Expression of transforming K-Ras oncogene affects mitochondrial function and ... · 2017. 1. 3. · Expression of transforming K-Ras oncogene affects mitochondrial function and morphology

1757 (2006) 1338–1356www.elsevier.com/locate/bbabio

Biochimica et Biophysica Acta

Expression of transforming K-Ras oncogene affects mitochondrial functionand morphology in mouse fibroblasts

Ferdinando Chiaradonna ⁎, Daniela Gaglio, Marco Vanoni, Lilia Alberghina

Department of Biotechnology and Biosciences, University of Milano-Bicocca, Piazza della Scienza 2, 20126 Milan, Italy

Received 16 February 2006; received in revised form 23 June 2006; accepted 1 August 2006Available online 3 August 2006

Abstract

K-ras transformed fibroblasts have been shown to have a stronger dependence from glycolysis, reduced oxidative phosphorylation ability anda fragility towards glucose depletion compared to their immortalized, normal counterparts. In this paper, using RNA profiling assays andmetabolic perturbations, we report changes in expression of genes encoding mitochondrial proteins and alterations in mitochondrial morphologythat correlate with mitochondrial functionality. In fact, unlike normal cells, transformed cells show reduced ATP content and inability to modifymitochondria morphology upon glucose depletion. Being reverted by GEF-DN expression, such morphological and functional changes aredirectly connected to Ras activation. Taken together with reported partial mitochondrial uncoupling and more sustained apoptosis of transformedcells, our results indicate that activation of the Ras pathway strikingly impacts on energy and signaling-related aspects of mitochondriafunctionality, that in turn may affect the terminal phenotype of transformed cells.© 2006 Elsevier B.V. All rights reserved.

Keywords: Transformed cell; Ras; Glucose metabolism; Mitochondrial morphology; Energy metabolism; Apoptosis

1. Introduction

1.1. Mitochondria and cancer

Mitochondria are dynamic eukaryotic organelles that havelong been known to play a central role in cellular metabolism,notably in ATP production by oxidative phosphorylation [1,2].The primary metabolic function of mitochondria is oxidativephosphorylation (OXPHOS), an energy-generating process thatcouples oxidation of respiratory substrates to the synthesis ofATP. Mitochondria are delimited by two membranes dividingthem into two different compartments: the matrix and the intermembrane space. The OXPHOS system comprises four redoxcomplexes (numbered I to IV, making up the respiratory chain),and complex V (i.e. the ATP synthase), all located in the mito-chondrial inner membrane. The respiratory chain transferselectrons from NADH and FADH2, generated through thebreakdown of substrates in the matrix, or imported from thecytosol through specific transport systems, to molecular oxygen,

⁎ Corresponding author. Tel.: +39 02 64483515; fax: +39 02 64483519.E-mail address: [email protected] (F. Chiaradonna).

0005-2728/$ - see front matter © 2006 Elsevier B.V. All rights reserved.doi:10.1016/j.bbabio.2006.08.001

the terminal electron acceptor. Energy released by oxidation ofthese substrates is used to generate an electro-chemical protongradient (ΔΨ) across the mitochondrial inner membrane. ATPsynthase couples utilization of this gradient to the synthesis ofATP. Each complex of the respiratory chain and complex Vconsist of multiple polypeptide subunits, some encoded bynuclear genes and some encoded by mitochondrial DNA.Protein composition, stoichiometric ratio of the various proteinsubunits, post-translational modifications, tissue specificity andthe role of each and every subunit in the function of mito-chondrial complexes are still under investigation. In mammalsthe complexes I to Vare composed respectively by 42, 4, 11, 13and 15 subunits. Respiratory chain complexes comprise coresubunits that are necessary for complex activity and othersubunits, possibly playing ancillary or modulatory roles, whileall subunits of ATP-synthase seem required for activity [1,2].

Besides ATP synthesis, mitochondria are involved in severalother key metabolic processes such as oxidative decarboxyla-tion of pyruvate, tricarboxylic acid cycle, and fatty acidoxidation. Mitochondria are the site of important biosyntheticreactions, such as amino acids and heme biosynthesis and partof gluconeogenesis. Mitochondria take part in intracellular

mailto:[email protected]://dx.doi.org/10.1016/j.bbabio.2006.08.001

1339F. Chiaradonna et al. / Biochimica et Biophysica Acta 1757 (2006) 1338–1356

homeostasis of inorganic ions such as calcium and phosphate,as well as in the balance of NAD+/NADH, since part of NAD+,produced by NADH oxidation in the respiratory chain, goesback to the cytosol where it is required for glycolysis. Severalenzymes of the urea cycle are also localized in mitochondrialmatrix. Besides their central role in metabolic activity, mito-chondria have been shown more recently to have a central rolein the cascade of events that leads to programmed cell death. Infact, evidence has been gathered indicating a pro-apoptotic rolefor several molecules usually associated to mitochondria(cytochrome C, AIF, EndoG, Bax) as well as a role in dampingthe apoptotic cascade of proteolytic enzymes (caspase) by othermolecules usually associated to mitochondria [3,4]. Thus, thesefindings assign to mitochondria a more critical role in theresponses of cells to a multiplicity of physiological and geneticstresses, inter-organelle communication, cell proliferation andcell death [5–10].

The study of energymetabolism of transformed cells has beena central issue of cancer research until the interest shifted togenetic approaches. As early as 1930, Otto Warburg proposedthat cancer cells may have impaired mitochondrial function andthat this alteration would result in the elevated rate of glycolysisthat is a common feature of most tumors [11]. During the 1970sH.A. Krebs stated that the elevated rate of glycolysis “may be asymptom of cancer, but not a primary cause” [12–14], a conceptrecently restated by Robert Weinberg who wrote that “aerobicglycolysis is an epiphenomenon of cell transformation ratherthan a casually important process” [15]. Although the glycolyticphenotype of many cancer cells and tumors has been demon-strated at both the biochemical andmolecular levels [16–24], thepresumed impairment of cancer mitochondrial function hasnever been unambiguously established. In fact, to this day, westill do not know the role, if any, that mitochondria play inneoplastic transformation and/or in maintaining or promotingthe transformed state. Recent studies highlighted that mitochon-drial dysfunction is one of the most recurrent features of cancercells [25–28], given that substantial differences between themitochondria of normal and cancer cells have been reported atmicroscopic, molecular, biochemical, metabolic and geneticlevel.

A fundamental role for hypoxia in emergence of mitochon-dria dysfunction is supported from experimental and clinicalevidence. Indeed, hypoxia has been shown to alter theexpression of genes involved in stress response, anaerobicmetabolism, angiogenesis, tissue remodeling, and cell to cellcontact acting in an epigenetic and non-epigenetic fashions [29].All these phenomena participate in the process of “adaptive res-ponse” of cancer cells to hypoxic conditions contributing to theirgrowth advantage. The importance of hypoxia in tumor deve-lopment is substantiated by several reports indicating that indeveloping tumors the oxygen level declines more than glucoselevel [30–33]. Cancer cells would counteract oxygen shortageby hyperactivation of glycolysis to produce ATP. The secondaryeffect of stimulated glycolysis is the accumulation of lactate inthe environment with a direct consequence on the extracellularpH that becomes more acidic [30–33]. Cells that are able tosurvive in acidic environment will be strongly advantaged,

and some authors have shown, in several cancer cells, an up-regulation of the Na+–H+ exchange and vacuolar H+-ATPasethat facilitates survival in an acidic environment [34–36].Moreover, an acidic environment induces apoptosis in normalneighbor cells and degradation of extracellular matrix that in turnfacilitates migration and invasion of the surrounding tissues bywell-adapted cancer cells. In this regard, it is widely recognizedthat a significant number of tumors reveals over-expression ofHIF1α, which participates in the induction of some glycolyticenzymes [8,33,37–44], of angiogenetic processes by inducingthe VEGF expression [45,46] and in the migration processes byinducing different proteases, such as urokinase PlasminogenActivators [47,48]. On the other hand, other authors support theview that the metabolic shift to glycolysis directly results fromoncogenic mutations of elements of the signal transductionpathways that control glucose uptake by the cells or of tran-scription factors that control the expression of glycolytic andmitochondrial genes [10,18,22,49–52]. For these reasons, themolecular mechanisms that promote the expression of an aber-rant energy metabolism in tumor and cancer cells are presently asubject of renewed debate.

1.2. Alterations of mitochondria in cancer

Mitochondrial alterations specifically associated with theirbioenergetics function have been observed in cancer cells.Mutations in mitochondrial DNA (mtDNA) are commonlyfound in a variety of cancers [38,53,54]. Microscopic study oftumors revealed mitochondrial hyperplasia, and up-regulatedexpression of mitochondrial cytochrome oxidase II mRNA inmalignant breast tissues has been observed [55]. Expressionanalysis in glioblastoma tissues showed reduction of cyto-chrome C oxidase subunit II and III (COX II, COX III), ATPsynthase subunit 6 (ATP 6), NADH dehydrogenase subunit 1and 4 (ND1 and ND4) transcripts [56].

Only recently, mitochondrial enzymes have been directlyimplicated in hereditary neoplasia. Germline heterozygousmutations in nuclear genes encoding subunits of mitochondrialcomplex II (succinate-ubiquinone oxydoreductase, composed offour subunits – SDHA, SDHB, SDHC and SDHD – andinvolved in electron transport and in tricarboxylic-acid cycle)cause inherited tumoral syndromes [46,48,57–59], whilehomozygous mutations in the SDHA-encoding gene causeneurodegenerative disorders [60,61]. Mutations in the geneencoding fumarate hydratase (FH, fumarase that convertsfumarate to malate) cause inherited neoplastic syndromes, aswell as to kidney cancers [61,63–65], associated with a reduc-tion in dosage of SDH or FH-encoding genes. Complete or nearcomplete loss of enzyme function occurs only in the somatictumor cells. Reduced mitochondrial SDH or FH activity mightaffect apoptosis and angiogenesis induction, both hallmarks oftumorigenesis [46,48,58,59]. In fact, defects in energy produc-tion may block energy-dependent apoptotic processes, and up-regulate angiogenesis, due to increased HIF1α stability resultingfrom succinate inhibition of HIF1α prolyl-hydroxylase [61,62].Further evidence of the importance of mtDNA mutations inneoplastic transformation comes from studies of complex IV

1340 F. Chiaradonna et al. / Biochimica et Biophysica Acta 1757 (2006) 1338–1356

(COX IV) mutations in prostate cancer [66]. Mitochondrialcytochrome c oxidase activity in total cellular homogenate andin mitochondrial samples from cultured human carcinoma celllines has been shown to be significantly lower than that mea-sured in the control epithelial cell line [25].

Specific repression of the expression of the β-catalyticsubunit of the H+-ATP synthase (β-F1-ATPase), a rate-limitingcomponent of mitochondrial oxidative phosphorylation, hasbeen documented in rat hepatocarcinomas, in several humantumors[67], and notably of carcinomas [68,69]. Decreasedexpression of β-F1-ATPase observed in the inner core of somecarcinomas is accompanied by concurrent up-regulation ofglycolytic enzymes in most of the human solid tumors ana-lyzed and might result from a partial hypoxic environment insuch tumors. Reduced adenine nucleotide translocase activityhas been reported in certain hepatoma versus normal livermitochondria [70,71] and it has been correlated to the aggres-siveness of cancer cells [72]. Evidence has been collectedindicating that pathogenic mtDNA mutations that impinge onmitochondrial energy transduction do play a relevant role inthe etiology of cancer by any of the following mechanisms:excessive reactive oxygen species production, reduced cellularapoptotic potential or altered mitochondria to nucleus signalingin a cellular invasive phenotype [54,73], suggesting that alteredglycolysis of cancer cells could be a consequence ofmitochondrial dysfunction.

1.3. A fibroblast model for the study of mouse mitochondrialfunction in transformed cells

As briefly summarized above, mitochondria are involvedin different, interacting intracellular networks in both normaland transformed cells. If one wants to identify the network(s)that presides and regulates the process under investigation[74], it is necessary to start by analyzing the network(s) understudy using a defined, genetically tractable model both fornormal and transformed cells in which the transformed phe-notype can be switched on and off by defined molecularevents.

We have developed an experimental system comprisingnormal, K-ras transformed and reverted, isogenic cell lines usingNIH3T3 fibroblasts. The use of NIH3T3 cells to assay the

Fig. 1. Comparative analysis of Ras- and GEF-DN- regulated genes using Affymetrplated at 3000 cell/cm2 in media supplemented with 25 mM glucose and used for thidentified by using Affymetrix MG_U74Av2Array as described in Materials and metchange ≥1 in each of the two independent experiments is reported in the table. (Bdifferentially regulated in at least one pair-wise comparison. Fold changes are calculpathway whose regulation was scored not change (NC) in the Affymetrix arrays. Rdehydrogenase complex, subunit C, cytochrome c oxidase; subunit Va, cytochromcytochrome c oxidase, subunit VIIa 1; cytochrome c oxidase subunit VIIa polypepVIIc; cytochrome c oxidase, subunit VIIIa; ATP synthase, F0 complex subunit F;polypeptide 2; ATP synthase, F1 complex, O subunit; NADH dehydrogenase (ubisubcomplex 2; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 4; NADH(ubiquinone) 1 alpha subcomplex 7; NADH dehydrogenase (ubiquinone) 1 beta sudehydrogenase (ubiquinone) 1, subcomplex 1; NADH dehydrogenase (ubiquinone)dehydrogenase flavoprotein 1; NADH dehydrogenase (ubiquinone) flavoprotein 2. (Cprimers as indicated in Materials and methods, using samples from normal (lane N), tThe vinculin transcript was used as endogenous controls for semiquantitative RT-PC

transforming ability of potential and known oncogenes is welldocumented. Developed by Tordaro and Green [75] as a cell linefor transformation studies, this mouse fibroblastic cell line islargely employed for its indefinite growth in culture, retention ofcontact inhibition, and ease of transformation due to mutationsor expression of introduced genes. The ability of transformed3T3 to overcome contact inhibition when plated in soft agar is apowerful tool, used to examine the oncogenic potentialities ofgenes such as Ras [76], sphingosine kinase [77] and the G-protein linked T151M mutant calcium sensing receptor (CaR)[78]. Moreover several reports found coherent correlation be-tween the results obtained in this cellular model with findings intumor tissues and animal models [79–82].

Ras proteins are intracellular switches whose activation state(i.e. their binding to GDP and GTP) controls downstreampathways leading to cell growth and differentiation. Theactivation state of Ras proteins is governed through thecompeting action of GTPase Activating Proteins (GAP) andGuanine nucleotide Exchange Factors (GEF). Mutation of theras gene is a critical event in the onset of different malignantphenotypes. Also deregulation of either GAP or GEF activitymay result in hypo- or hyper-activation of downstream pathway(s), so that for instance over-expression of a GEF or inactivationa GAP may both result in cell transformation [83–85].

Research performed in our laboratory indicates that a singleamino acid change within the catalytic domain of themammalian GEF CDC25Mm turns this molecule into a dominantnegative protein (called GEF-DN). GEF-DN is able to efficientlydisplace wild-type GEF from p21ras and to originate a stableRas–GEF binary complex due to the reduced affinity of thenucleotide-free Ras–GEF complex for the incoming nucleotide[86]. This “Ras-sequestering property” can be utilized toattenuate Ras signal transduction pathways in mouse fibroblaststransformed by oncogenic ras, since GEF-DN expression down-regulates Ras activity both in vitro and in vivo and induces areversion of the transformed phenotype on the basis ofmorphology, anchorage independent growth and reduction ofRas-dependent tumor formation in nude mice [87]. Thus, the useof three cell lines: normal NIH3T3 mouse fibroblasts (that werefer to as normal, or N); NIH3T3 cells transformed by anactivated form of the K-ras oncogene [88,89] (that we refer to astransformed, or T) and K-ras transformed NIH3T3 fibroblasts

ix arrays. (A) The normal (N), transformed (T) and reverted (R) cell lines weree RNA extraction after 48 h of growth. The differentially expressed genes werehods. The number of genes showing differentially expression with at least a fold) The Table shows some mitochondrial proteins whose mRNA expression wasated as 2SLR (Signal Log Ratio). Below are listed the genes considered for eachespiratory Chain (NC) succinate dehydrogenase complex, subunit B; succinatee c oxidase subunit Vb; cytochrome c oxidase subunit VI a, polypeptide 1;tide 2-like; cytochrome c oxidase subunit VIIb; cytochrome c oxidase, subunitATP synthase, F0 complex, subunit c; ATP synthase, F0 complex, subunit f,quinone) 1 alpha subcomplex 1; NADH dehydrogenase (ubiquinone) 1 alphadehydrogenase (ubiquinone) 1 alpha subcomplex 6; NADH dehydrogenase

bcomplex 5; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9; NADHFe–S protein 3; NADH dehydrogenase (ubiquinone) Fe–S protein 4; NADH) Validation of selected genes by RT-PCR. RT-PCR was conducted with specificransformed (lane T) and reverted (lane R) cell lines cultured as described above.R.


that stably over-express the GEF-DN (that we refer to as revertedor R [87]) allows us to directly assess the role played by the Rasactivation in the any given studied phenotype.

In this paper, using an RNA profiling assay and metabolicperturbations, we report changes in expression of genesencoding mitochondrial proteins and alteration in mitochondrial


morphology that correlate with mitochondrial functionality. Infact transformed cells show a reduction of ATP cellular contentin correlation to glucose depletion and inability to modify themitochondria morphology as normal cell does. Such morpho-logical and functional changes are directly connected to Rasactivation, since they are reverted by GEF-DN expression.Together with the reported partial uncoupling and larger fractionof apoptotic cells in the transformed line, our results indicatethat activation of the Ras pathway strikingly impacts onenergetic and signaling-related aspects of mitochondria func-tionality that in turn may affect the terminal phenotype of thetransformed cell.

2. Materials and methods

2.1. Cell culture

Normal mouse fibroblasts (obtained from the ATCC, Manassas, VA, USA)and a K-Ras-transformed normal-derived cell line, 226.4.1 [90], were routinelygrown in Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA,USA) containing 10% newborn calf serum, 4 mM glutamax, 100 U/ml penicillinand 100 mg/ml streptomycin (normal growth medium), at 37 °C in a humidifiedatmosphere of 5% CO2. The reverted cell line, stably and constitutivelyexpressing the dominant mutant Cdc25W1056E (GEF-DN) [87] was maintainedin normal growth medium supplemented with 0.7 mg/ml geneticin (G418;Sigma-Aldrich Inc., St. Louis, MO, USA). Cells were passaged using trypsin-ethylenediaminetetraacetic acid (EDTA) (Invitrogen) and maintained in culturefor 48 h before experimental manipulation. To verify the cell response to theglucose depletion, the cells were grown in medium with 4 mM glutamax andwithout glucose and sodium pyruvate (Invitrogen) supplemented with theappropriate concentration of glucose (25 and 1 mM).

2.2. RNA preparation and Affymetrix Analysis

For the Affymetrix Gene Chip screening the three cell lines were plated3000 cells/cm2 in high glucose (25 mM). After 2 days the cells were detachedto prepare the mRNAs and the relative cRNAs. Total RNAwas prepared usingTrizol reagent (GIBCO-BRL, Grand Island, NY, USA), following the manu-facturer's protocol. Double-strand cDNA was synthesized from total RNAusing Superscript™ cDNA Synthesis kit (Life Technologies, Carlsbad, CA,USA) and the oligo T-7-(dT)24 primer that contained a T-7 RNA polymerasesite. cDNA was in vitro transcribed using the T7 BioArray High Yield RNATranscript Labeling Kit (Enzo Biochem, Farming Dale, NY, USA) to producebiotinylated cRNA. Labeled cRNA was isolated using an RNeasy Mini Kitcolumn (Qiagen Inc., Valencia, CA, USA). Purified cRNA was fragmented to200–300 mer cRNA using a fragmentation buffer as suggested by Affymetrixprotocol. Housekeeping controls α-actin and GAPDH genes served as endo-genous markers and were added to the sample to monitor the quality of thetarget.

Biotin-labeled cRNAs were hybridized to anMG_U74Av2 Affymetrix GeneChip. Hybridization experiments were repeated twice using independent cRNAprobes synthesized with RNA from two independent sets of cells. Data presentedin this work represent the average of both experiments.

Raw data were analyzed using Affymetrix Gene Chip software Mass 5.1.Fold change was calculated using the Affymetrix Gene Chip software with aComparison Analysis where two samples, hybridized to two Gene Chip probearrays of the same type, are compared with different types of algorithm againsteach other in order to detect and quantify changes in gene expression. Resultswere further elaborated through replica and statistical methods using varioussoftware.

2.3. Semiquantitative reverse-transcription-PCR

RNAwas extracted from cells cultured as described above. Total RNAwasincubated with DNase I RNase-Free (Abgene, New York, USA) at 37 °C for 1 h.

The RNA was quantified measuring the absorbance at 260 and 280 nm in aspectrometer Lambda EZ 201 (PerkinElmer) and then stored at −80 °C.

Five micrograms of total RNA were reverse-transcribed with oligo dT byusing the Superscript™ III RT-PCR First-Strand Synthesis System for RT-PCR(Invitrogen Corp., Carlsbad, CA, USA).

One microliter of the RT product was amplified with primer pairs specific forthe genes studied. Specifically for UCP-3: forward ATGAGTTTTGCC-TCCATTCG reverse AAGGAGGGCACAAATCCTTT; TFAM: forwardTAGGAAAATTGCAGCCCTGT reverse CTTCAGCCATCTGCTCTTCC;TOMM40: forward TCCAGGTGACCCACACAGTA reverse CCAGCTGA-TACCCAAAGGAG; TST: forward CCCACTTTGGGGACTATGTG reverseTTCTCGAAGCCATCTTTCGT; COX6c: forward CACAGATGCGTG-GTCTTCTG reverse CATAGTTCAGGAGCGCAGGT; COXI: forward GCA-ACCCTACACGGAGGTAA reverse AGGTTGGTTCCTCGAATGTG; COXII:forward TCTCCCCTCTCTACGCATTC reverse TCAGAGCATTGGCCATA-GAA; COXIII: forward AGGCCACCACACTCCTATTG reverse TGGAATC-CAGTAGCCATGAA. As internal control of PCR assays were designed specificprimers for vinculine transcript VCL: forward GGGTTTGCAAAGGAATT-TTGG reverse CAGGAAGCAGCTCTTTGACA. The reaction mixture of 30 μlcontained 1/30 volume of cDNA, 200 nM of each dNTP, 1 unit of REDAccuTaqDNA Polymerase (Sigma-Aldrich S.r.l. Milan, Italy), 10× buffer (supplied withenzyme), and 0.5 μM each of the forward and reverse primers. The mixture wassubjected to amplification using an Eppendorf Mastercycler (Eppendorf,Hamburg, Germany). The reaction with each couple of primers was performedwith an initial denaturation at 95 °C for 2 min, followed by 20–30 cycles ofdenaturation at 95 °C for 30 s (different cycles were used to avoid a saturatingamplification), annealing at 56 °C for 1 min, and extension at 72 °C for 1 min. Afinal 5 min extension step was added after the last cycle. Fifteen μl of RT-PCRproduct were loaded on 1.5% agarose gel and visualized by ethidium bromidestaining and photographed under UV light.

2.4. Digital imaging microscopy for mitochondrial morphology inliving cells

For the visualization of mitochondrial morphology in living cells we usednormal, transformed and reverted cells cultured in high and low glucose (1 mM)and attached on cover glasses treated with 0.2% gelatin. To visualize themitochondria MitoTracker Green FM (200 nM) and CMXRos (MitoTrackerRed) (60 nM) (Molecular Probes Inc., Eugene, OR, USA) were used, adding thedyes directly in the culture medium for 39′ at 37 °C. Then the cover glasses werewashed twice with PBS and directly analyzed under a Nikon ECLIPSE 90ifluorescence microscope equipped with a b/w CCD camera (Hamamatsu-CoolSnap, Hamamatsu Corporation, Japan), using Plan Apo objective (60× oil;numerical aperture 1.4) and Plan Fluor objective (100×; numerical aperture 1.3).Analysis of the images was also performed using Z-stacks images acquired on amotorized Nikon ECLIPSE 90i (Nikon Corporation, Tokyo, Japan). The imageswere deconvolved using the iterative algorithm in MetaMorph 7 and evaluatedas best focus intensity projections.

2.5. Mitochondrial mass and potential analysis in living cells

Mitochondrial mass and potential were determined with the probesMitoTracker Green (60 nM) and CMXRos (MitoTracker Red) (60 nM)(Molecular Probes) using fluorescence-activated cell sorter (FACScan, Becton-Dickinson). Briefly, cells were trypsinized by treatment with 0.25% trypsin, thenwere suspended in 1 ml of PBS+10% FCS (0.5×106 cells per analysis)containing the two dyes separately at the above indicated final concentrationsand labeled for 30 min at 37 °C in the dark. Subsequently cells were washedonce in PBS+10% FCS and promptly used for flow cytometric analysis. Insome experiments, the cells were pretreated for 10 min with 50 μM carbonylcyanide 3-chlorophenylhydrazone (CCCP, Sigma-Aldrich S.r.l. Milan, Italy)and stains added to the CCCP containing solution for an additional 30 min at37 °C. The unbound dyes were then removed with one wash, as above, andpromptly used for flow cytometric analysis. The percentage and the mean valueof mass and potential were calculated for each sample and corrected for auto-fluorescence obtained from samples of unlabeled cells. Data analysis wasperformed with WinMDI software.


2.6. ATP and ADP quantification

Intracellular ATP and ADP contents were determined based luciferin/luciferase method with use of ApoSensor ATP-ADP ratio bioluminescent assaykit (Eppendorf, Hamburg, Germany), following the manufacturer's instructions.Briefly, the cells supplemented with high or low glucose, were washed withPBS, detached from plates by using trypsin/EDTA solution and then counted.For each assay 10,000 cells/sample were used, and each experiment wasperformed in duplicate. The RLU values recorded by Lumat LB9507luminometer (Berthold Technologies, Bad Wildbad, Germany) were normalizedby protein concentration determined for each sample by the method of Bradfordusing Bio-Rad protein assay (Bio-Rad Laboratories, Milan, Italy).

3. Results

3.1. Transcriptional profiling of genes encoding mitochondrialproteins in normal, transformed and reverted mouse fibroblasts

Transcriptional profiling of normal, transformed andreverted mouse fibroblasts has been reported [10]. Here weextend such an analysis to expression of genes encodingmitochondrial proteins, taking in consideration for thispurpose also genes whose regulation was scored as one foldchange in two independent experiments. Microarray analysiswas validated by RT-PCR on 5-regulated transcripts, usingvinculin as a non-changing control. RNA profiling and RT-PCR results for the selected RNAs showed strong correlation(Fig. 1C).

As shown in Fig. 1A, around 6% of total genes scored asregulated in transformed cells vs. normal cells (with a foldchange ≥1 or ≤−1) are mitochondrial genes. Moreover, if weextend this estimation adding the results of the transcriptionalanalysis reported in our previous paper [10], we observe thataround 10% of total regulated genes (with a fold change ≥1or ≤−1) in the comparison between transformed cells vs.normal cells, are linked to energy-production pathways,indicating that oncogenic k-ras induces a strong remodelingof metabolism during the transformation process. Detailedanalysis of these genes encoding mitochondrial proteins (Fig.1B) showed that several genes encoding subunits ofcytochrome oxidase were either up- or down-regulated intransformed vs. normal cells. RNA levels of the mitochondrialencoded COX proteins (I, II and III), that are not present ontothe Affymetrix chip, were tested by RT-PCR. The level ofthese RNAs was not affected in k-ras-transformed cells (Fig.1C), suggesting that assembly of the COX complex may beimpaired in the transformed cell line. Interestingly, trans-formed cells showed up-regulation of the cytochrome coxidase assembly protein COX 17, a key mitochondrialcopper chaperone involved in the assembly of cytochrome coxidase, which has been found to be over-expressed in non-small cell lung cancer [91]. Expression of several genesencoding subunits of ATP synthase (F1F0, an oligomer ofabout 14 polypeptides that are all essential for its catalyticactivity) was also altered in transformed cells.

Cellular control over adaptive changes in mitochondrialcontent requires ability to sense the requirement for additionalmitochondrial energy production, followed by triggering of

signaling pathways that culminate in an increased andcoordinated expression of “respiratory” genes and ensuing up-regulation of mitochondrial function. These processes arecontrolled by different transcription factors and it wasinteresting to find some important regulators of mitochondrialbiogenesis, integrity and functionality differentially expressedin transformed cells. As shown in Fig. 1B, mitochondrialtranscription factor A (TFAM), essential for the maintenance ofmtDNA [92], was up-regulated in transformed cells. In the samecells, another well-characterized example of regulation ofmetabolic pathways, the transcriptional coactivator peroxisomeproliferator-activated receptor gamma coactivator-1α (PGC-1α)[93], appeared to be down-regulated. PGC-1α activates geneexpression through specific interaction with transcriptionfactors that bind the promoters of genes encoding metabolicenzymes. Two tissue-specific factors as the muscle enhancerfactor (MEF2A) and hepatocyte nuclear factor (HNF4) werefound down-regulated. Other transcription factors, such as thenuclear factors erythroid-related and -derived Nrf1 and Nfe2l3,involved in the activation of transcription of a series of genesinduced in defensive response to antioxidants were also foundto be down-regulated.

Developing mitochondria acquire most of their proteins bythe uptake of mitochondrial preproteins from the cytosol [1]. Tomediate this protein import, both mitochondrial membranescontain independent protein transport systems: the Tommachinery in the outer membrane and the Tim machinery inthe inner membrane. Both TOM40 and syntaxin 2, necessaryproteins for the transport process were found to be up-regulatedin transformed cells [94–96]. Tim44, which serves as an adaptorprotein for the binding of mtHsp70 to the membrane, thatparticipates to the processing of preprotein after cleavage of thepresequence [97,98], also was found to be down-regulated intransformed cells. Another protein that has been found down-regulated in transformed cells was Uncoupling protein 3(UCP3). UCP3 belongs to a protein family that comprisesUCP1, 2 and 3. These proteins are involved in several mito-chondrial processes and in different human pathologies[65,99,100]. We found other mitochondrial genes, indicated asvarious processes in Fig. 1B, both up- and down-regulated intransformed cells.

These k-ras-induced effects are substantially reverted byGEF-DN expression (Fig. 1B compare column T/R with R/T),since they take place under normoxic conditions, they are not anadaptive response of transformed cells to oxygen limitation.

3.2. Alterations in mitochondria morphology of transformedcells is reverted by expression of the GEF-DN

The penetrance of the transformed phenotype in mouse 3T3fibroblasts stably transfected with the k-ras oncogene isdependent on glucose availability [10]. Thus, normal, trans-formed and reverted fibroblasts were grown in media supple-mented with either normal (25 mM) or low (1 mM) initialglucose concentration. Cells were followed for at least 96 h, i.e.from the moment of seeding to when they either reached con-fluence or started to grow in multi strata or to die. Experiments

Fig. 2. Mitochondrial morphology of normal, transformed and reverted cell lines in high glucose availability.Mitochondrial staining of normal (N; A andD), transformed (T; Band E) and reverted (R; C and F) cells withMitoTracker Green FM, using two different objectives (60× and 100×) andmagnified view of corresponding boxed area in the rightpanels. The cells for microscopic analysis were grown for 24 h (1) and 96 h (2) in 25 mM glucose. The pictures are representative of several observations on living cells.



reported in this and the following paragraphs refer to the above-mentioned experimental set-up.

In a first set of experiments we analyzed mitochondriamorphology by fluorescence microscopy of cells stained withMitoTracker Green FM, a dye that becomes fluorescent once itaccumulates in the lipid environment of mitochondria. Asshown in Fig. 2(1), panels A, C, D, F and magnifications,mitochondria of normal and reverted cells, after 24 h of growthin medium supplemented with 25 mM initial glucoseconcentration, appeared fragmented, with short and long rodspartially clustered in the perinuclear region. The same analysisperformed on transformed cells showed a more fragmentedmitochondrial configuration, less organized structures and noclustering in the perinuclear region (Fig. 2(1), panels B, E andmagnification). The differences in mitochondrial structureswere analyzed also at 96 h after plating in the same initialglucose concentration, time at which normal and reverted cellsshowed an increased G1 fraction due to contact inhibition, whiletransformed cells continued to grow [10]. Compared to theearlier time point, normal and reverted cells showed a moreinterconnected mitochondrial network and a decreased peri-nuclear clustering (Fig. 2(2) panels A, C, D, F and magnifica-tions), while transformed cells (Fig. 2(2) panels B, E andmagnification) showed mitochondrial fragmentation andappearance of a larger number of cytoplasmatic, diffuse smallmitochondrial spheres, structures that could be related to thebeginning of apoptotic process, observed at low but consistentfrequency at this time point only in transformed cells (ref. [10]and data not shown).

Mitochondria of normal cells grown for 24 h in mediumsupplemented with 1 mM initial glucose concentration weremore fragmented and less clustered in the perinuclear regionthan the same cells after 24 h of growth in mediumsupplemented with 25 mM initial glucose concentration(compare panel A, D and magnification in Figs. 3((1) and 2(1)). Reverted cells were highly similar to normal cells withmore evident cytoplasmic redistribution and decreased peri-nuclear localization (Fig. 3(1), panel C, F and magnification).On the contrary, no significant redistribution of mitochondriawas observed in transformed cells, whose staining pattern wasvery similar to that of cells grown in 25 mM glucose (comparepanel B, E and magnification in Figs. 3((1) and 2(1)). After96 h of growth in medium supplemented with 1 mM initialglucose concentration, the mitochondrial reticulum of normalcells appeared more extended in long thinner processesdifferent from the pattern observed in cells grown in 25 mMglucose at the same time point (compare Panels A, D andmagnification in Figs. 3(3(2) and 2(2)). A similar morphologywas observed in reverted cells, except that the mitochondrialelongations appeared thicker than in normal cells (Fig. 3(2),panels C, F and magnification). Transformed cells showedmitochondrial fragmentation similar to the one observed inhigh glucose condition (Fig. 3(2), panels B, E and magnifica-tion). In low glucose conditions, transformed cells showed anotable increase of apoptosis, while normal and reverted cellsstrongly accumulate in G1 phase of cell cycle ([10] and datanot shown).

3.3. Alteration in mitochondrial mass and potential oftransformed cells is reverted by expression of the GEF-DN

Cells grown as described in the previous section wereanalyzed for the distribution of mitochondrial mass andpotential by flow cytometry. Cells were independently stainedwith MitoTracker Green FM, (see previous chapter) whosefluorescence monitors total mitochondrial mass and Mito-Tracker Red, a dye whose fluorescence is dependent onmitochondrial potential (ΔΨ). Specificity of MitoTracker Redhas been first verified by flow cytometry. Fig. 4A, B and Cshows the fluorescence level obtained by flow cytometry – withor without treatment with 50 μM CCCP, a mitochondrialdepolarizer – in normal, transformed and reverted cells (panelsA, B, C, respectively). After detachment from the plates, eachcell line was treated for 10 min with 50 μM CCCP and thenlabeled with the MitoTracker Red for additionally 30 min, toanalyze the mitochondrial potential. As shown in the Fig. 4A, Band C the three cell lines showed a strong reduction of potentialafter the treatment with CCCP (compare in the three panels thered curves with blue curves) indicating the specificity of the dyefor mitochondrial potential. Specificity of MitoTracker Red, aswell as of MitoTracker Green was further evaluated bymicroscopy. As shown in Fig. 4 when the cells treated with(Fig. 4D, E and F) or without (Fig. 4G, H and I) CCCP wereloaded with both MitoTracker Red (MTR) and MitoTrackerGreen FM (MTG) and then imaged, they showed only areduction in red staining (MTR) but not of green staining(MTG). In fact the outcome of merging the pictures obtained bythe two dyes gave as results a yellow staining in absence of theuncoupler agent CCCP (Fig. 4G, H and I) and only a greenstaining in presence of the same agent (Fig. 4D, E and F),indicating a reduction of mitochondrial potential and a minoreffect, if any, on mitochondrial mass (MTG staining), as wealready observed using CCCP and MTG staining by flowcytometry (data not shown).

Data for mitochondrial mass are reported in Fig. 5 and datafor mitochondrial potential in Fig. 6. In both Figures, the threeupper panels report auto fluorescence for normal (panel A),transformed (Panel B) and reverted (Panel C) cells. Thesepanels were used to calibrate analysis (i.e. to score unstainedcells) in panels reported below. As shown in Fig. 5, panels Dthrough I, proliferating cells grown for 24 h in mediasupplemented with 25 and 1 mM initial glucose concentrations,showed similar percentage of stained cells (right values on thepanels: LR) and not stained (left values on the panels: LL). Inboth media, the LL values sharply decreased as a function oftime for both normal and reverted cells, reaching a minimumafter 96 h of growth. On the contrary, transformed cellsconsistently showed a peak of LL value at 72 h. Such a valuedecreased at the later time point, but still remained higher thanin normal and reverted cells. In all cell lines, the value of MeanFluorescence (MF) remained about constant after 24 and 72 h ofgrowth, but sharply increased at the last examined time point,i.e. 96 h. At this time point normal cells showed two distinctsubpopulations (panels R and U). The subpopulation with highfluorescence is very limited in transformed cells grown in

Fig. 4. Effect of uncoupling agent CCCP on staining of mitochondria with MitoTracker Red and MitoTracker Green FM. The three cell lines, normal (N),transformed (T) and reverted (R), were treated for 10 min with 50 μM CCCP followed by labeling for 30 min with 60 nM MitoTracker Red and then analyzed byflow cytometry (A, B and C), or labeled with 60 nM MitoTracker Red and 200 nM MitoTracker Green FM after a treatment (D, E and F) or not (G, H and I) with 50μM CCCP and then analyzed by fluorescence microscopy. The results of the merge of the two pictures acquired for both dyes in the same field are shown in the 6bottom panels of microscopic analysis.


25 mM glucose (panel S) resulting in a significantly lower MFvalue as compared to normal cells. Reverted cells showed onintermediate condition (panel T).

Growth in media supplemented with 1 mM initial glucoseconcentration gave a similar pattern for MF, but while themaximum MF reached by normal and reverted cells was lowerthan in 25mMglucose, the maximalMF reached by transformedcells was the same as for the cells grown in 25 mM, so that in thiscondition transformed cells displayed the highest mitochondrialmass. Interestingly at this time point, two distinct subpopula-tions were readily apparent also in transformed cells.

Parallel samples were analyzed for mitochondrial ΔΨ bystaining with MitoTracker Red (Fig. 6). Staining pattern wasquite similar to that observed for MitoTracker Green FMstaining, i.e. the fraction of unstained cells (LL) decreased withtime in both normal and reverted cells, while it remained high intransformed cells. MF steadily increased with time in all celllines. As observed with MitoTracker Green staining, the MFvalue was higher for normal and reverted cells grown in 25 mMglucose concentration, while transformed cells displayed thehigher MF value after growth in media supplemented with1 mM initial glucose concentration. Little, if any, evidence fortwo sub-populations within stained cells was apparent.

Fig. 3. Mitochondrial morphology of normal, transformed and reverted cell linestransformed (T; B and E) and reverted (R; C and F) cells with MitoTracker Greecorresponding boxed area in the right panels. The cells for microscopic analysis wereof several observations on living cells.

3.4. Effect of glucose availability on cellular ATP thereinnormal, transformed and reverted cell lines

Glucose is the main substrate for intracellular ATP genera-tion. We have previously shown that the transformed cell linehas a high rate of glycolysis, necessary to sustain its enhancedproliferative capacity, accompanied by a larger production oflactate and a partial uncoupling of mitochondrial respirationchain [10]. The result of the analysis of mitochondrial potential(ΔΨ), mitochondria propriety strongly associated with thecapacity to generate ATP, performed on the cells grown in highand low glucose availability, showed an increasing potentialalong the time-course and little differences between the threecell lines. Therefore we decided to evaluate the intracellularATP content in cells grown in high and low glucose availability.When the measurement of ATP levels was performed in activeproliferating cells (24 h in 25 and 1 mM glucose) the three celllines showed similar ATP levels (Fig. 7A and B) and a lowADP/ATP ratio (Fig. 7C and D). After 96 h of growth in highglucose medium (25 mM) the amount of ATP contained in thethree cell lines decreased by 35%, 32% and 28% respectivelyfor normal, transformed and reverted cells when compared tovalues obtained at 24 h (Fig. 7A and B), resulting in a slight

in low glucose availability. Mitochondrial staining of normal (N; A and D),n FM, using two different objectives (60× and 100×) and magnified view ofgrown for 24 h (1) and 96 h (2) in 1 mM glucose. The pictures are representative

Fig. 5. Effect of oncogenic K-Ras and glucose availability on themitochondrial mass of proliferating and arrested cells. Normal, transformed and reverted cells, culturedin 25 mM glucose for 24 h (D-F, exponentially growing cells), 72 h (L-N) and 96 h (R-T, G1 arrested cells) and in 1 mM glucose, at the same time points, 24 h (G-H,exponentially growing cells), 72 h (O-Q) and 96 h (U-W, G1 arrested cells), were analyzed by FACS after MitoTracker Green FM staining. (A) Normal, (B) transformedand (C) reverted, panels were used as controls of cell auto fluorescence. Indicated in each panel are the percentage of positive stained population – LowRight - (LR), thenot stained population – Low Left - (LL) and the mean fluorescence of stained population – Mean Fluorescence - (MF). The panels are representative of at least 3experiments.


Fig. 6. Effect of oncogenic K-ras and glucose deprivation on the mitochondrial potential (ΔΨ). Normal, transformed and reverted cells, cultured in 25 mM glucose for24 h (D-F, exponentially growing cells), 72 h (L-N) and 96 h (R-T, G1 arrested cells) and in 1 mM glucose, at the same time points, 24 h (G-H, exponentially growingcells), 72 h (O-Q) and 96 h (U-W, G1 arrested cells), were analyzed by FACS after MitoTracker Red staining. (A) Normal, (B) transformed and (C) reverted panelswere used as controls of cells auto fluorescence. Indicated in each panel are the percentage of positive stained population – Low Right - (LR), the not stainedpopulation – Low Left - (LL) and the mean fluorescence of stained population – Mean Fluorescence - (MF). The panels are representative of at least 3 experiments.


Fig. 7. ATP production and [ADP]/[ATP] ratio of normal, transformed and reverted cells in high and low glucose availability. ATP and ADP content were measuredusing a luciferin-luciferase assay in the three cell lines along the time course in high (A and C) and low glucose availability (B and D). The results were calculated inRLU (relative light unit) after normalization for protein content of each sample.


increase of the ADP/ATP ratio (Fig. 7C and D). In normal cells,the drop in ATP level after 96 h of growth in low glucosemedium was the same observed in high glucose media (36%).Strikingly, ATP level dropped significantly (77%) in trans-formed cells at the same time point, while an intermediate drop(55%) was observed in reverted cells (Fig. 7B). As a result, theADP/ATP ratio in transformed cells increased dramatically ascompared to normal and reverted cell lines (Fig. 7D).

4. Discussion

Increasing evidence accumulated in recent years, confirmsprevious observations indicating that energy metabolism ofcancer cells and tumors significantly differs from that of normalcells and healthy tissues. Tumor cells have been showed to have ahigher glycolytic rate attributed to mitochondrial dysfunctionand/or hypoxic environment of developing tumor, a conditionthat would force cancer cells to use essentially glycolysis togenerate ATP. Mitochondrial dysfunctions have been shown tobe due in part to mtDNA mutation and/or aberrant expressionof metabolic and mitochondrial enzymes, while hypoxia is dueto low vascularization that limits oxygen supply in growingtumors.

4.1. Ras activation and mitochondrial dysfunction

While the relation between oncogenes and tumor suppressorswith onset of tumor phenotype has been well dissected in termsof deregulation of some fundamental cellular processes as cellcycle, survival, apoptosis and migration, less is known about the

influence of oncogenes on energy metabolism of tumors. Acorrelation between Myc activation and p53 inactivation andaltered expression of genes encoding glycolytic and mitochon-drial proteins has been reported [20,22,101–107]. Correlationsbetween oncogenic Ras and energy metabolism have also beenreported [51]. A fully transformed state, obtained by combinedexpression of different transforming proteins (telomerase, largeand small T antigen and H-Ras) showed a correlation betweentumor aggressiveness, dependence on glycolytic energy produc-tion and decreased dependence on mitochondrial energyproduction [23]. Inhibition of Ras using the Ras inhibitortrans-farnesylthiosalicylic acid (FTS) or Ras antisense showeddown-regulation of HIF-1α, glycolysis and ATP with a conse-quent increased apoptosis [108] or up-regulation of mitochon-drial enzymes [109]. The relation between Ras pathways andbiogenesis and activity of mitochondria has been morethoroughly investigated in yeast, where it has been shown thatRas proteins transmit information on nutritional state to mito-chondria by regulating expression and activity of mitochondrialproteins [39,110–112].

Here we make use of a model of immortalized mousefibroblasts and isogenic k-ras transformed and GEF-DN re-verted cells (see Introduction and refs. [10] and [87]), to directlycorrelate oncogenic ras activation with mitochondrial (dys)function. Results obtained here and elsewhere [10] by a combi-nation of techniques are summarized in Fig. 8. Color-codingrefers to transcriptional regulation in transformed vs. normalcells as follows: red, up-regulation; green, down-regulation;yellow, no change. Cyan-colored proteins indicate that no RNAwas detected by RNA profiling assays.

Fig. 8. Metabolic rerouting in transformed mouse fibroblasts by expression of oncogenic K Ras. In transformed cells the expression of oncogenic K-Ras proteininduces a higher rate of glycolysis (red arrow), resulting in accumulation of lactic acid in culture medium, a reduction of fatty acid biosynthesis (green arrow) and apartial uncoupling of mitochondria. These phenomena are substantiated by a transcriptional remodeling of several genes that regulate different pathways (i.e.glycolysis, mitochondrial respiration and cell cycle) most likely necessary to adapt the metabolism of transformed cells to proliferate and survive in normoxic andhypoxic environment, conditions observed in early and late steps of developing tumors. Transcriptional profiling of normal and transformed cells showed that severalgenes encoding mitochondrial proteins are either up-regulated (subunits colored in red) or down-regulated (subunits colored in green) in transformed cells as comparedto normal or reverted cells. Genes whose expression did not change in transformed cells are shown in yellow, while genes not identified in the Affymetrix screen areshown in cyan. This transcriptional remodeling influences the morphology and the capacity to adapt the mitochondria to variation in substrate availability (bottom partof picture). In fact while normal cells increase mitochondrial mass and mitochondrial interconnections (Bottom B and C), probably to facilitate optimal use of theavailable substrate, transformed cells that essentially rely on glycolysis, are able to proliferate until glucose is available (Bottom B) because in low glucose (Bottom C),despite their increase in mitochondrial potential, they go in apoptosis probably due to uncoupled mitochondria (Bottom A) and fragmented mitochondria,characteristics often observed in apoptotic cells or in non-functional mitochondria. GEF-DN expression reverts the transformed phenotype to one very close to thenormal cells. Direct interaction with Ras is shown by heavy black line while “global” phenotypic effects are indicate by thin line (see the bottom part of the figure).



An increased glycolytic flux, down-regulated expression ofseveral genes involved in fatty acid biosynthesis, unbalancedtranscription of genes encoding subunits of the pyruvatedehydrogenase complex, subunits of respiratory complex IIand IV as well as of ATP synthase was observed in ras-transformed fibroblasts vs. their normal and reverted counter-parts (Figs. 1 and 8 and ref. [10]). Altered transcription of genesencoding subunits of complexes IV and ATP synthase has beenassociated with regulation of mitochondrial activity [113] andtumor progression [66–69,114]. Moreover, changes in subunitcomposition of cytochrome c oxidase, observed in differenttissues or after hypoxic treatment, is associated to changes in theactivity of the complex itself [59,115]. Our results suggest anunbalanced composition of the COX complex, with subunitsencoded by nuclear genes being affected more then thoseencoded by mitochondrial DNA (Fig. 1), in keeping withobservation made in prostate, ovarian, colon, esophageal andbreast cancer, where an altered ratio between some nuclear-encoded subunits (IV, Vb and VIc) to mitochondrial-encodedsubunits (I, II and III) has been proposed to alter the rate ofoxidative metabolism [66,116]. Evidence linking expression ofATP-synthase subunits with the rate of oxidative metabolism,has been reported in several tumor models [56,117–120].

RNA profiling assays also indicated down-regulation ofsome key transcriptional regulators involved in the expression ofnuclear and mitochondrial respiratory genes and other proteinsinvolved in mitochondria functionality (see Fig. 8). Interest-ingly, the down-regulation of the transcriptional coactivatorPGC-1α appears, that plays an essential role in mitochondrialbiogenesis, induction of genes of respiratory chain, fatty acidoxidation, heme biosynthetic pathways, and that can bestimulated by environmental signaling followed by variationof cAMP levels in the cells [121–123]. Also interesting, thedown-regulation of UCP3 protein appears. In fact, while thegreat number of studies carried out on this protein did notcompletely clarify its function, several reports indicate that it isinvolved in the enhancement of proton conductance when isactivated by ROS metabolism, and that this might be an impor-tant way to attenuate mitochondrial ROS production and theconsequent oxidative damage [65,99,100]. Other authorsshowed a correlation between levels of expression of UCP3with fatty acid transport and oxidation in muscle [124–126], orglucose metabolism in neuronal cells and UCP3 disrupted mice[125–129].

By taking into account that a large number of reportsunderline the importance of efficient oxidative phosphorylation,and in particular the strong involvement of complexes IVand V,in the execution of apoptosis [44,105,130–132], our dataconverge to indicate a remodeling of energy metabolism andpartial uncoupling of mitochondria [10], as summarized in thebottom panels in Fig. 8. Transformed cells do not increaseoxygen consumption in presence of uncoupler DNP, whilenormal and reverted cells do. Transformed cells respond toglucose shortage by substantially increasing ROS productionand apoptotic activity, while normal and reverted cells arrest inG1. These responses are coherent with several findings reportedin the literature. For instance, deregulation of mitochondrial

activity induced by oncogenic K-ras should influence energeticmetabolism, as shown by inability to respond to DNP (ref. [10],Fig. 8 bottom A) and to produce ATP in low glucose (Fig. 7D),through increased ROS production [10] lead to apoptosis, in rastransformed cells [91,133–135]. Such event is more evident incells grown in low initial glucose concentration (ref. [10], Fig. 8bottom B and C).

Taken together, the transcriptional data presented in thisreport indicate that deregulation of mitochondrial related genesmay contribute to the metabolic shift associated with K-Rastransforming activity, also in consideration that reverted cells, inwhich the GEF-DN is able to strongly decrease the level of Ras-GTP [86,87], showed opposite regulation when compared to thetransformed cells, thereby supporting the notion that reportedresponses are all linked to K-ras over-expression.

4.2. Dynamic alterations of mitochondrial mass andmorphology in transformed cells

Mitochondria are dynamic organelles that can change innumber and morphology during development, cell cycle, asfunction of substrate availability and during the apoptoticprocesses. In fact, at least under some conditions, mitochondriain mammalian cells form a physically interconnected networkthat may represent an efficient system for energy delivery,calcium exchange, intermitochondrial DNA (mtDNA) comple-mentation through exchange of genomes between mitochondria(reviewed in [136]). This complex network is regulated byprocesses of fusion and fission whose rate can be modulated bygrowth conditions, ultimately bringing to an alteration inmitochondrial number and size. Variations of mitochondrialmorphology have been shown to correlate with the switch fromoxidative phosphorylation to glycolysis and vice versa. Adecrease in mitochondrial connectivity leading to formation ofshort, round mitochondria has also been associated withconditions that compromise mitochondrial function [137,138].

Here we show that growing normal and transformed cellsexhibit different mitochondrial morphology. Microscopicanalysis of mitochondria in growing normal cells (24 h,25 mM glucose) showed a less fragmented and organizedstructure positioned around nucleus that became interconnectedand filamentous in cells arresting in G1 phase (96 h, 25 mMglucose). These morphological changes are influenced byglucose availability and cell cycle distribution (that is changingduring the time course of the experiment, ref. [10] and data notshown). Mitochondria remodeling is tightly controlled bymultiple proteins involved in fusion and fission, while organelledistribution is regulated through attachments to microtubulesand actin filaments [139–142]. Cell cycle-dependent changes inmitochondria morphology have been previously reported [42]and proposed to be strongly correlated to energy production inrelation to the cell cycle and to the metabolic status of the cells.Fragmentation of mitochondrial mass and its localization in theperinuclear region of the cells [42,143] has been associated withthe requirement of a metabolism focused on energy production,protein and lipid synthesis for the next mitotic division. Intransformed cells mitochondria appeared as a less defined


structure at 24 h and fragmented at 96 h that could reflect thehigher percentage of S phase cells at 96 h when compared tonormal cells. Fragmentation observed in transformed cells mayindicate also a less active mitochondria, often observed inapoptotic cells or due to the switch to production of ATP byglycolysis (ref. [10] and Fig. 8 bottom B and C). The parallelanalysis of mitochondrial mass and potential offers support tothe hypothesis that mitochondria of transformed cells are lessactive. In fact normal and reverted cells, in presence of fer-mentable substrate (25 mM glucose) together with a majorconnection of mitochondrial network, showed an increase ofboth mitochondrial mass and potential, while transformed cellsshowed lower mitochondrial mass and potential in relation tofragmented mitochondria. This difference is even more strikingby taking into account that a large fraction of transformed cellsremained unstained. Time-course-dependent strongly suggestthat ATP production in transformed cells is largely glucose-dependent, since after 96 h of growth, all three cell lines haveused all glucose, but only transformed cells are unable to sustainATP production. Further, analysis of ATP content in cells grownin 25 mM glucose and 50 μMCCCP for 24 h, showed reductionof total ATP only in normal and revertant cell lines, confirmingthat transformed cells rely on glycolysis more that on oxidativephosphorylation (data not shown).

4.3. Final remarks

The results presented in this paper, together with the reportedpartial uncoupling and larger fraction of apoptotic cells in thetransformed cell line [10], and the reversion of each of thesephenotypes by expression of the GEF-DN (ref. [10], Fig. 8),indicate that activation of the Ras pathway strikingly impacts onenergy and signaling-related aspects of mitochondria function-ality that in turn may affect the terminal phenotype of trans-formed cells.

Acknowledgments

This work has been supported by grants from AIRC, MIUR(Progetto Strategico Oncologia and FIRB-ITALBIONET) toL.A. and MIUR (FAR) to M.V. D.G. has been supported by afellowship from the Levi-Montalcini Association. We thankLara Sala Danna for technical assistance.

References

[1] C.M. Koehler, M.F. Bauer (Eds.), Mitochondrial Function and Biogene-sis, Springer-Verlag, Heidelberg, 2004.

[2] I.E. Scheffler (Ed.), Mitochondria, Wiley-Liss, New York, 1999.[3] I. Budihardjo, H. Oliver, M. Lutter, X. Luo, X. Wang, Biochemical

pathways of caspase activation during apoptosis, Annu. Rev. Cell Dev.Biol. 15 (1999) 269–290.

[4] K. Thress, S. Kornbluth, J.J. Smith, Mitochondria at the crossroad ofapoptotic cell death, J. Bioenerg. Biomembr. 31 (1999) 321–326.

[5] D.R. Green, Apoptotic pathways: ten minutes to dead, Cell 121 (2005)671–674.

[6] Z. Jin, W.S. El-Deiry, Overview of cell death signaling pathways, CancerBiol. Ther. 4 (2005) 139–163.

[7] M.J. Goldenthal, J. Marin-Garcia, Mitochondrial signaling pathways: areceiver/integrator organelle, Mol. Cell. Biochem. 262 (2004) 1–16.

[8] G. van Loo, X. Saelens, M. van Gurp, M. MacFarlane, S.J. Martin,P. Vandenabeele, The role of mitochondrial factors in apoptosis: aRussian roulette with more than one bullet, Cell Death Differ. 9 (2002)1031–1042.

[9] R.S. Balaban, S. Nemoto, T. Finkel, Mitochondria, oxidants, and aging,Cell 120 (2005) 483–495.

[10] F. Chiaradonna, E. Sacco, R. Manzoni, M. Giorgio, M. Vanoni, L.Alberghina, Ras dependent carbon metabolism and transformation inmouse fibroblasts, Oncogene (2006) (published on-line doi: 10.1038/sj.onc.1209528).

[11] O. Warburg, On the origin of cancer cells, Science 123 (1956) 309–314.[12] H.A. Krebs, Otto Heinrich Warburg 18 (1972) 629–699.[13] H.A. Krebs, The Pasteur effect and the relations between respiration and

fermentation, Essays Biochem. 8 (1972) 1–34.[14] D.H. Williamson, H.A. Krebs, M. Stubbs, M.A. Page, H.P. Morris, G.

Weber, Metabolism of renal tumors in situ and during ischemia, CancerRes. 30 (1970) 2049–2054.

[15] W.C. Hahn, R.A. Weinberg, Rules for making human tumor cells,N. Engl. J. Med. 347 (2002) 1593–1603.

[16] L.G. Baggetto, Deviant energetic metabolism of glycolytic cancer cells,Biochimie 74 (1992) 959–974.

[17] M. Board, S. Humm, E.A. Newsholme, Maximum activities of keyenzymes of glycolysis, glutaminolysis, pentose phosphate pathway andtricarboxylic acid cycle in normal, neoplastic and suppressed cells,Biochem. J. 265 (1990) 503–509.

[18] C.V. Dang, G.L. Semenza, Oncogenic alterations of metabolism, TrendsBiochem. Sci. 24 (1999) 68–72.

[19] R.A. Gatenby, R.J. Gillies, Why do cancers have high aerobic glycolysis?Nat. Rev., Cancer 4 (2004) 891–899.

[20] S.P. Mathupala, C. Heese, P.L. Pedersen, Glucose catabolism in cancercells. The type II hexokinase promoter contains functionally activeresponse elements for the tumor suppressor p53, J. Biol. Chem. 272(1997) 22776–22780.

[21] S. Mazurek, E. Eigenbrodt, The tumor metabolome, Anticancer Res. 23(2003) 1149–1154.

[22] R.C. Osthus, H. Shim, S. Kim, Q. Li, R. Reddy, M. Mukherjee, Y. Xu, D.Wonsey, L.A. Lee, C.V. Dang, Deregulation of glucose transporter 1 andglycolytic gene expression by c-Myc, J. Biol. Chem. 275 (2000)21797–21800.

[23] A. Ramanathan, C. Wang, S.L. Schreiber, Perturbational profiling of acell-line model of tumorigenesis by using metabolic measurements, Proc.Natl. Acad. Sci. U. S. A. 102 (2005) 5992–5997.

[24] D.R. Spitz, J.E. Sim, L.A. Ridnour, S.S. Galoforo, Y.J. Lee, Glucosedeprivation-induced oxidative stress in human tumor cells. A funda-mental defect in metabolism? Ann. N. Y. Acad. Sci. 899 (2000) 349–362.

[25] J.S. Modica-Napolitano, K.K. Singh, Mitochondrial dysfunction incancer, Mitochondrion 4 (2004) 755–762.

[26] K.K. Singh, Mitochondrial dysfunction is a common phenotype in agingand cancer, Ann. N. Y. Acad. Sci. 1019 (2004) 260–264.

[27] K.K. Singh, Mitochondria damage checkpoint in apoptosis and genomestability, FEMS Yeast Res. 5 (2004) 127–132.

[28] M. Verma, J. Kagan, D. Sidransky, S. Srivastava, Proteomic analysis ofcancer-cell mitochondria, Nat. Rev., Cancer 3 (2003) 789–795.

[29] G.U. Dachs, D.J. Chaplin, Microenvironmental control of geneexpression: implications for tumor angiogenesis, progression, andmetastasis, Semin. Radiat. Oncol. 8 (1998) 208–216.

[30] N. Raghunand, R.A. Gatenby, R.J. Gillies, Microenvironmental andcellular consequences of altered blood flow in tumours, Br. J. Radiol. 76(Spec No. 1) (2003) S11–S22.

[31] T. Henning, M. Kraus, M. Brischwein, A.M. Otto, B. Wolf, Relevance oftumor microenvironment for progression, therapy and drug development,Anti-cancer Drugs 15 (2004) 7–14.

[32] X.L. Zu, M. Guppy, Cancer metabolism: facts, fantasy, and fiction,Biochem. Biophys. Res. Commun. 313 (2004) 459–465.

[33] M. Guppy, The hypoxic core: a possible answer to the cancer paradox,Biochem. Biophys. Res. Commun. 299 (2002) 676–680.

http://dx.doi.org/doi:10.1038/sj.onc.1209528http://dx.doi.org/doi:10.1038/sj.onc.1209528


[34] S.R. Sennoune, D. Luo, R. Martinez-Zaguilan, Plasmalemmal vacuolar-type H+-ATPase in cancer biology, Cell Biochem. Biophys. 40 (2004)185–206.

[35] S. Harguindey, G. Orive, J. Luis Pedraz, A. Paradiso, S.J. Reshkin, Therole of pH dynamics and the Na+/H+ antiporter in the etiopathogenesisand treatment of cancer. Two faces of the same coin-one single nature,Biochim. Biophys. Acta 1756 (2005) 1–24.

[36] G. Orive, S.J. Reshkin, S. Harguindey, J.L. Pedraz, Hydrogen iondynamics and the Na+/H+ exchanger in cancer angiogenesis andantiangiogenesis, Br. J. Cancer 89 (2003) 1395–1399.

[37] D.J. Discher, N.H. Bishopric, X. Wu, C.A. Peterson, K.A. Webster,Hypoxia regulates beta-enolase and pyruvate kinase-M promoters bymodulating Sp1/Sp3 binding to a conserved GC element, J. Biol. Chem.273 (1998) 26087–26093.

[38] J.S. Carew, P. Huang, Mitochondrial defects in cancer, Mol. Cancer 1(2002) 9.

[39] L. Dejean, B. Beauvoit, O. Bunoust, B. Guerin, M. Rigoulet, Activationof Ras cascade increases the mitochondrial enzyme content of respiratorycompetent yeast, Biochem. Biophys. Res. Commun. 293 (2002)1383–1388.

[40] X. Dong, K. Ghoshal, S. Majumder, S.P. Yadav, S.T. Jacob, Mitochon-drial transcription factor A and its downstream targets are up-regulated ina rat hepatoma, J. Biol. Chem. 277 (2002) 43309–43318.

[41] H. Lu, R.A. Forbes, A. Verma, Hypoxia-inducible factor 1 activationby aerobic glycolysis implicates the Warburg effect in carcinogenesis,J. Biol. Chem. 277 (2002) 23111–23115.

[42] D.H. Margineantu, W. Gregory Cox, L. Sundell, S.W. Sherwood, J.M.Beechem, R.A. Capaldi, Cell cycle dependent morphology changes andassociated mitochondrial DNA redistribution in mitochondria of humancell lines, Mitochondrion 1 (2002) 425–435.

[43] A. Minchenko, I. Leshchinsky, I. Opentanova, N. Sang, V. Srinivas, V.Armstead, J. Caro, Hypoxia-inducible factor-1-mediated expression ofthe 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 (PFKFB3)gene. Its possible role in the Warburg effect, J. Biol. Chem. 277 (2002)6183–6187.

[44] L.A. Shchepina, O.Y. Pletjushkina, A.V. Avetisyan, L.E. Bakeeva, E.K.Fetisova, D.S. Izyumov, V.B. Saprunova, M.Y. Vyssokikh, B.V.Chernyak, V.P. Skulachev, Oligomycin, inhibitor of the F0 part of H+-ATP-synthase, suppresses the TNF-induced apoptosis, Oncogene 21(2002) 8149–8157.

[45] H.M. Sowter, R.R. Raval, J.W. Moore, P.J. Ratcliffe, A.L. Harris,Predominant role of hypoxia-inducible transcription factor (Hif)-1alphaversus Hif-2alpha in regulation of the transcriptional response to hypoxia,Cancer Res. 63 (2003) 6130–6134.

[46] T. Kuwai, Y. Kitadai, S. Tanaka, S. Onogawa, N. Matsutani, E. Kaio, M.Ito, K. Chayama, Expression of hypoxia-inducible factor-1alpha isassociated with tumor vascularization in human colorectal carcinoma, Int.J. Cancer 105 (2003) 176–181.

[47] C.H. Graham, T.E. Fitzpatrick, K.R. McCrae, Hypoxia stimulatesurokinase receptor expression through a heme protein-dependent path-way, Blood 91 (1998) 3300–3307.

[48] L. Tacchini, E. Matteucci, C. De Ponti, M.A. Desiderio, Hepatocytegrowth factor signaling regulates transactivation of genes belonging tothe plasminogen activation system via hypoxia inducible factor-1, Exp.Cell Res. 290 (2003) 391–401.

[49] S. Mazurek, W. Zwerschke, P. Jansen-Durr, E. Eigenbrodt, Metaboliccooperation between different oncogenes during cell transformation:interaction between activated ras and HPV-16 E7, Oncogene 20 (2001)6891–6898.

[50] V. Le Mellay, R. Houben, J. Troppmair, C. Hagemann, S. Mazurek, U.Frey, J. Beigel, C. Weber, R. Benz, E. Eigenbrodt, U.R. Rapp, Regulationof glycolysis by Raf protein serine/threonine kinases, Adv. EnzymeRegul. 42 (2002) 317–332.

[51] P. Vizan, L.G. Boros, A. Figueras, G. Capella, R. Mangues, S. Bassilian,S. Lim, W.N. Lee, M. Cascante, K-ras codon-specific mutations producedistinctive metabolic phenotypes in NIH3T3 mice [corrected] fibroblasts,Cancer Res. 65 (2005) 5512–5515.

[52] R.L. Elstrom, D.E. Bauer, M. Buzzai, R. Karnauskas, M.H. Harris, D.R.

Plas, H. Zhuang, R.M. Cinalli, A. Alavi, C.M. Rudin, C.B. Thompson,Akt stimulates aerobic glycolysis in cancer cells, Cancer Res. 64 (2004)3892–3899.

[53] K. Polyak, Y. Li, H. Zhu, C. Lengauer, J.K. Willson, S.D. Markowitz, M.A. Trush, K.W. Kinzler, B. Vogelstein, Somatic mutations of themitochondrial genome in human colorectal tumours, Nat. Genet. 20(1998) 291–293.

[54] J.A. Petros, A.K. Baumann, E. Ruiz-Pesini, M.B. Amin, C.Q. Sun, J.Hall, S. Lim, M.M. Issa, W.D. Flanders, S.H. Hosseini, F.F. Marshall,D.C. Wallace, mtDNA mutations increase tumorigenicity in prostatecancer, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 719–724.

[55] M.G. Sharp, S.M. Adams, R.A. Walker, W.J. Brammar, J.M. Varley,Differential expression of the mitochondrial gene cytochrome oxidase IIin benign and malignant breast tissue, J. Pathol. 168 (1992) 163–168.

[56] V. Dmitrenko, K. Shostak, O. Boyko, O. Khomenko, V. Rozumenko, T.Malisheva, M. Shamayev, Y. Zozulya, V. Kavsan, Reduction of thetranscription level of the mitochondrial genome in human glioblastoma,Cancer Lett. 218 (2005) 99–107.

[57] E. Gottlieb, I.P. Tomlinson, Mitochondrial tumour suppressors: a geneticand biochemical update, Nat. Rev., Cancer 5 (2005) 857–866.

[58] C. Eng, M. Kiuru, M.J. Fernandez, L.A. Aaltonen, A role formitochondrial enzymes in inherited neoplasia and beyond, Nat. Rev.,Cancer 3 (2003) 193–202.

[59] C. Vijayasarathy, S. Damle, S.K. Prabu, C.M. Otto, N.G. Avadhani,Adaptive changes in the expression of nuclear and mitochondrial encodedsubunits of cytochrome c oxidase and the catalytic activity duringhypoxia, Eur. J. Biochem. 270 (2003) 871–879.

[60] J.J. Briere, J. Favier, V.E. Ghouzzi, F. Djouadi, P. Benit, A.P. Gimenez, P.Rustin, Succinate dehydrogenase deficiency in human, Cell. Mol. LifeSci. 62 (2005) 2317–2324.

[61] P.J. Pollard, J.J. Briere, N.A. Alam, J. Barwell, E. Barclay, N.C. Wortham,T. Hunt, M. Mitchell, S. Olpin, S.J. Moat, I.P. Hargreaves, S.J. Heales,Y.L. Chung, J.R. Griffiths, A. Dalgleish, J.A. McGrath, M.J. Gleeson,S.V. Hodgson, R. Poulsom, P. Rustin, I.P. Tomlinson, Accumulation ofKrebs cycle intermediates and over-expression of HIF1alpha in tumourswhich result from germline FH and SDH mutations, Hum. Mol. Genet.14 (2005) 2231–2239.

[62] M.A. Selak, S.M. Armour, E.D. MacKenzie, H. Boulahbel, D.G. Watson,K.D. Mansfield, Y. Pan, M.C. Simon, C.B. Thompson, E. Gottlieb,Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase, Cancer Cell 7 (2005) 77–85.

[63] G.S. Chuang, A. Martinez-Mir, D.E. Engler, R.F. Gmyrek, A.Zlotogorski, A.M. Christiano, Multiple cutaneous and uterine leiomyo-mata resulting from missense mutations in the fumarate hydratase gene,Clin. Exp. Dermatol. 31 (2006) 118–121.

[64] N.A. Alam, S. Olpin, I.M. Leigh, Fumarate hydratase mutations andpredisposition to cutaneous leiomyomas, uterine leiomyomas and renalcancer, Br. J. Dermatol. 153 (2005) 11–17.

[65] K.S. Echtay, J.L. Pakay, T.C. Esteves, M.D. Brand, Hydroxynonenal anduncoupling proteins: a model for protection against oxidative damage,BioFactors 24 (2005) 119–130.

[66] P.C. Herrmann, J.W. Gillespie, L. Charboneau, V.E. Bichsel, C.P.Paweletz, V.S. Calvert, E.C. Kohn, M.R. Emmert-Buck, L.A. Liotta, E.F.Petricoin, Proteomics 3 (2003) 1801–1810.

[67] A. Isidoro, E. Casado, A. Redondo, P. Acebo, E. Espinosa, A.M. Alonso,P. Cejas, D. Hardisson, J.A. Fresno Vara, C. Belda-Iniesta, M. Gonzalez-Baron, J.M. Cuezva, Breast carcinomas fulfill the Warburg hypothesisand provide metabolic markers of cancer prognosis, Carcinogenesis 26(2005) 2095–2104.

[68] J.M. Cuezva, G. Chen, A.M. Alonso, A. Isidoro, D.E. Misek, S.M.Hanash, D.G. Beer, The bioenergetic signature of lung adenocarcinomasis a molecular marker of cancer diagnosis and prognosis, Carcinogenesis25 (2004) 1157–1163.

[69] A. Isidoro, M. Martinez, P.L. Fernandez, A.D. Ortega, G. Santamaria, M.Chamorro, J.C. Reed, J.M. Cuezva, Alteration of the bioenergeticphenotype of mitochondria is a hallmark of breast, gastric, lung andoesophageal cancer, Biochem. J. 378 (2004) 17–20.

[70] R.L. Barbour, S.H. Chan, Adenine nucleotide transport in hepatoma


mitochondria and its correlation with hepatoma growth rates and tumorsize, Cancer Res. 43 (1983) 1511–1517.

[71] S.H. Chan, R.L. Barbour, Adenine nucleotide transport in hepatomamitochondria. Characterization of factors influencing the kinetics of ADPand ATP uptake, Biochim. Biophys. Acta 723 (1983) 104–113.

[72] A. Chevrollier, D. Loiseau, B. Chabi, G. Renier, O. Douay, Y.Malthiery, G. Stepien, ANT2 isoform required for cancer cell glycolysis,J. Bioenerg. Biomembr. 37 (2005) 307–317.

[73] D.C. Wallace, A mitochondrial paradigm of metabolic and degenerativediseases, aging, and cancer: a dawn for evolutionary medicine, Annu.Rev. Genet. 39 (2005) 359–407.

[74] H.V. Westerhoff, L. Alberghina (Eds.), Systems Biology: Definitions andPerspectives, Springer Verlag, 2005.

[75] G.J. Tordaro, H. Green, An assay for cellular transformation by SV40,Virology 23 (1964) 117–119.

[76] S.M. Barr, E.M. Johnson, Ras-induced colony formation and anchorage-independent growth inhibited by elevated expression of Puralpha inNIH3T3 cells, J. Cell. Biochem. 81 (2001) 621–638.

[77] P. Xia, J.R. Gamble, L. Wang, S.M. Pitson, P.A. Moretti, B.W.Wattenberg, R.J. D'Andrea, M.A. Vadas, An oncogenic role ofsphingosine kinase, Curr. Biol. 10 (2000) 1527–1530.

[78] A.O. Hoff, G.J. Cote, H.A. Fritsche Jr., H. Qiu, P.N. Schultz, R.F. Gagel,Calcium-induced activation of a mutant G-protein-coupled receptorcauses in vitro transformation of NIH/3T3 cells, Neoplasia 1 (1999)485–491.

[79] X. Liu, J. Powlas, Y. Shi, A.X. Oleksijew, A.R. Shoemaker, R. De Jong,T. Oltersdorf, V.L. Giranda, Y. Luo, Rapamycin inhibits Akt-mediatedoncogenic transformation and tumor growth, Anticancer Res. 24 (2004)2697–2704.

[80] N. Anand, S. Murthy, G. Amann, M.Wernick, L.A. Porter, I.H. Cukier, C.Collins, J.W. Gray, J. Diebold, D.J. Demetrick, J.M. Lee, Proteinelongation factor EEF1A2 is a putative oncogene in ovarian cancer, Nat.Genet. 31 (2002) 301–305.

[81] F. Armstrong, M.M. Duplantier, P. Trempat, C. Hieblot, L. Lamant, E.Espinos, C. Racaud-Sultan, M. Allouche, E. Campo, G. Delsol, C.Touriol, Differential effects of X-ALK fusion proteins on proliferation,transformation, and invasion properties of NIH3T3 cells, Oncogene 23(2004) 6071–6082.

[82] D. Piestun, B.S. Kochupurakkal, J. Jacob-Hirsch, S. Zeligson, M.Koudritsky, E. Domany, N. Amariglio, G. Rechavi, D. Givol, Nanogtransforms NIH3T3 cells and targets cell-type restricted genes, Biochem.Biophys. Res. Commun. 343 (2006) 279–285.

[83] X. Guo, L.J. Stafford, B. Bryan, C. Xia, W. Ma, X. Wu, D. Liu, Z.Songyang, M. Liu, A Rac/Cdc42-specific exchange factor, GEFT,induces cell proliferation, transformation, and migration, J. Biol. Chem.278 (2003) 13207–13215.

[84] A.J. Dupuy, K. Morgan, F.C. von Lintig, H. Shen, H. Acar, D.E. Hasz,N.A. Jenkins, N.G. Copeland, G.R. Boss, D.A. Largaespada, Activationof the Rap1 guanine nucleotide exchange gene, CalDAG-GEF I, in BXH-2 murine myeloid leukemia, J. Biol. Chem. 276 (2001) 11804–11811.

[85] K.S. Vogel, L.J. Klesse, S. Velasco-Miguel, K. Meyers, E.J. Rushing, L.F.Parada, Mouse tumor model for neurofibromatosis type 1, Science 286(1999) 2176–2179.

[86] M. Vanoni, R. Bertini, E. Sacco, L. Fontanella, M. Rieppi, S. Colombo, E.Martegani, V. Carrera, A. Moroni, C. Bizzarri, V. Sabbatini, M. Cattozzo,A. Colagrande, L. Alberghina, Characterization and properties ofdominant-negative mutants of the ras-specific guanine nucleotideexchange factor CDC25(Mm), J. Biol. Chem. 274 (1999) 36656–36662.

[87] P. Bossu', M. Vanoni, V. Wanke, M.P. Cesaroni, F. Tropea, G. Melillo, C.Asti, S. Porzio, P. Ruggiero, V. Di Cioccio, G. Maurizi, A. Ciabini, L.Alberghina, A dominant negative RAS-specific guanine nucleotideexchange factor reverses neoplastic phenotype in K-ras transformedmouse fibroblasts, Oncogene 19 (2000) 2147–2154.

[88] S. Kahn, F. Yamamoto, C. Almoguera, E. Winter, K. Forrester, J. Jordano,M. Perucho, The c-K-ras gene and human cancer (review), AnticancerRes. 7 (1987) 639–652.

[89] F. Yamamoto, M. Perucho, Activation of a human c-K-ras oncogene,Nucleic Acids Res. 12 (1984) 8873–8885.

[90] S. Pulciani, E. Santos, L.K. Long, V. Sorrentino, M. Barbacid, ras geneAmplification and malignant transformation, Mol. Cell. Biol. 5 (1985)2836–2841.

[91] C. Suzuki, Y. Daigo, T. Kikuchi, T. Katagiri, Y. Nakamura, Identificationof COX17 as a therapeutic target for non-small cell lung cancer, CancerRes. 63 (2003) 7038–7041.

[92] D. Kang, N. Hamasaki, Mitochondrial transcription factor A in themaintenance of mitochondrial DNA: overview of its multiple roles, Ann.N. Y. Acad. Sci. 1042 (2005) 101–108.

[93] S.M. Houten, J. Auwerx, PGC-1alpha: turbocharging mitochondria, Cell119 (2004) 5–7.

[94] K.M. Abdul, K. Terada, M. Yano, M.T. Ryan, I. Streimann, N.J.Hoogenraad, M. Mori, Functional analysis of human metaxin inmitochondrial protein import in cultured cells and its relationship withthe Tom complex, Biochem. Biophys. Res. Commun. 276 (2000)1028–1034.

[95] K. Gabriel, B. Egan, T. Lithgow, Tom40, the import channel of themitochondrial outer membrane, plays an active role in sorting importedproteins, EMBO J. 22 (2003) 2380–2386.

[96] W. Voos, Tom40: more than just a channel, Nat. Struct. Biol. 10 (2003)981–982.

[97] M.F. Bauer, K. Gempel, A.S. Reichert, G.A. Rappold, P. Lichtner, K.D.Gerbitz, W. Neupert, M. Brunner, S. Hofmann, Genetic and structuralcharacterization of the human mitochondrial inner membrane translocase,J. Mol. Biol. 289 (1999) 69–82.

[98] T. Matsuoka, J. Wada, I. Hashimoto, Y. Zhang, J. Eguchi, N. Ogawa, K.Shikata, Y.S. Kanwar, H. Makino, Gene delivery of Tim44 reducesmitochondrial superoxide production and ameliorates neointimal pro-liferation of injured carotid artery in diabetic rats, Diabetes 54 (2005)2882–2890.

[99] M.D. Brand, T.C. Esteves, Physiological functions of the mitochondrialuncoupling proteins UCP2 and UCP3, Cell Metab. 2 (2005) 85–93.

[100] T.C. Esteves, M.D. Brand, The reactions catalysed by the mitochondrialuncoupling proteins UCP2 and UCP3, Biochim. Biophys. Acta 1709(2005) 35–44.

[101] J.W. Kim, K.I. Zeller, Y. Wang, A.G. Jegga, B.J. Aronow, K.A.O'Donnell, C.V. Dang, Evaluation of myc E-box phylogenetic footprintsin glycolytic genes by chromatin immunoprecipitation assays, Mol. Cell.Biol. 24 (2004) 5923–5936.

[102] F. Li, Y. Wang, K.I. Zeller, J.J. Potter, D.R. Wonsey, K.A. O'Donnell,J.W. Kim, J.T. Yustein, L.A. Lee, C.V. Dang, Myc stimulates nuclearlyencoded mitochondrial genes and mitochondrial biogenesis, Mol. Cell.Biol. 25 (2005) 6225–6234.

[103] S.P. Mathupala, A. Rempel, P.L. Pedersen, Aberrant glycolyticmetabolism of cancer cells: a remarkable coordination of genetic,transcriptional, post-translational, and mutational events that lead to acritical role for type II hexokinase, J. Bioenerg. Biomembr. 29 (1997)339–343.

[104] H. Kondoh, M.E. Lleonart, J. Gil, J. Wang, P. Degan, G. Peters, D.Martinez, A. Carnero, D. Beach, Glycolytic enzymes can modulatecellular life span, Cancer Res. 65 (2005) 177–185.

[105] B. Kadenbach, S. Arnold, I. Lee, M. Huttemann, The possible role ofcytochrome c oxidase in stress-induced apoptosis and degenerativediseases, Biochim. Biophys. Acta 1655 (2004) 400–408.

[106] J.W. Lee, S.H. Bae, J.W. Jeong, S.H. Kim, K.W. Kim, Hypoxia-induciblefactor (HIF-1)alpha: its protein stability and biological functions, Exp.Mol. Med. 36 (2004) 1–12.

[107] P. Carmeliet, Y. Dor, J.M. Herbert, D. Fukumura, K. Brusselmans, M.Dewerchin, M. Neeman, F. Bono, R. Abramovitch, P. Maxwell, C.J.Koch, P. Ratcliffe, L. Moons, R.K. Jain, D. Collen, E. Keshert, E. Keshet,Role of HIF-1alpha in hypoxia-mediated apoptosis, cell proliferation andtumour angiogenesis, Nature 394 (1998) 485–490.

[108] R. Blum, J. Jacob-Hirsch, N. Amariglio, G. Rechavi, Y. Kloog, Rasinhibition in glioblastoma down-regulates hypoxia-inducible factor-1alpha, causing glycolysis shutdown and cell death, Cancer Res. 65(2005) 999–1006.

[109] S. Ohnami, N. Matsumoto, M. Nakano, K. Aoki, K. Nagasaki, T.Sugimura, M. Terada, T. Yoshida, Identification of genes showing


differential expression in antisense K-ras-transduced pancreatic cancercells with suppressed tumorigenicity, Cancer Res. 59 (1999) 5565–5571.

[110] L. Hlavata, T. Nystrom, Ras proteins control mitochondrial biogenesisand function in Saccharomyces cerevisiae, Folia Microbiol. (Praha) 48(2003) 725–730.

[111] C. Chevtzoff, J. Vallortigara, N. Averet, M. Rigoulet, A. Devin, The yeastcAMP protein kinase Tpk3p is involved in the regulation ofmitochondrial enzymatic content during growth, Biochim. Biophys.Acta 1706 (2005) 117–125.

[112] T. Mabuchi, Y. Ichimura, M. Takeda, M.G. Douglas, ASC1/RAS2suppresses the growth defect on glycerol caused by the atp1-2 mutation inthe yeast Saccharomyces cerevisiae, J. Biol. Chem. 275 (2000)10492–10497.

[113] B. Kadenbach, M. Huttemann, S. Arnold, I. Lee, E. Bender,Mitochondrial energy metabolism is regulated via nuclear-codedsubunits of cytochrome c oxidase, Free Radical Biol. Med. 29 (2000)211–221.

[114] F.L. Wang, Y. Wang, W.K. Wong, Y. Liu, F.J. Addivinola, P. Liang, L.B.Chen, P.W. Kantoff, A.B. Pardee, Two differentially expressed genes innormal human prostate tissue and in carcinoma, Cancer Res. 56 (1996)3634–3637.

[115] C. Vijayasarathy, I. Biunno, N. Lenka, M. Yang, A. Basu, I.P. Hall, N.G.Avadhani, Variations in the subunit content and catalytic activity of thecytochrome c oxidase complex from different tissues and differentcardiac compartments, Biochim. Biophys. Acta 1371 (1998) 71–82.

[116] R.C. Krieg, R. Knuechel, E. Schiffmann, L.A. Liotta, E.F. Petricoin III,P.C. Herrmann, Mitochondrial proteome: cancer-altered metabolismassociated with cytochrome c oxidase subunit level variation,Proteomics 4 (2004) 2789–2795.

[117] Y.K. Shin, B.C. Yoo, H.J. Chang, E. Jeon, S.H. Hong, M.S. Jung, S.J.Lim, J.G. Park, Down-regulation of mitochondrial F1F0-ATP synthase inhuman colon cancer cells with induced 5-fluorouracil resistance, CancerRes. 65 (2005) 3162–3170.

[118] Q.Y. He, J. Chen, H.F. Kung, A.P. Yuen, J.F. Chiu, Identification oftumor-associated proteins in oral tongue squamous cell carcinoma byproteomics, Proteomics 4 (2004) 271–278.

[119] F. Capuano, D. Varone, N. D'Eri, E. Russo, S. Tommasi, S. Montemurro,F. Prete, S. Papa, Oxidative phosphorylation and F(O)F(1) ATP synthaseactivity of human hepatocellular carcinoma, Biochem. Mol. Biol. Int. 38(1996) 1013–1022.

[120] H. Simonnet, N. Alazard, K. Pfeiffer, C. Gallou, C. Beroud, J. Demont, R.Bouvier, H. Schagger, C. Godinot, Low mitochondrial respiratory chaincontent correlates with tumor aggressiveness in renal cell carcinoma,Carcinogenesis 23 (2002) 759–768.

[121] J.T. Rodgers, C. Lerin, W. Haas, S.P. Gygi, B.M. Spiegelman, P.Puigserver, Nutrient control of glucose homeostasis through a complex ofPGC-1alpha and SIRT1, Nature 434 (2005) 113–118.

[122] P. Puigserver, Tissue-specific regulation of metabolic pathways throughthe transcriptional coactivator PGC1-alpha, Int. J. Obes. (Lond) 29(Suppl. 1) (2005) S5–S9.

[123] R.C. Scarpulla, Nuclear control of respiratory gene expression inmammalian cells, J. Cell. Biochem. 97 (2006) 673–683.

[124] V. Bezaire, L.L. Spriet, S. Campbell, N. Sabet, M. Gerrits, A. Bonen,M.E. Harper, Constitutive UCP3 overexpression at physiological levelsincreases mouse skeletal muscle capacity for fatty acid transport andoxidation, FASEB J. 19 (2005) 977–979.

[125] P. Schrauwen, D.G. Hardie, B. Roorda, J.C. Clapham, A. Abuin, M.

Thomason-Hughes, K. Green, P.M. Frederik, M.K. Hesselink, Improvedglucose homeostasis in mice overexpressing human UCP3: a role forAMP-kinase? Int. J. Obes. Relat. Metab. Disord. 28 (2004) 824–828.

[126] P. Schrauwen, M.K. Hesselink, The role of uncoupling protein 3 in fattyacid metabolism: protection against lipotoxicity? Proc. Nutr. Soc. 63(2004) 287–292.

[127] G.M. Leinninger, J.W. Russell, C.M. van Golen, A. Berent, E.L.Feldman, Insulin-like growth factor-I regulates glucose-induced mito-chondrial depolarization and apoptosis in human neuroblastoma, CellDeath Differ. 11 (2004) 885–896.

[128] Y. Hong, B.D. Fink, J.S. Dillon, W.I. Sivitz, Effects of adenoviraloverexpression of uncoupling protein-2 and -3 on mitochondrialrespiration in insulinoma cells, Endocrinology 142 (2001) 249–256.

[129] C. Garcia-Martinez, B. Sibille, G. Solanes, C. Darimont, K. Mace, F.Villarroya, A.M. Gomez-Foix, Overexpression of UCP3 in cultured humanmuscle lowers mitochondrial membrane potential, raises ATP/ADP ratio,and favors fatty acid vs. glucose oxidation, FASEB J. 15 (2001) 2033–2035.

[130] S. Matsuyama, Q. Xu, J. Velours, J.C. Reed, The Mitochondrial F0F1-ATPase proton pump is required for function of the proapoptotic proteinBax in yeast and mammalian cells, Mol. Cell 1 (1998) 327–336.

[131] S. Matsuyama, J. Llopis, Q.L. Deveraux, R.Y. Tsien, J.C. Reed,Changes in intramitochondrial and cytosolic pH: early events thatmodulate caspase activation during apoptosis, Nat. Cell Biol. 2 (2000)318–325.

[132] S. Singh, A. Khar, Differential gene expression during apoptosis inducedby a serum factor: Role of mitochondrial F(0)–F(1) ATP synthasecomplex, Apoptosis 10 (2005) 1469–1482.

[133] A.D. Cox, C.J. Der, The dark side of Ras: regulation of apoptosis,Oncogene 22 (2003) 8999–9006.

[134] M. Eskandarpour, S. Kiaii, C. Zhu, J. Castro, A.J. Sakko, J. Hansson,Suppression of oncogenic NRAS by RNA interference induces apoptosisof human melanoma cells, Int. J. Cancer 115 (2005) 65–73.

[135] O. Millan, A. Ballester, A. Castrillo, J.L. Oliva, P.G. Traves, J.M. Rojas,L. Bosca, H-Ras-specific activation of NF-kappaB protects NIH 3T3 cellsagainst stimulus-dependent apoptosis, Oncogene 22 (2003) 477–483.

[136] K.G. Hales, The machinery of mitochondrial fusion, division, anddistribution, and emerging connections to apop

Documents

Expression of transforming K-Ras oncogene affects mitochondrial function and ... · 2017. 1. 3. · Expression of transforming K-Ras oncogene affects mitochondrial function and morphology