What is happening in invasion?

T. cruzi invasion- non phagocyticPhagocytosis Active invasion

Actin filaments

Trypanosoma cruziYeast

Lamp-1

T. cruzi invasion summary

Leishmania phagosome

Treatment for kinetoplastid diseases HAT

Early (these drugs cannot cross the blood/brain barrier)

Suramin (1916) highly charged compound

Mode of action (?) - inhibits metabolic enzymes (NAD+)

Pentamidine (some resistance)Mode of action (?) - likely multiple targetsDifferential uptake of drug - parasite conc. mM quantites

LateMelarsoprol (lipophilic) (1947)

Highly toxic arsenical - up to 10% treated dieMode of action (?) - possibly energy metabolism

Eflornithine (drug has similar affinity to mammalian enzyme)

suicide inhibitor of ornithine decarboxylaseblocking polyamine biosynthesis

Treatments for HAT

Early Stage

First-line drugs Pentamidine Pentamidine Suramin Suramin

Clinical trials - DB 289 (Phase III)Pre-clinical stage - -

Late-stage/CNS

First-line drugs Melarsoprol Melarsoprol Eflornithine

Clinical trials - Nifurtimox + Eflornithine

Pre-clinical stage - -

1985 2005

Chagas Acute

Nifurtimox60-90 daysMode of action (?) ROS - then DNA damage

Benznidazole30-120 daysMode of action - thought to inhibit nucleic acid

synthesis (ROS?)

ChronicVirtually untreatable - just treat symptoms

Treatment for kinetoplastid diseases

Treatments for Chagas

Acute StageFirst-line drugs Benznidazole Benznidazole

Nifurtimox NifurtimoxClinical trials Allopurinal

Indeterminate Stage

Clinical trials - Benznidazole

Chronic StageFirst-line drugs - -Clinical trials - -Pre-clinical stage - Antifungal triazoles

Cruzipain inhibitor

1985 2005

Leishmaniasis Pentavalent antimonial compounds (1947,1950)

10-30 day treatment

Pentamidine (for failed cases)(1940)

Amphotericine (1959)Drug interacts with plasma membrane ergosterol (also in fungi)Discriminates between ergosterol and cholesterolNew formulation w/liposomes readily taken up by macrophages!

Allopurinol (experimental in humans, used for dogs)

Inhibits hypoxanthine-guanine phosphoribosyltransferase(HGPRTase) - feedback inhibition of purine biosynthesis

Treatment for kinetoplastid diseases

Treatments for Leishmaniasis

New Drug Targets! Putative drug targets

kDNA replication, mitochondrial RNA editing RNA processing Fatty acid metabolism - not well studied Cell cycle and differentiation Membrane transport - unique transporters (purines!) Acidocalcisomes - Storage for Ca++, Mg++, polyphosphates

Plant-like vacuolar H+ pyrophosphatase Carbohydrate metabolism - glycosomes, alternative oxidase

Drug target validation Is the gene essential for parasite survival? Redundancy Classical gene knockout - diploid organisms Now, RNA interference!

Gene Expressionhttp://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowTOC&rid=mboc4.TOC&depth=2

Prokaryotic Translation is concurrent with

transcription No barrier restricts movement of

transcript to translation apparatus Single RNA polymerase

synthesizes all RNA species

Eukaryotic Transcript must be processed

Capping, splicing, polyA addition mRNA is sequestered as RNP in

the nucleus, must be transported tocytoplasm

Genes are often split - codingsequence is not contiguous

3 different RNA polymerasesrequired to synthesize RNA classes

Polycistronic Transcripts

DNA

mRNA Polycistronic transcriptmultiple genes

Operon - gene cluster

Proteins perform a coordinated function

Examples: Carbohydrate degradationAmino acid biosynthesis

Eukaryotic Transcripts

5’ 7-methylgaunosine cap structure Post-transcriptional modification - after ~ 25 nucleotides Prevents degradation by 5’ exonucleases Helps in the export from the nucleus

Poly-adenylated tail Post-transcriptional modification Helps in stability of the mRNA

Mature transcript

Kinetoplastid Transcription

Alternative Splicing Discovered by D. Baltimore - immunoglobin heavy chain Increases the diversity of protein repertoire Improper alternative splicing can lead to disease

Cis-Splicing Mechanism

•Several steps in the splicing reaction require ATP

Splicing is mediated by the Spliceosome

Splicesome mediated - simplified

Composed of snRNPs Small nuclear ribonucleoprotein

Small nuclear U-rich RNA (snRNA) Each complexed with ~ 7 proteins

1. U1 base-pairs with the 5’ splice-site2. U2 binds/pairs with the branch point; also pairs

with U6 in the assembled spliceosome3. U4 pairs with U6 in snRNPs, but releases during

spliceosome assembly4. U5 interacts with both exons (only 1-2 nt adjacent

to intron); helps bring exons together5. U6 displaces U1 at the 5’ splice-site (pairs with nt

in the intron); it also pairs with U2 in thecatalytic center of the spliceosome

Highly simplified version

Trans-splicing:1st discovered in trypanosomes

Gene A Gene B Gene C Gene D Gene E

DNA

Polycistronictranscript

AAAA

AAAA AAAA

AAAA

AAAA

SL RNA

No evidence ofoperons

Trans-splicing

Polyadenylation

Individual mRNAs each with a SL and poly A tail

To date: ALL coding sequences are trans-spliced!

Comparison of cis- and trans-splicing

Lariat intermediate

Y-branch intermediate

transesterification

transesterification

Intramolecular Intermolecular

Comparison of Spliceosomes

New Technology - SMaRT Defects in alternative splicing can lead to human disease Use of artificial trans-splicing to “repair” and give rise to a

functional mRNA

www.intronn.com

Correcting at the pre-mRNA level!

Spliceosome-mediated RNA Trans-splicing

Trypanosomatid MitochondrialRNA editing

Single mitochondrion Unique mitochondrial DNA

Catenated structure composedof mini- and maxicircles

Size of molecules varies withspecies (15-80 kb) (1 - 2.5 kb)

50 maxicircles/network 5000-10,000 minicircles/network Minicircles were initially thought

to be nonfunctional, just astructural component

Maxicircle20 kb

Minicircle1 kb

Maxicircle sequence Initial sequencing of the T. brucei maxicircles demonstrated that it

encoded apocytochrome b, subunits 1 and 2 of cytochrome coxidase (cox) and some unassigned reading frames (MURFs) (somelater turned out to be subunits of NADH dehydrogenase).

However some pseudogene features – e.g. cox2 had a –1 frameshiftand this was conserved between kinetoplastid species.

Sequence determination of cox2 cDNA in 1984 showed an insertionat the precise position of the frameshift converting GA to UUGUAU.

This wasn’t accepted at first – there were 50 maxicircles and maybeone had the difference or the gene was encoded in the nucleus.

Extensive analysis showed no conventional cox2 genes existed inthe nucleus or mitochondrion but a mechanism of adding in U’s wasway too outlandish to be accepted at that time.

Maxicircle Sequence

Sequencing of other mitochondrial cDNAs and their comparison tothe genomic sequence showed not only the addition of U’s but alsotheir deletion.

In 1986 the first CAUTIOUS paper on a “co- or post-transcriptionalnucleotide insertion process” was published (Benne et al.,1986 Cell46, 819-826 - 18 page paper).

Although the data showed deletion of one U, the authors didn’t dareto conclude that this form of editing could also occur.

Other groups of investigators found similar editing processes andthe number of edited trypanosomatid RNAs expanded.

The mystery of missing AUG translational start codons was solvedas these are provided by RNA editing by both addition and deletionof U’s

Mitochondrial RNA editing

*

**

** ** ****

***

***

****

***

**

*

*

*

** ** **

**

*** **

*** *

***

***

**

***** *

*** *

*** ********

******

**

*

**

*

Cell

Edited T. brucei ND7 mRNA

Cryptic mRNAs produced mRNA sequence DOES NOT exactly

correspond with genomic DNA sequence Requires insertion of uridine residues

(u) or deletion (*) to create afunctional ORF

Extreme example is ND7 >90% of mRNA is edited

Process is more active inprocyclic form parasites

Minicircles encode gRNAs (guideRNAs) that act as templates forinsertion and deletion (1991)

Process is essential (2001) Demonstrated by gene silencing in

bloodstream form parasites

Maxicircle Comparison Ribosomal RNA sequences ARE NOT edited

Insertional RNA editing

GCGGAGAAAAAAUGAAAUGUGUUGUCUUUUAAUG ::|:||||||||||||||:|||||||||||||3'-UUUUUUUUUUUUUACUUUAUACAACAGAAAAUUACppp5'

(A)n5'

Edited mRNAEditing

GCGGAGAAAAAAGAAAGGGUCUUUUAAUG ::|:|||| ||:||||||||3'-UUUUUUUUUU CAGAAAAUUACppp5'

(A)n5'

UUUACU U U A

UACA

A Guide RNA

AnchorPoly(U) tail

Primary transcript (Maxicircle encoded)

(Minicircle encoded)

Pan-editing of the L. tarentolae A6 mRNA

Precursor mRNA

Precursor mRNA

Precursor mRNA

Precursor mRNA

Edited mRNA

Edited mRNA

Edited mRNA

Edited mRNA

Mechanism of RNA EditingInsertion Deletion

RNA Editing Proteins

Mediated by Protein Complex