TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

View
42
Download
3
Category

Documents

Preview:

DESCRIPTION

Specific ablation of cBAT results in a compensatory response of increased browning by enhanced sympathetic input to WAT. TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943. - PowerPoint PPT Presentation

Citation preview

TJ Schulz et al. Nature 000, 1-5 (2013) doi:10.1038/nature11943

Specific ablation of cBAT results in a compensatory response ofincreased browning by enhanced sympathetic input to WAT.

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

Documents

Nature Biotechnology: doi:10.1038/nbt...sensitivity to detect MS indels decreases markedly at low allele fractions. Nature Biotechnology: doi:10.1038/nbt.3966 log 10 (KS t est ) log

Nature Immunology: doi:10.1038/ni · assignment of cells from each population across at least 2 out of 3 plates. Nature Immunology: doi:10.1038/ni.3688. Supplementary Figure 2 Temporal

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Nature Biotechnology: doi:10.1038/nbt

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

P. van der Harst et al. Nature 000 , 1 - 7 (2012) doi:10.1038/nature 11677

G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

Nature Biotechnology: doi:10.1038/nbtruminant host shown on individual circles around the tree. Nature Biotechnology: doi:10.1038/nbt.4110 Author Andrew Gordon Created Date 3/12/2018

Nature Reviews Drug Discovery Volume 13 Issue 10 2014 [Doi 10.1038%2Fnrd4391]

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Published in Nature Materials (2016) doi:10.1038/nmat4569

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

GroupImGluRActivationEnhancesCa2 -Dependent ... · TheJournalofNeuroscience,September23,2009 • 29(38):11943–11953 • 11943. MaterialsandMethods SpragueDawleyrats(15–25dold,ofeithersex)

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122