Mutations of K-ras Oncogene and Absence of H-ras …clincancerres.aacrjournals.org/content/clincanres/1/3/359.full.pdf · histological types of the tumor. The presence of mutations

Vol. 1, 359-365, March 1995 Clinical Cancer Research 359

3 The abbreviations used are: NSCLC, non-small cell lung carcinomas;RFLP, restriction fragment length polymorphism.

Mutations of K-ras Oncogene and Absence of H-ras Mutations in

Squamous Cell Carcinomas of the Lung1

JiItI Vachtenheim,2 Irena Hor#{225}kov#{225},

Hana Novotn#{225}, Petr Op#{225}lka,

and Helena Roubkov#{225}

Laboratory of Molecular Biology [J. V., I. H., H. N.] and Department

of Clinical Oncology [P. 0., H. R.], Institute of Chest Diseases,18071 Prague 8, Czech Republic

ABSTRACT

Mutations of the K-ras gene have been implicated in the

pathogenesis of human lung adenocarcinomas. In most stud-

ies published so far, squamous cell lung cancers harboredras mutations only exceptionally or no mutations were de-

tected at all. We have examined 141 lung tumor DNA sam-ples for mutations in codons 12, 13, and 61 of K-ras and

H-ras oncogenes. A large panel of 118 squamous cell carci-

nomas was included in the study. For K-ras codon 12, weused a sensitive two-step PCR-restriction fragment length

polymorphism method which detects < 1 % of mutated DNAin the sample. K-ras mutations were found in 17 tumors(12%; 14 in codon 12 and 3 in codon 13). Among 19 adeno-carcinomas, mutation was revealed in 7 samples (37%). Of

these, one sample harbored two point mutations in codon 12.

Nine mutational events were found in squamous cell carci-

nomas (8%, one adenosquamous carcinoma included, all incodon 12). Of four large cell carcinomas, one contained amutation. Mutant-enriched PCR products harboring muta-tions were directly sequenced. Fifteen mutational events

were G-�T transversions or G-+A transitions, one was a

G-+C transition, and one sample revealed a frameshift de-letion of one G from codon 12. Similar mutational spectrum

was found in both squamous cell carcinomas and adenocar-cinomas, suggesting similar carcinogenic pathways in both

histological types of the tumor. The presence of mutationsdid not correlate with the stage of the disease. Moreover, weanalyzed all samples for mutations in codons 12, 13, and 61of the H-ras gene. We found only one mutation in codon 12.

Thus, H-ras mutations apparently play an inferior role inlung carcinogenesis. We conclude that mutations of the K-ras oncogene can play a role in the development of not onlylung adenocarcinomas but also of a subset (about 8%) ofsquamous cell carcinomas.

INTRODUCTION

The ras genes code for small membrane-bound proteins

(p21’�) that bind and hydrolyze GTP and participate, through a

cascade of protein kinases, in transmitting signals into the flu-

cleus. Activating point mutations in genes of the ras gene family

that convert these proto-oncogenes into their transforming forms

are well documented to occur in many human tumors. Most

frequently, mutations of the c-Ki-ras-2 (K-ras) oncogene were

detected in 70-95% of pancreatic cancers (1-4), in 30-60% of

colon and rectal tumors (5-8), and in about 45% of ovarian

tumors (9). K-ras was also reported to be activated in the

neoplasms of the lung and other organs. Most of these mutations

occur in codon 12 and only a minority of mutational events is

located in codons 13 and 61. In many tumor cell types, K-ras

mutations have been suggested to play a role in the multistep

molecular pathogenesis of neoplastic transformation. For exam-

ple, in carcinomas of the colon, K-ras appears to become

mutated during the adenoma growth. Recently, although at

lower frequencies, the mutations were detected even in normal

colonic mucosa from patients suffering from the tumor (10, 1 1).

Both borderline and invasive ovarian carcinomas were also

shown mutated in K-ras (9), implying that borderline tumors

may represent a continuum between benign and invasive ovar-

ian tumors. Also, K-ras mutations were found in 2 of 16 atypical

endometrial hyperplasias, which are precursors of endometrial

carcinomas (12). Pancreatic precancerous lesions (mucous cell

hyperplasias), the presumed precursors of the pancreatic carci-

noma, have been also shown to contain K-ras mutations at high

frequencies similar to those documented for ductal type of

pancreatic carcinomas (13). All of these findings indicate that

K-ras mutations may be relatively early genetic events in the

formation of many human neoplasms.

About 80% of lung cancers are histologically classified as

NSCLC,3 comprising the two most frequent types, adenocarci-

noma and squamous cell carcinoma. It has been well docu-

mented that K-ras is mutated in a subset of lung adenocarcino-

mas. The frequency of mutations varied from 15 to 60% (14-

25). Squamous cell carcinomas of the lung were reported to

contain mutated K-ras only exceptionally. Of the 21 squamous

cell lung tumors, 2 showed activated K-ras (24) and 2 of 6 cell

lines established from squamous cell lung carcinomas contained

K-ras mutations in codon 12 (21). In earlier studies, no muta-

tions of K-ras in this type oftumor were detected (14, 17). Also,

two mutations of H-ras, both in codon 61, were detected among

36 lung squamous cell carcinomas (19). In a recent study,

however, the authors described an unusual distribution of K-ras

activating mutations in lung neoplasms, the squamous cell tu-

mors being mutated more frequently (8’38) than adenocarcino-

mas (3’22; Ref. 26). ras mutations are absent from small cell

lung carcinomas (21) and neuroendocrine neoplasms of the lung

(27). The clinical significance of K-ras mutations in lung car-

Received 9/21/94; accepted 10/21/94.t This work was supported by Grants 0072-3, 0952-3, and 2290-3 from

the Internal Granting Agency, Ministry of Health, Czech Republic (J. V.).2 To whom requests for reprints should be addressed.

Research. on August 19, 2018. © 1995 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

http://clincancerres.aacrjournals.org/

360 Mutations of K-ras in Lung Cancer

cinomas has also been investigated. Tumors harboring these

mutations were found to have a generally worse prognosis and

were associated with shortened survival (18, 26, 28).

In this work, we have undertaken the study on a large panel

of squamous cell lung carcinomas to analyze the mutations in

K-ras and H-ras oncogenes. In most studies carried out to date,

activating mutations were detected by methods that do not

enable revelation of the mutation if present in less than about

5-10% of cells (oligonucleotide hybridization, single-strand

conformation polymorphism, and direct sequencing). Here we

used a modified two-step mismatch, PCR method (29, 30) in

which the detection of mutation in <1% of the tumor cell

population is reliably accomplishable. In this method, the arti-

ficial restriction site is introduced by a mismatched primer. The

normal allele is destroyed after the first PCR step by restriction

enzyme digestion, enabling only the mutant allele to be ampli-

fled in the second PCR step (29, 30). We used this approach to

screen changes in codon 12 of the K-ras gene, which is the most

frequent mutational hot spot of ras genes in lung carcinomas

and in most of other human solid tumors. For codons 13 and 61

of K-ras and all three codons (codons 12, 13, and 61) of H-ras,

a single-step mismatch PCR assay was used. To determine the

type of mutation, the mutant-enriched PCR products were di-

rectly sequenced.

MATERIALS AND METHODS

Tissue Samples, Preparation of DNA, and Control CellLines. Fresh tumor samples were obtained from surgically

removed lungs immediately after resection. The patients were

treated at the Institute of Chest Diseases (Prague, Czech Repub-

lic) and did not receive chemotherapy or radiotherapy before

surgical resection. A fragment of tumor tissue adjacent to that

used for histopathological diagnosis was frozed in liquid nitro-

gen and stored at -75#{176}C. High molecular weight DNA was

prepared by standard techniques using proteinase K digestion

and phenol/chloroform extraction.

DNA extracted from cell lines (American Type Culture

Collection) with known mutations served as controls. SW 480

cell line contains a homozygous mutation in codon 12 of K-ras

(GGT-�GTT). In lines Calu-1 and A-427, one allele is mutated

at the same codon (GGT-�TGT and GGT-+GAT, respective-

ly). LoVo cell line harbors GGC-�GAC mutation in codon 13

of K-ras and NCI-H460 has a CAA-�CAT mutation in codon

61 of K-ras. pT24C3 plasmid was a control for the screening of

the H-ras (codon 12) mutations.

PCR. Genomic DNA (0.2 or 0.4 p.g) was amplified in

20- or 40-pA volumes in a reaction containing primers (Genset),

dNTPs (see below), 50 mM KC1, 10 mtvt Tris-HC1 (pH 8.3),

0.01% (w/v) gelatin, and 1.5 m� MgC12. For codons 12 and 13

of the K-ras, the concentration of MgC12 was 2 mr�t. Table 1

gives the primers used in amplification reactions. Final concen-

tration of primers in the reaction was 0.5 p�M except for codon

13 H-ras where the concentration 1 JiM was used. dNTPs were

at the following final concentrations: 50 p.M (K-ras, codons 12

and 13), 100 p.M (K-ras, codon 61; H-ras, codon 61), or 200 p.M

(H-ras, codons 12 and 13). One unit of Taq polymerase (Perkin

Elmer’Cetus) was added to the 40-pA reaction in hot start set-

tings. Amplification mixtures were cycled 30 or 35 cycles in a

thermal cycler (Perkin Elmer/Cetus), each cycle at 94#{176}Cfor 1

mm followed by 1 or 2 mm at the annealing temperature and 1

or 2 mm at 72#{176}C.For codon 12 of K-ras, samples were ampli-

fled 16 cycles in the first step and then diluted 400 times in the

second-step amplification. For single-step PCR screening of

K-ras codon 12 mutations, primers for the second step were

used (Table 1). The annealing temperatures were as follows:

55#{176}Cfor K-ras, codon 12 (both steps); 52#{176}Cfor K-ras, codons13 and 61; 60#{176}Cfor H-ras, codons 12 and 13; and 40#{176}Cfor

H-ras, codon 61.

The template for codon 13 of K-ras amplification was a

176-base pair PCR product amplified from genomic DNA by

use of non-mismatched primers (K125 and K12A; Ref. 21) and

diluted 10,000 times in the second amplification. For screening

of codon 61 of H-ras, an approach described by the same

authors was used: PCR product obtained by amplification of

genomic DNA with primers 5’-ATGAGAGGTACCAGG�A-

GAG and 5’-TCACGGGGTflTCACCTGTACT served as a tem-

plate for amplification.

Restriction Enzyme Cleavage and Gel Electrophoresis.After amplification, reaction products were incubated with the

appropriate restriction enzyme (Table 1) for a minimum of 4 h

(3 units enzyme/sample) and electrophoresed through native 8%

polyacrylamide gel or 3% NuSieve 3:1 agarose gel (FMC),

stained in ethidium bromide, and photographed. Restriction

enzymes were purchased from Fermentas (MvaI, BsuRI, BclI,

and MspI), Sigma (HphI and A1wNI), and New England Biolabs

(Earl). All samples showing mutant-specific band were pro-

cessed twice to exclude a possible error introduced by Taq

polymerase.

DNA Sequencing. For sequencing, the mutant allele-

enriched PCR amplification products with mutations in codon

12 of the K-ras gene were purified by Magic PCR Preps kit

(Promega) without restriction enzyme cleavage. The samples

with mutations in codon 13 of K-ras were prepared for sequenc-

ing as follows: 176-base pair template (above) was first ampli-

fled with the antisense primer as in Table 1 and a sense primer

(5’-TATFATAAGGCGTGCTGAAAATGA) having one mis-

match in order to destroy the native BsuRI site, cleaved with

BsuRI, diluted and amplified again with primers shown in Table

1 for K-ras, codon 13. The PCR product was then purified on a

Minicon 30 (Amicon) microconcentrator.

Double-stranded PCR products were sequenced by Cir-

cumVent (New England Biolabs) orfinol (Promega) sequencing

kits according to the conditions specified by the suppliers.

32P-labeled antisense primer (second step, Table 1) and the

sense primer (Table 1) were used for sequencing PCR products

to detect mutations in codon 12 and codon 13 of the K-ras gene,

respectively.

Statistical Methods. Two-tailed Fisher’s exact test was

used to examine the correlation of data (stage of the disease,

histology, and presence or absence of mutations).

RESULTS

Mismatch PCR.RFLP Method for the Detection of Mu-tations in K-ras and H-ras Genes. A RFLP created through

mismatched primers is a rapid and efficient method to detect

point mutations and has been applied to the study of activation



- N � 1� �ri ‘0 N 00 C’s 2 � � � Z

a

b

--- - �$#{149}‘ H’-� -� �

4- Uncut4- Mutant

4- Wild

b...� � � ‘-� �J � \ . .

�“e � -‘.�tS’d�led�.a#{224}�”1

Clinical Cancer Research 361

Table 1 Summary of PCR primers, amplification products, restriction enzymes, and diagnostic restriction fragments for the K-ras and H-ras

genes

Primers

PCRproduct

(6p)(’

Restriction

enzyme

Mutant-specific

fragment (bp)

Wild allele-specific

fragment (bp)

K-ras

Codon 12 s:

a:

5 :

a:

5�ACTGAATATAAACTTGTGGTAGTTGGACCTt�

5’-TCAAAGAATGGTCCTGCACC (first step)

5’-ACTGAATATAAACTTGTGGTAGTTGGACCT

5’-TCAAAGAATGGTCCTGGACC (second step) 157 MvaI 142 113

Codon 13 5:

a:5’-TATTATAAGGCCTGCTGAAAATGA

5’-TATCGTCAAGGCACTCTTGCCTAGG 83 BsuRI 73 48

Codon 6 1 5 :

a:5:

a:

5 ‘ -CTTGGATATTCTCGACACAGCTGAT

5’-AATTACTCCTTAATGTCAGC

5’-GGATATTCTCGACACAGCAGGTGA

5’-AATTACTCCTTAATGTCAGC

179

176

BclI

Earl

179

176

155

157

H-ras

Codon 12 5: 5’-GAGACCCTGTAGGAGGACCC 312 MspI 291 235

a : 5 ‘ -GGGTGCTGAGACGAGGGACT

Codon 13 5:

a:5’-CCTCCTTGGCAGGTGAGGCAGGA

5’-GGTCAGCGCACTCTTGCCCTCA 125 HphI 101 90

Codon 6 1 5 :

a:

5 ‘ -ATGAGAGGTACCAGGCAGAG

5’-CGCATGGCGCTGTACAGCTC 177 A1wNI 157 139

a bp, base pairs; s, sense primer; a, antisense primer.b Mismatched nucleotides are bold.

of the ras gene group (21, 31). For codon 12 of K-ras, the

primers used here in the two-step screening were the same as

described (11). Sequences of all primers are summarized in

Table 1. In most assays, a further mismatch is introduced into

the primers to create a control restriction site. Because of this the

sizes of PCR products differ from those obtained after restric-

tion enzyme digestion enabling thus to distinguish between the

low level of the mutant allele and possible incomplete digestion

by a restriction enzyme.

When the positive control DNA (SW 480, homozygously

mutated K-ras codon 12) was diluted with normal DNA and

processed by a two-step assay, the mutant allele-specific band

was still discernible in the 1:333 dilution (not shown).

Frequency of Mutations in NSCLC and Single-Step

versus Double-Step Assay for K-ras Codon 12. The non-

small cell lung tumor samples analyzed in our study comprised

1 17 cases of squamous cell carcinomas, 1 adenosquamous cell

carcinoma, 19 adenocarcinomas, and 4 large cell carcinomas.

All tumors have been subjected to the two-step PCR-RFLP

analysis to detect mutations in codon 12 of K-ras. Of 141

tumors 14 (10%) were found mutated in this codon (Fig. la).

Four of these mutations were detected among I 9 adenocarcino-

mas. Nine of 118 squamous cell carcinomas (1 adenosquamous

carcinoma included) and 1 of 4 large cell tumors harbored the

mutation. The 14 samples were also screened by a less sensitive

one-step procedure. As shown in Fig. lb, the band intensity of

mutated allele varied. In several samples, the mutated allele-

specific band was very weak and in two samples (Fig. la, Lanes

4 and 5), the mutation was just at the limit of detection. It means

that, in mutation-positive tumors, at least 5% of the cells were

mutated. This detection limit for the single-step method was

estimated by a titration experiment with mutated (SW480) and

control DNA (not shown). Of the 14 samples with K-ras codon

12 mutation, 1 mutation was found to be homozygous (Fig. 1,

4- Uncut4- Mutant

4- Wild

Fig. I Mutation of K-ras codon 12 in NSCLC. Two-step (a) and

single-step (b) PCR-RFLP assay in 14 tumor samples. Order of samplesin a and b is the same and the numbers correspond to those in Table 2

and in Fig. 3a. PCR-RFLP conditions are described in “Materials and

Methods’ ‘. Two or three independent amplifications were performed to

verify the mutations; the same results were obtained.

Lane 2). In this sample, either the normal allele was lost or both

alleles had the same type of mutation. Normal allele-specific

band was detectable in all other samples, along with the mutated

one (Fig. lb).

We screened codons 13 and 61 of the K-ras gene further

for point mutations by a one-step PCR-RFLP procedure and

found three mutations in codon 13 (Fig. 2). All of them occurred

in adenocarcinomas. In the titration experiment for codon 13,




%r� � S �,- - - 0

‘E- Uncut

�- Mutant

�- Wild

Fig. 2 K-ras mutations in codon 13 detected by a single-step PCR-RFLP method. Three tumors show a mutant-specific band of the samesize as positive control DNA (LoVo cell line). Numbers of tumorscorrespond to those in Table 2 and in Fig. 3b. The sizes of fragments arein Table 1 . The assay was repeated three times with the samples shownand the same results were obtained.

mutation was seen until the dilution 1:20 (LoVo cell line DNA

diluted in a normal DNA, not shown). For K-ras codon 61, no

artificial restriction site could be designed to detect point mu-

tations in all three nucleotides in a single assay. The mutations

in the two first bases and the mutation in the third position were

therefore analyzed separately as described (21). No mutation

was found in this codon. In the control DNA (NCI-H460), a

clear mutant-specific band was seen (not shown).

Mutations of H-ras were rarely detected in NSCLC. Since

v-Ha-ras is capable of transforming normal human bronchial

epithelial cells in culture (32), we were interested in determining

if there are any mutations in any of the three codons of H-ras in

our samples. Only 1 mutation in codon 12 was observed among

141 NSCLC samples analyzed. This mutant-specific band was

very weak, indicating that only a minor portion of tumor cell

population (<5%) was mutated (not shown; this sample was not

sequenced). Thus, H-ras mutations do not play a role in the

development of human NSCLC. In the codon 12 of H-ras,

however, G-�C change in the second position cannot be de-

tected by a PCR-RFLP assay because this mutation creates a

new MspI restriction site just three bases downstream, resulting

in the PCR product which is indiscernible from the wild one on

the gel.

Correlation of Clinical Parameters with the MutationalFrequency. When clinical parameters were compared to the

finding of a mutation, no statistically significant correlation

between the stage of the disease (ThM classification I-IV) and

the presence or absence of K-ras mutation was found. However,

all three codon 13 mutations were in stages III or IV. Although

the K-ras mutations were found about two times more fre-

quently in NSCLC cases with node metastases, no statistically

significant correlation exists between these two groups. Further-

more, while the occurrence of mutations in codon 12 was

common to both types of lung cancer studied, codon 13 muta-

tions of K-ras were absent from lung squamous cell carcinomas.

Spectrum of K-ras Mutations in NSCLC. The histo-

logical type of individual tumors, the mutational events, and the

stages of the disease are summarized in Table 2. The mutations

were determined by direct sequencing of mutant-enriched PCR

products after the second step of PCR (‘ ‘Materials and Meth-

ods’ ‘). Fig. 3a shows examples of sequences around the codon

12 of K-ras in mutated NSCLC tumors and Fig. 3b depicts an

example of mutations found in the three adenocarcinomas mu-

tated in K-ras codon 13. Since mutant-enriched PCR products

were sequenced, only the mutated nucleotide bands or more

prominent mutated bands besides residual normal bases are seen

on sequence autoradiograms (Fig. 3). All of the mutational

events, except for one, are G-T transversions (10 events) or

G-+A transitions (6 cases). One G-t’C transversion in the

second position of codon 12 has been observed in a squamous

cell carcinoma. In codon 12, the point mutations resulted in the

following amino acid changes: from glycine (wild type) to

cysteine (three samples), aspartic acid (four samples), valine

(two samples), serine (two samples), alanine (one sample), and

phenylalanine (two nucleotide changes, one sample). In addi-

tion, a single nucleotide deletion of one G in codon 12 of K-ras

was detected in another squamous cell carcinoma (Fig. 3a, Lane

14). This mutation causes a frameshift resulting in a stop codon

several bases downstream. The translation product of the tran-

scribed RNA should therefore result in a short truncated peptide

having apparently no transforming activity because most of the

carboxy part of the protein should not be synthesized. The

frameshift mutation in this sample was further confirmed by

several independent amplifications of genomic DNA and se-

quencing both the antisense and sense strands (not shown). In

codon 13, all three cases revealed a substitution from glycine to

cysteine. Concerning both codons 12 and 13, nine- and eight-

point mutations were in the first and the second position, re-

spectively. Control cell lines were also processed by the same

procedures as tumor DNAs and corresponding mutations were

detected (not shown).

The overall mutational frequency was 17 (12%) of 141 in

all NSCLC samples, 7 (37%) of 19 in adenocarcinomas, and 9

(8%) of 118 in squamous cell carcinomas (including 1 adeno-

squamous carcinoma), and 1 (25%) of 4 in large cell carcino-

mas. Therefore, it can be concluded that K-ras mutations occur

not only in lung adenocarcinomas but also, at lower frequencies,

in squamous cell carcinomas of the lung.

DISCUSSION

The two-step PCR-RFLP method was shown to be a reli-

able procedure to detect K-ras codon 12 point mutations present

in only a small percentage of the tumor cells (4, 10, 1 1, 30).

Here we screened 141 NSCLC DNA samples using this assay.

All mutations were clearly recognized as prominent bands on

the gel (Fig. 1). This method could be used in the screening of

samples such as sputum, bronchoalveolar lavage, pancreatic

juice, or feces, into which tumor cells are often shed from the

tumor. Mutations of K-ras have been detected in sputum from

patients with lung cancer and in pancreatic juice from patients



b

Fig. 3 Direct sequencing of mutant-enriched PCR products resulting from two-step amplification procedures. Examples of all types of mutations

found in codon 12 (a) and codon 13 (b) of the K-ras gene are presented. For codon 12, antisense strand is shown (normal codon 12 sequence is ACC).

The sense strand was synthesized in codon 13 sequencing reactions (normal codon 13 sequence is GGC). The numbers of tumor samples correspondto the numbers in Figs. I and 2 and in Table 2. Arrowheads, mutated bases. Normal codon triplet (sense strand) is also displayed under each scquencc.

Mismatched nucleotide is underlined in the sequence displayed on the left for each codon. Each sample was sequenced twice to verify the mutation.


Table 2 Types of K-r as mutations in NSCLC

Patient Sex, age Histological diagnosis Codon Mutation ThM stage

1 M, 64 Squamous cell carcinoma 12 GGT-*TGT (Cys) II

2 M, 46 Squamous cell carcinoma 12 GGT-*GAT (Asp)” III3 M, 65 Squamous cell carcinoma 12 GGT-*AGT (5cr) II

4 M, 59 Adenocarcinoma 12 GGT-*GAT (Asp) I

5 M, 51 Squamous cell carcinoma 12 GGT-O.GTI’ (Val) I6 M, 56 Adenosquamous carcinoma 12 GGT-+TGT (Cys) I

7 F, 65 Adenocarcinoma 12 GGT-t.GAT (Asp) II

8 M, 52 Squamous cell carcinoma 12 GGT-*GCT (Ala) III9 M, 68 Large cell carcinoma 12 GGT-*GTT’ (Val) III

10 F, 62 Squamous cell carcinoma 12 GGT-*AGT (5cr) I

1 1 F, 54 Adenocarcinoma 12 GGT-*TGT (Cys) III

12 M, 64 Adenocarcinoma 12 GGT-*1TF (Phe)” I

13 M, 46 Squamous cell carcinoma 12 GGT-OGAT (Asp) II

14 M, 39 Squamous cell carcinoma 12 GGT-*deletion of one G III

15 F, 48 Adenocarcinoma 13 GGC-’TGC (Cys) III16 M, 68 Adenocarcinoma 13 GGC-*TGC (Cys) III17 F, 47 Adenocarcinoma 13 GGC-*TGC (Cys) IV

a Wild-type allele has not been present.h double mutation in codon 12.

G\TCGA TCGA TCGA TCGA TCGA TCGA TCGA

all r�n’n

�� I Control No.2 No.7 No.3 No.5 No.6 No.8

V GGT(GIy) GAT(Asp) GAT(Asp) AGT(Ser) GTT(Val) TGT(Cys) GCT(Ala)

TCGA TCGA

No.12 No.14m(Phe) GGT>GT

with pancreatic cancer by another sensitive assay, namely, mu-

tant-allele-specific amplification (33, 34). Very recently, mu-

tated p.53 and ras genes have been detected in archival sputum

samples obtained before the clinical diagnosis of lung cancer

(35). Also, K-ras mutations were found in the DNA isolated

from the stool of patients with mutation-positive colorectal

tumors (36) and suggested to be useful for early detection of

colorectal tumors. In the case of bronchogenic carcinoma, pre-

TCGA�TCC

00T00I bC -

0- 1.-4

CI��)I

GGC(Gly)

TCGA

No. 16TGC(Cys)

invasive stages persist for years and classical screening methods

are inefficient to detect the tumor at this stage (reviewed in Ref.

37). It remains to be elucidated the timing of appearance of

K-ras mutations during the carcinogenesis of NSCLC and to test

the diagnostic value of possible mutations of K-ras and other

genes detected in sputum or bronchoscopic material.

Although all of the mutations of K-ras were well above the

detection limit of the sensitive two-step PCR-RFLP method,




several samples were near or at the detection limit of the

one-step assay. In other samples, most tumor cells were mu-

tated. It can be therefore inferred that K-ras mutations appear

early during the progression of the tumor. However, if K-ras

mutation occurs as an early event during the development of the

squamous cell lung carcinoma, it probably does not confer a

growth advantage to cells at least in a subset of mutated tumors.

In a recent report, K-ras mutations were suggested to be ac-

quired early in lung adenocarcinomas (38).

In this work, the pattern of K-ras mutations in NSCLC was

similar to that reported previously. Among the samples ana-

lyzed, one revealed G-�C transition. G-�A transitions and

G-+T transversions were detected in all other mutated DNAS.

These two types of mutations arise as a result of treatment by

specific carcinogens in animal model systems. G-t’A transitions

are detected at high frequency on application of methylating

N-nitroso compounds such as methylnitrosourea, presumably

through the formation of 06-methyldeoxyguanosine. Benzo

(a)pyrene, forming hydrophobic DNA adducts, produces mostly

G-+T transversions. Both the benzo(a)pyrene and derivatives of

N-nitroso compounds are constituents of the cigarette smoke. As

all but one patient with K-ras mutation in our study were current

or former smokers, K-ras mutations detected here might have

been formed as a consequence of action of these groups of

carcinogens.

We found here a codon-specific distribution of K-ras mu-

tations in NSCLC tumors. Codon 12 mutations occurred in all

histological types of non-small cell lung cancer. On the other

hand, mutations in codon 13 were absent in squamous cell

carcinomas. In articles reporting the mutations of K-ras in

squamous cell lung cancers (fresh tumors or cell lines, 12

samples total), no codon 13 mutations were described (19, 21,

24, 26). Either codon 12 or codon 61 mutations were present.

Thus, our results, based on a large group of squamous cell lung

tumors, further suggest that there is an absence of the mutations

in codon 13 of K-ras in this type of tumor. Besides the K-ras

codon 12 mutations, Rosell et al. (26) observed mutations in

codon 61. Here, on the contrary, we were unable to detect any

mutation in this codon among 141 NSCLC samples. K-ras

mutations were reported to occur also in large cell lung carci-

nomas (21, 26). We found one mutation (codon 12) out of four

of these tumors examined.

In more than a one-half of the NSCLC samples analyzed in

this work, we have previously studied the methylation status of

the specific MspI/HpaII sites at the 3’ end of H-ras gene and

loss of heterozygosity at the H-ras locus (39). We hypothesized

that hypomethylation may contribute to allelic loss at the H-ras

locus (39). Neither H-ras allelic loss nor H-ras hypomethylation

(the latter change found in about one-third of tumor samples)

correlated with K-ras mutations. An interesting fact, however,

has been noted because the only sample with the loss of the

shorter H-ras allele having no methylation change (five other

DNAS with shorter allele loss were hypomethylated) displayed

the homozygous mutation of K-ras described here (Fig. 1 and

Table 2, patient 2).

We have shown that the same types of mutations appear in

both adenocarcinomas and squamous cell carcinomas of the

lung. We have demonstrated on an extended number of squa-

mous cell tumors that this histological type also harbors K-ras

mutations, although at a frequency four times lower than that in

adenocarcinomas. All mutations found in squamous cell tumors

clustered in codon 12 of K-ras. One mutation was also noted in

codon 12 of H-ras (squamous cell carcinoma) in a minority of

tumor cells. H-ras mutations, therefore, do not have any impor-

tance in the formation of NSCLC. It remains to be investigated

if screening of mutations in codon 12 of K-ras by a sensitive

mutant allele-enriched method might become a contribution to

an early diagnosis of NSCLC.

ACKNOWLEDGMENTS

We thank Dr. Fiala and Dr. Hytych for help in collecting the tumor

samples.

REFERENCES

1. Almoguera, C., Shibata, D., Forrester, K., Martin, J., Arnheim, N.,

and Perucho, M. Most human carcinomas of the exocrine pancreascontain mutant c-K-ras genes. Cell, 53: 549-554, 1988.

2. Smit, V. T. H. B. M., Boot, A. J. M., Smits, A. M. M., Fleuren, G. J.,Cornelisse, C. J., and Bos, J. L. KRAS codon 12 mutations occur veryfrequently in pancreatic adenocarcinomas. Nucl. Acid Res., 16: 7773-7783, 1988.

3. Lemoine, N. R., Jam, S., Hughes, C. M., Staddon, S. L., Maillet, B.,

Hall, P. A., and KlOppel, G. Ki-ras oncogene activation in preinvasive

pancreatic cancer. Gastroenterology, 102: 230-236, 1992.

4. Hruban, R. H., van Mansfeld, D. M., Offerhaus, G. J. A., vanWeering, D. H. J., Allison, D. C., Goodman, S. N., Kensler, 1. W., Bose,K. K., Cameron, J. L., and Bos, J. L. K-ras oncogene activation inadenocarcinoma of the human pancreas. Am. J. Pathol., 143: 545-554,

1993.

5. Bos, J. L., Fearon, E. R., Hamilton, S. R., Verlaan-de Vries, M., vanBoom, J. H., van der Eb, A. J., and Vogelstein, B. Prevalence of ras

gene mutations in human colorectal cancers. Nature (Lond.), 327: 293-297, 1987.

6. Burmer, G., and Loeb, L. A. Mutations in the KRAS2 oncogeneduring progressive stages of human colon carcinoma. Proc. NatI. Acad.Sci. USA, 86: 2403-2407, 1989.

7. Shaw, P., Tardy, S., Benito, E., Obrador, A., and Costa, J. Occurenceof Ki-ras and p53 mutations in primary colorectal tumors. Oncogene, 6:2121-2128, 1991.

8. Shibata, D., Schaeffer, J., Li, Z.-H., Capella, G., and Perucho, M.

Genetic heterogeneity of the c-K-ras locus in colorectal adenomas butnot in adenocarcinomas. J. Nati. Cancer Inst., 85: 1058-1063, 1993.

9. Mok, S. C-H., Bell, D. A., Knapp, R. C., Fishbaugh, P. M., Welch,W. R., Muto, M. G., Berkowitz, R. S., and Tsao, S-W. Mutation ofK-ras protooncogene in human ovarian epithelial tumors of borderlinemalignancy. Cancer Res., 53: 1489-1492, 1993.

10. Minamoto, T., Ronai, Z., Yamashita, N., Ochiai, A., Sugimura, T.,Mai, M., and Esumi, H. Detection of Ki-ras mutation in non-neoplastic

mucosa of Japanese patients with colorectal cancers. Int. J. Oncol., 4:

397-401, 1994.

11. Ronai, Z., Luo, F. C., Gradia, S., Hart, W. J., and Butler, R.Detection of K-ras mutation in normal and malignant colonic tissues by

an enriched PCR method. Int. J. Oncol., 4: 391-396, 1994.

12. Enomoto, 1., Inoue, M., Perantoni, A. 0., Buzard G. S., Miki, H.,Tanizawa, 0., and Rice, J. M. K-ras activation in premalignant andmalignant epithelial lesions of the human uterus. Cancer Res., 51:

5308-5314, 1991.

13. Yanagisawa, A., Ohtake, K., Ohashi, K., Hori, M., Kitagawa, T.,

Sugano, H., and Kato, Y. Frequent c-Ki-ras oncogene activation in

mucous cell hyperplasia of pancreas suffering from chronic inflamation.Cancer Res., 53: 953-956, 1993.

14. Rodenhuis, S., van de Wetering, M. L., Mooi, W. J., Evers, S. G.,van Zandwijk, N., and Bos, J. L. Mutational activation of the K-RAS




oncogene. A possible pathogenetic factor in adenocarcinoma of thelung. N. Engl. J. Med., 317: 929-935, 1987.

15. Rodenhuis, S., Slebos, R. J. C., Boot, A. J. M., Evers, S. G., Mooi,W. J., Wagenaar, S. S., van Bodegom, P. C., and Bos, J. L. Incidenceand possible clinical significance of K-ras oncogene activation in ade-nocarcinoma of the human lung. Cancer Res., 48: 5738-5741, 1988.

16. Kobayashi, 1., Tsuda, H., Noguchi, M., Hirohashi, S., Shimosato,Y., Goya, T., and Hayata, Y. Association of point mutation in c-Ki-ras

oncogene in lung adenocarcinoma with particular reference to cytologicsubtypes. Cancer (Phila.), 66: 289-294, 1990.

17. Rodenhuis, S., and Slebos, R. J. C. The ras oncogenes in human

lung cancer. Am. Rev. Respir. Dis., 142: 527-530, 1990.

18. Slebos, R. J. C., Kibbelaar, R. E., Dalesio, 0., Kooistra, A., Stam,J., Meijer, C. J. L. M., Wagenaar, S. S., Vanderschueren, R. G. J. R. A.,van Zandwijk, N., Mooi, W. J., Bos, J. L., and Rodenhuis, S. K-RASoncogene activation as a prognostic marker in adenocarcinoma of thelung. N. Engl. J. Med., 323: 561-565, 1990.

19. Suzuki, Y., Orita, M., Shiraishi, M., Hayashi, K., and Sekiya, T.Detection of ras gene mutations in human lung cancers by single-strandconformation polymorphism analysis of polymerase chain reaction

products. Oncogene, 5: 1037-1043, 1990.

20. Capella, G., Cronauer-Mitra, S., Peinado, M. A., and Perucho, M.Frequency and spectrum of mutations at codons 12 and 13 of the c-K-ras

gene in human tumors. Environ. Health Perspec., 93: 125-131, 1991.

21. Mitsudomi, T., Viallet, J., Mulshine, J. L., Linnoila, I., Minna, J. D.,and Gazdar, A. F. Mutations of ras genes distinguish a subset of

non-small-cell lung cancer cell lines from small-cell lung cancer celllines. Oncogene, 6: 1353-1362, 1991.

22. Husgafvel-Pursiainen, K., Ridanpaa, M., Hackman, P., Anttila, S.,

Karjalainen, A., Onfelt, A., Borresen, A-L., and Vainio, H. Detection of

ras gene mutations in human lung cancer: Comparison of two screening

assays based on the polymerase chain reaction. Environ. Health Per-

spec., 98: 183-185, 1992.

23. Sugio, K., Ishida, T., Yokoyama, H., Inoue, 1., Sugimachi, K., andSasazuki, T. ras Gene mutations as a prognostic marker in adenocarci-noma of the human lung without lymph node metastasis. Cancer Res.,

52: 2903-2906, 1992.

24. Husgafvel-Pursiainen, K., Hackman, P., Ridanpaa, M., Anttila, S.,

Karjalainen, A., Partanen, T., Taikina-Aho, 0., Heikkilh, L., and Vainio,

H. K-ras mutations in human adenocarcinoma of the lung: associationwith smoking and occupational exposure to asbestos. Int. J. Cancer, 53:

250-256, 1993.

25. Westra, W. H., Slebos, R. J. C., Offerhaus, G. J. A., Goodman,S. N., Evers, S. G., Kensler, T. W., Askin, F. B., Rodenhuis, S., andHruban, R. H. K-ras oncogene activation in lung adenocarcinoma fromformer smokers. Cancer (Phila.), 72: 432-438, 1993.

26. Rosell, R., Li, S., Sk#{225}cel,Z., Mate, J. L., Maestre, J., Canela, M.,

Tolosa, E., Armengol, P., Barnadas, A., and Ariza, A. Prognostic impactof mutated K-ras gene in surgically resected non-small cell lung cancer

patients. Oncogene, 8: 2407-2412, 1993.

27. Wagner, S. N., Muller, R., Boehm, J., PUtz, B., W#{252}nsch,P. H., andHdfler, H. Neuroendocrine neoplasms of the lung are not associatedwith point mutations at codon 12 of the Ki-ras gene. Virchows Arch. BCell Pathol., 63: 325-329, 1993.

28. Mitsudomi, T., Steinberg, S. M., Oie, H. K., Mulshine, J. L., Phelps,

R., Viallet, J., Pass, H., Minna, J. D., and Gazdar, A. F. ras Genemutations in non-small cell lung cancers are associated with shortened

survival irrespective of treatment intent. Cancer Res., 51: 4999-5002,1991.

29. Kahn, S. M., Jiang, W., Culbertson, T. A., Weinstein, I. B., Wil-hams, G. M., Tomita, N., and Ronai, Z. Rapid and sensitive non-radioactive detection of mutant K-ras genes via ‘ ‘enriched’ ‘ PCR am-plification. Oncogene, 6: 1079-1083, 1991.

30. Levi, S., Urbano-Ispizua, A., Gill, R., Thomas, D. M., Gilbertson,

J., Foster, C., and Marshall, C. J. Multiple K-ras codon 12 mutations incholangiocarcinomas demonstrated with a sensitive polymerase chainreaction technique. Cancer Res., 51: 3497-3507, 1991.

31. Jiang, W., Kahn, S. M., Guillem, J. G., Lu, S-H., and Weinstein,

I. B. Rapid detection of ras oncogenes in human tumors: applications tocolon, esophageal, and gastric cancer. Oncogene, 4: 923-928, 1989.

32. Yoakum, G. H., Lechner, J. F., Gabrielson, E. W., Korba, B. E.,Malan-Shibley, L., Willey, J. C., Valerio, M. G., Shamsuddin, A. M.,

Trump, B. F., and Harris, C. C. Transformation of human bronchialepithelial cells transfected by Harvey ras oncogene. Science (Washing-ton DC), 227: 1174-1179, 1985.

33. Takeda, S., Ichii, S., and Nakamura, Y. Detection of K-ras mutation

in sputum by mutant-allele-specific amplification (MASA). HumanMutation, 2: 117-122, 1993.

34. Tada, M., Omata, M., Kawai, S., Saisho, H., Ohto, M., Saiki, R. K.,

and Sninsky, J. J. Detection of ras gene mutations in pancreatic juice

and peripheral blood of patients with pancreatic adenocarcinoma. Can-

cer Res., 53: 2472-2474, 1993.

35. Mao, L., Hruban, R. H., Boyle, J. 0., Tockman, M., and Sidransky,D. Detection of oncogene mutations in sputum precedes diagnosis oflung cancer. Cancer Res., 54: 1634-1637, 1994.

36. Sidransky, D., Tokino, T., Hamilton, S. R., Kinzler, K. W., Levin,

B., Frost, P., and Vogelstein, B. Identification of ras oncogene muta-tions in the stool of patients with cutable colorectal tumors. Science

(Washington DC), 256: 102-105, 1992.

37. Szabo, E., Birrer, M. J., and Mulshine J. L. Early detection of lung

cancer. Semin. Oncol., 20: 373-382, 1993.

38. Li, Z.-H., Zheng, J., Weiss, L. M., and Shibata, D. c-K-ras and p.53

mutations occur very early in adenocarcinoma of the lung. Am. J.

Pathol., 144: 303-309, 1994.

39. Vachtenheim, J., Hor#{225}kov#{225},I., and Novotn#{225}, H. Hypomethylation

of CCGG sites in the 3’ region of H-ras protooncogene is frequent and

is associated with H-ras allele loss in non-small cell lung cancer. CancerRes., 54: 1145-1148, 1994.



1995;1:359-365. Clin Cancer Res J Vachtenheim, I Horáková, H Novotná, et al. squamous cell carcinomas of the lung.Mutations of K-ras oncogene and absence of H-ras mutations in

Updated version

http://clincancerres.aacrjournals.org/content/1/3/359

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/1/3/359To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



Documents

Mutations of K-ras Oncogene and Absence of H-ras …clincancerres.aacrjournals.org/content/clincanres/1/3/359.full.pdf · histological types of the tumor. The presence of mutations