SHORT COMMUNICATION

Association of Pro12Ala (rs1801282) variant of PPAR gammawith Rheumatoid Arthritis in a Pakistani population

Syed Fazal Jalil • Iltaf Ahmed • Zeeshan Gauhar •

Mushtaq Ahmed • Javaid M. Malik •

Peter John • Attya Bhatti

Received: 8 April 2013 / Accepted: 19 April 2013

� Springer-Verlag Berlin Heidelberg 2013

Abstract Peroxisome proliferator-activated receptor-

gamma (PPAR-gamma) belongs to a receptor superfamily

of ligand-activated transcription factors, encoded by

PPARG gene. Role of PPARc has been well established

in variety of metabolic disorders and in regulation of

inflammation. In the present study, we aimed to investigate

the association of PPARG (Pro12Ala; rs1801282) in clin-

ically definite Pakistani Rheumatoid Arthritis (RA) patients

and matching controls. The genotypes of the Pro12Ala

variant in the PPARG were determined in a sample of 300

Pakistanis, including 150 RA cases and 150 controls. The

genotyping was performed using Amplification Refractory

Mutation System-Polymerase Chain Reaction (ARMS-

PCR) method, and the data was analyzed through Graph-

pad Prism 5 V software. Allele-specific primer set (two

forward: PPARG-F1, PPARG-F2 and a common reverse

primer: PPARG-R) was used for amplification, and the

product was resolved on 2 % agarose gel. The CC (ProPro)

genotype has higher frequency in controls than RA cases

[75 (50.0 %) vs. 51 (34.0 %)], whereas the CG (ProAla)

genotype has relatively same frequencies in both cases and

controls [72 (48.0 %) vs. 70 (46.6 %)]. However, signifi-

cantly higher frequency of GG (AlaAla) genotype was

observed in cases [27 (18.0 %) vs. 5 (3.3 %); v2 18.54;

p \ 0.0001]. Furthermore, the minor allele G has signifi-

cantly higher allele frequency in cases having same trend

and direction of association (OR 1.991(1.412–2.808);

p \ 0.0001). These observations suggest that Pro12Ala

(rs1801282), a coding variant in the PPARG gene, is

associated with Rheumatoid Arthritis in Pakistanis.

Keywords Rheumatoid Arthritis � PPARG � Pro12Ala �Association studies � Polymorphism

Introduction

Rheumatoid Arthritis is a common complex autoimmune

disease characterized by chronic inflammation of synovial

membrane which leads to progressive joint damage and

even disability if left untreated. The etiology of RA is very

complex and is yet to be explored properly. It has a wide

spectrum of clinical manifestations, variability in disease

severity and/or progression and differences in therapeutic

response. These heterogeneous phenotypes of RA may

suggest the involvement of variety of factors in the

development of this complex trait which includes envi-

ronmental, hormonal and genetic factors, with genetic

susceptibility ranges from 50 to 60 % [1–3].

Genetic studies including candidate gene and genome-

wide association studies have identified numerous suscep-

tibility variants and loci for RA, out of which majority

are shared with other autoimmune inflammatory dis-

eases. Peroxisome proliferator-activated receptors (PPAR)

including PPARa, PPARb/d, PPARc, belong to a nuclear

I. Ahmed and S. F. Jalil equally contributed and are both first authors

of this manuscript.

S. F. Jalil (&) � I. Ahmed � Z. Gauhar � P. John � A. Bhatti

Atta-Ur-Rahman School of Applied Biosciences (ASAB),

National University of Science and Technology (NUST),

Islamabad 44000, Pakistan

e-mail: syedfjalil@gmail.com

M. Ahmed

Rheumatology Unit Military Hospital Rawalpindi,

Rawalpindi, Pakistan

J. M. Malik

Rahmat Noor Clinic and Arthritis Research Center Rawalpindi,

Rawalpindi, Pakistan

123

Rheumatol Int

DOI 10.1007/s00296-013-2768-2

receptor superfamily, have a significant role in the dif-

ferentiation of adipocytes, regulation of lipid metabolism,

glucose homeostasis and regulation of inflammation [4].

A common functional polymorphism in PPARc molecule

is proline to alanine substitution (Pro12Ala; rs1801282)

causing a missense substitution (CCA to GCA) in codon

12 of exon 2. Substitution of prolin to alanin have effect

on insulin sensitivity and hence can lead to type II dia-

betes [5, 6], also contributes to the pathogenesis of

inflammatory bowel disease (IBD ) and colon cancer [7–

9]. PPARG is a regulator of pro-inflammatory genes

(through NFkB and STATs pathways) [10], and its anti-

inflammatory role has been well established in liver and

colon [11, 12].

We hypothesized that PPRAG gene might have a role in

the inflammatory process of RA; therefore, to test this

hypothesis in the current study, we aimed to determine the

association of PPRAG-Pro12Ala polymorphism in a sam-

ple of Pakistanis. Identification of novel disease suscepti-

bility variants/allele is an important step toward the

understanding of biological mechanisms and pathways of

polygenic diseases which may ultimately helps in the

development of potential novel therapeutic targets.

Methods

Subjects

A total of 300 individuals of Pakistani ethnicity (150 RA

cases and 150 matching controls) were enrolled in this

study. All the patients were diagnosed by a certified

rheumatologist in the Military Hospital and Rahmat Noor

Clinic and Arthritis research center Rawalpindi, Pakistan,

and the patients satisfying American College of Rheu-

matology (ACR) 1987 criteria [13] were included in the

study group. Matching controls samples having no

inflammatory or autoimmune disease were also provided

by physicians/rheumatologists. Informed consent was

obtained from each individual participating in the

study, and approval was taken from the institutional

review board, national university of science and

technology.

Venous blood samples were collected from RA cases

and controls in 10-ml-Ethylenediamine-tetraacetic acid

(EDTA) tubes (BD vacutainer TM, Franklin Lakes, New

Jersey, USA). These samples were stored at 4 �C before

being processed for extraction of genomic DNA. Genomic

DNA was extracted, using kit method (NucleoSpin,

Macherery Nagel GmbH Germany) according to manu-

facturer instructions, and DNA was quantified with

PicoGreen� dsDNA assay kit (Life Technologies, NY,

USA).

Genotyping

A coding variant (Pro12Ala; rs1801282) from PPARG

gene was genotyped through Amplification Refractory

Mutation System-Polymerase Chain Reaction (ARMS-

PCR) using two forward and a common reverse primer

(PPARG-F1-50CTCTGGGAGATTCTCCTATTGACC30;PPARG-F2-50 CTCTGGGAGATTCTCCTATTGACG30;PPARG-R-50GCACCACTTGGTCCTACACTCT30). The

PCR amplification was performed in 96 well plates on

thermocycler 2,720 (Applied Biosystems). PCR products

were resolved on 2 % agarose gel.

Statistical analysis

Allele counting method was used to calculate the allele and

genotype frequencies, and the polymorphism was tested for

deviation from Hardy–Weinberg equilibrium (HWE).

Association of the SNP with RA was tested through chi-

Squared (v2) statistics, 2-tailed Fisher’s exact tests and

Z test by using Graphpad Prism 5 V software. Odd Ratio

(OR) with 95 % confidence intervals (CI) was also calcu-

lated. P value \ 0.05 was considered statically significant.

Results

The mean age at onset of disease was 42 ± 10 years with

68 % females, while the mean age of control individuals

was 41.5 ± 12 years. The characteristics of the RA

patients and healthy control groups are shown in Table 1.

A 0 % genotyping error was found which was estimated by

repeating 10 % of the samples. The association results and

genotype frequencies of the tested SNP are shown in

Table 2; Fig. 1. The frequency of homozygous CC (Pro-

Pro) genotype was 51 (34.0 %) in cases and 75 (50.0 %) in

controls; while the frequency of heterozygous CG (ProAla)

genotype was 72 (48.0 %) and 70 (46.7 %) in cases and

controls, respectively. The homozygous GG (AlaAla)

genotype frequency was significantly higher in patients 27

(18.0 %) as compare to controls 5 (3.3 %) (v2 18.54;

Table 1 Characteristics of Rheumatoid Arthritis patients and

controls

Cases

(n = 150)

Controls

(n = 150)

Sero-positive antibody (%) 100 (RF positive) 0

Female (%) 68 72

Mean age, years (±SD) 42 ± 10 41.5 ± 12

Disease duration, years (±SD) 5.1 ± 3.8 0

SD standard deviation

Rheumatol Int

123

p \ 0.0001). From allele frequency analysis, we found that

G allele frequency was significantly higher in patients (OR

1.991(1.412–2.808); p \ 0.0001) as compare to C allele in

relation to control group. Allele frequency distributions are

shown in Tables 3 and 4; Fig. 2.

Discussion

A SNP (Pro12Ala; rs1801282) from the coding region of

PPARG gene was tested for association with RA in a 300

Pakistani case–control sample. The advances in genetic era

have led to the identification of multiple risk loci and

sequence variants not only for monogenetic diseases, but

for common complex disease as well. Although the mul-

tifactorial traits due to their complex etiology have not only

ethnicity-specific variations in genetic predisposition, but

may also share most, if not all, of the susceptibility loci.

The anti-inflammatory role of PPARG gene is well estab-

lished and is known to play an important role in adipocyte

differentiation, lipid and glucose metabolism by regulating

various genes of glucose and lipid metabolic pathways

[14, 15]. The most common functional polymorphism

(rs1801282) in exon 2 of this gene leads to a proline to

alanine substitution (Pro12Ala), which have a significant

role in a variety of metabolic disorders [16–19]. A signif-

icantly lowered leukocyte count in carrier of Ala allele has

demonstrated the role of PPARc polymorphism in

inflammatory processes [19].

An association of the PPARc Pro12Ala polymorphism

with RA has not been examined in Pakistani population

before. Thus, we hypothesized that Pro12Ala of PPARcmight have some role in RA in Pakistanis. In the current

study, allele and genotype frequencies in cases and control

individuals were calculated. The association analysis

revealed that the homozygous genotype (CC; ProPro) has

higher frequency in healthy individuals than cases, which

may suggests it protective role in RA, whereas in case of

heterozygous genotype (CG; ProAla), the frequencies were

almost same in both cases and controls. However, signifi-

cantly higher frequency of homozygous genotype (GG;

AlaAla) was observed in cases, which suggests that GG

genotype might contribute to the RA in Pakistanis. Fur-

thermore, we observed that G allele (Ala) is a minor allele

that has significantly higher allele frequency in cases

having same trend and direction of associations. From

these findings, it is suggested that G allele might be a

susceptibility allele, while C allele (Pro) may have pro-

tective role to RA in Pakistani population. It can be con-

cluded that population with GG genotype for this

polymorphism are at high risk to develop RA as compared

to those with CC genotype.

Association of Pro12Ala polymorphism has not been

well documented with respect to RA, however, its role in

other autoimmune complex disease like artherosclerosis,

type 2 diabetes and insulin resistance have been shown

[6, 16, 19, 20]. A recent multi-ancestry meta-analysis by

Wu et al. [21] on 8,948 coronary artery disease (CAD)

cases and 14,427 controls from 22 published studies have

Table 2 Genotype frequencies distribution in cases and controls

Genotypes v2 Statistics, Ala-carrier versus non-carrier

ProPro (%) ProAla (%) AlaAla (%) v2 value df p value (alpha \ 0.05)

Cases (n = 150) 51.0 (34.0) 72.0 (34.0) 27.0 (18.0) 18.54 2 p \ 0.0001

Control (n = 150) 75.0 (50.0) 70.0 (46.7) 5.0 (3.3)

df degree of freedom

Fig. 1 Genotype frequency in cases and controls

Table 3 Allele frequency distribution in cases and controls

Allele Cases (n = 150) Controls (n = 150) G (Ala) Allele versus C (Pro) allele

OR (95 % CI)a p value

C 220.0 (73.3 %) 174.0 (58.0 %) 1.991 (1.412–2.808) 0.0001

G 80.0 (26.7 %) 126.0 (42.0 %)

a OR odd ratio

Rheumatol Int

123

shown that Pro12Ala polymorphism might be a risk factors

of CAD among Caucasians, but not in Asians, and the

AlaAla (GG) carriers are at high risk to develop CAD.

Association of Pro12Ala polymorphism was also tested in

Chinese RA patients from Sichuan Han population. They

found that Ala (G) allele frequency was much lower in RA

cases as compare to controls, thus, Ala (G) allele might be

a protective allele [22]. Although our results are inconsis-

tent with a study from Chinese population [22], these dis-

similarities could be due to difference in the ethnicity and

ancestry of both populations. A population-based study on

German population have shown that the Pro12Ala poly-

morphism might influence the onset of multiple sclerosis

(MS), and a significantly delayed disease onset of MS has

been demonstrated in individuals with AlaAla genotype

[23]. Similarly, it has been suggested that Pro12Ala is

associated with RA in Koreans [24]. Functional studies on

PPARG gene have revealed that Ala variant may alter the

binding affinity to PPARc-responsive DNA elements as

compared to wild type PPARc, and the differential

expression of PPARc-target genes have suggested the role

of Pro12Ala in transcriptional activity of PPARc [25, 26].

One major limitation of our study is the small sample

size of the study population which can be the cause of

inconsistencies in the findings, thus, further studies with a

large sample is warranted to confirm these results not only

in Pakistanis, but in other ethnic groups as well.

In summary, although the association of RA to PPARchas not been extensively studied, however, in current study

we have found significant association of Pro12Ala GG

genotype with RA in Pakistani population.

Acknowledgments This study was supported by Higher Education

Commission (HEC) of Pakistan. We are thankful to patients and other

healthy control individuals for their cooperation and participation in

the study.

Conflict of interest Authors declare no conflict of interest.

References

1. Seldin MF, Amos CI, Ward R, Gregersen PK (1999) The genetics

evolution and the assault on Rheumatoid Arthritis. Arthritis

Rheum 42:1071–1079

2. MacGregor AJ, Snieder H, Rigby AS, Koskenvuo M, Kaprio J,

Kaprio J et al (2000) Characterizing the quantitative genetic

contribution to Rheumatoid Arthritis using data from twins.

Arthritis Rheum 43:30–37

3. Firestein GS (2003) Evolving concepts of Rheumatoid Arthritis.

Nature 423:356–361

4. Kersten S, Desvergne B, Wahli W (2000) Roles of PPARs in

health and disease. Nature 405:421–424

5. Hara K, Okada T, Tobe K, Yasuda K, Mori Y, Kadowaki T et al

(2000) The Pro12Ala polymorphism in PPAR gamma2 may

confer resistance to type 2 diabetes. Biochem Biophys Res

Commun 271:212–216

6. Frederiksen L, Brødbaek K, Fenger M, Jørgensen T, Borch-

Johnsen K et al (2002) Comment: studies of the Pro12Ala

polymorphism of the PPAR-gamma gene in the Danish MONICA

cohort: homozygosity of the Ala allele confers a decreased risk of

the insulin resistance syndrome. J Clin Endocrinol Metab

87:3989–3992

7. Su CG, Wen X, Bailey ST, Jiang W, Rangwala SM, Keilbaugh

SA et al (1999) A novel therapy for colitis utilizing PPAR-

gamma ligands to inhibit the epithelial inflammatory response.

J Clin Invest 104:383–389

8. Desreumaux P, Dubuquoy L, Nutten S, Peuchmaur M, Englaro

W, Schoonjans K et al (2001) Attenuation of colon inflammation

through activation of the retinoid X receptor (RXR)/peroxisome

proliferators- activated receptor gamma (PPAR-gamma) hetero-

dimer. A basis for new therapeutic strategies. J Exp Med

193:827–838

9. Gupta RA, Dubois RN (2002) Controversy: PPAR gamma as a

target for treatment of colorectal cancer. Am J Physiol Gastro-

intest Liver Physiol 283:266–269

10. Debril MB, Renaud JP, Fajas L, Auwerx J (2001) The pleitropic

functions of peroxisome proliferator5 activated receptor gamma.

J Mol Med 79:30–47

11. Neuschwander-Tetri BA, Brunt EM, Wehmeier KR, Oliver D,

Bacon BR (2003) Improved nonalcoholic steatohepatitis after

48 weeks of treatment with the PPAR5gamma ligand rosiglitaz-

one. Hepatology 38:1008–1017

12. Lewis JD, Lichtenstein GR, Deren JJ, Sands BE, Hanauer SB, Katz

JA et al (2008) Rosiglitazone for active ulcerative colitis: a ran-

domized placebo-controlled trial. Gastroenterology 134:688–695

13. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF,

Cooper NS et al (1988) The American Rheumatism Association

1987 revised criteria for the classification of Rheumatoid

Arthritis. Arthritis Rheum 31:315–324

14. Yamauchi T, Kamon J, Waki H, Murakami K, Motojima K,

Komeda K et al (2001) The mechanisms by which both

Table 4 Allele frequencies in cases and controls

Genotype Cases

(n = 150)

Controls

(n = 150)

CC 51.0 (34.0) 75.0 (50.0) Z value = 4.008

CG 72.0 (34.0) 70.0 (46.7)

GG 27.0 (18.0) 5.0 (3.3)

Allele

C 0.58 0.73 p value = \ 0.0001

G 0.42 0.27

Fig. 2 Allele frequency in cases and controls

Rheumatol Int

123

heterozygous peroxisome proliferator-activated receptor gamma

(PPARgamma) deficiency and PPARgamma agonist improve

insulin resistance. J Biol Chem 276(44):41245–41254

15. Michalik L, Auwerx J, Berger JP, Chatterjee VK, Glass CK,

Gonzalez FJ et al (2006) International union of pharmacology.

Peroxisome proliferator-activated receptors. Pharmacol Rev

58(4):726–741

16. Stumvoll M, Haring H (2002) The peroxisome proliferator-acti-

vated receptor gamma2 Pro12Ala polymorphism. Diabetes

51:2341–2347

17. Doney AS, Fischer B, Cecil JE, Boylan K, McGuigan FE, Ralston

SH et al (2004) Association of the Pro12Ala and C1431T variants

of PPARG and their haplotypes with susceptibility to Type 2

diabetes. Diabetologia 47:555–558

18. Al-Shali KZ, House AA, Hanley AJ, Khan HM, Harris SB,

Zinman B et al (2004) Genetic variation in PPARG encoding

peroxisome proliferator-activated receptor gamma associated

with carotid atherosclerosis. Stroke 35:2036–2040

19. Temelkova-Kurktschiev T, Hanefeld M, Chinetti G, Zawadzki C,

Haulon S, Kubaszek A, Koehler C et al (2004) Ala12Ala genotype of

the peroxisome proliferator 5 activated receptor gamma2 protects

against atherosclerosis. J Clin Endocrinol Metab 89:4238–4242

20. Herrmann SM, Ringel J, Wang JG, Staessen JA, Brand E et al

(2002) Peroxisome proliferator activated receptor gamma poly-

morphism Pro12Ala is associated with nephropathy in type 2

diabetes: the Berlin Diabetes Mellitus (BeDiaM) study. Diabetes

51:2653–2657

21. Wu Z, Lou Y, Jin W, Liu Y, Lu L, Lu G (2012) The Pro12Ala

polymorphism in the peroxisome proliferator-activated receptor

gamma-2 gene (PPARc2) is associated with increased risk of

coronary artery disease: a meta-analysis. PLoS ONE 7(12):

e53105

22. Pan XF, Song XB, Wang LL, Li LX, Ying BW (2009) Associ-

ation of the Pro12Ala polymorphism in peroxisome proliferators

activated receptor-gamma gene with Rheumatoid Arthritis in

Sichuan Province of China. Zhonghua Yi Xue Yi Chuan Xue Za

Zhi 26(1):87–90

23. Klotz L, Schmidt S, Heun R, Klockgether T, Kolsch H (2009)

Association of the PPARc gene polymorphism Pro12Ala with

delayed onset of multiple sclerosis. Neurosci Lett 449:81–83

24. El-Sohemy A, Cornelis MC, Park YW, Bae SC (2006) Catalase

and PPARgamma2 genotype and risk of Rheumatoid Arthritis in

Koreans. Rheumatol Int 26(5):388–392

25. Deeb SS, Fajas L, Nemoto M, Pihlajamaki J, Mykkanen L,

Kuusisto J, Laakso M et al (1998) A Pro12Ala substitution in

PPARgamma2 associated with decreased receptor activity, lower

body mass index and improved insulin sensitivity. Nat Genet

20:284–287

26. Masugi J, Tamori Y, Mori H, Koike T, Kasuga M et al (2000)

Inhibitory effect of a prolineto-alanine substitution at codon 12 of

peroxisome proliferator-activated receptor gamma on thiazolidi-

nedione-induced adipogenesis. Biochem Biophys Res Commun

268:178–182

Rheumatol Int

123