UNIT 5

Chapter 17: From Gene to ProteinChapter 18: Microbial Models

Chapter 19: The Organization & Control of Eukaryotic Genomes

Chapter 20: DNA Technology

Introduction The Central Dogma is the molecular “chain of

command” in a cell DNA RNA proteins

Transcription: DNA used to make mRNA Translation: mRNA used to make protein/polypeptide

Transcription: RNA Synthesis RNA polymerase uses a template strand of DNA to

base pair with Transcription includes: initiation, elongation,

termination Initiation: RNA polymerase identifies template

strand by presence of promoter TATA box Transcription factors

RNA polymerase base pairs RNA nucleotides with the template strand Uracil is used

in RNA rather than thymine

Elongation: double helix unwinds as RNA polymerase adds nucleotides New RNA “peels off”

of the DNA as it reforms the helix

A single gene can be transcribed by many RNA polymerase molecules at once

Termination: elongation proceeds until a terminator is encountered Primary

transcript is released

In eukaryotes, the transcript is to be modified

RNA Processing Before translation, the primary transcript undergoes

processing 5’ cap: added to the 5’ end to prevent digestion by

enzymes, also includes attachment site for ribosomes Poly-A tail: added to the 3’ end to prevent digestion

by enzymes, also helps with exportation from nucleus

RNA splicing: non-coding sequences, introns, are removed, leaving only exons Spliceosomes made up of snRNPs facilitate splicing

of the exons

Translation: Polypeptide Synthesis The newly created mRNA

(messenger RNA) enters the cytoplasm and is attached to a ribosome Codons indicate which tRNA

is complimentary tRNA (transfer RNA) carries

amino acids to the ribosome Anti-codons correspond to

codons

Most codons correlate with a specific amino acid Genetic code is redundant but not ambiguous

Start and stop codons

The genetic code is very old and connects to our scientific understanding of evolution It is almost universal Foreign genes can be

expressed by organisms

There are 61 codons, but only 45 types of tRNA (anti-codons) Base pairing rules are “relaxed” in the third position of the

codon/anti-codon Called wobble: U can base pair with A or G

The ribosome is the site of translation P site: holds tRNA with

growing polypeptide A site: arrival site for next

tRNA E site: site for discharging

tRNAs

Translation includes: initiation, elongation, termination

Initiation and elongation require energy: GTP

Initiation: brings together mRNA, first amino acid and two ribosomal subunits First – small ribosomal subunit locates and attaches at

start codon Second – tRNA carrying appropriate anti-codon (and

methionine) arrives and attaches to mRNA

Third – large ribosomal subunit arrives and covers the tRNA at the P site (GTP required)

Initiation is now complete

E

PA

5’ CGCCAUGCCUAGCACAUGACCUA 3’

UAC

UAC

met

Elongation: brings together remaining tRNAs in order First – the next tRNA will arrive and base pair with

the codon at the A site Second – using GTP, a peptide bond is formed

between the new amino acid and the growing polypeptide

Third – using GTP, the mRNA and tRNA are moved in the 5’ 3’ direction exactly three nucleotides (translocation)

E

PA

5’ CGCCAUGCCUAGCACAUGACCUA 3’

UAC

UAC

met

GGA

promet

pro

E

PA

UACGGA

metpro

5’ CGCCAUGCCUAGCACAUGACCUA 3’

UACGGA

metpro

5’ CGCCAUGCCUAGCACAUGACCUA 3’

E

PA

GGA

metpro

5’ CGCCAUGCCUAGCACAUGACCUA 3’

UCG

ser

metpro

GGA5’ CGCCAUGCCUAGCACAUGACCUA 3’

UCG

ser

metpro

Summary of elongation

Termination: ribosome encounters a stop codon A release factor will base pair with the stop codon and

hydrolyze the polypeptide from the last tRNA

(Avg. protein translation: ~1 min)

Ribosomes There are bound (on the rough endoplasmic

reticulum) and free (in the cytoplasm) ribosomes Bound: used to make proteins that will be

secreted from the cell Free: used to make proteins that will stay in

the cytoplasm Same mRNA can be translated by multiple

ribosomes – polyribosomes

Prokaryotes Two major differences between eukaryotes

and prokaryotes There is no RNA processing

What is transcribed IS the mRNA

Transcription and translation are coupled

END

Bacterial Genetic MaterialBacterial Genetic Material

Bacteria possess a single chromosomeBacteria possess a single chromosome Double-stranded, circularDouble-stranded, circular 4-6 million base pairs on average4-6 million base pairs on average

Some bacteria carry Some bacteria carry plasmidsplasmids with “non-crucial” with “non-crucial” genesgenes Separate from chromosome, also circularSeparate from chromosome, also circular

Variation in Bacterial GeneticsVariation in Bacterial Genetics

Bacteria can acquire new genes by one of three Bacteria can acquire new genes by one of three methods: transformation, transduction, methods: transformation, transduction, conjugationconjugation TransformationTransformation: bacteria take up foreign DNA and : bacteria take up foreign DNA and

incorporate it into their chromosomeincorporate it into their chromosomeCan also be plasmidsCan also be plasmids

TransductionTransduction: phages act as : phages act as vectorsvectors for bacterial DNA for bacterial DNAAccidental and rareAccidental and rare

ConjugationConjugation: bacterial “sex” is the direct transfer of : bacterial “sex” is the direct transfer of genetic material between two bacteriagenetic material between two bacteria

Requires an Requires an F factorF factor (fertility) – gene that (fertility) – gene that allows for construction of a allows for construction of a sex pilussex pilus

Hollow tube for transfer of plasmidsHollow tube for transfer of plasmids

Most common type of shared plasmids = Most common type of shared plasmids = antibiotic resistanceantibiotic resistance

Regulation of Bacterial GenesRegulation of Bacterial Genes

Bacteria have relatively simple control systems Bacteria have relatively simple control systems for their genes called for their genes called operonsoperons Method for bacteria to turn on genes when needed Method for bacteria to turn on genes when needed

and off when notand off when not Operons have three components: a promoter, an Operons have three components: a promoter, an

operator, the gene(s) it controlsoperator, the gene(s) it controlsPromoterPromoter: site to which RNA poylmerase binds: site to which RNA poylmerase binds

OperatorOperator: site to which repressor protein binds: site to which repressor protein binds Repressor protein is always present in the cellRepressor protein is always present in the cell

The The laclac operon is an example found in operon is an example found in E. coliE. coli Genes produce proteins/enzymes to digest lactoseGenes produce proteins/enzymes to digest lactose

No lactose:No lactose:Repressor can bind to operatorRepressor can bind to operator

Prevents RNA polymerase from transcribing genes Prevents RNA polymerase from transcribing genes lacZlacZ, , lacYlacY, , lacAlacA

Lactose:Lactose:Lactose binds to repressor, changing its conformation so it Lactose binds to repressor, changing its conformation so it cannot bind to operatorcannot bind to operator

RNA polymerase can transcribe genes RNA polymerase can transcribe genes lacZlacZ, , lacYlacY, , lacA lacA and and digest the lactosedigest the lactose

END

Introduction

• Eukaryotic DNA is much more complex than that of prokaryotes• Little is known about expression

• Highly active area of research• Genome is typically larger• Cell specialization limits expression of genes

• Human genome possesses ~20K to 30K genes• >97% of the genome is non-coding• DNA is associated with MANY proteins• Complex packaging can influence transcription

• Loose packing = frequent transcription; tight packing = infrequent transcription

Gene Expression Controls

• Only a small portion of a multicellular organism’s DNA is actively transcribed in any given cell• Cellular differentiation makes

long-term control necessary• 200 cell types, 1 genome

• Many levels of control exist to regulate expression in eukaryotes

Molecular Basis of Cancer

• Oncogenes are cancer-causing genes• Arise from changes in a cell’s DNA (mutations)

• Chemical agents (carcinogens) or physical mutagens can alter proto-oncogene function

• Mutations in tumor-suppressor genes can also cause cancer

• Control adhesion of cells, inhibit cell cycle, repair damaged DNA, initiate apoptosis

• Example of proto-oncogene includes p53

• Mutations to gene occur in 50% of all cancers

• Nicknamed the “guardian angel of the genome”• Damage to a cell’s DNA stimulates p53

expression• Acts as a transcription factor for several other

genes• Activates p21 gene which halts cell cycle

• Turns on genes involved in DNA repair

• If damage is irreparable, it turns on “suicide genes” which causes cell death – apoptosis

Development of Cancer

• Usually, many mutations must occur for cancer to develop• Cancer is caused by the accumulation of mutations &

mutations occur throughout life the longer we live, the more chance of cancer

• Many malignant tumors have an active telomerase gene

• Viruses (esp. retroviruses) account for 15% of cancers• They may donate oncogenes or disrupt tumor-

suppressor genes or convert a proto-oncogene

END

Restriction Enzymes

• In nature, bacteria use restriction enzymes to cut foreign DNA• Restriction enzymes cut DNA at specific sites

• Enzymes identify a restriction site to cut at

• Restriction sites usually occur at many places in a sequence of DNA

• Restriction sites may occur at many locations, so the enzyme will make many cuts

• Often times, a staggered cut is made, producing sticky ends that can base pair with its compliment

DNA Cloning Vectors

• Bacterial plasmids are used as cloning vectors• DNA molecule that carries foreign DNA into a cell• Bacteria can pass on their plasmids to daughter cells

• Less complex than eukaryotes, reproduce faster

• Cloning a human gene in bacteria steps• Isolation of vector and gene of interest

• The vector is a plasmid• Plasmid engineered to carry a gene for resistance to an antibiotic

• Insertion of gene of interest into vector• Restriction enzymes used on both plasmid and

gene of interest to produce compatible sticky ends• Gene and plasmid fragments mixed and DNA

ligase joins them together

• Introduction of recombinant vector into cells• Bacteria are transformed by taking up plasmid• Both recombinant and non-recombinant bacteria

are created

• Cloning of cells (and gene of interest)• Bacteria are spread onto agar plates containing an

antibiotic• Antibiotic ensures that only bacteria with the

plasmid will grow• Transformed bacteria display “extra” trait

Complimentary DNA - cDNA

• RNA processing doesn’t occur in prokaryotes, so it can be difficult to get them to express eukaryotic DNA• A fully processed mRNA is needed since its lacking

introns

• mRNA acts as a template for making DNA• Reverse transcriptase used to make DNA from RNA

• Reverse transcriptase isolated from retroviruses

• Product is a cDNA molecule, DNA with no introns compatible with bacterial DNA

• Creation of cDNA

PCR

• The Polymerase Chain Reaction (PCR) can be used to create billions of copies of a segment of DNA in a few hours• No cells are needed

• Nucleotides, primers, DNA polymerase added into a test tube with our DNA to be copied

• PCR• Special

DNA Polymerase is used

• Since 1985, PCR has had a huge impact on biotechnology and DNA from a variety of sources has been amplified• A 40,000 year old frozen wooly mammoth• TINY amounts of blood or semen (or other DNA

evidence) from crime scenes

• Embryonic cells for rapid diagnosis of genetic disorders

• Viral genes from difficult-to-detect viruses like HIV

END