JA Spencer et al. Nature 000 , 1 - 5 (201 4 ) doi:10.1038/nature 13034

View
21
Download
1
Category

Documents

Preview:

DESCRIPTION

Variation in BM p O 2 according to vessel diameter and distance from the endosteal surface. JA Spencer et al. Nature 000 , 1 - 5 (201 4 ) doi:10.1038/nature 13034. - PowerPoint PPT Presentation

Citation preview

JA Spencer et al. Nature 000, 1-5 (2014) doi:10.1038/nature13034

Variation in BM pO2 according tovessel diameter and distance from the endosteal surface.

JA Spencer et al. Nature 000 , 1 - 5 (201 4 ) doi:10.1038/nature 13034

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

O Jagoutz & MD Behn Nature 504 , 131 - 134 (201 3 ) doi:10.1038/nature 12758

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics: doi:10.1038/ng - David Reich...The gray dashed line denotes the diagonal (n = 11) . Nature Genetics: doi:10.1038/ng.3952 8 Supplementary Figure 8 Comparison of autosomal

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

RA Boon et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11919

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Nature Biotechnology: doi:10.1038/nbt

G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332