Current Trends in Biotechnology and PharmacyVol. 9 (3) 222-227 July 2015, ISSN 0973-8916 (Print), 2230-7303 (Online)

222

AbstractLactobacilli are well reckoned for their

technological and probiotic significance and theirexercise in dairy products for trade and industry.The present study was carried out to isolate andcharacterize Lactobacilli from various dairy andnon dairy sources of Indian origin. The isolateswere subjected to phenotypic and genotypiccharacterizations followed by partial 16SrDNAsequencing . As many as 40 isolates wereidentified as Lactobacilli and among them 14were identified as L.plantarum, 5 as L.fermentum, 5 as L. delbrueckii subsp. bulgaricus,4 L. brevis , 2 L. pentosus and 1 isolate as L.mucosae. The great diversity was found with theplace as well as source of collection.

Key Words: Lactobacilli, human feces, curd andbamboo shoots

IntroductionBelonging to the genus Lactic Acid Bacteria

(LAB), lactobacilli are characterized by theformation of lactic acid as the main end productof carbohydrate metabolism and find theirhabitats in plants or material of plant origin, silage,fermented food as well as in the oral cavities,gastrointestinal tracts (GIT), and vaginas ofhumans and animals. Also Known as the powerhouses of food industry (1) they are the mostvital groups of acid producing bacteria in thefood industry for their use as starter culturesfor dairy product sas well as they are gainingincreasing attention in the area of probiotics dueto their potential health benefits to consumer (2).

Being the most dominant microflora of fecalsamples, LAB may exist as commensalorganisms, which are adapted to intestinalenvironment (3). Since the composition of theindigenous lactoflora varies from individual toindividual, the study of new strains not onlyprovides presumptive knowledge of beneficialmicrobiota from different parts of the country,but it would also leads to development of novelprobiotic strains (4). The health attributes relatedto probiotics are known to be strain specific andare affected by the nutritional and environmentalconditions of the host. In India, there is a largediversity in the food habits of the people. Amongall the fermented foods consumed by ethnicpeople living in the sub-Himalayan regions ofIndia, it is bamboo shoots which are consumedmost (5,6). In southern part of India it is Dosa (afermented crepe or pancake made from ricebatter and black lentils) which is is widely popular.In the present study, we have targetedLactobacillus species from dairy and non dairysources for their phenotypic and genotypiccharacterization for their possible futureapplications as novel functional strains.

Materials and MethodsCultivation Conditions : Human faeces , sourdough , (dosa) batter , fermented bamboo shootsand samples of household curd(dahi) werecollected from diverse niches (as mentioned inTable 1) of India .The samples were enriched inMRS broth (Himedia Laboratories Pvt. Ltd,Mumbai, India) followed by streaking and pourplating on MRS agar under anaerobic conditions.

Phenotypic and Genotypic Characterization ofIndigenous Lactobacillus Species from Diverse

Niches of India

Kiran Thakur1*, Narendra Kumar1, Dhiraj Kumar Nanda1, and Sudhir Kumar Tomar1

National Collection of Dairy Cultures, 1Dairy Microbiology Division, National Dairy Research Institute,Karnal,Haryana,India-132001

*For Correspondence - sudhirndri@gmail.com

Characterization of Lactobacillus species

Current Trends in Biotechnology and PharmacyVol. 9 (3) 222-227 July 2015, ISSN 0973-8916 (Print), 2230-7303 (Online)

223

Isolates were phenotypically assigned to thegenus level on the basis of : cell morphology,Gram staining and catalase reaction.

Phenotypic and genotypic characterization :The putative lactobacilli isolates were furthersubjected to molecular typing methods. GenomicDNA from each isolate was prepared essentiallyfollowing the method of Pospiech and Neumann(7). Lactobacillus genus-speciûc and speciesspecific primer (Table.2) (8-12) were used forthe conûrmation of putative Lactobacillusisolates. Polymerase chain reaction (PCR) wasperformed on an EppendorfMastercycler(Hamburg, Germany) and was veriûed byelectrophoresis on 2% (w/v) agarose gel using a100 bp ladder (Bangalore Genei,Bangalore,India) as a molecular weight marker.16S rDNA gene of some representative isolateswas ampliûed using primer 7F and primer S-G-Lab-0677-R (Table 2). The purified ampliûedPCR products (20 ìL) were sent for sequencingusing primer 7F (12, 13) to obtain partialsequence of the 16S rDNA followed by analysisusing the Chromas software (version 1.45, http://www.technelysium. com.au/chromas.html).Basic Local Alignment Search Tool (BLAST)analysis was performed for similarity check withthe already available database for speciesdetermination. The phylogenetic dendrogramwas constructed by using unweighted pair-groupmethod with arithmetic averages (UPGMA) ofMEGA4.0 (Center for Evolutionary FunctionalGenomics, The Biodesign Institute, Arizona StateUniversity, Phoenix, AZ, USA).

ResultsPhenotypic and Genotypic characterization :Initially screened on the basis of microscopicexamination and catalase test, 40 isolatesappeared to belong to the Lactobacillus genusand were further characterized by biochemicaland molecular methods. All these isolatesconformed to the general phenotypiccharacteristics of genus Lactobacillus by gramstaining methods. These isolates were observedto be invariably rod shaped cells (Figure 1) ,gram-positive, catalase-negative, non motile,facultative anaerobic bacteria and were able togrow at 15°C, 2%, and 4% NaCl. The genericstatus was further conûrmed by PCR as all theisolates showed ampliûcation product ofexpected size (250 bp) using genus-speciûcprimers (Fig. 2) (2.1). Based on the phenotypiccharacteristics , the isolates were tentativelydesignated as L. plantarum(14), L.fermentum(5), L.delbrueckii subsp. Bulgaricus(5), L. brevis (4) , L.pentosus (2) and L. mucosae(1) (Figure 1). For species conûrmation speciesspecific primers were used (Fig 2) (2.2, 2.3, 2.4,2.5 & 2.6) . Further, partial sequencing of 16SrDNA was performed for representative isolates.The sequences obtained from the isolates werecompared to those of reference strains held inGenBank. Sequence data was generated forselected isolates on the basis of their origin,probiotic and technological properties (data notshown) were submitted to the GenBank underthe following Accession No.(Table 4). Thephylogenetic analysis (Figure 3.0) together with

Fig.1. Negative Staining and Gram staining showing the rod shapes of lactobacilli :A. L.acidophilus,B. L.del. bugaricus C. L. casei, D. L. plantarum , E. L.fermentum and F.L. mucosae

Kiran Thakur et al

Current Trends in Biotechnology and PharmacyVol. 9 (3) 222-227 July 2015, ISSN 0973-8916 (Print), 2230-7303 (Online)

224

Fig.2 . Genus-speciûc PCR of Lactobacillus , 100 bp ladder, Lane 1-10 are Isolates, 2.2 Species specificPCR for L. plantarum (220bp) , 100 bp ladder , 2.3 Species specific PCR for L. fermentum (337 ), 2.4Species specific PCR for L.pentosus (220bp), 2.5 Species specific PCR for L.delbrueckii (1065bp)1Kbladder, 2.6 ( 7F, S-G-Lab-0677-R Isolates selected for 16s rDNA partial sequencing

Fig. 3. Phylogenetic analysis of all isolates with reference strains of Lactobacillus using 16S r DNA sequencesalong with standard sequences obtained from database constructed using the UPGMA method by Mega 4.0software.The boxed accession numbers are taken as a reference from NCBI genbank Database for similaritycheck.

Characterization of Lactobacillus species

Current Trends in Biotechnology and PharmacyVol. 9 (3) 222-227 July 2015, ISSN 0973-8916 (Print), 2230-7303 (Online)

225

species specific PCR profile has showed thediversity in Lactobacillus species with respect totheir source of origin. Among all the isolatesobtained from various sources, L. plantarum wasthe predominant flora.

DiscussionIn this study, 40 isolates of Lactobacillus

isolated from diversified niches were identifiedby a combination of conventional and moleculartechniques. The great diversity has been foundwith respect to source of sample and within thesample. The microflora of curd from two differentregions of india , Human feces (individual toindividual ), fermented bamboo shoots (houseto house) varied significantly on the specieslevel.Lactobacillus isolates were identified byPCR amplification and partial sequencing of 16SrDNA. According to genotypic features, L.

delbrueckii subsp. bulgaricus and L. brevis wasmost dominant in the household curd fromPuducherry, a place in South India. The isolatesfrom curd possessedhomofermentative andheterofermentative characteristics as reportedpreviously by different authors (14, 15). L.pentosus and L. plantarum were prevalent inBamboo shoot and dosa batter. There are fewreports on isolation of L. plantarum, L. pentosus,L. brevisand L. fermentum, from fermentedbambooshoot products (16, 17). It was reportedthe isolation of lactobacilli from raw andfermented products like milk, curd, idli batter andpickle from Bangalore, South Indian region.According to earlier reports, occurance ofL.plantarum as a predominant species insourdough is in an agreement with our findingsas shown in (Table 3) (18). The phylogeneticanalysis has shown the close relationship

Table 1. Collection of samples from different parts of India

1 Human faeces (30) Haryana and Manipur

2 Sour dough(3) Himachal Pradesh

3 FermentedBamboo shoots(5) Manipur

4 Household curd(10) Puducherry, Kerala

5 Dosa batter(3) Delhi

Table.2 List of primers used in this study for Lactobacillus identiûcation and their properties

Target Primer sequence Annealing Product Refere5 2 – 3 2 temp. (°C) size (bp) nces

Lactobacillus genus CTCAAAACTAAACAAAGTTTCCTTGTACACACCGCCCGTCA 55 250 (8)

L. plantarum GCTGGATCACCTCCTTTCATGAGGTATTCAACTTATG 53 220 (9)

L. fermentum AATACCGCATTACAACTTTGGGTTAAATACCGTCAACGTA 50 337 (10)

L. pentosus GCTGGATCACCTCCTTTCGTATTCAACTTATTAGAACG 53 220 (9)

L. delbrueckii subsp. AAGTCTGTCCTCTGG CTGGAAAABulgaricus ATGAAGTTGTTTAAAGTAGGTA 58 1065 (11)

16s rDNA (7F, AGAGTTTGATCATGGCTCAGS-G-Lab-0677-R ) CACCGCTACACATGGAG 57 700 (12,13)

Kiran Thakur et al

Current Trends in Biotechnology and PharmacyVol. 9 (3) 222-227 July 2015, ISSN 0973-8916 (Print), 2230-7303 (Online)

226

Table.3. Identiûcation of isolates from four different samples and their Genbank Accesion Numbers

Sr. No. Source Organism Accesion no.

1 Human faeces L.fermentum KC9208182 Human faeces L.fermentum KC9208193 Bamboo shoot L. plantarum KC9208204 Human faeces L.mucosae KC9208215 Human faeces L.fermentum KC9208226 Human faeces L. del.subsp.bulgaricus KC9208237 Sourh dough L.plantraum KC9208248 Human faeces L.plantraum KC5075409 Bamboo shoot L.plantraum KC50754110 Human faeces L. del.subsp.bulgaricus KC50754211 Human faeces L.plantraum KC50754312 Sourh dough L.plantraum KC50754413 Dosa batter L.plantraum KC50754514 Human faeces L.fermentum KC507546

between L. mucosae and L. fermentum. They canbe regarded as closely related species on thebasis of similarity index also reported by(19).There are few reports on analysis ofcomposition of lactobacilli in human fecesspecifically in India. Studying complexenvironmental samples such as faeces, whichgenerally contain different bacterial species isvery interesting.Themicroflora varies in differentstages of the host’s life. Furthermore, thismicroflora is also influenced by geographicalconditions (20). Among the species characterizedfrom Human feces, L. plantarum was dominantspecies followed by L. fermentum. Later hasbeen one of predominant lactobacilli in humanintestine and vaginal tract as previously described(21).

ConclusionsThis study would pave the way to analyze

the composition of unexplored microbiota ofIndian population as well dairy and plant sources.The 16s ribosomal DNA partial sequences havebeen submitted to NCBI. This study hasculminated into identification and characteriza-tion of a number of indigenous Lactobacilli strainswhich can be further explored for functional and

technological properties and can also be adoptedfor commercial food applications.

AcknowledgementThe authors acknowledge the contribution

of National Dairy Research Institute, Karnal(India) for providing necessary funding andfellowship during the course of study.

References1. Willem, M.D.V. Systems solutions by lactic

acid bacteria: from paradigms to practice.Microbial Cell Factories , 10:S1-S2. (2011).

2. Mirzaei, H., Javadi, A. and Alimohammadi,B.O. Technological properties of candidateprobiotic Lactobacillus plantarum strainsisolated from Iranian traditional Lighvancheese . Annals of Biological Research, 3:4691-4695. (2012).

3. Tannock, G.W. A special fondness forlactobacilli. Applied EnvironmentalMicrobiology, 709:3189. (2004).

4. Khalil, R., Mahrous, H. and El-Halafawy,K.H. Evaluation of the probiotic potentialof lactic acid bacteria isolated from faecesof breast-fed infants in Egypt. AfricanJournal of Biotechnology, 6:939-949(2007).

Characterization of Lactobacillus species

Current Trends in Biotechnology and PharmacyVol. 9 (3) 222-227 July 2015, ISSN 0973-8916 (Print), 2230-7303 (Online)

227

5. Sharma, O.P. DendrocalamushamiltoniiMunro, the Himalayan miracle bamboo. In:Trivedi, M.L., Gill, B.S., Saini, S.S. (Eds.),Plant Science Research in India. Today &Tomorrow’s Printers & Publishers, NewDelhi, pp. 189 – 195.(1989).

6. Tamang, J.P. Food culture in the EasternHimalayas. Journal of Himalayan Researchand Cultural Foundation, 5:107-118. (2001).

7. Pospiech, A. and Neumann, B. A versatilequick prep of genomic DNA from Gram-positive bacteria. Trends in Genetics, 11:217–218. (1995).

8. Dubernet, S., Desmasures, N. andGueguen, M. A PCR-based method foridentiûcation of lactobacilli at the genuslevel. FEMS Microbiology Letters, 214:271–275. (2002).

9. Berthier, F. and Ehrlich, S.D. Rapid speciesidentification within two groups of closelyrelated lactobacilli using PCR primers thattarget the 16S D 23S rRNA spacer region.FEMS Microbiology Letters, 161: 97–106.(2006).

10. Dickson, E.M., Riggio, M.P. andMacpherson, L. A novel species speciûcPCR assay for identifying Lactobacillusfermentum. Journal of MedicalMicrobiology, 54: 299–303.( 2005).

11. Torriani, S., Zapparoli, G. and Dellaglio, F.Use of PCR-Based Methods for RapidDifferentiation of Lactobacillus delbrueckiisubsp.bulgaricus and L. delbrueckiisubsp.lactis. Applied and EnvironmentalMicrobiology, 65: 4351-4356.(1999).

12. Lane, D.J. 16S/23S rRNA sequencing, in:Stackebrandt E.R., Goodfellow M. (Eds.),Nucleic Acid Techniques in BacterialSystematic, John Wiley & Sons Ltd.,Chichester, UK. 115 – 175.( 1991).

13. Heilig, G. H. J., Zoetendal, E.G., Vaughan,E. E., Marteau, P., Akkermans, A. D., deVos, W. M. Molecular diversity ofLactobacillus spp. and other lactic acidbacteria in the human intestine as

determined by specific amplification of 16Sribosomal DNA. Applied and EnvironmentalMicrobiology, 68: 114–123.(2002).

14. Goyal, R., Dhingra, R., Bajpai, P. and Joshi,N. Characterization of the Lactobacillusisolated from different curd samples.African Journal of Biotechnology,11:14448-14452.( 2012).

15. Patil, M.M., Pal, A., Anand, T. and Ramana,K.V. Isolation and characterization of Lacticacid bacteria from curd and cucumber.Indian Journal of Biotechnology, 9:166-172.(2008).

16. Chen, Y., Wu, H., Liu, C., Chen, H. andYanagida, F. Isolation and characterizationof lactic acid bacteria from jiang-sun(fermented bamboo shoots), a traditionalfermented food in Taiwan. Journal of theScience of Food and Agriculture, 90: 1977–1982. (2010).

17. Mallesha, Shylaja, R, Selvakumar, D. andJagannath, J.H. Isoaltion and identificationof Lactic acid bacteria isolated from raw andfermented products and their antibacterialactivity. Recent Research in Science andTechnology, 2:42-46.( 2010).

18. Corsett, A. and Settanni, L. Lactobacilli insourdough fermentation. Food ResearchInternational, 40: 539–558. (2007).

19. Roos, S., Karner, F., Axelsson, L. andJonsson, H. Lactobacillus mucosae sp.nov., a new species with in vitro mucus-binding activity isolated from pig intestine.International Journal of Systematic andEvolutionary, 50: 251–258.( 2010).

20. Reuter, G. The Lactobacillus andBifidobacterium microflora of the humanintestine: composition and succession.Current Issues in IntestestinalMicrobiology, 2: 43–53. (2001).

21. Aroutcheva, A., Gariti, D., Simon, M., Shott,S., Faro, J., Simoes, J. A., Gurguis, A., andFaro, S. Defense factors of vaginallactobacilli. American Journal of Obstetricsand Gynecology, 2: 375–379. (2001).

Kiran Thakur et al