Cross-talk between 4-1BB and TLR1 TLR2 Signaling …...Research Article Cross-talk between 4-1BB and TLR1–TLR2 Signaling in CD8þ T Cells Regulates TLR2's Costimulatory Effects Ann

Research Article

Cross-talk between 4-1BB and TLR1–TLR2Signaling in CD8þ T Cells Regulates TLR2'sCostimulatory EffectsAnn Mary Joseph1,3, Ratika Srivastava1, Jovanny Zabaleta2, and Eduardo Davila1,3

Abstract

The activation of TLR-MyD88 (Toll-like receptor-myeloiddifferentiation factor 88) signaling within T cells functions asa potent costimulatory signal that boosts antitumor and anti-viral responses. However, the molecular mechanisms underly-ing the costimulatory processes are poorly understood. Wecompared microarray gene analysis data between TLR1–TLR2-stimulated and unstimulated T-cell receptor transgenic "pmel"and MyD88–/– pmel CD8þ T cells and identified changes in theexpression of several TNF family members. In particular, TLRstimulation increased 4-1BB levels in pmel but not inMyD88�/�pmel T cells. A link between 4-1BB and TLR1–TLR2signaling in CD8þ T cells was highlighted by the suboptimalresponses of 4-1BB–/– T cells to TLR1–TLR2 agonist, but their

normal response to CD28 or OX40 costimulation. Blocking4-1BB signaling with antibodies also hindered the costimulatoryeffects of the TLR1–TLR2 agonist. The elevated levels of 4-1BBtranscripts in TLR1–TLR2-stimulated cells were not due toincreased mRNA stability nor increased histone activation, butinstead were associated with increased binding of p65 and c-Junto two distinct 4-1BB promoter sites. Combining TLR1–TLR2ligand with an agonistic antibody to 4-1BB enhanced theantitumor activity in mice with established melanoma tumors.These studies reveal that the costimulatory effects of TLR1–TLR2 signaling in CD8þ T cells are in part mediated by 4-1BBand are important for mounting an effective antitumor immuneresponse. Cancer Immunol Res; 4(8); 708–16. �2016 AACR.

IntroductionToll-like receptors (TLR) play a central role in activating

immune cells and clearing infectious entities by recognizingvarious molecules derived frommicrobial pathogens (1, 2). TLRsalsobind a rangeofmolecules released fromdying or stressed cells(3). Myeloid differentiation factor-88 (MyD88) is an adaptermolecule used by most TLRs and necessary for TLR-inducedsignaling. The activation of TLR-MyD88 signaling in CD4þ andCD8þ T cells prolongs their survival, augments T-cell expansion,and can enhance effector functions against tumors and infections(4–6). MyD88 signaling in T cells plays a vital role in T-cellsurvival even in the absence of exogenous TLR agonists (7). Themechanisms underlying the costimulatory effects of MyD88 sig-naling in T cells have yet to be defined.

A T cell's ability to proliferate and persist in vivo is heavilyinfluenced by the stimulation of various costimulatory receptors,

such as the tumor necrosis factor receptor (TNFR)members 4-1BB,CD70, LTA, OX-40, and GITR (8–10). 4-1BB signaling in T cellsenhances proliferation and promotes T-cell survival by increasingIL2 and by upregulating the expression of antiapoptotic proteins(11, 12). 4-1BB plays an important role in generating a responsivememory T-cell population (13, 14). Preclinical models indicatethat stimulating 4-1BB signaling on T cells or natural killer (NK)cells with agonistic antibodies elicits potent antitumor responses(10, 15–17). Clinical trials are examining the antitumor activity of4-1BB agonists alone or when administered together with otheranticancer agents such as PD-1 inhibitor in patients with melano-ma, colorectal cancer, head and neck cancer, or relapsed/refractoryB-cell non-Hodgkin lymphoma (NCT02179918, NCT00612664,NCT01775631, NCT02110082, and NCT01307267). Preliminarydata thus far show partial responses in melanoma patients and anincreased frequency of activatedCD8þ T cells in circulation (9, 18).

To better understand how TLR-MyD88 signals enhancedCD8þ T-cell responses, we assessed changes in gene expressionprofiles of the CD8þ T-cell receptor transgenic "pmel" mice,which recognize the epitope gp10025–33 expressed on melano-ma cells, and MyD88–/–pmel CD8þ T cells stimulated with orwithout the TLR1–TLR2 ligand (TLR1–TLR2L) Pam3CSK4.TLR1–TLR2 engagement on T cells increased the expression of4-1BB, OX40, OX40L, GITR, and LTA. We found that 4-1BBplayed a central role in regulating the costimulatory effects ofTLR1–TLR2 signaling in T cells. Combination therapy using anagonistic antibody to 4-1BB and TLR1–TLR2L enhanced anti-tumor responses in mice with established tumors. These studiesoffer insights into the molecular mechanisms through whichTLR–TLR2 signals costimulate CD8þ T cells and highlight thebiological significance of exploiting these signaling pathwaysto augment T-cell responses.

1University of Maryland, Marlene and Stewart Greenebaum CancerCenter, Baltimore, Maryland. 2Department of Pediatrics and StanleyS. Scott Cancer Center, Louisiana State University Health SciencesCenter, New Orleans, Louisiana. 3Department of Microbiology andImmunology, University of Maryland, Baltimore, Maryland.

Note: Supplementary data for this article are available at Cancer ImmunologyResearch Online (http://cancerimmunolres.aacrjournals.org/).

A.M. Joseph and R. Srivastava contributed equally to this article.

Corresponding Author: Eduardo Davila, University of Maryland/GreenebaumCancer Center, Room 10-041, Bressler Research Building, 655, West BaltimoreStreet, Baltimore, MD 21201-1559. Phone: 410-706-5051; Fax: 410-706-2484;E-mail: [email protected]

doi: 10.1158/2326-6066.CIR-15-0173

�2016 American Association for Cancer Research.

CancerImmunologyResearch

Cancer Immunol Res; 4(8) August 2016708

on July 26, 2020. © 2016 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from

Published OnlineFirst June 7, 2016; DOI: 10.1158/2326-6066.CIR-15-0173

http://cancerimmunolres.aacrjournals.org/

Materials and MethodsMice

C57BL/6 and MyD88–/– mice were purchased from CharlesRiver, whileTLR2–/– and pmel (B6.Cg-Thy1/Cy Tg(TcraTcrb)8Rest/J) mice were purchased from The Jackson Laboratory. TheIRAK4 kinase dead mice were a generous gift from Dr. StefanieVogel (University of Maryland, Baltimore, MD) and 4-1BB–/–

mice from Dr. Lieping Chen (Yale University, New Haven, CT).4-1BB–/–pmel and MyD88–/–pmel mice were obtained by crossingpmelwith4-1BB–/– andMyD88–/–mice and crossing offspring overnine generations. All the protocolswere approved by theUniversityof Maryland Institutional Animal Care and Use Committee.

T-cell isolation and stimulationMouse T cells were cultured in RPMI 1640 (Invitrogen) medi-

um with fetal bovine serum (Gemini), NEAA, penicillin, strep-tomycin, and gentamycin (Invitrogen). CD8þ T cells were initiallysorted using the negative enrichment kit followed by positiveselection (Invitrogen). In some experiments, pmel T cells werestimulatedwithMyD88–/– splenocytes pulsedwithmouse gp-100peptide (10 ng/mL; EGSRNQDWL, GenScript Corp) at 37�C in7% CO2 at 1:5 T cell:antigen presentation cells (APC) ratio,whereas WT (C57BL/6) CD8þ T cells were stimulated withplate-bound anti-CD3e (BD Biosciences) at 0.5 mg/mL, with orwithout the TLR1–TLR2 agonist Pam3CSK4 (1.5 mg/mL; Invivo-Gen). T-cell proliferation was determined by 3H-thymidine(1 mCi/well) uptake. For in vivo T-cell survival/expansion studies,CD8þpmel T cellswere purifiedbynegative selection (Invitrogen)from CD90.1�CD45.2þ pmel and CD90.1þCD45.2þMyD88�/�

pmel mice and activated in vitro with mgp100 peptide-pulsedwild-type (WT) splenocytes and, 1 day later, were enriched bynegative selection, mixed at a 1:1 ratio and i.v. injected intoCD45.1þmice. The number of transferred T cells was determinedin different organs at different time points by staining cells withantibodies against CD8, CD45.2, and CD90.1. T cells were res-timulated by vaccinating mice s.c. with 100 mg of hgp100 peptideadmixed in Incomplete Freund's Adjuvant (IFA) and 10 mg ofCpG-ODN on day 20 after T-cell transfer. IL1-agonist (IL1a,10 ng/mL) was from Biolegend and the cIAP1/2 inhibitorGDC-0152 was purchased from Selleck Chemicals.

Purified CD8þ T cells from WT, MyD88–/–, 4-1BB–/–, TLR2–/–,and IRAK4 KD mice were activated with anti-CD3e (0.5 mg/mL),with orwithout Pam3CSK4 (0.5mg/mL), 3H3 (1mg/mL; rat IgG2aagonistic mAb to mouse 4-1BB, kindly provided by Dr. R.S.Mittler, Emory University, Atlanta, GA), IgG2a isotype control(1 mg/mL, 2A3; BioXcell).

Flow cytometryIn some experiments, the expression of various molecules on

pmel T cells was determined by flow cytometry after activation andanalyzed using FlowJo software (TreeStar) at the indicated timepoints. Antibodies against 4-1BB, OX-40, OX-40L, CD25, CD44,CD62L, CD132, CD127, and GITR used in flow cytometry werepurchased from E-biosciences or BD Biosciences. Blocking antibo-dies to CD28 and GITR were purchased from BD Pharmingen, OX-40L from R&D Systems and 4-1BBL (19H3) from Dr. R.S. Mittler.

Whole-genome gene expressionMyD88–/– splenocytes underwent two rounds of CD8 T-cell

depletion by CD8-positive selection. Splenocytes were pulsed

with 10 ng/mL of mgp100 for 2 hours at 37�C followed byaddition of purified pmel or MyD88–/– pmel CD8 T cells withor without 10 mg/mL of Pam3CSK4. Seventy-two hours afterstimulation, pmel or MyD88–/– pmel CD8 T cells were selectedby two rounds of negative enriched (Invitrogen, Dynal AS). Purityof CD3þCD8þ was found to exceed 97% in all three experimentsconducted as determined by flow cytometry. Double-strandedcDNA (dsDNA) ismade from 200 ng of total RNA using oligo-dT,reverse transcriptase, and DNA polymerase as recommended bythe manufacturer (Ambion). In addition, the remaining RNA isdigested with RNAse H. The dsDNA is purified trough columnsand used as a template to generate biotin-labeled RNA (cRNA).TheGEO Submission is GSE79475, and theNCBI tracking systemnumber is 17812033.

For whole-genome gene expression cRNA (1.25 mg in 10 mL) ismixed with hybridization buffer and processed and analyzed, asrecommended by Illumina, Inc. For data analysis, the sampleswere normalized using the cubic spline algorithm, assuming thatthe distribution of transcripts is similar, and the net expressionwas determined by subtracting the expression levels in the refer-ence group (control samples) from the condition group (treat-ment samples). A differential expression is determined by com-parison between the condition group and the reference groupusing an algorithm that assumes that target signal intensity (l) isnormally distributed among replicates corresponding to somebiological condition. This experiment was conducted threetimes, and RNA samples from each group were used for the genearray. Changes in mRNA transcript levels observed betweengroups were confirmed by real-time PCR.

mRNA stabilityCD8þT cells were activated in an anti-CD3e (0.5 mg/mL) coated

plate for 3 days, in the presence or absence of Pam3CSK4. mRNAwas collected at 0, 2, 4, 12, and 16 hours after actinomycin D(Sigma) treatment (10 mg/mL). Reverse transcription was per-formed using the high-capacity reverse transcription kit fromInvitrogen. 4-1BB and b-actin mRNA levels were measured byqPCR using the SYBR green mix from Biorad and the followingprimer sets synthesized by Integrated DNA Technologies (IDT): 4-1BB, CCTTCCTGAAATTCAGGTGCTGCAG and GCAGCACAAT-GACCACCACGTTG;b-actin,GAAAAGATGACCCAGATCATGandATCTTCATGAGGTAGTCCGTC.

Chromatin immunoprecipitationCD8 T cells (106) were cultured in a 24-well plate coated with

1 mg/mL anti-CD3e in RPMI, 10% FBS, 1% penicillin–strepto-mycin, 1% NEAA, and 0.1% gentamycin, for 24, 48, 72, and96 hours in the presence or absence of Pam3CSK4 (1 mg/mL). Ateach time point, cells were collected and chromatin immunopre-cipitation was done using the Magnetic ChIP kit from ThermoScientific. Cross-linking of protein and DNA was performed byadding 37% formaldehyde to the culture solution to attain a finalconcentration of 1% formaldehyde. The cells were then lysedusing lysis buffer provided. Chromatin was digested using theMNase enzyme, and the nuclear membrane was disrupted usingshort pulses of sonication. The resulting chromatinwas incubatedovernight with antibodies to p65, c-Jun, RNA polymerase, andIsotype control from Cell Signaling Technologies and toH3K4me3 from SABiosciences EpiTech ChIP antibody kit. Theimmune complexes were isolated using Protein A/G-coated mag-netic beads andmagnetic stand. The cross-links were reversed and

TLR2's Costimulatory Effects on CD8þ T Cells Occur via 4-1BB

www.aacrjournals.org Cancer Immunol Res; 4(8) August 2016 709




protein digested using Proteinase K. The purified DNA was thenused in PCR to detect the promoter regions of 4-1BB. The fol-lowing primer sets were used: P1, ACGTCCTAATGGGCAA-CAGCTG, GTGAGGTTCTGCCGCTCCAC; P2, TTGGCCACCA-CACCATGC, CAAGGGTTTCAAGGTCCCC. Densitometry datawere obtained using Image J.

In vivo adoptive transfer experimentsFor T-cell survival/expansion studies, CD8þ pmel T cells were

purifiedbynegative selection (InvivoGen) fromCD90.1�CD45.2þ

pmel andCD90.1þCD45.2þMyD88�/�pmelmice andactivated invitrowithmgp100 peptide-pulsedWT splenocytes and, 1 day later,were enriched by negative selection, mixed at a 1:1 ratio and i.v.injected into CD45.1þ mice. The number of transferred T cells wasdetermined in different organs at different time points by stainingcells with antibodies against CD8 (553033), CD45.2 (553772),andCD90.1 (557266;BDBiosciences). T cellswere restimulatedbyvaccinatingmice s.c.with100mgofhgp100peptide admixed in IFAand10mgofCpG-ODN(tlrl-1826InvivoGen)onday20after T-celltransfer. CD90.1–CD45.2þpmel andCD90.1þCD45.2þMyD88–/–

pmel CD8 T cells were activated using 1 mg/mL ofmgp10025–33 for5 days and then mixed at 1:1 and injected i.v. into CD45.1þ mice.For tumor growth experiments, 105 B16 F1 melanoma cells wereinjected s.c. into the flanks of C57B6 mice on day 0. B16 F1melanoma cells were purchased from ATCC in 2013 and wereused within 3 years of receiving them. We authenticated that ourB16 cells expressed the melanin pigment by visual inspectionand microscopic inspection and that B16 cells were recognized as

target by pmel CD8þ T cells. On day 9, when tumors weredetected, the mice were sublethally irradiated (400 rads) usinga Cesium irradiator. After 24 hours, 5 � 106–7 � 106 pmelT cells, which were activated 3 days prior with 2.5 mg/mL ofhgp100 and 100 U/mL of IL2 (589106 Biolegend), were injectedi.v. into all groups.Ondays10, 14, 17, and20after tumor injection,the mice were administered TLR1–TLR2 ligand (10 mg), 3H3(100 mg, BE0239 BioXcell), TLR1–TLR2 ligand (10 mg), and 3H3(100 mg), i.p. or i.v. Tumors weremeasured regularly with a caliperandmice were euthanizedwhen tumor reached the set size limit orif the mice appeared moribund.

ResultsMyD88 promotes CD8þ T-cell survival and changes TNF familymember expression

We examined the biological significance ofMyD88 signaling inT-cell survival. An equal number of antigen-activated pmel(CD45.2þCD90.1�) and MyD88�/�pmel (CD45.2þ CD90.1þ)CD8þ T cells were coinjected into CD45.1þ mice, and T-cellnumbers in various organswere compared at different time pointsafter cell transfer. Figure 1A shows a representative dot plot ofpmel and MyD88�/�pmel CD8þ T cells 7 and 45 days aftertransfer. The number of pmel T cells and MyD88�/�pmel T cellswas similar on day 7 in the spleen, lymphnode, and bonemarrow(Fig. 1B).However,more pmel T cells were recovered fromeach ofthe different organs starting on day 14. T-cell expansion andcontraction kinetics in response to antigen restimulation were

A

Day 7

Day 45

CD90.1

CD

45.2

pmel MyD88−/−pmel

0

500

1,000

1,500

2,000

0 7 14 21

T C

ells

per

106

endo

geno

us c

ells pmel

MyD88−/−pmel

C

Days post restimulation

1

500

7 14 21 45 801

500

7 14 21 45 80

Spleen Lymph node Bone marrow

pmelMyD88−/−pmel

1

10

100

7 14 21 80

B

Days post adoptive transfer

Pm

elT

cells

per

106

endo

geno

us c

ells

1

10

7 14 21 801

10

7 14 21 80

Liver Lung

*

* *

*

* *

** **

*

** ** * *

**

* **

**

Figure 1.

MyD88 in CD8þ T cells plays animportant role for T-cell persistenceand expansion. A, antigen-activatedpmel (CD45.2þ CD90.1–) or MyD88–/–

pmel (CD45.2þ CD90.1þ) T cells wereinjected into C57BL6 mice. Bloodsamples were analyzed 45 days aftertransfer by flow cytometric stainingfor specific congenic markers. B, thenumber of transferred cells in thespleen, lymph nodes, bone marrow,liver, and lung was analyzed by flowcytometry at the indicated time pointsafter transfer. C, 20 days afteradoptive transfer of pmel or MyD88–/–

pmel T cells, mice were vaccinatedwith gp100, CpG-ODN in IFA, and thenumber of pmel and MyD88–/– pmelCD8þ T cells in the blood wasmeasured by flow cytometric analysisat the indicated time points aftervaccination. Statistics were generatedby the Student t test comparing pmelandMyD88�/�pmel T cells; � , P <0.05;�� , P < 0.01.

Joseph et al.

Cancer Immunol Res; 4(8) August 2016 Cancer Immunology Research710




also assessed 20 days after T-cell transfer. Pmel cells exhibited agreater potential to expand and persist than did MyD88�/�pmelcells (Fig. 1C). These data indicate that MyD88 signaling in T cellsprovides a distinct survival and/or proliferative advantage overMyD88-deficient pmel T cells.

Microarray gene expression profiles were compared betweenTLR1–TLR2-stimulated and unstimulated pmel and MyD88�/�

pmel CD8þ T cells. Gene expression in the pmel, MyD88–/–pmel,and MyD88–/–pmel þ TLR1–TLR2L groups was related, whereasTLR1–TLR2-stimulated pmel cells were only distantly related(Fig. 2A). TLR stimulation enhanced the expression of immuneresponse genes and genes regulating apoptosis and survival,signal transduction pathways, and metabolism (Fig. 2B). Underthe classification of T-cell costimulation, expression of the TNFfamily members Tnfsf9/OX40l, Tnfrsf9/4-1bb, Tnfrsf4/OX-40,Tnfrsf25/Dr3, Lta, and Tnfrsf18/Gitr was most prominently

enhanced after TLR1–TLR2 stimulation. Expression of the geneswas confirmed by quantitative RT-PCR (Fig. 2C). Surface expres-sion of OX40L, 4-1BB, and GITR was increased in response toTLR1–TLR2 stimulation and correlated with the RNA transcriptdata (Fig. 2D). OX40 surface expression was moderatelyincreased. In contrast, the expression of each of these proteinsremained similar in TLR1–TLR2-stimulated and unstimulatedMyD88–/– T cells (Fig. 2D, bottom). These data highlight apreviously unappreciated association between TLR–MyD88 sig-naling and TNFR family member expression in CD8þ T cells.

Costimulatory effects depend upon 4-1BB expression on CD8þ

T cellsWe examined the effect that blocking 4-1BB, OX-40, and GITR

had on the costimulatory effects of TLR1–TLR2 stimulation. PmelT cells were activated withmgp100-pulsed MyD88–/– splenocytes

C

02468

101214

A

22234311 143

1 = pmel 2 = pmel + TLR1/2 L3 = MyD88−/−pmel 4 = MyD88−/−pmel + TLR1/2 L

4-1BBOX-40L OX-40

WT

MyD

88−/

−

GITRCD8+ T Cells

+ TLR1/2 L −TLR1/2 L

D

mR

NA

Fol

d ch

ange

(T

LR-s

timul

ated

vs.

uns

timul

ated

)

B0 20

Cytokine signlaing pathwaysInterferon signaling pathway

MIF in immune responseT cell costimulation

Th1 and Th2 cell differentiationBCR pathway

CCR SignalingComplement pathways

Histamine signaling in DCsPGE2 signaling in immune…Inhibitory action of lipoxinsNFAT in immune response

Antigen presentationImmunological synapse formation

Th17 cell differentiationAnti-apoptotic TNFs/IAP pathway

APRIL and BAFF signalingMitochondrial Protein Regulation

Caspase cascadeAnti-apoptotic action of Gastrin

Ceramides signaling pathwayLymphotoxin-β receptor signaling

G-protein signalingErk Interactions: Inhibition of Erk

cAMP signalingAKT signaling

PTEN pathwayNucleotide metabolismAmino acid metabolism

Glycolysis and gluconeogenesisNitrogen metabolism

Polyamine metabolismButanoate metabolism

Imm

une

resp

onse

Apo

ptos

is a

ndsu

rviv

alS

igna

ltra

nsdu

ctio

nM

etab

olis

m

Number of genes

updown

Figure 2.

Gene expression analysis of TLR2-stimulated CD8þ T cells shows anenhanced expression of TNFRSFmembers. A, gene expression analysis wasconducted on purified CD8þ T cells frompmel and MyD88�/� pmel mice, activatedwith hgp10025–33�pulsedMyD88�/�APCswith or without TLR1–TLR2L for 3 days.Genes colored green are underexpressed,while red indicates overexpression. B,classification of genes upregulated by TLRstimulation in A. C, changes in mRNAtranscript levels between TLR-stimulatedand non–TLR-stimulated (�SD) T cellswere determined by real-time PCR. D,surface expression of TNFRSFmembers onWT andMyD88–/–CD8þ T cells 3 days afteractivation with anti-CD3e in the presenceor absence of TLR1–TLR2 ligand wereconfirmed by flow cytometric analysis. Thedata are representative of threeindependent experiments.






in the presence or absence of TLR1–TLR2L, with or withoutblocking antibodies to OX-40L, 4-1BBL, GITR, or CD28. Blocking4-1BB signaling reduced the costimulatory effects of TLR1–TLR2ligand (Fig. 3A). Blocking GITR also modestly reduced TLR2signals. In contrast, blocking OX40L or CD28 did not impairTLR1–TLR2 signaling, suggesting that although upregulated afterTLR stimulation, these receptors do not appear to modulate thecostimulatory effects of TLR1–TLR2 signaling in CD8þ T cells.Because the costimulatory effect of TLR1–TLR2 stimulation on Tcells was influenced by 4-1BB expression, we assessed TLR1–TLR2L's proliferative effects on WT and 4-1BB–/– CD8þ T cells.TLR1–TLR2L increased WT CD8þ T-cell proliferation but did notalter 4-1BB–/–CD8þT-cell proliferation (Fig. 3B). Likewise, TLR1–TLR2 engagement increased antigen-driven pmel T-cell expansionbut did not augment 4-1BB–/–pmel T-cell proliferation (Fig. 3C).

We examined whether differences in the expression of cytokinereceptors could help explain the changes in T-cell expansionbetween 4-1BB signaling–competent and 4-1BB–deficient T cells.TLR1–TLR2 stimulation increased the expression of CD25 (thea-chain of the IL2 receptor), CD132 (common-g chain), andCD127 (IL7 receptor subunit) on WT and 4-1BB–/– T cells (Sup-plementary Fig. S1). WT and 4-1BB–/–T cells also expressed moreof the activation markers CD69, CD44, and CD62L and thecostimulatory molecule CD28 after TLR stimulation. However,TLR1–TLR2L did not alter the expression of these molecules inMyD88–/–CD8þ T cells. Thus, the costimulatory effect of TLR1–TLR2 engagement likely occurs via mechanisms that do notinvolve these proteins.

To further understand the association between 4-1BB andTLR1–TLR2 signaling, we investigated how the absence ofMyD88or TLR2 altered the costimulatory effects of 4-1BB signaling.Purified WT, MyD88–/–, or TLR2–/– CD8þ T cells were activated

with -CD3e antibody and agonistic 4-1BB antibody. Whereaswild-type and TLR2–/–CD8þ T cells proliferatedmore in responseto 4-1BB stimulation,MyD88–/– T cells did not respond (Fig. 3D).These results suggest a potential role for MyD88 in 4-1BB–medi-ated costimulation. We tested whether the lack of 4-1BB on T cellsmight have a global impact andprevent T cells from responding toother common costimulatory signals. We observed that although4-1BB–/– T cells did not respond to TLR1–TLR2 L costimulation,they did respond to both CD28 and OX40 (Supplementary Fig.S2), indicating that 4-1BB deficiency does not globally affect allcostimulatory signals. Instead, the contribution of 4-1BB tomodulating TLR1–TLR2 costimulation is somewhat specific.

TLR signals enhance 4-1BB expression through increasedtranscription factor binding

We assessed 4-1BB expression kinetics in WT and MyD88–/–

CD8þ T cells over a period of 5 days with or without TLR1–TLR2L.As reported by others (19), 4-1BB expression on CD8þ T cellsincreaseduponT-cell activation, peakingbetween2and3days afteractivation, and returning to basal levels by day 4 in non-TLR–stimulated T cells. TLR1–TLR2L increased 4-1BB expression overnon–TLR-stimulated WT T cells between days 2 and 5. However,4-1BB expression on MyD88–/– CD8þ T cells was not affected byTLR1–TLR2L (Fig. 4A). The increase in 4-1BB surface expression inresponse to TLR1–TLR2 stimulation was correlated with increas-ed transcripts, as assessed by quantitative real-time PCR (Fig. 4B).

MyD88 signaling can enhance IFNg mRNA stability (20), andwe thus assessed whether TLR engagement increased 4-1BB tran-scripts by increasing mRNA stability. The decay rate of 4-1BBtranscripts was the same in TLR-stimulated and unstimulated Tcells (Fig. 4C, left), indicating that the increase in 4-1BB transcriptsin TLR-stimulated T cells was not a result of enhanced mRNA

A

Neutralizing antibody

0

5

Pro

lifer

atio

n

(cpm

×10

3 ) 10

TLR1/2 L: + −

Pro

lifer

atio

n (c

pm×

103 )

0

10

20

30

40

B* *

−TLR1/2 L +TLR1/2 L

C

0

10

20

30

40

50

0 0.5 1

Pro

lifer

atio

n

(cpm

×10

3 )

TLR1/2 L (μg/mL)

**

***

D

0

10

20

30

40P

rolif

erat

ion

(c

pm×

103 )

Iso Ab controlα4-1BB Ab

*

WT CD8+

4-1BB−/−CD8+

pmel CD8+

4-1BB−/−pmel CD8+

Figure 3.

4-1BB contributes to the costimulatoryeffects of TLR1–TLR2 ligand. A,purified pmel T cells were cultured withgp10025–33�pulsed MyD88�/� APCs inthe presence of blocking antibodies todifferent TNFRSF members. B, WTand 4-1BB�/� CD8þ T cells wereactivated with plate-bound anti-CD3eand cultured in the presence orabsence of TLR1–TLR2 ligand. C,purified pmel and 4-1BB–/–pmel CD8þ

T cells were activated withgp10025-33�pulsed irradiated MyD88–/–

splenocytes D, WT, MyD88–/–, andTLR2–/– CD8þ T cells were activatedwith plate-bound anti-CD3e antibodyand cultured in the presence of agonistic4-1BB antibody, 3H3, or isotypeantibody. Proliferation was assessedby measuring 3H-thymidine uptake72 hours after activation in A–D.Statistics were generated by theStudent t test; � , P < 0.05; �� , P < 0.01;�� , P < 0.001.

Joseph et al.





stability, with both TLR-stimulated or unstimulated T cells main-tainingmore than 80%of the starting amount of 4-1BBmRNA. Incontrast, the total mRNA dropped over 75% in both TLR-stim-ulated and unstimulated T cells (Fig. 4C, right).

We investigatedwhether TLR stimulation altered the amount oftranscription factors bound to the 4-1BB promoter. The 4-1bbgene has three distinct promoter regions (PI, PII, and PIII), ofwhich PI and PII each have an AP-1 and NF-kB binding site (21).We used a chromatin immunoprecipitation assay to assess NF-kB(p65) and AP-1(cJun) binding to each the PI and PII promoterregions at different time points after T-cell activation. Both p65and c-Jun bound to both the PI and PII regions as early as 24 hoursafter T-cell activation (Fig. 4D). However, binding of p65 to the PIand PII regions in TLR-stimulated cells was increased 48 hoursafter T-cell activation (Fig. 4D). In TLR-stimulated cells c-Junbound to the PI but not PII region. Because histone 3 lysine 4trimethylation (H3K4me3) is associated with transcriptionallyactive genes, we also assessed whether TLR1–TLR2L regulated 4-1BB transcription by increasing H3K4me3 binding (Fig. 4E).H3K4me3 was undetectable on PI and PII in na€�ve T cells andwas similar in TLR-stimulated and unstimulated CD8þ T cells.Thus, increased 4-1BB transcripts were primarily regulated byenhanced binding of p65 and c-Jun to the PI and PII.

4-1BB antibody plus TLR1–TLR2 ligand augments T-cellantitumor activity

We assessed whether combined stimulation of 4-1BB andTLR1–TLR2 signals enhanced CD8þ T-cell responses above eachof these signals alone. Purified WT or 4-1BB–/– CD8þ T cells wereactivated by plate bound CD3e antibody and treated with ago-nistic 4-1BB antibody (3H3), TLR1–TLR2L, or both. We alsotreated cells with IL1a to rule out that the activation of MyD88occurred via engagement of the IL1R. WT CD8þ T cells stimulatedwith 3H3 or TLR1–TLR2L proliferatedmore than untreated T cellsor those treated with an isotype control antibody (Fig. 5A).Combining 3H3 with TLR1–TLR2L further enhanced T-cell pro-liferation over 3H3 or TLR1–TLR2 L (Fig. 5A). IL1a did not affectT-cell proliferation. Costimulatory effects of TLR1–TLR2L or 3H3were not observed in 4-1BB–/–CD8þ T cells (Fig. 5A). Engagementof TLR1–TLR2 on both WT and 4-1BB–/– CD8þ T cells increasedIFNg production (Fig. 5B), suggesting that although the ability ofTLR1–TLR2 stimulation to augment T proliferation is dependenton 4-1BB, it is not required to enhance IFNg production.

We assessed the effects of the above-mentioned treatments onTLR2–/–, MyD88–/–, and IRAK4 kinase dead (IRAK4-KD) CD8þ Tcells (Fig. 5C). As expected, none of these T cells responded toTLR2 stimulation. However, 4-1BB stimulation augmented

C

0

0.25

0.5

0.75

1

0 5 10 15 20

4-1B

B m

RN

A re

lativ

e to

β-a

ctin

Hours after actinomycin D

D

P1

GAPDH

MyoD

Input H3K4me3 Iso

P2

TLR1/2 L:

MyD88−/− + TLR1/2 L MyD88−/−

WTWT+ TLR1/2 L

0

50

100

150

200

250

0 1 2 3 4 5

4-1B

B G

eo m

ean

Days post activation

A

CD137PI

p65 / p50p65 / p50

PII

c-Jun/c-Fos c-Jun/c-Fos

Input p65 c-Jun RNAP Iso Input p65 c-Jun RNAP Iso

2448

96

Hou

rs

TLR1/2L: − + − + − + − + − + − + − + − + − + − +

E

Input H3K4 IsoNaïve T cells

B

***

***

******

0

25

50

75

100

0 5 10 15 20%m

RN

A c

once

ntra

tion

drop +TLR1/2L

−TLR1/2L

0

10

20

30

40

50

60

24 48 72 96 120

4-1B

B m

RN

A F

old

chan

ge

Hours post activation

−TLR1/2 L

+TLR1/2 L − + − + − +

Figure 4.

TLR signals enhance 4-1BB expressionby increasing transcription factorbinding to the 4-1BB promoter. A, 4-1BB surface expression was analyzedby flow cytometry after activation ofWT and MyD88–/– CD8þ T cells byplate-bound anti-CD3e, in thepresence or absence of TLR1–TLR2ligand at the indicated time points andis representative of at least twoindependent experiments. B, 4-1BBmRNA expression in CD8þ T cells wasanalyzed by qPCR at the indicatedtime points after activation. mRNAlevels were normalized to b-actin. C,CD8þ T cells were activated for 72hours and then treated withactinomycin D for 2, 4, 12, and 16 hours.mRNA was isolated and 4-1BBexpression analyzed by qPCR andnormalized to b-actin. D and E,chromatin immunoprecipitation wasconducted using the indicatedantibodies to analyze histonemodifications at the promoter regionsof 4-1BBat indicated timepoints (D) ortranscription factor binding (E) afteractivation with anti-CD3e, with orwithout TLR ligand. Amplification ofthe GAPDH promoter site served as acontrol for transcriptionally activeeuchromatin and the MyoD promoteras a control for transcriptionallyinactive euchromatin. RNApolymerase (RNAP) binding andisotype antibody served as positiveand negative controls, respectively.Statistics were generated by theStudent t test; �� , P < 0.001.






TLR2–/– CD8þ T-cell proliferation, but did not affect MyD88–/–

or IRAK4-KD CD8þ T-cell proliferation. These data highlightthat the proliferative effects of 4-1BB signaling in CD8þ T cellsdepend to some degree on both MyD88 and IRAK-4. However,although the costimulatory effects of TLR1–TLR2 ligand dependon 4-1BB, the costimulatory effects of 4-1BB do not rely on theexpression of TLR2.

To further explore a link between TLR2 and 4-1BB signaling,we evaluated the effects of inhibiting the cellular inhibitorsof apoptosis 1 and 2 (c-IAP1/2). c-IAP1/2 function as positiveregulators of the canonical NF-kB signaling pathway and areessential in both TLR2 and 4-1BB signaling (22, 23). TreatingT cells with a small molecule inhibitor of c-IAP1 and c-IAP2,GDC-0152, impeded the effects of combination TLR1–TLR2 and4-1BB stimulation and decreased the costimulatory effects ofeach separately (Supplementary Fig. S3). Thus, the costimulatoryeffects of TLR1–TLR2 and 4-1BB required TRAF signaling, andNF-kB activation was required for the costimulatory effects ofcombination TLR1–TLR2 and 4-1BB signaling.

4-1BB antibody plus TLR1–TLR2 ligand augments T-cellantitumor activity

Combined treatment of mice with TLR1–TLR2L and agonistic4-1BB antibody provided greater antitumor activity than did pmel

T cells or TLR1–TLR2L alone and to a smaller extent over micetreated with 4-1BB antibody alone (Fig. 5D, left). Transient tumorregression was observed over the course of 2 weeks in micereceiving TLR1–TLR2L plus anti–4-1BB or anti–4-1BB alone.Combinatorial TLR1–TLR2L and anti–4-1BB treatment inducedstronger antitumor responses thandid 3H3alone. The tumors in 4of 10 mice treated with TLR1–TLR2L plus anti–4-1BB extensivelyregressed, and three mice remained tumor free (SupplementaryFig. S4). Combination of TLR1–TLR2L with anti–4-1BB treat-ment also significantly enhanced survival compared with that ofmice treated with 3H3 (P < 0.05) or TLR1–TLR2 L (P < 0.001).These results indicate that the costimulatory effects of TLR1–TLR2 signaling in CD8þ T cells are in part mediated by 4-1BBand can be exploited to augment antitumor immune response.

DiscussionStimulation of CD8þ T cells with TLR ligands leads to enhanc-

ed proliferation and effector functions (24). Studies from ourgroup have shown that MyD88-deficient CD8þ T cells have animpaired ability to survive for a long time in vivo (25). HowMyD88 within CD8þ T cells contributes to survival is undefined.The current studies demonstrate that TLR stimulation alteredthe expression of about 200 genes, including 4-1BB, OX-40,

0

200

400

600

800

1,000

Pro

lifer

atio

n

(cpm

×10

3 )No treatment+TLR1/2L+3H3+TLR1/2L+3H3+IL1+Isotype control

0

50

100

150

200

250 100

80

60

40

20

0

200

150

100

50

00 20 40 0 20 40Days post tumor injection Days post tumor injection

Per

cent

sur

viva

l

Tum

or s

ize

(mm

2 )

250

300

Pro

lifer

atio

n

(cpm

×10

3 ) No treatment+TLR1/2L+3H3+TLR1/2L +3H3+IL1+Isotype control

A

C

** ***

****

D

0

200

400

600

IFN

γ (n

g/m

L)

B ** ***

WT

MyD88−/−TLR2−/−

WT 4-1BB−/−4-1BB−/−

IK4KD

ǂǂǂ ǂǂ

**

*

Pmel

Pmel + TLR1-TLR2L

Pmel + 3H3

Pmel + TLR1-TLR2L +3H3

+×

***

Figure 5.

Combining TLR1–TLR2 ligand and4-1BB agonistic antibody increasesT-cell proliferation and improvesantitumor activity against melanomain mice. A and B, Purified WT and 4-1BB–/–, or C, TLR2–/–, MyD88–/–, andIRAK4 kinase dead CD8þ T cells, wereactivatedbyCD3eAb–coated plates inthe presence of TLR1–TLR2L, 3H3,TLR1–TLR2L and 3H3, IL1, or isotypeantibody. Proliferation (�SD) wasassessed by measuring 3H-thymidineuptake, whereas IFNg production wasmeasured by ELISA 48 hours afteractivation. Student t test; �� , P < 0.01;�� , P < 0.001. Data from A–C arerepresentative of three independentexperiments. D, B16-F1 melanomacells were injected s.c. into C57B6mice. When palpable tumors weredetected, mice were irradiated andinjected i.v. with 5 � 106–7 � 106

–activated pmel T cells that had beenexposed to TLR1–TLR2 ligand 24 hoursbefore injection. TLR1–TLR2 ligandand 3H3 were injected i.p. Error bars,SE from the mean of 10 mice pergroup. Statistics were generated byrepeated measures ANOVA–Tukeyposttest; � , P < 0.05; �� , P < 0.01;�� , P < 0.001. Survival statistics weregenerated by the log-rank test. TheStudent t testwas conducted between3H3 and TLR1–TLR2L þ 3H3.z, P < 0.05; zz, P < 0.01.

Joseph et al.





OX-40L, GITR, and DR3, which are known to costimulate acti-vated CD8þ T cells (26–29). 4-1BB plays a crucial role in enhanc-ing the function (30) and survival of CD8þ T cells (13, 14, 29,31, 32). We present another vital role of 4-1BB as a mediator ofthe costimulatory effects of TLR1–TLR2 signals on CD8 T cells.TLR1–TLR2 engagement on T cells failed to costimulate T-cellexpansion in the absence of 4-1BB or when blocking 4-1BB usingantibodies. Although both TLR and 4-1BB signals promote CD8þ

T-cell expansion and survival, combining these signals increasedT-cell expansion over each individual treatment alone. The costi-mulatory effects of TLR1–TLR2L and the ability for 4-1BB block-ade to inhibit the costimulatory properties of TLR1–TLR2 wereheavily influenced by the amount of T-cell receptor (TCR) signal.Too high a concentration of CD3e antibody or peptide-pulsedAPCs bypassed the costimulatory effects of TLR1–TLR2 agonistor 4-1BB agonistic antibodies. Our analyses focused on CD8þ

T-cells; however, the effects observed in CD8þ T cells might alsooccur in CD4þ T cells.

We demonstrated here that the combination of both TLRligand and 4-1BB signals enhanced T-cell proliferation andIFNg production in vitro and augmented antitumor responsesin mice to a greater extent than either treatment alone. How-ever, in vivo 4-1BB stimulation on different cells types cangenerate varied responses. For example, activating 4-1BB sig-nals on DCs in a mouse model of HSV-1 (Herpes simplexvirus-1) infection leads to the IFNg-dependent accumulationof indoleamine-pyrrole 2,3-dioxygenase (IDO) and subse-quent suppression of the immune response. Additionally,4-1BB signals enhanced immunity against influenza in aCD8þ T cell–dependent manner (33). Depending on thein vivo model, 4-1BB can either promote or block CD4þCD25þ

regulatory T-cell activity (34, 35). The transfer of 4-1BBþ CD8þ

T cells generates an effective antitumor response when admin-istered with agonistic 4-1BB antibody therapy. That 4-1BBstimulation can elicit varied immune responses highlights apotential advantage to the targeting of therapy to specific cellsubsets.

These studies reveal that the costimulatory effects of TLR1–TLR2 signaling in CD8þ T-cell expansion are in part mediated by4-1BB, that 4-1BB signaling in T cells depends in part on thepresence of MyD88, and combination therapy using TLR ligandand agonistic 41BB antibodies can be exploited to enhanceantitumor immune response. The proposed model throughwhich the T-cell receptor, TLR2, and 4-1BB signaling are believedto interact is shown in Supplementary Fig. S5.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: A.M. Joseph, E. DavilaDevelopment of methodology: R. Srivastava, J. Zabaleta, E. DavilaAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): A.M. Joseph, J. ZabaletaAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): A.M. Joseph, R. Srivastava, J. ZabaletaWriting, review, and/or revision of themanuscript: A.M. Joseph, R. Srivastava,J. Zabaleta, E. DavilaAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): R. Srivastava

Grant SupportThis study was supported by the R01CA140917 (E. Davila), University of

Maryland,Marlene and StewartGreenebaumCancer (E.Davila), P30CA134274(E. Davila), and the T32 AI007540 (A.M. Joseph). J. Zabaleta has been partiallysupported by grants from the National Institute of General Medical Sciences(NIGMS P20GM103501, P30GM114732, and U54GM104940-01), and theNational Institute on Minority Health and Health Disparities (NIMHDP20MD004817 and U54MD008176-01).

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received July 13, 2015; revised March 25, 2016; accepted May 5, 2016;published OnlineFirst June 7, 2016.

References1. Adams S. Toll-like receptor agonists in cancer therapy. Immunotherapy

2009;1:949–64.2. Rakoff-Nahoum S, Medzhitov R. Toll-like receptors and cancer. Nat Rev

Cancer 2009;9:57–63.3. Rakoff-Nahoum S, Medzhitov R. Role of toll-like receptors in tissue repair

and tumorigenesis. Biochemistry (Mosc) 2008;73:555–61.4. Geng D, Zheng L, Srivastava R, Asprodites N, Velasco-Gonzalez C,

Davila E. When toll-like receptor and T-cell receptor signals collide: amechanism for enhanced CD8 T-cell effectors function. Blood 2010;116:3494–504.

5. Asprodites N, Zheng L, Geng D, Velasco-Gonzalez C, Sanchez-Perez L,Davila E. Engagement of Toll-like receptor-2 on cytotoxic T-lympho-cytes occurs in vivo and augments antitumor activity. FASEB J 2008;22:3628–37.

6. Komai-Koma M, Jones L, Ogg GS, Xu D, Liew FY. TLR2 is expressed onactivated T cells as a costimulatory receptor. Proc Natl Acad Sci U S A2004;101:3029–34.

7. Rahman AH, Cui W, LaRosa DF, Taylor DK, Zhang J, Goldstein DR, et al.MyD88 plays a critical T cell-intrinsic role in supporting CD8 T cellexpansion during acute lymphocytic choriomeningitis virus infection.J Immunol 2008;181:3804–10.

8. Wortzman ME, Clouthier DL, McPherson AJ, Lin GH, Watts TH. Thecontextual role of TNFR family members in CD8(þ) T-cell control of viralinfections. Immunol Rev 2013;255:125–48.

9. Moran AE, Kovacsovics-Bankowski M, Weinberg AD. The TNFRs OX40, 4-1BB, and CD40 as targets for cancer immunotherapy. Curr Opin Immunol2013;25:230–7.

10. Shuford WW, Klussman K, Tritchler DD, Loo DT, Chalupny J, Siadak AW,et al. 4-1BB costimulatory signals preferentially induce CD8þ T cellproliferation and lead to the amplification in vivo of cytotoxic T cellresponses. J Exp Med 1997;186:47–55.

11. Sabbagh L, Pulle G, Liu Y, Tsitsikov EN, Watts TH. ERK-dependent Bimmodulation downstream of the 4-1BB-TRAF1 signaling axis is a criticalmediator of CD8 T cell survival in vivo. J Immunol 2008;180:8093–101.

12. Lee HW, Park SJ, Choi BK, Kim HH, Nam KO, Kwon BS. 4-1BB promotesthe survival of CD8þ T lymphocytes by increasing expression of Bcl-xL andBfl-1. J Immunol 2002;169:4882–8.

13. BertramEM, Lau P,Watts TH. Temporal segregation of 4-1BB versus CD28-mediated costimulation: 4-1BB ligand influences T cell numbers late in theprimary response and regulates the size of the T cell memory responsefollowing influenza infection. J Immunol 2002;168:3777–85.

14. Bertram EM, Dawicki W, Sedgmen B, Bramson JL, Lynch DH, Watts TH. Aswitch in costimulation from CD28 to 4-1BB during primary versussecondary CD8 T cell response to influenza in vivo. J Immunol 2004;172:981–8.

15. Halstead ES, Mueller YM, Altman JD, Katsikis PD. In vivo stimulation ofCD137 broadens primary antiviral CD8þ T cell responses. Nat Immunol2002;3:536–41.






16. Melero I, Shuford WW, Newby SA, Aruffo A, Ledbetter JA, Hellstrom KE,et al. Monoclonal antibodies against the 4-1BB T-cell activation moleculeeradicate established tumors. Nat Med 1997;3:682–5.

17. Sin JI, Kim H, Ahn E, Jeon YH, Park WS, Lee SY, et al. Combined stimula-tion of TLR9 and 4.1BB augments Trp2 peptide vaccine-mediated mela-noma rejection by increasing Ag-specific CTL activity and infiltration intotumor sites. Cancer Lett 2013;330:190–9.

18. Sznol M, Hodi FS, Margolin K, McDermott DF, Ernstoff MS, Kirkwood JM,et al. Phase I study of BMS-663513, a fully human anti-CD137 agonistmonoclonal antibody, in patients (pts) with advanced cancer (CA). J ClinOncol 2008;26:3007.

19. Pollok KE, Kim YJ, Zhou Z, Hurtado J, Kim KK, Pickard RT, et al. InducibleT cell antigen 4-1BB. Analysis of expression and function. J Immunol1993;150:771–81.

20. Sun D, Ding A. MyD88-mediated stabilization of interferon-gamma-induced cytokine and chemokine mRNA. Nat Immunol 2006;7:375–81.

21. Kim JD, Kim CH, Kwon BS. Regulation of mouse 4-1BB expression:multiple promoter usages and a splice variant. Mol Cells 2011;31:141–9.

22. Tseng PH, Matsuzawa A, Zhang W, Mino T, Vignali DA, Karin M. Differentmodes of ubiquitination of the adaptor TRAF3 selectively activate theexpression of type I interferons and proinflammatory cytokines. NatImmunol 2010;11:70–5.

23. Gyrd-Hansen M, Meier P. IAPs: from caspase inhibitors to modulators ofNF-kappaB, inflammation and cancer. Nat Rev Cancer 2010;10:561–74.

24. Kaczanowska S, Joseph AM, Davila E. TLR agonists: our best frenemy incancer immunotherapy. J Leukoc Biol 2013;93:847–63.

25. Geng D, Zheng L, Srivastava R, Riker AI, Velasco-Gonzales C, Markovic SN,et al. Amplifying TLR-MyD88 signals within tumor-specific T-cellsenhances antitumor activity to suboptimal levels of weakly-immunogenictumor-antigens. Cancer Res 2010;70:7442–54.

26. Slebioda TJ, Rowley TF, Ferdinand JR, Willoughby JE, Buchan SL, TarabanVY, et al. Triggering of TNFRSF25 promotes CD8(þ) T-cell responses andanti-tumor immunity. Eur J Immunol 2011;41:2606–11.

27. Kober J, Leitner J, Klauser C, Woitek R, Majdic O, Stockl J, et al. Thecapacity of the TNF family members 4-1BBL, OX40L, CD70, GITRL,CD30L and LIGHT to costimulate human T cells. Eur J Immunol 2008;38:2678–88.

28. Bansal-Pakala P, Halteman BS, ChengMH, CroftM. Costimulation of CD8T cell responses by OX40. J Immunol 2004;172:4821–5.

29. Snell LM, Lin GH, McPherson AJ, Moraes TJ, Watts TH. T-cell intrinsiceffects of GITR and 4-1BB during viral infection and cancer immunother-apy. Immunol Rev 2011;244:197–217.

30. Saoulli K, Lee SY, Cannons JL, Yeh WC, Santana A, Goldstein MD, et al.CD28-independent, TRAF2-dependent costimulation of resting T cellsby 4-1BB ligand. J Exp Med 1998;187:1849–62.

31. Wang C, Lin GH, McPherson AJ, Watts TH. Immune regulation by 4-1BBand 4-1BBL: complexities and challenges. Immunol Rev 2009;229:192–215.

32. Lin GH, Liu Y, Ambagala T, Kwon BS, Ohashi PS, Watts TH. Evaluatingthe cellular targets of anti-4-1BB agonist antibody during immunotherapyof a pre-established tumor in mice. PLoS ONE 2010;5:e11003.

33. Choi BK, Kim YH, Choi JH, Kim CH, Kim KS, Sung YC, et al. Unifiedimmunemodulation by 4-1BB triggering leads to diverse effects on diseaseprogression in vivo. Cytokine 2011;55:420–8.

34. Zheng G, Wang B, Chen A. The 4-1BB costimulation augments theproliferation of CD4þCD25þ regulatory T cells. J Immunol 2004;173:2428–34.

35. Choi BK, Bae JS, Choi EM, Kang WJ, Sakaguchi S, Vinay DS, et al. 4-1BB-dependent inhibition of immunosuppression by activated CD4þCD25þ

T cells. J Leukoc Biol 2004;75:785–91.


Joseph et al.




2016;4:708-716. Published OnlineFirst June 7, 2016.Cancer Immunol Res Ann Mary Joseph, Ratika Srivastava, Jovanny Zabaleta, et al.

s Costimulatory Effects′Cells Regulates TLR2 T+TLR2 Signaling in CD8−Cross-talk between 4-1BB and TLR1

Updated version

10.1158/2326-6066.CIR-15-0173doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerimmunolres.aacrjournals.org/content/suppl/2016/06/07/2326-6066.CIR-15-0173.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerimmunolres.aacrjournals.org/content/4/8/708.full#ref-list-1

This article cites 35 articles, 13 of which you can access for free at:

Citing articles

http://cancerimmunolres.aacrjournals.org/content/4/8/708.full#related-urls

This article has been cited by 1 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerimmunolres.aacrjournals.org/content/4/8/708To request permission to re-use all or part of this article, use this link



http://cancerimmunolres.aacrjournals.org/lookup/doi/10.1158/2326-6066.CIR-15-0173

http://cancerimmunolres.aacrjournals.org/content/suppl/2016/06/07/2326-6066.CIR-15-0173.DC1

http://cancerimmunolres.aacrjournals.org/content/4/8/708.full#ref-list-1

http://cancerimmunolres.aacrjournals.org/content/4/8/708.full#related-urls

http://cancerimmunolres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerimmunolres.aacrjournals.org/content/4/8/708


Documents

Cross-talk between 4-1BB and TLR1 TLR2 Signaling …...Research Article Cross-talk between 4-1BB and TLR1–TLR2 Signaling in CD8þ T Cells Regulates TLR2's Costimulatory Effects Ann