What is happening in invasion?
T. cruzi invasion- non phagocyticPhagocytosis Active invasion
Actin filaments
Trypanosoma cruziYeast
Lamp-1
T. cruzi invasion summary
Leishmania phagosome
Treatment for kinetoplastid diseases HAT
Early (these drugs cannot cross the blood/brain barrier)
Suramin (1916) highly charged compound
Mode of action (?) - inhibits metabolic enzymes (NAD+)
Pentamidine (some resistance)Mode of action (?) - likely multiple targetsDifferential uptake of drug - parasite conc. mM quantites
LateMelarsoprol (lipophilic) (1947)
Highly toxic arsenical - up to 10% treated dieMode of action (?) - possibly energy metabolism
Eflornithine (drug has similar affinity to mammalian enzyme)
suicide inhibitor of ornithine decarboxylaseblocking polyamine biosynthesis
Treatments for HAT
Early Stage
First-line drugs Pentamidine Pentamidine Suramin Suramin
Clinical trials - DB 289 (Phase III)Pre-clinical stage - -
Late-stage/CNS
First-line drugs Melarsoprol Melarsoprol Eflornithine
Clinical trials - Nifurtimox + Eflornithine
Pre-clinical stage - -
1985 2005
Chagas Acute
Nifurtimox60-90 daysMode of action (?) ROS - then DNA damage
Benznidazole30-120 daysMode of action - thought to inhibit nucleic acid
synthesis (ROS?)
ChronicVirtually untreatable - just treat symptoms
Treatment for kinetoplastid diseases
Treatments for Chagas
Acute StageFirst-line drugs Benznidazole Benznidazole
Nifurtimox NifurtimoxClinical trials Allopurinal
Indeterminate Stage
Clinical trials - Benznidazole
Chronic StageFirst-line drugs - -Clinical trials - -Pre-clinical stage - Antifungal triazoles
Cruzipain inhibitor
1985 2005
Leishmaniasis Pentavalent antimonial compounds (1947,1950)
10-30 day treatment
Pentamidine (for failed cases)(1940)
Amphotericine (1959)Drug interacts with plasma membrane ergosterol (also in fungi)Discriminates between ergosterol and cholesterolNew formulation w/liposomes readily taken up by macrophages!
Allopurinol (experimental in humans, used for dogs)
Inhibits hypoxanthine-guanine phosphoribosyltransferase(HGPRTase) - feedback inhibition of purine biosynthesis
Treatment for kinetoplastid diseases
Treatments for Leishmaniasis
New Drug Targets! Putative drug targets
kDNA replication, mitochondrial RNA editing RNA processing Fatty acid metabolism - not well studied Cell cycle and differentiation Membrane transport - unique transporters (purines!) Acidocalcisomes - Storage for Ca++, Mg++, polyphosphates
Plant-like vacuolar H+ pyrophosphatase Carbohydrate metabolism - glycosomes, alternative oxidase
Drug target validation Is the gene essential for parasite survival? Redundancy Classical gene knockout - diploid organisms Now, RNA interference!
Gene Expressionhttp://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowTOC&rid=mboc4.TOC&depth=2
Prokaryotic Translation is concurrent with
transcription No barrier restricts movement of
transcript to translation apparatus Single RNA polymerase
synthesizes all RNA species
Eukaryotic Transcript must be processed
Capping, splicing, polyA addition mRNA is sequestered as RNP in
the nucleus, must be transported tocytoplasm
Genes are often split - codingsequence is not contiguous
3 different RNA polymerasesrequired to synthesize RNA classes
Polycistronic Transcripts
DNA
mRNA Polycistronic transcriptmultiple genes
Operon - gene cluster
Proteins perform a coordinated function
Examples: Carbohydrate degradationAmino acid biosynthesis
Eukaryotic Transcripts
5’ 7-methylgaunosine cap structure Post-transcriptional modification - after ~ 25 nucleotides Prevents degradation by 5’ exonucleases Helps in the export from the nucleus
Poly-adenylated tail Post-transcriptional modification Helps in stability of the mRNA
Mature transcript
Kinetoplastid Transcription
Alternative Splicing Discovered by D. Baltimore - immunoglobin heavy chain Increases the diversity of protein repertoire Improper alternative splicing can lead to disease
Cis-Splicing Mechanism
•Several steps in the splicing reaction require ATP
Splicing is mediated by the Spliceosome
Splicesome mediated - simplified
Composed of snRNPs Small nuclear ribonucleoprotein
Small nuclear U-rich RNA (snRNA) Each complexed with ~ 7 proteins
1. U1 base-pairs with the 5’ splice-site2. U2 binds/pairs with the branch point; also pairs
with U6 in the assembled spliceosome3. U4 pairs with U6 in snRNPs, but releases during
spliceosome assembly4. U5 interacts with both exons (only 1-2 nt adjacent
to intron); helps bring exons together5. U6 displaces U1 at the 5’ splice-site (pairs with nt
in the intron); it also pairs with U2 in thecatalytic center of the spliceosome
Highly simplified version
Trans-splicing:1st discovered in trypanosomes
Gene A Gene B Gene C Gene D Gene E
DNA
Polycistronictranscript
AAAA
AAAA AAAA
AAAA
AAAA
SL RNA
No evidence ofoperons
Trans-splicing
Polyadenylation
Individual mRNAs each with a SL and poly A tail
To date: ALL coding sequences are trans-spliced!
Comparison of cis- and trans-splicing
Lariat intermediate
Y-branch intermediate
transesterification
transesterification
Intramolecular Intermolecular
Comparison of Spliceosomes
New Technology - SMaRT Defects in alternative splicing can lead to human disease Use of artificial trans-splicing to “repair” and give rise to a
functional mRNA
www.intronn.com
Correcting at the pre-mRNA level!
Spliceosome-mediated RNA Trans-splicing
Trypanosomatid MitochondrialRNA editing
Single mitochondrion Unique mitochondrial DNA
Catenated structure composedof mini- and maxicircles
Size of molecules varies withspecies (15-80 kb) (1 - 2.5 kb)
50 maxicircles/network 5000-10,000 minicircles/network Minicircles were initially thought
to be nonfunctional, just astructural component
Maxicircle20 kb
Minicircle1 kb
Maxicircle sequence Initial sequencing of the T. brucei maxicircles demonstrated that it
encoded apocytochrome b, subunits 1 and 2 of cytochrome coxidase (cox) and some unassigned reading frames (MURFs) (somelater turned out to be subunits of NADH dehydrogenase).
However some pseudogene features – e.g. cox2 had a –1 frameshiftand this was conserved between kinetoplastid species.
Sequence determination of cox2 cDNA in 1984 showed an insertionat the precise position of the frameshift converting GA to UUGUAU.
This wasn’t accepted at first – there were 50 maxicircles and maybeone had the difference or the gene was encoded in the nucleus.
Extensive analysis showed no conventional cox2 genes existed inthe nucleus or mitochondrion but a mechanism of adding in U’s wasway too outlandish to be accepted at that time.
Maxicircle Sequence
Sequencing of other mitochondrial cDNAs and their comparison tothe genomic sequence showed not only the addition of U’s but alsotheir deletion.
In 1986 the first CAUTIOUS paper on a “co- or post-transcriptionalnucleotide insertion process” was published (Benne et al.,1986 Cell46, 819-826 - 18 page paper).
Although the data showed deletion of one U, the authors didn’t dareto conclude that this form of editing could also occur.
Other groups of investigators found similar editing processes andthe number of edited trypanosomatid RNAs expanded.
The mystery of missing AUG translational start codons was solvedas these are provided by RNA editing by both addition and deletionof U’s
Mitochondrial RNA editing
*
**
** ** ****
***
***
****
***
**
*
*
*
** ** **
**
*** **
*** *
***
***
**
***** *
*** *
*** ********
******
**
*
**
*
Cell
Edited T. brucei ND7 mRNA
Cryptic mRNAs produced mRNA sequence DOES NOT exactly
correspond with genomic DNA sequence Requires insertion of uridine residues
(u) or deletion (*) to create afunctional ORF
Extreme example is ND7 >90% of mRNA is edited
Process is more active inprocyclic form parasites
Minicircles encode gRNAs (guideRNAs) that act as templates forinsertion and deletion (1991)
Process is essential (2001) Demonstrated by gene silencing in
bloodstream form parasites
Maxicircle Comparison Ribosomal RNA sequences ARE NOT edited
Insertional RNA editing
GCGGAGAAAAAAUGAAAUGUGUUGUCUUUUAAUG ::|:||||||||||||||:|||||||||||||3'-UUUUUUUUUUUUUACUUUAUACAACAGAAAAUUACppp5'
(A)n5'
Edited mRNAEditing
GCGGAGAAAAAAGAAAGGGUCUUUUAAUG ::|:|||| ||:||||||||3'-UUUUUUUUUU CAGAAAAUUACppp5'
(A)n5'
UUUACU U U A
UACA
A Guide RNA
AnchorPoly(U) tail
Primary transcript (Maxicircle encoded)
(Minicircle encoded)
Pan-editing of the L. tarentolae A6 mRNA
Precursor mRNA
Precursor mRNA
Precursor mRNA
Precursor mRNA
Edited mRNA
Edited mRNA
Edited mRNA
Edited mRNA
Mechanism of RNA EditingInsertion Deletion
RNA Editing Proteins
Mediated by Protein Complex