic (SAF) plants. (A) Differential visible damage inleaves after 5 mM MV treatment for 24 h; (B) Relative membrane permeability at 0, 12,and 24 h of MV treatment. Percent relative membrane permeability was calculatedusing 100% to represent values obtained after autoclaving. (C) Transcript levels ofAtABF3 in leaves treated with 5 mM MV for 12 h. Data are expressed as the mean ± SDof five biological replicates. Asterisks indicate a significant difference between NT andSAF plants at *p < 0.05 or **p < 0.01 by t-test.

Z. Wang et al. / Plant Physiology and Biochemistry 109 (2016) 199e208206

mechanism in plants. Maintaining a proper balance of ROS is crucialfor plant growth (Kim et al., 2004a). Excessive ROS usually lead tocellular oxidative damage and even death. In addition to droughtand salt tolerance, transgenic Arabidopsis plants overexpressingAtABF3 show better performance under oxidative stress than wild-type plants (Kim et al., 2004a; Abdeen et al., 2010). Similarly, in the

current study, we found that SAF plants exhibited improvedoxidative stress tolerance, as previously observed in other plantspecies, suggesting that AtABF3 increases oxidative stress toleranceand regulates multiple abiotic stress pathways in alfalfa. Theenhanced drought and salt stress tolerance observed in SAF plantsmight be attributed to the improved oxidative stress tolerancedetected in these plants.

4. Conclusion

Alfalfa, the “queen of the forages”, is an important perennialcrop plant that can potentially be used to help solve the currentfood, energy, and environmental problems. Developing novel al-falfa cultivars with increased adaptability to various abiotic stressesis crucial, and recent advances in transgenic technology have pro-vided us with an efficient approach for alfalfa improvement (Wanget al., 2015). In this study, we successfully generated and charac-terized two independent transgenic alfalfa lines expressing AtABF3under the control of the oxidative stress-inducible SWPA2 promoterthrough Agrobacterium-mediated transformation. The SAF plantsexhibited smaller leaves than NT plants, which may be helpful forimproving drought tolerance. Expression of AtABF3 conferred al-falfa plants with enhanced tolerance to multiple abiotic stresses,including drought, salt, and oxidative stress, as well as herbicideresistance, which contributed to the better growth of these plantsunder stress conditions. In addition, herbicide resistance is a usefultrait for field management of alfalfa. However, since the increasedabiotic stress tolerance observed in the present study was limitedto alfalfa at the seedling stage, the transgenic lines should befurther analyzed under field conditions, including semi-arid lands.To our knowledge, this study represents the first example of alfalfaimprovement using AtABF3. The results demonstrate that AtABF3 isa useful genetic resource for developing alfalfa plants withenhanced resistance to various abiotic stresses. The SAF alfalfaplants generated in this study should be useful for sustainableagriculture on marginal lands, such as desertification areas and theLoess plateau in China.

Author contributions

S.-S. Kwak and Z. Wang: conceived and designed the experi-ments. Z. Wang, G. Su, and M. Li: performed the experiments. H. Li,Q. Ke, B. Xu, and J. Huang: analyzed the data. X.-P. D and S.Y. Kim:contributed reagents/materials/analysis tools. Z. Wang and S.-S.Kwak: wrote the paper.

Acknowledgments

This work was supported by the KRIBB Initiative program, theKorea-China International Collaboration Project, National ResearchFoundation of Korea, the 111 project of the Ministry of Education(no. B12007), the Special-Fund of Scientific Research Programs ofState Key Laboratory of Soil Erosion and Dryland Farming on theLoess Plateau (A314021403-C5), and the Doctoral ScientificResearch Foundation of Northwest A&F University (2452015341),China.

References

Abdeen, A., Schnell, J., Miki, B., 2010. Transcriptome analysis reveals absence ofunintended effects in drought-tolerant transgenic plants overexpressing thetranscription factor ABF3. BMC Genom. 11, 69.

Ahmad, R., Kim, M., Back, K.-H., Kim, H.-S., Lee, H.-S., Kwon, S.-Y., Murata, N.,Chung, W.-I., Kwak, S.-S., 2008. Stress-induced expression of choline oxidase inpotato plant chloroplasts confers enhanced tolerance to oxidative, salt, anddrought stresses. Plant Cell Rep. 27, 687e698.

Z. Wang et al. / Plant Physiology and Biochemistry 109 (2016) 199e208 207

Auer, T., Khoschsorur, G.A., Rabl, H., Iberer, F., Petutschnigg, B., Wasler, A.,Tscheliessnigg, K.H., 1995. Detection of lipid peroxidation products by malon-dialdehyde (MDA-TBA reaction) in organ transplantation. Transpl. Proc. 27,2749e2751.

Bowler, C., Slooten, L., Vandenbranden, S., De Rycke, R., Botterman, J., Sybesma, C.,Van Montagu, M., Inz�e, D., 1991. Manganese superoxide dismutase can reducecellular damage mediated by oxygen radicals in transgenic plants. EMBO J. 10,1723e1732.

Cai, Z., Liu, J., Wang, H., Yang, C., Chen, Y., Li, Y., Pan, S., Dong, R., Tang, G., Barajas-Lopez Jde, D., Fujii, H., Wang, X., 2014. GSK3-like kinases positively modulateabscisic acid signaling through phosphorylating subgroup III SnRK2s in Arabi-dopsis. Proc. Natl. Acad. Sci. U. S. A. 111, 9651e9656.

Casaretto, J.A., Ho, T.H., 2005. Transcriptional regulation by abscisic acid in barley(Hordeum vulgare L.) seeds involves autoregulation of the transcription factorHvABI5. Plant Mol. Biol. 57, 21e34.

Cheng, Y.J., Kim, M.D., Deng, X.P., Kwak, S.S., Chen, W., 2013. Enhanced salt stresstolerance in transgenic potato plants expressing IbMYB1, a sweetpotato tran-scription factor. J. Microbiol. Biotechnol. 23, 1737e1746.

Choi, H., Hong, J., Ha, J., Kang, J., Kim, S.Y., 2000. ABFs, a family of ABA-responsiveelement binding factors. J. Biol. Chem. 275, 1723e1730.

Choi, Y.-S., Kim, Y.-M., Hwang, O.-J., Han, Y.-J., Kim, S.Y., Kim, J.-I., 2012. Over-expression of Arabidopsis ABF3 gene confers enhanced tolerance to drought andheat stress in creeping bentgrass. Plant Biotechnol. Rep. 7, 165e173.

Chu, H., Jeong, J.C., Kim, W.J., Chung, D.M., Jeon, H.K., Ahn, Y.O., Kim, S.H., Lee, H.S.,Kwak, S.S., Kim, C.Y., 2013. Expression of the sweetpotato R2R3-type IbMYB1agene induces anthocyanin accumulation in Arabidopsis. Physiol. Plant. 148,189e199.

Deak, M., Kiss, G., Koncz, C., Dudits, D., 1986. Transformation of Medicago byAgrobacterium-mediated gene transfer. Plant Cell Rep. 5, 97e100.

Fujita, Y., Fujita, M., Shinozaki, K., Yamaguchi-Shinozaki, K., 2011. ABA-mediatedtranscriptional regulation in response to osmotic stress in plants. J. Plant Res.124, 509e525.

Fujita, Y., Yoshida, T., Yamaguchi-Shinozaki, K., 2013. Pivotal role of the AREB/ABF-SnRK2 pathway in ABRE-mediated transcription in response to osmotic stressin plants. Physiol. Plant. 147, 15e27.

Hodges, D.M., DeLong, J.M., Forney, C.F., Prange, R.K., 1999. Improving the thio-barbituric acid-reactive-substances assay for estimating lipid peroxidation inplant tissues containing anthocyanin and other interfering compounds. Planta207, 604e611.

Hossain, M.A., Cho, J.I., Han, M., Ahn, C.H., Jeon, J.S., An, G., Park, P.B., 2010. TheABRE-binding bZIP transcription factor OsABF2 is a positive regulator of abioticstress and ABA signaling in rice. J. Plant Physiol. 167, 1512e1520.

Hsieh, T.H., Li, C.W., Su, R.C., Cheng, C.P., Sanjaya, Tsai, Y.C., Chan, M.T., 2010.A tomato bZIP transcription factor, SlAREB, is involved in water deficit and saltstress response. Planta 231, 1459e1473.

Huang, X.S., Liu, J.H., Chen, X.J., 2010. Overexpression of PtrABF gene, a bZIP tran-scription factor isolated from Poncirus trifoliata, enhances dehydration anddrought tolerance in tobacco via scavenging ROS and modulating expression ofstress-responsive genes. BMC Plant Biol. 10, 230.

Ji, X., Liu, G., Liu, Y., Zheng, L., Nie, X., Wang, Y., 2013. The bZIP protein from Tamarixhispida, ThbZIP1, is ACGT elements binding factor that enhances abiotic stresssignaling in transgenic Arabidopsis. BMC Plant Biol. 13, 151.

Kang, J.Y., Choi, H.I., Im, M.Y., Kim, S.Y., 2002. Arabidopsis basic leucine zipperproteins that mediate stress-responsive abscisic acid signaling. Plant Cell 14,343e357.

Kim, J.B., Kang, J.Y., Kim, S.Y., 2004a. Over-expression of a transcription factorregulating ABA-responsive gene expression confers multiple stress tolerance.Plant Biotechnol. J. 2, 459e466.

Kim, K.-Y., Kwon, S.-Y., Lee, H.-S., Hur, Y., Bang, J.-W., Kwak, S.-S., 2003. A noveloxidative stress-inducible peroxidase promoter from sweetpotato: molecularcloning and characterization in transgenic tobacco plants and cultured cells.Plant Mol. Biol. 51, 831e838.

Kim, S.-H., Hamada, T., 2005. Rapid and reliable method of extracting DNA and RNAfrom sweetpotato, Ipomoea batatas (L). Lam. Biotechnol. Lett. 27, 1841e1845.

Kim, S., Kang, J.Y., Cho, D.I., Park, J.H., Kim, S.Y., 2004b. ABF2, an ABRE-binding bZIPfactor, is an essential component of glucose signaling and its overexpressionaffects multiple stress tolerance. Plant J. 40, 75e87.

Kim, Y.H., Kim, M.D., Choi, Y.I., Park, S.C., Yun, D.J., Noh, E.W., Lee, H.S., Kwak, S.S.,2011. Transgenic poplar expressing Arabidopsis NDPK2 enhances growth as wellas oxidative stress tolerance. Plant Biotechnol. J. 9, 334e347.

Kobayashi, F., Maeta, E., Terashima, A., Takumi, S., 2008. Positive role of a wheatHvABI5 ortholog in abiotic stress response of seedlings. Physiol. Plant. 134,74e86.

Kwon, S.Y., Jeong, Y.J., Lee, H.S., Kim, J.S., Cho, K.Y., Allen, R.D., Kwak, S.S., 2002.Enhanced tolerances of transgenic tobacco plants expressing both superoxidedismutase and ascorbate peroxidase in chloroplasts against methyl viologen-mediated oxidative stress. Plant Cell Environ. 25, 873e882.

Li, H., Wang, Z., Ke, Q., Ji, C.Y., Jeong, J.C., Lee, H.-S., Lim, Y.P., Xu, B., Deng, X.-P.,Kwak, S.S., 2014. Overexpression of codA gene confers enhanced tolerance toabiotic stresses in alfalfa. Plant Physiol. Biochem. 83, 31e40.

Liu, J.X., Howell, S.H., 2010. bZIP28 and NF-Y transcription factors are activated byER stress and assemble into a transcriptional complex to regulate stressresponse genes in Arabidopsis. Plant Cell 22, 782e796.

Luo, P., Shen, Y., Jin, S., Huang, S., Cheng, X., Wang, Z., Li, P., Zhao, J., Bao, M., Ning, G.,2016. Overexpression of Rosa rugosa anthocyanidin reductase enhances tobacco

tolerance to abiotic stress through increased ROS scavenging and modulation ofABA signaling. Plant Sci. 245, 35e49.

Marris, E., 2008. Water: more crop per drop. Nature 452, 273e277.Muniz Garcia, M.N., Giammaria, V., Grandellis, C., Tellez-Inon, M.T., Ulloa, R.M.,

Capiati, D.A., 2012. Characterization of StABF1, a stress-responsive bZIP tran-scription factor from Solanum tuberosum L. that is phosphorylated by StCDPK2in vitro. Planta 235, 761e778.

Muniz Garcia, M.N., Stritzler, M., Capiati, D.A., 2014. Heterologous expression ofArabidopsis ABF4 gene in potato enhances tuberization through ABA-GAcrosstalk regulation. Planta 239, 615e631.

Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bio assayswith tobacco tissue cultures. Physiol. Plant. 15, 473e497.

Nakashima, K., Yamaguchi-Shinozaki, K., 2013. ABA signaling in stress-response andseed development. Plant Cell Rep. 32, 959e970.

Oh, S.J., Song, S.I., Kim, Y.S., Jang, H.J., Kim, S.Y., Kim, M., Kim, Y.K., Nahm, B.H.,Kim, J.K., 2005. Arabidopsis CBF3/DREB1A and ABF3 in transgenic rice increasedtolerance to abiotic stress without stunting growth. Plant Physiol. 138, 341e351.

Park, S.C., Kim, Y.H., Kim, S.H., Jeong, Y.J., Kim, C.Y., Lee, J.S., Bae, J.Y., Ahn, M.J.,Jeong, J.C., Lee, H.S., Kwak, S.S., 2015. Overexpression of the IbMYB1 gene in anorange-fleshed sweetpotato cultivar produces a dual-pigmented transgenicsweet potato with improved antioxidant activity. Physiol. Plant. 153, 525e537.

Pruthvi, V., Narasimhan, R., Nataraja, K.N., 2014. Simultaneous expression of abioticstress responsive transcription factors, AtDREB2A, AtHB7 and AtABF3 improvessalinity and drought tolerance in peanut (Arachis hypogaea L. PLoS one 9,e111152.

Radovi�c, J., Sokolovi�c, D., Markovi�c, J., 2009. Alfalfa-most important perennial foragelegume in animal husbandry. Biotechnol. Anim. Husband. 25, 465e475.

Raghavendra, A.S., Gonugunta, V.K., Christmann, A., Grill, E., 2010. ABA perceptionand signalling. Trends Plant Sci. 15, 395e401.

Roychoudhury, A., Paul, S., Basu, S., 2013. Cross-talk between abscisic acid-dependent and abscisic acid-independent pathways during abiotic stress.Plant Cell Rep. 32, 985e1006.

Schenk, R.U., Hildebrandt, A.C., 1972. Medium and techniques for induction andgrowth of monocotyledonous and dicotyledonous plant cell cultures. Can. J. Bot.50, 199e204.

Seong, E.S., Guo, J., Kim, Y.H., Cho, J.H., Lim, C.K., Hyun Hur, J., Wang, M.H., 2007.Regulations of marker genes involved in biotic and abiotic stress by over-expression of the AtNDPK2 gene in rice. Biochem. Biophys. Res. Commun. 363,126e132.

Sirichandra, C., Davanture, M., Turk, B.E., Zivy, M., Valot, B., Leung, J., Merlot, S., 2010.The Arabidopsis ABA-activated kinase OST1 phosphorylates the bZIP transcrip-tion factor ABF3 and creates a 14-3-3 binding site involved in its turnover. PLoSone 5, e13935.

Sun, Y.F., Niu, L.C., Song, F.Q., 2014. Progress on salinization soil restoration method.Int. J. Ecol. 3, 30e36.

Um, M.O., Park, T.I., Kim, Y.J., Seo, H.Y., Kim, J.G., Kwon, S.-Y., Kwak, S.-S., Yun, D.-J.,Yun, S.J., 2007. Particle bombardment-mediated transformation of barley withan Arabidopsis NDPK2 cDNA. Plant Biotechnol. Rep. 1, 71e77.

Vanjildorj, E., Bae, T.W., Riu, K.Z., Kim, S.Y., Lee, H.Y., 2005. Overexpression of Ara-bidopsis ABF3 gene enhances tolerance to drought and cold in transgenic lettuce(Lactuca sativa). Plant Cell Tiss. Org. 83, 41e50.

Vanjildorj, E., Bae, T.W., Riu, K.Z., Yun, P.Y., Park, S.Y., Lee, C.H., Kim, S.Y., Lee, H.Y.,2006. Transgenic Agrostis mongolica Roshevwith enhanced tolerance to droughtand heat stresses obtained from Agrobacterium-mediated transformation. PlantCell Tiss. Org. 87, 109e120.

Vysotskii, D.A., De Vries-Van Leeuwen, I.J., Souer, E., Babakov, A.V., De Boer, A.H.,2013. ABF transcription factors of Thellungiella salsuginea: structure, expressionprofiles and interaction with 14-3-3 regulatory proteins. Plant Signal Behav. 8,e22672.

Wang, W.-B., Kim, Y.-H., Lee, H.-S., Kim, K.-Y., Deng, X.-P., Kwak, S.-S., 2009. Analysisof antioxidant enzyme activity during germination of alfalfa under salt anddrought stresses. Plant Physiol. Biochem. 47, 570e577.

Wang, W., Vinocur, B., Altman, A., 2003. Plant responses to drought, salinity andextreme temperatures: towards genetic engineering for stress tolerance. Planta218, 1e14.

Wang, Y., Gao, C., Liang, Y., Wang, C., Yang, C., Liu, G., 2010. A novel bZIP gene fromTamarix hispida mediates physiological responses to salt stress in tobaccoplants. J. Plant Physiol. 167, 222e230.

Wang, Z., Ke, Q., Kim, M.D., Kim, S.H., Ji, C.Y., Jeong, J.C., Lee, H.S., Park, W.S.,Ahn, M.J., Li, H., Xu, B., Deng, X., Lee, S.H., Lim, Y.P., Kwak, S.S., 2015. Transgenicalfalfa plants expressing the sweetpotato Orange gene exhibit enhanced abioticstress tolerance. PLoS one 10, e0126050.

Wang, Z., Li, H., Ke, Q., Jeong, J.C., Lee, H.S., Xu, B., Deng, X.P., Lim, Y.P., Kwak, S.S.,2014. Transgenic alfalfa plants expressing AtNDPK2 exhibit increased growthand tolerance to abiotic stresses. Plant Physiol. Biochem. 84, 67e77.

Wise, A.A., Liu, Z., Binns, A.N., 2006. Three methods for the introduction of foreignDNA into Agrobacterium. In: Wang, K. (Ed.), Agrobacterium Protocols. HumanaPress, Totowa, NJ, pp. 43e54.

Yoshida, T., Fujita, Y., Maruyama, K., Mogami, J., Todaka, D., Shinozaki, K., Yama-guchi-Shinozaki, K., 2015. Four Arabidopsis AREB/ABF transcription factorsfunction predominantly in gene expression downstream of SnRK2 kinases inabscisic acid signalling in response to osmotic stress. Plant Cell Environ. 38,35e49.

Yoshida, T., Fujita, Y., Sayama, H., Kidokoro, S., Maruyama, K., Mizoi, J., Shinozaki, K.,Yamaguchi-Shinozaki, K., 2010. AREB1, AREB2, and ABF3 are master

Z. Wang et al. / Plant Physiology and Biochemistry 109 (2016) 199e208208

transcription factors that cooperatively regulate ABRE-dependent ABA signalinginvolved in drought stress tolerance and require ABA for full activation. Plant J.61, 672e685.

Zandkarimi, H., Ebadi, A., Salami, S.A., Alizade, H., Baisakh, N., 2015. Analyzing theexpression profile of AREB/ABF and DREB/CBF genes under drought and salinity

stresses in grape (Vitis vinifera L.). PLoS one 10, e0134288.Zhang, C., Bousquet, A., Harris, J.M., 2014. Abscisic acid and lateral root organ

defective/NUMEROUS INFECTIONS AND POLYPHENOLICS modulate root elon-gation via reactive oxygen species in Medicago truncatula. Plant Physiol. 166,644e658.