Tiffany Fleming, Boyce Thompson InstituteCharles Bender, Guilderland High SchoolKim LaCelle, Wheatland-Chili Central School

Tom Brutnell, Associate Scientist, BTIAmanda Romag, Research TechnicianHugues Barbier, Postdoctoral AssociateYing Rong, Research Technician

BRACHYBIO! LINKING TEACHERS, STUDENTS AND SCIENTISTS IN PLANT RESEARCH

BrachyBio! Linking Teachers, Students and Scientists in Plant Research

BrachyBio! Goals:

Bring real scientific research to science classrooms using plants

Create a mutually-beneficial partnership where all groups are able to learn with and from one another to advance scientific understanding of plants

Demonstrate to students and teachers that scientific inquiry is relevant and can be used to solve important social and environmental problems

BrachyBio! Goals Bring real scientific topics to the classroom

Students can understand the importance of plant science by relating to the roles that plants play in their daily lives as sources of food and energy.

Maize WheatRice Barley

BrachyBio! Goals Partnership: Teachers, Scientists, Students

Students Learning Objectives

Scientist Research Objectives

• Students make Discoveries!

• Standardize experimental conditions

• Make observations and collect data

• Record and share results

• Topics: Biology, genetics, environmental science, agriculture

• Create a library of brachy data

• Share data with the research community

• Use data as a tool for investigating cereal crops

BrachyBio! Goals Scientific inquiry can help solve important social &

environmental problems

Current Plant Science Research ChallengeMeet the population’s demand for food

Meeting Agricultural Research Goals

Maize WheatRice Barley

Large plants

Long growing seasons with specific growth requirements

Regulated food crops

Brachypodium distachyonA Model System

• Brachypodium distachyon, is a small, fast-growing grass related to rice, wheat, barley, oats and other important grain crops.

• Self fertilizing; goes form seed to seed in 6-8 weeks

• Requires minimal care• One of the smallest of all of the

grass species genomes sequenced to date (only 272 million base pairs)

• DNA can be easily mutated through standard plant breeding methods

• Model system for engineering C4 photosystem traits into C3 plants

CC44

CC

33

CommCommon on

descendescentt

MaizeMaize 2.5 billion bp

Rice Rice 420 million bp

WheatWheat 17 billion bp

BrachyBrachy 270 million bp

Setaria Setaria 510 million bp

Phylogeny of the grasses

Phylogeny of the grasses

Slide courtesy of Toby Kellogg

DNA: The Molecule of Life

DNA Sequence Observable Phenotype

Genes Color, Architecture, Disease Resistance, Etc

DNA: The Molecule of Life

DNA Sequence Observable Phenotype

Genes Color, Architecture, Disease Resistance, Etc

CCCTTGATATGCTGCACGACGT Plant trait?

GATCGTCGACCGGTGCCTAGCAGCTGGCCACG

GATCGTCGACCAGTGCCTAGCAGCTGGTCACG

Mutagenesis

Ethyl Methanesulfonate (EMS) CH3SO3C2H5

Produces random mutations in genetic material by nucleotide

substitution

BTI Scientists Treat Seeds with EMS and build mutant seed populations

Generation 1 Brachy

Seeds

Generations 1 Plant

Gerations 3 seed

population

Grow M1 & HarvestGrow M1 & Harvest

Overnight EMS

Treatment + GA

Overnight EMS

Treatment + GA

Plant M2 Harvest seeds

Plant M2 Harvest seeds

Generations 2 plants

BrachyBio! Seed StockBrachyBio! Seed Stock

Students Find and Catalogue MutantsFam

ily #

000931

Phenotype Category

Phenotype Subcategory

MutantDescriptions

First Screen

Family # #mutants

#germinatedColor White Albino 00931 3/12

Architecture Size Small 00931 3/12

Students find and Catalog Mutants

Pale Green Mutant Variegated Mutant & Early Flowering

•Pigmentation related to photosynthetic pathways may be applied towards understanding photosynthetic development.

• Increased branching may contribute towards increased plant yields with potential applications in biofuel development.

Wild Type Pale Green Highly Branched

• A majority of the plants will be wild type. These plants can be used for many additional lessons in the classroom.

Discuss Applications of Mutant Phenotypes

Students observe and record physical characteristics

•Size

•Coloration

•Architecture

•Flowering time

• Tool for future gene discovery

• Applicable to related cereal crops

Record and Share Data in the Mutant Library

Students Upload pictures in the Mutant Library

000874 VirescentClass/School name

Scientists Can Access Library and

Order Seeds

Search: Virescent

Results: 000874

Students join the Research Community

Professional Development for Science Teachers

•Develop content knowledge in hard-to-teach topics like genetics, heredity, and photosynthesis

•Work as an annual cohort to develop lesson plans that integrate new content knowledge into the existing curricula•Receive classroom support, web-based resources, and equipment to implement new lessons into their classrooms•Access to an online database where students can upload their data and compare it to data generated in classrooms across New York State.

Students: making discoveries that extend beyond the classroom

•Students are making discoveries! • They work to standardize growth

conditions and collect meta-data on environmental conditions like temperature, light, humidity.

• They observe and catalog unique phenotypes caused by random genetic mutations in the DNA of Brachypodium plants.

• Through a shared database, they have the opportunity to compare their results with other classrooms. They may discover how environmental differences influence phenotypic expression.

Wheatland Chili Middle School

Connecting to BTI Scientists

•Student work is generating data that scientists will use to continue to breed and develop important food crops.

•Students are exposed to agricultural issues and research in ways that are relevant and timely.

How do teachers bring BrachyBio! To their classrooms?

•The BrachyBio! website (www.bti.cornell.edu/brachybio) and curriculum materials have been developed by teachers, scientists and science educators for use in the middle and high school science classroom. The curriculum may be taught as a stand-along unit, or integrated into existing units including genetics and heredity, photosynthesis, or growth and development, all using scientific inquiry.

Acknowledgements

Tom Brutnell, ScientistAmanda Romag, Research TechnicianHugues Barbier, Postdoctoral AssociateYing Rong, Research Technician

Tiffany Fleming, Boyce Thompson InstituteCharles Bender, Guilderland High SchoolKim LaCelle, Wheatland-Chili Central School