Proc. Natl. Acad. Sci. USAVol. 84, pp. 4767-4771, July 1987Biochemistry

DNA sequence analysis with a modified bacteriophage T7DNA polymerase

(DNA polymerase I/reverse transcriptase/chain-terminating inhibitors/2'-deoxyinosine 5'-triphosphate/processivity)

STANLEY TABOR AND CHARLES C. RICHARDSONDepartment of Biological Chemistry, Harvard Medical School, Boston, MA 02115

Contributed by Charles C. Richardson, March 6, 1987

ABSTRACT A chemically modified phage T7 DNA poly-merase has three properties that make it ideal for DNAsequencing by the chain-termination method. The enzyme ishighly processive, catalyzing the polymerization of thousandsof nucleotides without dissociating. By virtue of the modifica-tion the 3' to 5' exonuclease activity is eliminated. The modifiedpolymerase efficiently uses nucleotide analogs that increase theelectrophoretic resolution of bands in gels. Consequently,dideoxynucleotide-terminated fragments have highly uniformradioactive intensity throughout the range ofa few to thousandsof nucleotides in length. There is virtually no background dueto terminations at pause sites or secondary-structure impedi-ments. Processive synthesis with dITP in place of dGTPeliminates band compressions, making possible the unambig-uous determination of sequences from a single orientation.

The dideoxynucleotide method forDNA sequencing is basedon the ability of a DNA polymerase to extend a primer,annealed to the template that is to be sequenced, until achain-terminating nucleotide is incorporated (1). The result-ing series of unique fragments are separated by polyacryl-amide gel electrophoresis. Ideally, a DNA polymerase usedfor sequencing should (i) have high processivity and a rapidrate of nucleotide incorporation, (ii) lack exonuclease activ-ity, and (iii) not discriminate against nucleotide analogs.

(i) Processivity is the ability of a single enzyme molecule topolymerize nucleotides on a DNA chain without dissociating(2). Low processivity can lead to a background of artifactualbands that result from terminations by random dissociationrather than by the incorporation of a chain-terminatingnucleotide. A slow rate of incorporation can accentuatepause sites. (it) An exonuclease activity can cause variabilityin the intensity of radioactive fragments by increasing theprobability of the incorporation of a chain-terminating nucle-otide at positions where there is increased activity. It canenhance pausing at sequences with secondary structure andincrease the discrimination against analogs. (iii) A number ofnucleotide analogs are useful in improving the resolution ofDNA sequencing gels: 2',3'-dideoxynucleoside 5'-triphos-phates (ddNTPs) are used to specifically terminate chains (1),2'-deoxynucleoside 5'-[a-thio]triphosphates are used to labelthe fragments with 35S (3), and analogs ofdGTP (dc7GTP anddITP) are used to remove gel compressions that result frombase-pairing (4-6).The DNA polymerases currently used for sequencing are

the large fragment of Escherichia coli DNA polymerase I(Klenow fragment) (1) and avian myeloblastosis virus (AMV)reverse transcriptase (7). The large fragment of DNA poly-merase I has low processivity (dissociating before the incor-poration of an average of 10 nucleotides) and a 3' to 5'exonuclease activity (2) and discriminates 1000-fold against

dideoxynucleotides (8). Reverse transcriptase has higherprocessivity (synthesizing an average of several hundrednucleotides before dissociation), lacks an exonuclease activ-ity (2), and efficiently incorporates dideoxynucleotides (7).However, its rate of synthesis is very slow (-4 nucleotidesper sec).We describe here a DNA polymerase with properties ideal

forDNA sequencing. It is a chemically modified derivative ofthe DNA polymerase induced by phage T7. The enzyme iscomposed of two proteins associated in a one-to-one stoi-chiometry: the 84-kDa T7 gene 5 protein and the 12-kDa E.coli thioredoxin (9, 10). All of the catalytic activities of theenzyme reside in the gene 5 protein; however, DNA synthe-sis catalyzed by the gene 5 protein alone has very lowprocessivity (11). Thioredoxin binds the gene 5 protein to theprimertemplate to render DNA synthesis processive forthousands of nucleotides (11, 12). The rate of synthesis israpid (>300 nucleotides per sec) (11), more than 70 timesfaster than reverse transcriptase. Native T7 DNA polymer-ase (the gene 5 protein/thioredoxin complex)* has a potent 3'to 5' exonuclease activity (13, 14), 5000 times stronger thanthat of DNA polymerase I (11). The exonuclease activity isinactivated by oxidation of that domain of the gene 5 proteinvia the localized generation of free radicals (15). Modified T7DNA polymerase* retains high processivity and a rapid rateof synthesis and efficiently incorporates nucleotide analogs.It is similar in properties to form I of T7 DNA polymerasepreviously described (16, 17).

MATERIALS

Enzymes. T7 DNA polymerase was purified from cellsoverproducing both gene 5 protein and thioredoxin (11, 18)and converted to the modified form by the localized gener-ation of free radicals that inactivate the exonuclease activityof the gene 5 protein as described (15). The modified enzymehas a specific activity of 8000 units/mg, comparable to thatof the native enzyme (11), and the exonuclease activity is0.01% of its original activity. The enzyme (8000 units/ml) isstored in 10 mM potassium phosphate, pH 7.4/0.1 mMEDTA/0.1 mM dithiothreitol/50% glycerol at -20°C. Thelarge fragment ofE. coliDNA polymerase I was purified fromthe overproducing strain CJ155 (19). Avian myeloblastosisvirus reverse transcriptase was from Boehringer Mannheim.DNA, Oligonucleotides, and Nucleotides. Two DNA tem-

plates were used: M13 mGP1-2 DNA is a 9950-base-pair (bp)derivative of vector M13mp8 that contains a 2707-bp frag-

Abbreviations: dc7GTP, 2'-deoxy-7-deazaguanosine 5'-triphos-phate; ddNTP, 2',3'-dideoxynucleoside 5'-triphosphate.*We refer to the T7 gene 5 protein/thioredoxin complex as "nativeT7 DNA polymerase," acknowledging the fact that T7 gene 5protein in the absence of thioredoxin has all the catalytic activitiespresent in T7 DNA polymerase (11). "Modified T7 DNA polymer-ase" refers to native T7 DNA polymerase that has been chemicallymodified to inactivate its 3' to 5' exonuclease activity (15).

4767

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 1,

202

0

4768 Biochemistry: Tabor and Richardson

ment of phage T7 DNA (T7 base pairs 3133-5840; ref. 20)inserted via linkers between the EcoRI and HindIII sites ofM13mpl0; the strand synthesized by primer elongation is theantisense strand of T7 DNA. mHT1916 DNA is a derivativeof M13mp18 containing a 1778-bp insert of the speD region ofE. coli DNA (21). The 17-mer M13 DNA sequencing primer(GTTTTCCCAGTCACGAC) was from New EnglandBiolabs. dITP and HPLC-purified dNTPs and ddNTPs werefrom Pharmacia P-L Biochemicals. 2'-Deoxy-7-deazaguano-sine 5'-triphosphate (dc7GTP) was from Boehringer Mann-heim. [a-[35S]thio]dATP (1000 Ci/mmol; 1 Ci = 37 GBq) wasfrom New England Nuclear.

Film for Autoradiography. Kodak XAR-5 or OM-1 film wasused for autoradiography. OM-1 provides higher contrast andresolution than XAR-5, an advantage for sequencing gelsdespite the 3-fold higher sensitivity of XAR-5.

SEQUENCING PROCEDURE

Annealing Reaction. Five-fold-concentrated sequencingbuffer (5x SB) is 200 mM Tris HCl, pH 7.5/50 mMMgCl2/250 mM NaCl. The annealing reaction mixture (10 ,ul)contains 2 ,ug of template DNA, 0.2 ng of primer (an equalmolar ratio to the template), and 2 ,ul of 5 x SB. The mixtureis heated to 65°C for 2 min, then cooled to room temperatureover 30 min.

Labeling Reaction. A single "labeling" reaction is used forall four termination reactions. To the annealing mixture (10Al) is added 2 ,l of 2 ,M 3dNTPs (2 ,uM each dGTP, dTTP,and dCTP), 1 Al of 100 mM dithiothreitol, and 0.1-0.5 ,ul of10 ,uM [a-[35S]thio]dATP (1000-1500 Ci/mmol). Immedi-

ately prior to the reaction, modified T7 DNA polymerase isdiluted 1:8 (1000 units/ml) in 20 mM Tris HCl, pH 7.5/5 mMdithiothreitol/0.005% bovine serum albumin to reduce theglycerol concentration; >0.5% glycerol in the gel samplesdistorts the migration of fragments 450-550 nucleotides inlength. Labeling is begun by the addition of 2 ,l (2 units) ofdiluted polymerase, a 2-fold molar excess over templatemolecules. Incubation is at room temperature for 5 min, bywhich time the reaction is complete; incubation can becontinued for up to 20 min. Four aliquots of this "labeling"reaction mixture are used for the "termination" reactions.

Extension-Termination Reaction. Four separate dideoxy"termination" mixtures are prepared in 1.5-ml microcentri-fuge tubes. Each mixture (2.5 ,ul) contains 0.5 ,l of 5x SB,150 ,uM 4dNTPs (150 ,uM each dNTP), and 15 ,AM ddNTP,where ddNTP is ddGTP, ddATP, ddTTP, or ddCTP. Thetubes are kept closed to prevent evaporation and are warmedto 37°C a minute before the reactions are started. Threemicroliters of the above labeling reaction mixture is added toeach termination mixture and incubated at 37°C for 5 min.The reaction is largely complete within several seconds, butincubations can be continued for up to 30 min. Five micro-liters of stop solution (95% formamide/20 mM EDTA/0.05%xylene cyanol/0.05% bromophenol blue) is added. The mix-tures are heated at 75°C for 2 min immediately prior to loading2 Al onto the gel.

Factors Affecting Extension Lengths. Two parameters de-termine the average extension length. (i) During labeling thedNTP concentration is sufficient for an average extension of30 nucleotides, although extensions will range from a few toover a hundred nucleotides; 1-2 ,g ofDNA must be used foroptimal results. (ii) The length of the extensions in thetermination reaction will depend on the ratio of dNTP toddNTP. A ratio of 10:1 results in half the fragments termi-nating within an additional 30 nucleotides, assuming nodiscrimination between dNTPs and ddNTPs. This ratio (10: 1)is optimal for determining sequences from the primer up to=400 nucleotides. For determination of longer sequenceseither the dNTP concentration in the labeling reaction should

be increased (e.g., 5-fold) or the concentration of ddNTP inthe termination reaction should be decreased (e.g., to 5 AuM,resulting in a dNTP/ddNTP ratio of 30:1).Replacement of dGTP with dITP. To eliminate band com-

pressions dITP is substituted for dGTP in both the labelingand termination reactions at twice the concentration ofdGTP. ddGTP is retained (ddITP is not used). Modified T7DNA polymerase shows a 10-fold preference for the incor-poration of ddGTP over dITP; thus extension-terminationreactions using dITP and ddGTP contain one-fifth the con-centration of ddGTP used with dGTP. Since DNA containingdITP is particularly sensitive to the residual low levels ofexonuclease, termination reactions are limited to 5 min. Thefour reactions using dITP are carried out in conjunction with,rather than to the exclusion of, the four reactions usingdGTP, since the presence of dITP results in reducedprocessivity and a slightly diminished overall quality.

RESULTSAn Example. Our procedure using modified T7 DNA

polymerase involves two separate reactions: an initial reac-tion in which the primer is labeled radioactively ("labeling"step) followed by a processive extension in the presence ofddNTPs ("termination" step). In the labeling reaction, lowtemperature and limiting levels of dNTPs reduce theprocessivity of the enzyme, resulting in radioactive frag-ments ranging in size from a few to 150 nucleotides. In thetermination reaction, increased temperature and high dNTPconcentration are used to render the enzyme processive untila ddNTP is incorporated.A DNA sequencing gel is presented for the reaction using

modified T7 DNA polymerase with either dGTP (Fig. 1 a andc) or dITP (Fig. 1 b and d). The radioactive bands have highlyuniform intensity and there is no detectable backgroundradioactivity. Occasional bands are as much as 2- to 3-foldmore intense than average; they occur at the third position ofspecific trinucleotide sequences (e.g., TCT, AAG, GCA,CCT). The sequencing reaction is dissected in the experi-ments shown in Fig. 1 e andf. By 5 min the labeling reactionis virtually complete (Fig. le). Terminations are predomi-nantly at positions preceding by one nucleotide the sites ofdGTP incorporation, reflecting the fact that dGTP happenedto be the limiting nucleotide. Incorporation is very efficient:when [a-[35S]thio]dATP is limiting, more than 80% of theanalog is incorporated. The termination reaction is completewithin 1 min (Fig. lf).

Modified T7 DNA Polymerase Is Highly Processive. In theexperiment shown in Figs. 2 and 3, reactions were carried outwith a 5'-32P-labeled 17-mer primer, annealed to the 10,000-nucleotide mGPl-2 DNA template, and a limiting level ofDNA polymerase (a 1:10 ratio of polymerase to primer-templates). After various reaction times the products wereanalyzed by agarose (Fig. 2) or denaturing polyacrylamide(Fig. 3) gel electrophoresis. Modified T7 DNA polymeraseextends a high percentage of the primers the length of thetemplate prior to reinitiating synthesis on new primers (Figs.2a and 3a). Some templates are replicated by 30 sec, a ratein excess of 300 nucleotides per sec. This rate is 3 times fasterthan that of native T7 DNA polymerase (11). A 10-foldincrease in enzyme concentration results in complete repli-cation of most molecules within 2 min (Fig. 2b).The large fragment ofDNA polymerase I has a processivity

too low to be detected by agarose gel electrophoresis (Fig.2c); denaturing polyacrylamide gel electrophoresis showsthat it dissociates on average before the incorporation of 10nucleotides (Fig. 3b). The rate of elongation is stronglydependent on enzyme concentration; a 10-fold increase inconcentration results in an -8-fold increase in extensionlengths at comparable times (compare Fig. 3 c with b).

Proc. Natl. Acad. Sci. USA 84 (1987)

Dow

nloa

ded

by g

uest

on

Nov

embe

r 1,

202

0

Proc. Natl. Acad. Sci. USA 84 (1987) 4769

a b c ddGTP dITP dGTP dITP

GaTC'GCC OAK T02

800 b ---bo - ;~~

--6

MILAn=

-

e f gLabe~lng Termination Labeleo(Mod 17) (ddCTP) (Nat I

UU ~- -

333~_

~_- _ _

= 4

- -M

_As

_t _

_' _ 30

3 -

1' 5' 30 1' 5' 30O

FIG. 1. Autoradiograph of a polyacrylamide gel showinproducts of sequencing reactions using modified T7 DNA polase. (a-d) Examples are shown of the sequencing reactioimGP1-2 DNA in the presence of either dGTP (a and c) or dITP Id). Electrophoresis was for 12 hr (a and b) or 2 hr (c-g). (e) Aliwere removed from the labeling reaction at 1, 5, and 30 miiplaced into stop solution. (f) Labeling was for 5 min, followecddCTP termination reaction for 1, 5, and 30 min. (g) Lalreaction was carried out using 2 units of native T7 DNA polymcand aliquots were removed at 1, 5, and 30 min. Markers refer Inumber of nucleotides incorporated in a and b (left) or c-g (rigid, arrows indicate "holes" (H) corresponding to fragments coting dITP that are rapidly degraded (see Discussion). Electroph(was in 7% acrylamide/0.3% N,N'-methylenebisacrylamide geltaining 7 M urea in a buffer of 100mM Tris borate (pH 8.9) and:EDTA, using wedge spacers (22).

ng-7)

- 300

a b c dMod T7 _ Mod T7_ Pol'I PT(I1 10) 11) ( 0) '1 1)

,O-OCO-

10,000-- -

mruesO0 5 2 8 30 0 552 6 30 05 2 8 30C5 2 8 30

-20C

FIG. 2. Autoradiograph of an agarose gel comparing theprocessivity of modified T7 DNA polymerase (a and b), largefragment ofDNA polymerase I (c), and reverse transcriptase (d). Theprimer template was the 5'-32P-labeled 17-mer primer annealed to the10,000-nucleotide mGP1-2 DNA (11). The ratio of polymerase toprimertemplate was either 1:10 (a and c) or 1:1 (b and d). Termina-

-50 tion reaction conditions were used (without ddNTPs or NaCl).Aliquots were removed at 0.5, 2, 8, and 30 min and placed into stopsolution. Markers 0 and 10,000 refer to the number of nucleotidesincorporated. "P" is the position of "panhandle" structures thatresult from fully replicated molecules undergoing strand-displace-ment synthesis followed by strand-switching (23). Electrophoresiswas in a 0.6% agarose gel in a buffer containing 100 mM Tris borate(pH 8.3), 1 mM EDTA, and 50 gtg of ethidium bromide per ml.

ddNTPs and dNTPs are incorporated at equal efficiencies,-10 then 70% of the extensions will terminate within the first

three potential sites. ddATP, ddTTP, ddCTP, and ddGTP areeach examined in Fig. 4 a, b, c, and d. In each case, reactionswere carried out with modified T7 DNA polymerase (lane M),

ig the the large fragment ofDNA polymerase I (lane I), and reverse[ymer- transcriptase (lane R). Modified T7 DNA polymerase shows(ns on minimal discrimination (at most 2-fold), whereas reverseaquots transcriptase discriminates approximately 5-fold more thann and does modified T7 DNA polymerase. The large fragment ofI by abelingerase,to theit). Inntain-oresisl con-1 mM

a b c dMod. T7 Poll PolI RT'1110) (11001)1(i. 40) i11

> 200^-

eRT

( A1)

I

Reverse transcriptase has an intermediate processivity, dis-sociating on average after the incorporation of several hun-dred nucleotides (Figs. 2d and 3d). Specific sites are strongimpediments. The rate of elongation is four nucleotides persec, 1/70th that of modified T7 DNA polymerase, and isindependent of enzyme concentration (Fig. 3 d and e).

Modified T7 DNA Polymerase Lacks a 3' to 5' Exonuclease.Labeling reactions using modified T7 DNA polymerasecontinue until the dNTP pools are exhausted, after which theextensions are stable in prolonged incubation (Fig. le). Incontrast, native T7 DNA polymerase rapidly degrades theextensions once the dNTPs are depleted (Fig. ig); it effi-ciently removes nucleotides containing an a-phosphothion-ate linkage ([a-[35S]thio]dAMP), a linkage resistant to the 3'to 5' exonuclease activity of E. coli DNA polymerase 1 (24).Native T7 DNA polymerase will also degrade dideoxynucle-otide-terminated fragments (see below).

Modified T7 DNA Polymerase Incorporates ddNTPs at anEfficiency Comparable to that for dNTPs. We have analyzedthe frequency at which the four ddNTPs are incorporatedrelative to the four dNTPs. Termination reactions werecarried out using a 5'-32P-labeled 17-mer primer annealed tothe M13 DNA template and a dNTP/ddNTP ratio of 2:1. If

20 -

mmi/nes 1/3 33 3 3 3 /313

FIG. 3. Autoradiograph of a polyacrylamide gel comparing theprocessivity of modified T7 DNA polymerase (a), large fragment ofDNA polymerase I (b and c), and reverse transcriptase (d and e).Reaction conditions are described in the legend to Fig. 2. The ratioof polymerase to primer-template was either 1:100 (b), 1:10 (a, c, andd), or 1:1 (e). Aliquots were removed at 0.3, 1, and 3 min and placedinto stop solution. Markers refer to the number of nucleotidesincorporated. Electrophoresis was in an 8% acrylamide/0.4% N,N'-methylenebisacrylamide gel containing 7 M urea and a buffer of 100mM Tris borate (pH 8.3) and 1 mM EDTA.

Biochemistry: Tabor and Richardson

Dow

nloa

ded

by g

uest

on

Nov

embe

r 1,

202

0

4770 Biochemistry: Tabor and Richardson

a b c

MIR MIR MIR.- ,-n *.

>200-

100-

50-*y

a

d e fdc7GTP dITP

MIR 12 12

a

9 hNat T 7 Pol I1' 4'220 4'20'

Z.

.w .V..

9is

.V

:Pla 4 ra

20-

**

*

.* Ia.

I-~~~I:~~~~-,..s

* -: a

+~ ~~~~~* ; &sib o*its. fl0-# a 9 ' 4. , 9

ddATP ddTTP ddCTP L- ---- -dT

FIG. 4. Autoradiograph of a polyacrylamide gel showing theefficiency of incorporation of ddNTPs. The primer-template was the5'-32P-labeled 17-mer primer annealed to mGP1-2 DNA (11). Termi-nation reaction conditions were used with an equal molar ratio ofpolymerase to primer-template molecules. (a-d) Reactions were for20 min in mixtures containing 40 gM 4dNTPs and 20 ILM ddNTP,where the ddNTP was ddATP (a), ddTTP (b), ddCTP (c), or ddGTP(d-h). Polymerases used were modified T7 DNA polymerase (lanesM), large fragment of DNA polymerase I (lanes I), and reversetranscriptase (lanes R). (e and f) Reaction mixtures containedmodified T7 DNA polymerase, 20 ,M ddGTP and (in place of dGTP)either 40 AM dc7GTP (e, lane 1), 80 AM dc'GTP (e, lane 2), 40 /iMdITP (f, lane 1), or 400 /iM dITP (f, lane 2). (g and h) Reactions wereas described for d (in mixtures containing ddGTP), using either nativeT7 DNA polymerase (g) or large fragment of DNA polymerase I (h)at a 1:2 (g) or 1:20 (h) ratio of polymerase to template; aliquots wereremoved at 1, 4, and 20 min and placed into stop solution. Markersrefer to the number of nucleotides incorporated. Electrophoresis wasas described for Fig. 3.

DNA polymerase I does not terminate for at least severalhundred nucleotides. This result is consistent with earlierstudies demonstrating a 1000-fold discrimination by DNApolymerase I against ddTTP (8), with the high ddNTP/dNTPratio (50-250:1) required for DNA sequencing with DNApolymerase I large fragment (1), and the much lowerddNTP/dNTP ratios (1:5) used for DNA sequencing withreverse transcriptase (7). The efficiency of utilization ofdc7GTP and dITP by modified T7 DNA polymerase is shownin Fig. 4 e andf. dc7GTP is required at the same concentrationas dGTP to obtain the same frequency of terminations byddGTP, whereas dITP is required at a 10-fold higher level.The ability of native T7 DNA polymerase to incorporate

ddGTP is shown in Fig. 4g. Fragments corresponding to sitesterminated by ddGTP appear at 1 min. However, withincreasing time, synthesis is reinitiated on these fragmentsand they are replaced by ones that have incorporated ddGTPat sequences more distant. Such transient termination sitescorresponding to the incorporation of ddGTP do not occurwith DNA polymerase I, although they do occur at other sitesdue to dissociation (Fig. 4h). Native T7 DNA polymerasethus discriminates against ddNTPs not by selecting againsttheir incorporation, as is the case with DNA polymerase 1 (8),but rather by removing the analogs.

dGTP dITP dc7GTPG C A T G CA T G C AT

fll

a-

a: 5' GGCGGCTTACCGCAAtIT 3'

~~~~~~

b:5' TGGCGGAGC*CTGGG'AGC 3'******* t ft ft

C:5' ATCTGGCGGAGCCTGGGAGCTCCGCCAGAGCCGTTA 3

FIG. 5. Autoradiograph of a polyacrylamide gel comparing con-pressions after incorporation of dGTP, dITP, and dc'GTP. Reactionconditions were as described, substituting either dITP or dc'GTP fordGTP. The sequence shown is from mHT1916, which contains aregulatory region of the E. coli speD gene (21). Each compression isbracketed, and the corresponding sequence is shown below. Regionsof dyad symmetry are underlined, asterisks are above nucleotidescorresponding to bands compressed in the presence of dGTP, andarrows are above "expanded" nucleotides. Electrophoresis Was asdescribed for Fig. 1.

Incorporation of dITP by Modified T7 DNA PolymeraseEliminates Band Compressions. G+C-rich sequences withdyad symmetry can produce band compressions on a gel atpositions where the sequence at the 3' end stabilizes thesecondary structure (6). We compared the incorporation oftwo analogs of dGTP (dITP and dc7GTP), using modified T7DNA polymerase on a template that contains three regions ofcompression (Fig. 5). In sequence a, the dyad symmetryconsists of a 4-base stem and a 4-base loop, resulting in acompression of 1 nucleotide at the 3' end of the stem. Insequence b, there is a 3-base stem and a 3-base loop, with thelast 2 nucleotides at the 3' end of the stem compressed. Insequence c, the stem is 11 nucleotides (2 are A-T base pairs),the loop is 6 nucleotides, and the 7 nucleotides at the 3' endof the stem are compressed. In all three examples thefragments corresponding to the first several noncomplemen-tary nucleotides at the 3' end of the stemn have a compensa-tory "expansion"; these nucleotides destabilize the stem,causing the fragments to be retarded more than would bepredicted by the simple addition of each nucleotide. In everycase dITP removes the compressions, resulting in the uni-form migration of all fragments. In contrast, dc7GTP does notresolve the compression in sequence b, although it greatlydiminishes the ones in sequences a and c.

DISCUSSIONThe procedure we present for DNA sequencing exploits theunique attributes of modified T7 DNA polymerase. In thelabeling reaction, more than 80% of the radioactivity isincorporated. The termination reaction extends the labeledprimers under processive conditions until a dideoxynucle-

Proc. Natl. Acad. Sci. USA 84 (1987)

c

Dow

nloa

ded

by g

uest

on

Nov

embe

r 1,

202

0

Proc. Nati. Acad. Sci. USA 84 (1987) 4771

otide is incorporated. Since modified T7 DNA polymeraseshows minimal discrimination against ddNTPs, low levels ofthese analogs can be used. Processive synthesis by modifiedT7 DNA polymerase is extremely rapid, requiring shortreaction times (<5 min) for both labeling and terminationsteps.Compression of bands on a sequencing gel is a problem

inherent to specific sequences and is independent of thepolymerase used to synthesize the fragments (1, 5, 6). Theyoccur in sequences with dyad symmetry containing predom-inantly G-C base pairs. A compression begins when thefragment length is sufficient to form a stable hairpin structure,resulting in anomalously rapid migration. We have comparedthe incorporation oftwo different analogs ofdGTP (dITP anddc7GTP) in three regions of compression. In each case, aswell as in more than 50 others tested by us, the incorporationof dITP in place of dGTP eliminates the compression. Incontrast, dc7GTP only diminishes the effect. Inosine, whichlacks the exocyclic amino group of guanosine, hydrogenbonds considerably more weakly to cytidine (25). Indeazaguanosine the N-7 of the guanine nucleus is replaced bya methine moiety. Our results suggest that most compres-sions are due to standard Watson-Crick base-pairing. Theformation of alternative Hoogsteen base pairs (4) does nothave a role, since deazaguanosine but not inosine woulddestabilize such base pairs. Deazaguanosine must reducecompressions by pairing with cytidine more weakly than doesguanosine, although more strongly than inosine. dITP is lesseffective with DNA polymerase I (4) due to the lowprocessivity of this enzyme; dissociations within a region ofdyad symmetry will result in the termini becoming displacedfrom the template. Reinitiation at those termini will beinefficient, resulting in an artifactual band in all four lanes.The low level of polymerase molecules that have not lost

their exonuclease activity by chemical modification (0.01%)is not a problem in the standard sequencing reaction. How-ever, with prolonged incubation the residual activity willdegrade specific termini. The factors responsible for thedegradation of particular sites are not understood. Onepossible explanation is that they reflect a strong specificity ofthe exonuclease activity for single-stranded DNA, with itsactivity on double-stranded DNA (13, 14) being a conse-quence of degradation of frayed 3' termini. In support of thisexplanation, some sensitive sites occur within regions ofdyad symmetry, where the displacement of the dideoxyterminus will be favored. The number of susceptible sites andtheir rate of degradation are greatly enhanced by dITP (seeFig. ld) and to a lesser extent by dc7GTP, since these analogsfurther destabilize the helix. Due to the difficulty of comn-pletely eliminating the exonuclease activity chemically, thereare clear advantages in obtaining a genetic mutation thatwould accomplish this.The properties of modified T7 DNA polymerase suggest its

use for other applications. Its efficient use of low concentra-tions of radioactive nucleotides is an advantage in thepreparation ofDNA probes. Its high processivity and lack ofassociated exonuclease activity ate ideal properties for the

enzymatic amplification of large DNA fragments, a processcurrently limited to fragments at most several hundred basesin length (26). The absence of background pause sites and therelatively uniform distribution of dideoxy-terminated frag-ments can be expected to enhance the resolution possiblewith automated DNA sequence analysis (27).

We thank U. Ihgrid Richardson and Celia and Herbert Tabor fortheir critical reading of this manuscript. This investigation wassupported by U.S. Public Health Service Grant A106045.

1. Sanger, F, Nicklen, S. & Coulson, A. R. (1977) Proc. Natl.Acad. Sci. USA 74, 5463-5467.

2. Kornberg, A. (1982) Supplement to DNA Replication (Free-man, San Francisco).

3. Biggen, M. D., Gibson, T. J. & Hong, G. F. (1983) Proc. Natl.Acad. Sci. USA 80, 3963-3965.

4. Mizusawa, S., Nishimura, S. & Seela, F. (1986) Nucleic AcidsRes. 14, 1319-1324.

5. Mills, D. R. & Kramer, F. R. (1979) Proc. Natl. Acad. Sci.USA 76, 2232-2235.

6. Gough, J. A. & Murray, N. E. (1983) J. Mol. Biol. 166, 1-19.7. Zagursky, R. J., Baumeister, K., Lomax, N. & Berman, M. L.

(1985) Gene Anal. Tech. 2, 89-94.8. Atkinson, M. R., Deutscher, M. P., Kornberg, A., Russell,

A. F. & Moffatt, J. G. (1969) Biochemistry 8, 4897-4904.9. Modrich, P. & Richardson, C. C. (1975) J. Biol. Chem. 250,

5515-5522.10. Mark, D. F. & Richardson, C. C. (1976) Proc. Natl. Acad. Sci.

USA 73, 780-781.11. Tabor, S., Huber, H. & Richardson, C. C. (1987) J. Biol.

Chem., in press.12. Huber, H., Tabor, S. & Richardson, C. C. (1987) J. Biol.

Chem., in press.13. Hori, K., Mark, D. F. & Richardson, C. C. (1979) J. Biol.

Chem. 254, 11598-11604.14. Adler, S. & Modrich, P. (1979) J. Biol. Chem. 254,

11605-11614.15. Tabor, S. (1987) Dissertation (Harvard Univ., Boston).16. Fischer, H. & Hinkle, D. C. (1980) J. Biol. Chem. 255,

7956-7964.17. Engler, M. J., Lechner, R. L. & Richardson, C. C. (1983) J.

Biol. Chem. 258, 11165-11173.18. Tabor, S. & Richardson, C. C. (1985) Proc. Natl. Acad. Sci.

USA 82, 1074-1078.19. Joyce, C. M. & Grindley, N. D. F. (1983) Proc. Natl. Acad.

Sci. USA 80, 1830-1834.20. Dunn, J. J. & Studier, F. W. (1983) J. Mol. Biol. 8, 452-469.21. Tabor, C. W. & Tabor, H. (1987) J. Biol. Chern., in press.22. Ansorge, W. & Labeit, S. (1984) J. Biochem. Biophys. Meth-

ods 10, 237-243.23. Lechner, R. L., Engler, M. J. & Richardson, C. C. (1983) J.

Biol. Chem. 258, 11174-11184.24. Kunkel, T. A., Eckstein, F., Mildvan, A. S., Koplitz, R. M. &

Loeb, L. A. (1981) Proc. Natl. Acad. Sci. USA 78, 6734-6738.25. Inman, R. B. & Baldwin, R. L. (1964) J. Mol. Biol. 166,

477-535.26. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn,

G. T., Erlich, H. A. & Arnheim, N. (1985) Science 230,1350-1354.

27. Smith, L. M., Sanders, J. Z., Kaiser, R. J., Hughs, P., Dodd,C., Connell, C. R., Heiner, C., Kent, S. B. H. & Hood, L. E.(1986) Nature (London) 321, 674-679.

Biochemistry: Tabor and Richardson

Dow

nloa

ded

by g

uest

on

Nov

embe

r 1,

202

0