Transcript
Page 1: St. Cecilia Church...2020/11/15  · contact Presentation BVM or any Catholic parish that sells SCRIP. The tuition credits you add up can be given to St. Cecilia School to be distributed

33rd Sunday in Ordinary Time 15 November 2020

St. Cecilia Church Philadelphia ~ Pennsylvania

Page 2: St. Cecilia Church...2020/11/15  · contact Presentation BVM or any Catholic parish that sells SCRIP. The tuition credits you add up can be given to St. Cecilia School to be distributed

#179 2

OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Eileen Litka School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130

Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization

Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.

Saint Cecilia Church 535 Rhawn Street

Philadelphia, Pennsylvania 19111

PASTOR Reverend Charles E. Bonner

PASTOR EMERITUS Reverend Msgr. Francis X. Dreger

PAROCHIAL VICAR Reverend Robert Lucas

PERMANENT DEACON Deacon Patrick Diamond

PRINCIPAL Sister Catherine Irene Masino , IHM

VICE PRINCIPAL Sister Carolyn Elizabeth Braun, IHM

SACRAMENTS Baptism First three Sundays of the month at 12:15pm. Arrange-ments must be made at least two weeks prior to the Bap-tism. Attendance at a Pre-Jordan class is required for first time parents. Please register for class by contacting the Rectory at 215-725-1240.

Marriage Couples must contact a priest six months prior to the wed-ding.

Reconciliation Saturdays from 4:00 to 4:45pm

Homebound Visitation Please contact the Rectory.

Keep Holy the Lord’s Day All Catholics are encouraged to come to church for Mass, how-ever, if you are sick, you may follow the Mass through digital means. Our church livestreams Mass Sunday at 9:30am. Some additional viewing sites are listed below.

SUNDAY MASSES Cathedral Basilica of SS Peter & Paul 11:00am https://vimeo.com/event17522 TV—Channel 6 at 5:30am

www.stceciliafc.org/live-stream

Every Saturday ~ 4:00-4:45pm Wednesday, December 23

4:00-5:00pm & 6:00-7:00pm

Confessions have returned to the Confessional

Christmas Eve Masses Thursday ~ December 24

4:00pm & 7:00pm

Christmas Day Masses Friday ~ December 25

6:30, 8:00, 9:30, 11:00am & 12:30pm

No Confessions Christmas Eve

Page 3: St. Cecilia Church...2020/11/15  · contact Presentation BVM or any Catholic parish that sells SCRIP. The tuition credits you add up can be given to St. Cecilia School to be distributed

#179 3

ST. CECILIA CHURCH Sunday

Vigil 5:00pm (Saturday) 6:30am, 8:00am, 9:30am, 11:00am

Monday through Friday 6:30 and 8:30 am

Saturday 8:30 am

First Reading ~ Book of Proverbs 31:10-13, 19-20, 30-31

When one finds a worthy wife, her value is far beyond pearls. Her husband, entrusting his heart to her, has an unfailing prize. She brings him good, and not evil, all the days of her life. She obtains wool and flax and works with loving hands. She puts her hands to the distaff, and her fingers ply the spindle. She reaches out her hands to the poor, and extends her arms to the needy. Charm is deceptive and beauty fleeting; the woman who fears the LORD is to be praised. Give her a reward for her labors, and let her works praise her at the city gates.

The word of the Lord. Thanks be to God.

Responsorial Psalm Blessed are those who fear the Lord.

Holy Gospel ~ Matthew 25:14-15, 19-21

Jesus told his disciples this parable: "A man going on a journey called in his servants and entrusted his posses-sions to them. To one he gave five talents; to another, two; to a third, one--to each according to his abil-ity. Then he went away.

"After a long time the master of those servants came back and settled accounts with them. The one who had received five talents came forward bringing the addition-al five. He said, 'Master, you gave me five talents. See, I have made five more.' His master said to him, 'Well done, my good and faithful servant. Since you were faithful in small matters, I will give you great responsibili-ties. Come, share your master's joy.'"

The Gospel of the Lord. Praise to you, Lord Jesus Christ.

Second Reading First Letter of St. Paul to the Thessalonians 5:1-6

Concerning times and seasons, brothers and sis-ters, you have no need for anything to be written to you. For you yourselves know very well that the day of the Lord will come like a thief at night. When people are saying, "Peace and security," then sudden disaster comes upon them, like labor pains upon a pregnant woman, and they will not escape.

But you, brothers and sisters, are not in darkness, for that day to overtake you like a thief. For all of you are children of the light and children of the day. We are not of the night or of darkness. There-fore, let us not sleep as the rest do, but let us stay alert and sober.

The word of the Lord. Thanks be to God.

33rd Sunday in Ordinary Time November 15, 2020

FOCUS: God empowers us to participate in his work to bring about good in the world.

We are called to participate in God’s work to multi-ply goodness in our world, and God gives us all we need for this work. Especially in the Eucharist, we receive God’s grace and strength that we, too, may be faithful in small matters and great responsibilities. LITURGY OF THE WORD: The first reading from Proverbs declares a worthy wife as having value far beyond pearls. She is described as bringing goodness, being entrusted with her husband’s heart, hard-working, and in fear of the Lord. Paul tells the Thessalonians that they are children of the light and children of the day, and thus, disaster will not befall them when the day of the Lord comes. In the Gos-pel, Jesus tells a parable of the faithful servant who multiplies the talents given him by his master. REFLECTION: Discipleship isn’t a holding back for fear of making a mistake, or looking like a fool. Judging from today’s parable, it requires a spirit of risk and boldness, sometimes in big matters, but mostly in small daily occurrences. Whatever the “risky business” we use in our service of the Lord, we are encouraged in today’s parable by a Master who trusts his servants to “give it a try” – so that when he returns we will hear him call us “good and faithful servants.” So we ask ourselves:

Do I treat my faith as something fragile, keeping it close and protected as if it will break if brought out into the open?

In my daily life, how venturesome before others am I with my faith?

Page 4: St. Cecilia Church...2020/11/15  · contact Presentation BVM or any Catholic parish that sells SCRIP. The tuition credits you add up can be given to St. Cecilia School to be distributed

#179 4

We thank those who help sanitize the pews after each Mass. We are always looking for volunteers. If you could spare about 20 minutes after the daily Masses and after the Sat-urday and Sunday Masses, and including funer-als, please contact the rectory at 215-725-1240 or see the coordinator after Mass.

Mass Schedule for Weekend November 21-22 Saturday (Vigil) Celebrant: Fr. Lucas 5:00pm Lector: Ed Sharp

6:30am Celebrant: Fr. Bonner Lector: Celine Severino

8:00am Celebrant: Fr. Bonner Lector: Michelle Riccobono

9:30am Celebrant: Fr. Lucas Guitar Group Lector: Zach Demusz

11:00am Celebrant: Fr. Lucas Lector: Fran Diamond

Mass Book ~ 2021 This is a reminder that you may now pick up your announced Mass request sheets for 2021 from the rectory.

God bless our newly baptized

Thomas James DiMatteo

The Archdiocese of Philadelphia is grateful to partner with Revive Parishes, an organization that provides online ministry train-ing for parish leaders taught by the best and most experienced Cath-olic ministry practitioners in the country. To learn more and enroll visit https://reviveparishes.com/philadelphia/ . This is a FREE and interesting tool.

Manna Food Drive Thank you for bringing non-perishable food items to the vesti-bule of the church this weekend. May God bless you for helping others.

SCHOOL NEWS Now is the time to apply for scholarships for the 2021-2022 school year for Catholic grade schools.

CSFP—Children’s Scholarship Fund Philadelphia is accepting applications NOW. First deadline is Nov. 15, 2020 for the next school year. Visit CSFPhiladelphia.org to apply and more infor-mation. This is a lottery based scholarship for 4 years for stu-dents in K-8th grade. BLOCS is also now accepting applications for 2021-2022. For info on how to apply, email [email protected].

Another way to offset your tuition cost is to purchase SCRIP. Presentation BVM church sells SCRIP and you can contact them at 215-939-3900 or email [email protected]. EVERYONE CAN PURCHASE SCRIP ~ You do not need to have children in school to purchase SCRIP. You, as a parishioner can help our students by buying these gift cards and using them whenev-er and wherever you shop. There are hundreds of places you can use them such as grocery stores, clothing stores, sporting goods stores, bookstores, restaurants, anywhere you can think. You can contact Presentation BVM or any Catholic parish that sells SCRIP. The tuition credits you add up can be given to St. Cecilia School to be distributed to families with their tuition.

Iron Hill Brewery & Restaurant On Tuesday ~ December 8

Give yourself a break and dine at the restaurant or take out.

They will donate 20% of the food bill back to St. Cecilia School.

Print your coupon at https://www.ironhillbrewery.com/give20/pdfs/12-8-20-

GIVE20_HV.pdf Coupon may be redeemed only at the

Huntingdon Valley restaurant on December 8, 2020.

Page 5: St. Cecilia Church...2020/11/15  · contact Presentation BVM or any Catholic parish that sells SCRIP. The tuition credits you add up can be given to St. Cecilia School to be distributed

#179 5

The Giving Tree will be in the front of church by Thanksgiving Day. Every year we provide gifts of love that respond to the practical needs of those less fortunate through-out the City of Philadelphia. We encourage you to choose a tag from the tree and purchase the item listed. We will collect the gifts the weekend of December 12-13. Due to COVID-19 precautions, we are doing things a little different this year. Riley and Sons Moving has generously donated a truck to collect and sort the gifts. The truck will be in the church parking lot the weekend of December 12-13. We are asking that you bring the gifts to the truck and NOT place them under the tree. Items should be UNWRAPPED AND UNBAGGED with only the tag attached to each item (no shopping bags, no gift bags or envelopes). And, we ask that you please do not bring gifts any other weekend or day. Gifts will be delivered to - - - -

Our Brother’s Place provides emergency shelter for 149 men and supportive services for an additional 50 men daily. Birthright is an outreach center for women during crisis pregnancies and the critical months after the birth of their babies. Guiding Star Ministries is a home for single pregnant women and their children. Mercy Hospice is a community grounded in faith and service where single women and mothers with children experiencing homelessness and in recovery can find opportunities for new beginnings. St. Francis Inn meets the immediate daily needs of men and women with food, clothing and hospitality. St. John’s Hospice provides a residential facility for men seeking to transition from homelessness to independence, as well as day and overnight emergency services. Catholic Social Services/Women of Hope is a shelter for women with mental illness.

Page 6: St. Cecilia Church...2020/11/15  · contact Presentation BVM or any Catholic parish that sells SCRIP. The tuition credits you add up can be given to St. Cecilia School to be distributed

179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING

Masonry ContractorsSince 1922

215.533.1934215.533.1934

20% Discounton Labor for all Mechanical Work

15% Cash Paidfor Accident Referrals

$39.00+tax

Inspection & Emissions

$19.95Oil Change

(Most Cars)

Auto Body & Repair Shop

612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com

Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed

In Our 4th Decade of Quality Service

French Drains • Foundation Repair • Mold Remediation

215-639-8500www.morganbasementwaterproofing.com

All Work Guaranteed

• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care

ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE

10400 Roosevelt Blvd.Philadelphia, PA

215-698-5600www.stnrehab.org

BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -

P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !

Rafferty Roofi ng215-281-0771

PA062531

For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured

20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

rivate & Public Healthcare - La- - - -- -- - - - nforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficeccecececececececececececece

ponders - Fooooooooooood &d & d &d & d & d & d & d &d & d &d &d &d & d & d & AAAAAAgrAAAAAAAAlture - Energy Sector rrrrrrrr rrrrr - Wa- Wa- Wa- WWW- Wa- Wa- Wa- WaWa- Wa- Wa- WWaste

Waterwaste - Transportattattattattattattatattatattattattattta ion ion ion ononononon on on onon on on on & Lo&&&&&&&& gics - Public Woooooooorks r & - & Infrfffffffffffff astastrastrtstttstaststtsttstst uctur

Communicatatatttttttatattatttioionononsionsionionionionsionionsiooniono & I&&&&&&&&& nforf matioy Workeorkekkekekekekekekekekekkekers -rs -rs -rs -rs -rs -rs -rs rs -rs -rs -rs -rs -s -s - Community

overnment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkorkorkeorkeorkeorkeorkeorkorkorkeorkerrs - Critical Maacturing -g ---g --g -g ---g --g --- CheCheCheCheCheCheCheCheCheCheCheCheCheCheChemical & Hazardouateteeeeeeeeeeeeeerialrrrrrrrrrrrrrr s FiFiFiFiFiFiFiFiFiFiFiFiFiFiFinancnancnannannananaannanannancnancnancan ial Services - Defensdustristristristristristrstrtristristristritristritritrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Baasasasasasasase - Commercial Faciesssssessessssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkkkkkkekekekerskekekkkk - Resid ti l & Sh ltervicesicesicesicescescecescesicesicesicescescescesces & Facilities - Hygiene Prod

To all thoserivate & Publicrivate & nforcement Pubnforcement Pub

ssentialFirst RespFirst Resp

workersWaterwaste Waterwaste

keepingcs - PublicuCommunCommun

s safe,chnologychnology

yzardouzardouD fD

service isvices DefensDefenmercial Facimercial Faci

invaluable &idential & Shelteidential & ShelteH i P dH i Ptha

nk yo

u

afeeeefeeeeeeeefefefefetyty --ttty --ttttty t -tt -- OffiOOOOOOOOOOOOO cers & First RespondeFFFoFFFFFF od &d &d &d &&&d &&d &&od d &&d &d &d &d &d &d &d &d &d AgrAAgrAAAAAgrAAAAAgrgrrgrrAggrrrAgrA rrgAAA rAAAgrAAgg iculicucuiculuiculiculiculcuiculiiicuicultureturetureurertureurturertureurrrurerrrurrtur - E- E- EE- E- E- E-- EEE- EEEnergy Se

ooroorror rrr - WaWa- WaWa- Wa- WW- WaWWWWWW- W- WWaa- WWaWaWaaWaasteststtstee stesssteetsteetts ess ees e & Wa& Wa& W& Wa& WaWaWW& Wa& Wa& WaW& Wa& Wa& WaWWWaa&& W& WaWa& Waterwterwterwterwteterwterwterwterwerwtterwe wteteerwerwerwrwwterwtterwwwasteastasteaasteasteaastesteteasteaassteasteaststststeeeeeee - TTT- T- TT- TT- T--- T- TT- T-- ranrarrarararrararraararaaaraarortrtrtrtrtrrrttttttatioatitiatiotitatiattiiatataatatataaaa n &&n & n &&n &nn Logistics - Public Wor

After

Now Hiring friends and family caregivers.www.Bayada.com/careathome

Quality Senior Home Care Services since 1975.

Call today to learn more!(215) 419-7868

MONDAY, November 16 6:30am – Living & Dec’d members of Ferguson Family 8:30am – Honora Cardelli

TUESDAY, November 17 6:30am – James Callahan 8:30am – Dec’d members of Adam & Kolling Families

WEDNESDAY, November 18 6:30am – Living & Dec’d members of Cunningham Family 8:30am – John & Eleanor Winterberger

THURSDAY, November 19 6:30am – Thomas Wagner 8:30am – Joseph A. Berg

FRIDAY, November 20 6:30am – Harry C. Cunningham 8:30am – Dec’d members of Hughes Family

SATURDAY, November 21 8:30am – Plewes Family 5:00pm – Ed & Joan MacNew

Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Meghan Kovacs Joan Marie Reiley John Lawrysk Maki Turner Stephanie Morgan Kirsten Hosack-Edling James Potts Mary Benson Mary Jane Brough Esther Sharp Leo Wuestkamp Stephen Ruczynski Helen Tobin Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Daniel Mitchell Lisa Kovacs-Breuer Gregory Farrell Ed MacNew Timothy Martin John Smykal Julia McCauley Alice Davis Josephine O’Donnell Mary Matthews Marguerite Zeltman Alice Zmijewski Jack Vogler Eileen Gaynor Alberta DeMasi Marian Diel Eleanor DeNoble Eugenia DiSilva Kathi Silcox Catherine Needham Connie Merkel Ellen Jones Alonso Castillo Theresa Halbherr Catherine Davis Betty Harding Bill Scott Isabel Schmidt Mary Mikus Robert McGrody Vincent Florian Fran McManus Helen Flood

Always in our prayers Ellen Jones

Page 7: St. Cecilia Church...2020/11/15  · contact Presentation BVM or any Catholic parish that sells SCRIP. The tuition credits you add up can be given to St. Cecilia School to be distributed

179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

FOX CHASE WINDOWS & DOORSSALES - INSTALLATION

Please Call ... 215-725-4211

FREE ESTIMATES

Parish Member

ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member

G.J. ROSSI & SONELECTRICIANS

Now In Our 3rd Generation

PATRICK J. FOY(215) 281-9656

Interior & Exterior PaintingWallpapering & Scraping

FREE Estimates • Reliable • Honest

309 Central Ave., Cheltenham379-0881

JOSEPH P. FARLEYPLUMBING & HEATING

Alterations-Jobbing

Reg. No. 3121P.A. 043294

Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242

*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )

Sweeney’sVerree Tavern

KITCHEN OPEN FROM 11 AM TO MIDNIGHT

The all new Kim’s Crab CakesPhilly’s Largest Wings

All Soups & Chili HomemadeTAKE OUT AVAILABLE

All Major Sporting Events With 6 Colored TV’s

Finest Tavern Food Now Available in our

New Private Dining Room

7968 VERREE RD.215–725-3366

Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated

2000

SENIOR CITIZEN DISCOUNTS

ReliableFull Service Plumber

PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE

INSURED • FREE ESTIMATES215-722-6783215-379-8300

SERVING ENTIRE CITY & SUBURBSCITY VIOLATIONS CORRECTED

SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED

DIGGING & EXCAVATION SPECIALISTS

Reg. Master Plumber #4287Michael Zalewski

Experience Peace of Mind:Pre-Arrange Your Burial at an

Archdiocese of Philadelphia Cemetery.

• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries

CALL 215-352-4001 TODAY

Leslie AitaVocalist

[email protected]

Parishioner

Visit Us At Our New Location

Rockledge Plaza Huntingdon Pike

408 Huntingdon PikeRockledge, PA 19046215-379-2100

Family Ownedand Operated

Since 1948

$350Off Any New Stairlift With This Ad

• FREE in home evaluations• Family owned & operated for more than 20 years

1.888.900.8883

www.Tri-StateStairlifts.com

Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”

7450 Oxford Ave Phila, PA 19111 215-728-1050

David G RichardsonSupervisor/Owner

Cher l A Webb-RichardsonManager & LCBA Insurance Rep

Parishioner

richardsonsfuneralhome.com Councilman Brian O’Neill

Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438

[email protected]

FreeNotaryPublic

Free copies

& Faxes

Karon MassadoReal Estate Salesperson

o 267.435.8015 m [email protected]

1601 Market St.- Fl. 19, Phila, PA

Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111

www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director

Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900

www.BirthRight.org

“It is the right of every pregnant woman to give birth, and the right of every child to be born.”

~Birthright Charter7986 Oxford Avenue

Philadelphia, PA 19111215-728-0385

A Blessing from God

John DeCristofaroROOFING

Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts

215-379-2953 Member of St. Cecilia

A Tompkins Community BankFormerly Madison Bank

8000 Verree Rd., Philadelphia(215) 722-4566

www.risingsunhomecare.org

Providing The Highest Quality Care

Parishioner of St. Cecilia

215-605-9555

catering For your next event, call ahead to order

- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1

Eric McHughParishioner

CYO Volunteer OFFERING AUTO, HOME, LIFE,

& BUSINESS INSURANCE Call for a quote

215-328-9990 x7001 or email [email protected]

210 Huntingdon Pike, Rockledge

Patronize the Adve isers who make this bulletin possible!

BUILD YOUR COMMUNITY!

Patt o i e the A

SHOP LOCAL

Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.

This describes the power of...

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!

Call 1.800.333.3166 TODAY!

Pranic Healing infl uences your natural life force to bring about a

healthier body.

Dan McMeans Pranic Healer

215 962 [email protected]

https://danmcmeans.wixsite.com/advancehealing

Page 8: St. Cecilia Church...2020/11/15  · contact Presentation BVM or any Catholic parish that sells SCRIP. The tuition credits you add up can be given to St. Cecilia School to be distributed

IT'S TAX TIME!Be Confi dent In Your Accountant

For pricing & appointments at your home or my offi ce call:

215-603-4535 or 215-572-0529

179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Schmidt’s Florist 700 Solly Ave., Phila., PA 19111

www.schmidtsfl orist.com 215-745-6234

LAW OFFICES

PAUL A. COGHLAN437 RHAWN STREET

PHILADELPHIA, PA 19111(215) 725-5998

FAX (215) 725-3904

Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge

Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.

Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com

Stewart and McGowanATTORNEYS-AT-LAW

6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800

S W D ’ E

WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies

The Original

Pizza6500 Rising Sun Ave. • 215-745-9992

Nora McCloskeyParishioner

Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103

www.bloomingartiststudio.comwww.bloomingartiststudio.com

PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING

SENIOR CITIZEN DISCOUNTFREE ESTIMATES

Ph: (215) 728-1482Fax: (215) 742-7098

8675 Torresdale Ave.Philadelphia, PA 19136

WWW.BILLFRUSCO.COM

O’Donnell PaintingInterior and Exterior

House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854

JOHN F. GIVNISH(3rd Generation)

JOHN F.X. GIVNISH, III(4th Generation)

Serving the Archdioceseof Philadelphia with

grace and dignity since 1928

1-800-GIVNISH

Each Offi ce Independently Owned and Operated

Larry AitaREALTOR®

Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.

Regency Realty

Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!

2018 Outstanding

Agentof the Year

s.

Parishioner

Serving Families Since 1900

Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013

Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.

215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:

Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle

to make sure it is the car they are supposed to enter.

In Remembrance of Samantha Josephson

#WHATSMYNAME

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly

payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four

season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103

JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish

Professionals Serving Professionals

Jay B. ComlyBuilding & Offi ce Maintenance

[email protected]

w/an A+ Rating

Commercial • AutomotiveResidential • Safes

Fully Equipped RadioDispatched Mobile Trucks

7936 Oxford Ave. 215-745-5007

Full Service Locksmith Since 1978Member of Parish

VERREEPHARMACY

7960 VERREE RD.(AT RHAWN)Free Delivery

M-F 9AM - 8PMSat. 9AM - 6PM

Sun. 9AM - 1 PM215-342-0100

Mitchell Spivack, R. PH.

HandymanElectric, PlumbingOdd jobs... Just Ask!

From McCloy’s TV 267-231-8785

Tax & AccountingFrancis J. McConnell CPA

Tax Preparation • Individual & Business(Across from St. Williams)

Call (215) 742-3428 for Appointments

Charles P. Elliott, PC 110 Central Ave

Cheltenham, PA 19012

215-663-2500We Make House Calls

Complimentary InitialConsultation

We are here for all your tax, IRS, fraud investigations,

& inheritance tax.

RENEE ROACHEREALTOR ~ PARISHIONER

FOX CHASE SPECIALISTBuying or Selling a Home?

Call Today!

Office 215-961-6000 Cell [email protected]

EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE

A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children

7950 Bustleton Ave., Philadelphia, PA215-821-3522

Cochrane Construction LLC

ROOFINGSIDING * GUTTERS

Chimney Restorations & RepairsLicensed & Insured PA # 154589

Senior Citizen Discounts • Free Est.215-839-4317

www.cochraneconstruction.org

Friends, Family, Neighbors!

1-844-640-4200 PaulsRun.org/Living

Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted

FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!

WE CARE AND IT SHOWS

Beautiful On-Site Chapel with Daily Mass - Respite Stay Available

We Acknowledge We Appreciate

2990 Holme Ave., Phila.215-335-2100

www.imrehab.org

IMMACULATE MARYCENTER

Rehabilitation & Healthcare

Advertise Your Business Here

800-333-3166 ext. 161www.jppc.net


Recommended