UNIT 5
Chapter 17: From Gene to ProteinChapter 18: Microbial Models
Chapter 19: The Organization & Control of Eukaryotic Genomes
Chapter 20: DNA Technology
Introduction The Central Dogma is the molecular “chain of
command” in a cell DNA RNA proteins
Transcription: DNA used to make mRNA Translation: mRNA used to make protein/polypeptide
Transcription: RNA Synthesis RNA polymerase uses a template strand of DNA to
base pair with Transcription includes: initiation, elongation,
termination Initiation: RNA polymerase identifies template
strand by presence of promoter TATA box Transcription factors
RNA polymerase base pairs RNA nucleotides with the template strand Uracil is used
in RNA rather than thymine
Elongation: double helix unwinds as RNA polymerase adds nucleotides New RNA “peels off”
of the DNA as it reforms the helix
A single gene can be transcribed by many RNA polymerase molecules at once
Termination: elongation proceeds until a terminator is encountered Primary
transcript is released
In eukaryotes, the transcript is to be modified
RNA Processing Before translation, the primary transcript undergoes
processing 5’ cap: added to the 5’ end to prevent digestion by
enzymes, also includes attachment site for ribosomes Poly-A tail: added to the 3’ end to prevent digestion
by enzymes, also helps with exportation from nucleus
RNA splicing: non-coding sequences, introns, are removed, leaving only exons Spliceosomes made up of snRNPs facilitate splicing
of the exons
Translation: Polypeptide Synthesis The newly created mRNA
(messenger RNA) enters the cytoplasm and is attached to a ribosome Codons indicate which tRNA
is complimentary tRNA (transfer RNA) carries
amino acids to the ribosome Anti-codons correspond to
codons
Most codons correlate with a specific amino acid Genetic code is redundant but not ambiguous
Start and stop codons
The genetic code is very old and connects to our scientific understanding of evolution It is almost universal Foreign genes can be
expressed by organisms
There are 61 codons, but only 45 types of tRNA (anti-codons) Base pairing rules are “relaxed” in the third position of the
codon/anti-codon Called wobble: U can base pair with A or G
The ribosome is the site of translation P site: holds tRNA with
growing polypeptide A site: arrival site for next
tRNA E site: site for discharging
tRNAs
Translation includes: initiation, elongation, termination
Initiation and elongation require energy: GTP
Initiation: brings together mRNA, first amino acid and two ribosomal subunits First – small ribosomal subunit locates and attaches at
start codon Second – tRNA carrying appropriate anti-codon (and
methionine) arrives and attaches to mRNA
Third – large ribosomal subunit arrives and covers the tRNA at the P site (GTP required)
Initiation is now complete
Elongation: brings together remaining tRNAs in order First – the next tRNA will arrive and base pair with
the codon at the A site Second – using GTP, a peptide bond is formed
between the new amino acid and the growing polypeptide
Third – using GTP, the mRNA and tRNA are moved in the 5’ 3’ direction exactly three nucleotides (translocation)
E
PA
GGA
metpro
5’ CGCCAUGCCUAGCACAUGACCUA 3’
UCG
ser
metpro
GGA5’ CGCCAUGCCUAGCACAUGACCUA 3’
UCG
ser
metpro
Termination: ribosome encounters a stop codon A release factor will base pair with the stop codon and
hydrolyze the polypeptide from the last tRNA
(Avg. protein translation: ~1 min)
Ribosomes There are bound (on the rough endoplasmic
reticulum) and free (in the cytoplasm) ribosomes Bound: used to make proteins that will be
secreted from the cell Free: used to make proteins that will stay in
the cytoplasm Same mRNA can be translated by multiple
ribosomes – polyribosomes
Prokaryotes Two major differences between eukaryotes
and prokaryotes There is no RNA processing
What is transcribed IS the mRNA
Transcription and translation are coupled
END
Bacterial Genetic MaterialBacterial Genetic Material
Bacteria possess a single chromosomeBacteria possess a single chromosome Double-stranded, circularDouble-stranded, circular 4-6 million base pairs on average4-6 million base pairs on average
Some bacteria carry Some bacteria carry plasmidsplasmids with “non-crucial” with “non-crucial” genesgenes Separate from chromosome, also circularSeparate from chromosome, also circular
Variation in Bacterial GeneticsVariation in Bacterial Genetics
Bacteria can acquire new genes by one of three Bacteria can acquire new genes by one of three methods: transformation, transduction, methods: transformation, transduction, conjugationconjugation TransformationTransformation: bacteria take up foreign DNA and : bacteria take up foreign DNA and
incorporate it into their chromosomeincorporate it into their chromosomeCan also be plasmidsCan also be plasmids
TransductionTransduction: phages act as : phages act as vectorsvectors for bacterial DNA for bacterial DNAAccidental and rareAccidental and rare
ConjugationConjugation: bacterial “sex” is the direct transfer of : bacterial “sex” is the direct transfer of genetic material between two bacteriagenetic material between two bacteria
Requires an Requires an F factorF factor (fertility) – gene that (fertility) – gene that allows for construction of a allows for construction of a sex pilussex pilus
Hollow tube for transfer of plasmidsHollow tube for transfer of plasmids
Most common type of shared plasmids = Most common type of shared plasmids = antibiotic resistanceantibiotic resistance
Regulation of Bacterial GenesRegulation of Bacterial Genes
Bacteria have relatively simple control systems Bacteria have relatively simple control systems for their genes called for their genes called operonsoperons Method for bacteria to turn on genes when needed Method for bacteria to turn on genes when needed
and off when notand off when not Operons have three components: a promoter, an Operons have three components: a promoter, an
operator, the gene(s) it controlsoperator, the gene(s) it controlsPromoterPromoter: site to which RNA poylmerase binds: site to which RNA poylmerase binds
OperatorOperator: site to which repressor protein binds: site to which repressor protein binds Repressor protein is always present in the cellRepressor protein is always present in the cell
The The laclac operon is an example found in operon is an example found in E. coliE. coli Genes produce proteins/enzymes to digest lactoseGenes produce proteins/enzymes to digest lactose
No lactose:No lactose:Repressor can bind to operatorRepressor can bind to operator
Prevents RNA polymerase from transcribing genes Prevents RNA polymerase from transcribing genes lacZlacZ, , lacYlacY, , lacAlacA
Lactose:Lactose:Lactose binds to repressor, changing its conformation so it Lactose binds to repressor, changing its conformation so it cannot bind to operatorcannot bind to operator
RNA polymerase can transcribe genes RNA polymerase can transcribe genes lacZlacZ, , lacYlacY, , lacA lacA and and digest the lactosedigest the lactose
END
Introduction
• Eukaryotic DNA is much more complex than that of prokaryotes• Little is known about expression
• Highly active area of research• Genome is typically larger• Cell specialization limits expression of genes
• Human genome possesses ~20K to 30K genes• >97% of the genome is non-coding• DNA is associated with MANY proteins• Complex packaging can influence transcription
• Loose packing = frequent transcription; tight packing = infrequent transcription
Gene Expression Controls
• Only a small portion of a multicellular organism’s DNA is actively transcribed in any given cell• Cellular differentiation makes
long-term control necessary• 200 cell types, 1 genome
• Many levels of control exist to regulate expression in eukaryotes
Molecular Basis of Cancer
• Oncogenes are cancer-causing genes• Arise from changes in a cell’s DNA (mutations)
• Chemical agents (carcinogens) or physical mutagens can alter proto-oncogene function
• Mutations in tumor-suppressor genes can also cause cancer
• Control adhesion of cells, inhibit cell cycle, repair damaged DNA, initiate apoptosis
• Example of proto-oncogene includes p53
• Mutations to gene occur in 50% of all cancers
• Nicknamed the “guardian angel of the genome”• Damage to a cell’s DNA stimulates p53
expression• Acts as a transcription factor for several other
genes• Activates p21 gene which halts cell cycle
• Turns on genes involved in DNA repair
• If damage is irreparable, it turns on “suicide genes” which causes cell death – apoptosis
Development of Cancer
• Usually, many mutations must occur for cancer to develop• Cancer is caused by the accumulation of mutations &
mutations occur throughout life the longer we live, the more chance of cancer
• Many malignant tumors have an active telomerase gene
• Viruses (esp. retroviruses) account for 15% of cancers• They may donate oncogenes or disrupt tumor-
suppressor genes or convert a proto-oncogene
END
Restriction Enzymes
• In nature, bacteria use restriction enzymes to cut foreign DNA• Restriction enzymes cut DNA at specific sites
• Enzymes identify a restriction site to cut at
• Restriction sites usually occur at many places in a sequence of DNA
• Restriction sites may occur at many locations, so the enzyme will make many cuts
• Often times, a staggered cut is made, producing sticky ends that can base pair with its compliment
DNA Cloning Vectors
• Bacterial plasmids are used as cloning vectors• DNA molecule that carries foreign DNA into a cell• Bacteria can pass on their plasmids to daughter cells
• Less complex than eukaryotes, reproduce faster
• Cloning a human gene in bacteria steps• Isolation of vector and gene of interest
• The vector is a plasmid• Plasmid engineered to carry a gene for resistance to an antibiotic
• Insertion of gene of interest into vector• Restriction enzymes used on both plasmid and
gene of interest to produce compatible sticky ends• Gene and plasmid fragments mixed and DNA
ligase joins them together
• Introduction of recombinant vector into cells• Bacteria are transformed by taking up plasmid• Both recombinant and non-recombinant bacteria
are created
• Cloning of cells (and gene of interest)• Bacteria are spread onto agar plates containing an
antibiotic• Antibiotic ensures that only bacteria with the
plasmid will grow• Transformed bacteria display “extra” trait
Complimentary DNA - cDNA
• RNA processing doesn’t occur in prokaryotes, so it can be difficult to get them to express eukaryotic DNA• A fully processed mRNA is needed since its lacking
introns
• mRNA acts as a template for making DNA• Reverse transcriptase used to make DNA from RNA
• Reverse transcriptase isolated from retroviruses
• Product is a cDNA molecule, DNA with no introns compatible with bacterial DNA
PCR
• The Polymerase Chain Reaction (PCR) can be used to create billions of copies of a segment of DNA in a few hours• No cells are needed
• Nucleotides, primers, DNA polymerase added into a test tube with our DNA to be copied
• Since 1985, PCR has had a huge impact on biotechnology and DNA from a variety of sources has been amplified• A 40,000 year old frozen wooly mammoth• TINY amounts of blood or semen (or other DNA
evidence) from crime scenes
• Embryonic cells for rapid diagnosis of genetic disorders
• Viral genes from difficult-to-detect viruses like HIV
END