Role of FGF receptors in rescue of ∆F508-CFTR
By
Kar Ki Anthony Chen
A thesis submitted in conformity with the requirements for the degree of Master of Science
Graduate Department of Biochemistry University of Toronto
© Copyright by Kar Ki Anthony Chen (2015)
ii
Role of FGF receptors in rescue of ∆F508-CFTR
Kar Ki Anthony Chen
Master of Science
Department of Biochemistry
University of Toronto
2015
Abstract
∆F508-CFTR is the most common mutation causing cystic fibrosis (CF), where it
exhibits folding defects and is unable to reach the plasma membrane. To identify signaling
pathways involved in ∆F508-CFTR rescue, we screened a library of esiRNAs that target over
750 different kinases and associated signaling proteins. We identified 20 novel suppressors of
∆F508-CFTR rescue including FGFR1. The top hits of the screen were validated by various
methods: halide exchange assay, immunoblotting and ELISA following shRNA-mediated
knockdown. Inhibition of FGFR1 with SU5402 leads to ∆F508-CFTR rescue in CF patient cells
and in intestinal organoids from ∆F508/∆F508 mice. Chaperone array analysis on Human
Bronchial Epithelial cells identified altered expression of several chaperones and their effects on
∆F508-CFTR maturation were validated by ELISA. We propose that FGFR signaling regulates
specific chaperones that control ΔF508-CFTR maturation, and suggest that FGFRs may serve as
important targets for therapeutic intervention for the treatment of CF.
iii
Acknowledgments
I would like to thank my supervisor, Dr. Daniela Rotin for providing me guidance and
encouragement throughout the Master‟s program. These experiences will definitely aid in my
future endeavors. I would also like to thank my committee members, Dr. Neil Sweezey and Dr.
Walid Houry, for their support and suggestions during the committee meetings.
I want to thank Dr. Agata Trzcinska-Daneluti, who is a mentor, a colleague, and a friend.
She not only performed the Cellomics studies, but also provided me with helpful suggestions
throughout the project. I want to thank Dr. Chong Jiang for teaching me lab techniques as well as
ordering regents since I started in the lab and I want to thank Leo Nguyen for teaching me lab
techniques especially the Ussing chamber analysis. I also want to thank all of the lab members,
Avi, Chen, Ruth and Frozan who made my journey fulfilling and exciting. Finally, I want to
thank my friends and my family for supporting me throughout this time.
iv
I performed the majority of the work presented in this thesis. However, the kinome
esiRNA screen as well as its validation with the Cellomics assay was performed by Dr. Agata
Trzcinska-Daneluti (Figure 3.1,3.2). Knockdown efficiency of the shRNA constructs was
determined by Leo Nguyen (Table A1). The saliva secretion assay was performed by Dr. Chong
Jiang and the intestinal organoids experiments were performed by Ryan Murchie (Figure 3.8).
Most of the work in this thesis was published in the journal Molecular Cell Proteomics under the
title „RNA interference screen to identify kinases that suppress rescue of deltaF508-CFTR.”
where I am sharing a co-first authorship with Dr. Agata Trzcinska-Daneluti.
v
Table of Contents
Abstract ........................................................................................................................................... ii
Acknowledgments .......................................................................................................................... iii
List of Tables ............................................................................................................................... viii
List of Figures ................................................................................................................................ ix
Abbreviations ................................................................................................................................. xi
Chapter 1 : INTRODUCTION .................................................................................................... 1
1. Introduction ................................................................................................................................ 1
1.1 Cystic Fibrosis .................................................................................................................... 1
1.2 CFTR and CF causing mutations ........................................................................................ 5
1.2.1 CFTR structure ........................................................................................................ 5
1.2.2 Channel gating of CFTR by ATP hydrolysis .......................................................... 8
1.2.3 CFTR regulation by phosphorylation ................................................................... 10
1.2.4 CF causing mutations ............................................................................................ 11
1.2.5 ∆F508-CFTR ......................................................................................................... 13
1.3 Chaperone systems involved in the processing of CFTR ................................................. 16
1.3.1 ER-associated and cytosolic chaperone systems .................................................. 16
1.3.2 Peripheral chaperone systems ............................................................................... 18
1.4 Screens to identify correctors of ∆F508 CFTR ................................................................. 20
1.4.1 High-throughput screens for correctors of ΔF508-CFTR ..................................... 20
1.4.2 Discovery of VX-809 and VX-770 and their clinical trials .................................. 21
1.4.3 Our screens using high-content halide exchange (Cellomics) assays ................... 21
1.5 Kinases and FGFR signaling ............................................................................................ 25
1.5.1 Kinases .................................................................................................................. 25
1.5.2 FGFR signaling ..................................................................................................... 25
1.5.3 MAP Kinase Pathway and chaperones ................................................................. 27
vi
1.6 Project Rationale and goals ............................................................................................... 29
Chapter 2 : MATERIALS AND METHODS ........................................................................... 30
2. Methodology ............................................................................................................................ 30
2.1 Media and Reagents .......................................................................................................... 30
2.2 Cells .................................................................................................................................. 30
2.3 Cellomics YFP Halide Exchange Screen .......................................................................... 31
2.3.1 shRNA Knockdown and qPCR quantification of knockdown ............................. 32
2.3.2 Cellomics shRNA analysis ................................................................................... 32
2.3.3 Combination drug treatment ................................................................................. 33
2.4 Immunoblotting ................................................................................................................. 33
2.5 ELISA assay ...................................................................................................................... 33
2.6 Short-circuit Current (Isc) Measurements in Ussing Chambers ....................................... 34
2.7 Salivary Secretion Assay (SSA) ....................................................................................... 34
2.8 Intestinal Organoids Experiments ..................................................................................... 35
2.9 Chaperone array ................................................................................................................ 35
2.10 Validation of Chaperone Array Hits ................................................................................. 35
2.11 HSF1 experiments ............................................................................................................. 36
Chapter 3 : RESULTS ................................................................................................................ 37
3. Results ...................................................................................................................................... 37
3.1 Kinome esiRNA screen for identifying suppressors of rescue of ∆F508-CFTR .............. 37
3.2 Validation of top hits of esiRNA screen with shRNA ...................................................... 42
3.2.1 Immunoblotting for the mature (band C) ∆F508-CFTR ....................................... 47
3.2.2 Cell surface appearance of ∆F508 analyzed by ELISA ........................................ 50
3.2.3 Ussing chamber analysis to measure function of rescued ∆F508-CFTR ............. 52
3.3 FGFR mediated inhibition of rescue of ∆F508-CFTR ..................................................... 55
3.3.1 shRNA knockdown of FGFRs and selected downstream effectors. ..................... 55
vii
3.3.2 SU5402 partially rescues ∆F508-CFTR in mice .................................................. 59
3.3.3 SU5402 mediated rescue of ∆F508-CFTR in nasal cells from CF patients ......... 62
3.4 Identifying the chaperones involved in rescue of ∆F508-CFTR downstream of FGFR inhibitor ............................................................................................................................. 65
3.4.1 Change in chaperone expression level upon SU5402 treatment ........................... 65
3.4.2 Validation of the top hits from the chaperone array ............................................. 69
3.5 Combination drug treatment ............................................................................................. 73
Chapter 4: DISCUSSION ........................................................................................................... 78
4. Discussion ................................................................................................................................ 78
4.1 Identification of Kinases and Associated Signaling Proteins that Suppress Rescue of
∆F508-CFTR ..................................................................................................................... 78
4.2 FGFR signaling plays an important role in the maturation of ∆F508-CFTR ................... 80
5. FUTURE DIRECTIONS ....................................................................................................... 85
5.1 Investigate the role of specific chaperones/chaperonins in rescue of ∆F508-CFTR ........ 85
5.2 Investigate the role of specific kinases in rescue of ∆F508-CFTR ................................... 85
5.3 Test the effect of FGFR (and other kinase inhibitors) on rescue of ΔF508 in samples
from ∆F508/∆F508 patients. ............................................................................................. 86
6. SUMMARY ............................................................................................................................ 87
7. CONCLUSION ....................................................................................................................... 88
REFERENCES ............................................................................................................................ 89
Appendix ..................................................................................................................................... 101
viii
List of Tables
Table 1: Results of the esiRNA screen 40
Table 2. Validation of the hits by the halide-exchange assay 45
Table 3: Top Up- or Down -regulated chaperones following SU5402 treatment of
F508/F508-CFTR HBE cells 68
Table 4: Rescue of ∆F508-CFTR in cells treated with VX-809 and FGFR inhibitors analyzed
with the Cellomics assay 76
Table 5. Cellomics data for ∆F508-CFTR cells treated with VX-770 and SU5402 77
Table A1. Knockdown efficiency of shRNA clones that were used to validate the esiRNA
kinome screen. 100
Table A2: Extent of knockdown of shRNA clones for the down-regulated chaperones used in the
ELISA assay 106
ix
List of Figures
Figure 1.1: Pulmonary pathogenesis in cystic fibrosis 4
Figure 1.2: CFTR schematic diagram and homology model. 7
Figure 1.3: Schematic diagram of the opening and closing of CFTR by ATP 9
Figure 1.4: Overview of CFTR mutations 12
Figure 1.5: ΔF508-CFTR trafficking and folding defects 15
Figure 1.6: Overview of the chaperone system that is involved in the trafficking of CFTR 19
Figure 1.7: Overview of the Cellomics assay 24
Figure 1.8: Overview of FGFR1 signaling 26
Figure 1.9: Activation of HSF1 28
Figure 3.1: Representative hits of the kinome esiRNA screen 39
Figure 3.2: Effect of shRNA-mediated knockdown of the suppressor genes on ∆F508-CFTR
channel activity 44
Figure 3.3: Effect of shRNA-mediated knockdown of the hit genes on maturation of ∆F508-
CFTR 49
Figure 3.4: Effect of shRNA-mediated knockdown of the hit genes on surface expression of
∆F508-CFTR 51
Figure 3.5: Effect of kinase knockdown on ΔF508-CFTR channel activity in polarized MDCK
cells stably expressing ΔF508-CFTR 54
Figure 3.6: Correction of the ∆F508-CFTR defect following knockdown of FGF receptors and
downstream signaling proteins 57
x
Figure 3.7: Effect of shRNA-mediated knockdown of FGFRs and selected downstream effectors
on surface expression of ∆F508-CFTR. 58
Figure 3.8: Rescue of ΔF508-CFTR in ΔF508/ΔF508 CF mice or intestinal organoids from these
mice. 61
Figure 3.9: Rescue of ΔF508-CFTR in CF patient nasal cells 64
Figure 3.10: Chaperone expression analysis following FGFR inhibition by SU5402 67
Figure 3.11: Validation of chaperone hits 71
Figure 3.12: Effect of mutant HSF1 on cell surface expression of ∆F508-CFTR in HEK293-GT
cells stably expressing ∆F508-CFTR-3HA 72
Figure 3.13: Rescue of ∆F508-CFTR in cells treated with VX-809 and FGFR inhibitors 74
Figure 3.14: Cellomics data for ∆F508-CFTR cells treated with VX-770 and SU5402 75
Figure 4.1: Current model explaining how inhibition of FGFR via SU5402 leads to rescue of
∆F508-CFTR 84
xi
Abbreviations
ΔF508-CFTR deletion of phenylalanine at position 508 in CFTR
ΔIsc difference in maximal stimulated current
HEK293-GT genetically engineered HEK 293 cell line expressing the human macrophage
scavenger receptor
5% Blotto 5% dry milk made with PBST
ABC adenine nucleotide-binding cassette
ASL airway surface liquid
ATP adenosine triphosphate
BHK baby hamster kidney cell
CAMK2B calcium/calmodulin-dependent protein kinase II beta
cAMP cyclic adenosine monophosphate
CF cystic fibrosis
CFTR cystic fibrosis transmembrane conductance regulator
CHIP carboxyl terminus of Hsc70 interacting protein
CK2 casein kinase 2
CL4 cytoplasmic loop 4
Corr-4a corrector 4a
DMEM Dulbecco‟s Modified Eagle‟s Medium
DMSO dimethyl sulfoxide
xii
DNA deoxyribonucleic acid
DNDS 4,4-dinitrostilbene-2,2- disulfonic acid
ECL enhanced chemiluminescence
ENaC epithelial sodium channel
ER endoplasmic reticulum
ERAD ER-associated degradation
ERK extracellular signal-regulated kinase
esiRNA endonuclease-prepared siRNA
FBS fetal bovine serum
FGFR fibroblast growth factor receptor
FIG mixture of forskolin, IBMX, Genistein
FRS2α fibroblast growth factor receptor substrate 2
G551D-CFTR glycine to aspartic acid substitution mutation at position 551 in CFTR
GFP green fluorescent protein
Gly GlyH-101
Gsk3β glycogen synthase kinase 3 beta
HA hemagglutinin
HBE human bronchial epithelial
HBSS Hank‟s balanced salt solution
Hdj human DnaJ homologue
xiii
HEK human embryonic kidney cell
HRP horseradish peroxidase
Hsc heat shock cognate protein
HSF1 heat shock factor 1
Hsp heat shock protein
HTS high-throughput screen
IBMX 3-isobutyl-1-methylxanthine
ICD intracellular domain
ICL intracellular coupling loop
IPMK inositol polyphosphate multikinase
Isc short-circuit current
JNK c-Jun N-terminal kinase
LPS lipopolysaccharide
MAP3K mitogen-activated protein kinase kinase kinase
MDCK Madin-Darby canine kidney epithelial cell
MEK MAPK/ERK kinase
MSD membrane-spanning domain
mTOR mammalian target or rapamycine
NAS nonsense-associated alternative splicing
NBD nucleotide-binding domain
xiv
NFκB nuclear factor kappa-light-chain-enhancer of activated B cell
PAL mixture of pepstatin, aprotinin, and leucine
PBS phosphate buffered saline
PBST phosphate buffered saline with Tween 20
PI3K phosphoinositide 3 kinase
PKA protein kinase A
PKC protein kinase C
PLCγ Phospholipase C-gamma
PMSF phenylmethylsulfonyl fluoride
PRKAR2B cAMP-dependent protein kinase type II-beta regulatory subunit
R region regulatory region
RNA ribonucleic acid
RNAi RNA interference
RPS6KC1 ribosomal protein S6 kinase delta-1
RTK receptor tyrosine kinase
RT-qPCR quantitative real time polymerase chain reaction
SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis
shRNA small/short hairpin RNA
siRNA small-interfering RNA xvii
STAT1 signal transducer and activator of transcription 1
xv
SUMO small ubiquitin-like modifier
TAK TGF-beta activated kinase
TMB 3,3',5,5'-Tetramethylbenzidine
WT-CFTR wild-type CFTR
YFP yellow fluorescent protein
1
Chapter 1 : INTRODUCTION
1. Introduction
1.1 Cystic Fibrosis
Cystic Fibrosis (CF) is an autosomal recessive disorder that is caused by lack of
functional cystic fibrosis transmembrane conductance regulator (CFTR) proteins at the apical
surface of secretory epithelia (Ratjen and Döring 2003). As the only known ABC transporter-
class ion channel, CFTR not only functions as an anion channel, it also regulates other channels
such as the Epithelial Na+ Channel (ENaC) (Stutts et al. 1995), as well as bicarbonate transport
(Quinton 2010; Kim and Steward 2009). CF is associated with a wide range of defects in
secretory epithelia, and patients with CF exhibit abnormalities in the respiratory, gastrointestinal
and genitourinary system (Ratjen and Döring 2003). However, the most prominent changes are
observed in the airway, where reduction in chloride secretion coupled with increased sodium
absorption due to elevated activity of ENaC results in dehydration and thickening of airway
surface liquid (ASL) as seen in figure 1.1 (Boucher 2003). These changes impair the
mucociliary clearance of bacteria and lead to bacterial colonization and chronic infections of the
lung, which causes severe morbidity and ultimately death (Boucher 2003)
While several classes of mutation in CFTR have been identified to date, the most
common mutation among CF patients is the deletion of phenylalanine at position 508 (ΔF508) of
the CFTR protein (Kerem, et al. 1989). ΔF508-CFTR is a trafficking mutant that is prone to
aberrant folding where it is retained in the ER and unable to reach the plasma membrane (Cheng
et al. 1990). During biosynthesis, ΔF508-CFTR is recognized by the ER quality control system
(ERAD) and targeted for ubiquitin-dependent proteasomal degradation (Riordan 2008). Several
ER-associated chaperone complexes both in the cytoplasm and ER lumen are involved in the
folding or degradation of CFTR (Valentine et al. 2012). It has been shown that even when the
mutant protein is matured by low temperature rescue (27°C) and reaches the plasma membrane,
its cell surface stability is significantly reduced and it is sorted for lysosomal degradation
(Sharma et al. 2001). Studies have demonstrated that cell membrane chloride conductance can be
partially restored by maneuvers that correct or rescue ΔF508-CFTR biosynthetic processing,
2
thereby promoting its exit from the ER and targeting it to the cell surface (Wilke, et al. 2012;
Van Goor, et al. 2006). Interestingly, other studies have suggested that even partial correction as
low as 10-25% rescue of CFTR activity may be sufficient to at least partially restore airway
epithelial function (Zhang et al. 2009). However, to date, there are no effective correctors in the
clinic that can recue this trafficking defect.
3
Figure 1.1: Pulmonary pathogenesis in cystic fibrosis. In normal airways, the balance between
sodium absorption is mediated by ENaC and anion secretion is mediated by apical CFTR as well
as other anion channels. The balance between sodium absorption and anion secretion determines
the volume of the airway surface liquid (ASL). This process maintains the viscosity of the ASL
where effective mucus clearance occurs. Normally CFTR downregulates ENaC activity.
However, this process is absent in cystic fibrosis due to lack of functional CFTR. Thus, in cystic
fibrosis, reduction in chloride secretion coupled with increased sodium absorption due to
elevated activity of ENaC results in dehydration and thickening of ASL. This impedes mucus
clearance, which promotes accumulation of airway secretory products such as growth factors,
glycosaminoglycans (GAGs) and chemokines that promote inflammation. (Modified from
Frizzell and Pilewski 2004)
4
5
1.2 CFTR and CF causing mutations
1.2.1 CFTR structure
CFTR is a member of the adenine nucleotide-binding cassette (ABC) family of
transporters (Gadsby et al. 2006). ABC transporters utilize the energy of ATP binding and
hydrolysis to transport various substrates across cellular membranes (Jones and George 2004).
Although CFTR retains the core structure of other ABC transporter, it is the only known ABC
transporter that functions as a chloride channel (Kartner et al. 1991). CFTR is a glycoprotein
composed of 1480 amino acids. The protein consists of five domains: 2 membrane spanning
domains (MSD1, MSD2) each composed of six transmembrane segments, 2 nucleotide binding
domains (NBD1, NBD2), which possess a binding site for ATP, and a unique regulatory (R)
region (Riordan 2008). The two MSD domains form the anion pore of the channel while the
NBD domains play a role in the activation and inactivation of CFTR (Riordan 2008).
Phosphorylation of the R region controls the activity of the CFTR channel. To date, there are no
high resolution structures of the full length CFTR protein. Information from high resolution
structure of CFTR will allow us to understand the drug binding mechanism of the protein which
aids in the development of novel drugs to treat CF patients. A homology model has been built for
the full length CFTR based on the structure of the bacterial ABC transporter Savv1866, as shown
in figure 1.2 (Mornon et al. 2008).
6
Figure 1.2: CFTR schematic diagram and homology model. Panel A shows the schematic
diagram of CFTR, which consists of 2 membrane spanning domains (MSD), 2 nucleotide
binding domains (NBD) and a unique regulatory region (R). Panel B shows the homology model
of CFTR based on the bacterial ABC transporter Savv1866. The intracellular coupling helix/loop
(ICL) of the MSDs (ICL1, ICL2 of MSD1 and ICL3, ICL4 of MSD2) provide the contacts with
NBDs to create the MSD/NBD interfaces (Modified from Lyczak et al. 2002 ; Mornon et al.
2008).
7
8
1.2.2 Channel gating of CFTR by ATP hydrolysis
Compared to other members of the ABC family, which use energy from ATP hydrolysis
for active transport, CFTR utilizes ATP to regulate the opening and closing of the channel.
Similar to other members of the ABC family, the hydrolysis rate of ATP is different between the
two NBD domains. The ATP in the binding site of NBD1 is very slowly hydrolyzed, while ATP
in the site of NBD2 readily undergoes hydrolysis (Aleksandrov et al. 2008). Opening of CFTR
requires cAMP/PKA-dependent phosphorylation of the R region followed by the binding of two
ATP molecules in NBD1 and NBD2 (Jih and Hwang 2012). When both ATP molecules are
bound to the NBDs, it induces dimerization of the NBDs in a head-to-tail fashion and leads to
opening of the channel (Jih and Hwang 2012). Channel closing is caused by ATP hydrolysis at
NBD2 and the subsequent release of ADP and Pi drives disassembly of the NBD dimer (Vergan
et al. 2005). The gating mechanism of CFTR by ATP is depicted in Figure 1.3.
9
Figure 1.3: Schematic diagram of the opening and closing of CFTR by ATP. ATP (yellow)
remains tightly bound to NBD1 (green). ATP binding to NBD2 (blue) is followed by a slow
channel opening step that proceeds through a transition state (square brackets) in which the
intramolecular NBD1–NBD2 tight heterodimer is formed but the transmembrane pore (grey
rectangles) has not yet opened. The open state becomes destabilized by hydrolysis of the ATP
bound at NBD2, which leads to disruption of the tight dimer interface where the channel closes.
(Modified from Gadsby et al. 2006)
10
1.2.3 CFTR regulation by phosphorylation
Unlike other ABC transporter proteins, CFTR possess a unique R region that harbors
multiple serine and threonine residues that can be phosphorylated by PKA (Seibert et al. 1999).
NMR studies have shown that the R region assumes a disordered structure where its
conformation as well as its interdomain interaction changes based on its phosphorylation state
(Baker et al. 2007). At its native state, the R region restrains channel activity and its inhibition is
released upon phosphorylation by PKA. Interestingly, partial deletion of the R region produces a
constitutively active channel (Ostedgaard et al. 2002). Moreover, channel opening of CFTR is
contingent upon PKA phosphorylation, whereby this phosphorylation increases channel activity
over 100-fold (Ostedgaard et al. 2001). Results from mutagenesis studies (Seibert et al. 1999), as
well as evidence of structural rearrangement of the R region upon phosphorylation (Dulhanty
and Riordan 1994) suggest that regulation of CFTR is dependent on the conformational change
of the R region. Even though the R region remains unstructured and disordered upon
phosphorylation, it has been shown to interact with other domains of CFTR. In particular, NMR
studies have shown that phosphorylation of the R region reduced interactions with NBD1, which
may play an important role in conferring the regulatory effect of the R domain on CFTR (Baker,
et al. 2007).
CFTR can also be phosphorylated by other kinases, most notably by PKC, to modulate its
activity. Phosphorylation by PKC is essential for acute activation of CFTR by PKA (Jia et al.
1997). However, the R region does not undergo conformational changes when phosphorylated by
PKC (Dulhanty and Riordan 1994). Although the exact mechanism of how PKC directly regulate
CFTR is unknown, it has been hypothesized that PKC phosphorylation facilitates subsequent
PKA phosphorylation by exposing sites that are otherwise inaccessible (Chang et al. 1993)
Aside from the phosphorylation of CFTR by PKA and PKC, phosphorylation by other
kinases has not been extensively studied. Studies by the Luz group have shown that Casein
kinase 2 (CK2), was able to regulate CFTR through direct phosphorylation, which affects both
channel conductance and trafficking of the protein to the plasma membrane (Luz et al. 2011).
Thus, the regulation of CFTR through phosphorylation has been shown to be a dynamic and
complex process. Future work is being done to elucidate the mechanism of how phosphorylation
11
affects CFTR activity and whether other kinases may play a role in regulating both channel
activity and trafficking of the protein.
1.2.4 CF causing mutations
To date, more than 2000 CFTR mutations have been identified
(www.genet.sickkids.on.ca/cftr). These mutations can be classified into six classes (De Boeck
2014). Class I mutations produce a stop codon leading to premature transcription termination
signals. These mutations result in truncated or no protein expression. Class II mutations are
usually missense mutations causing the protein to misfold, leading to premature degradation and
failure to reach the plasma membrane. The most common CF-causing mutation, ΔF508-CFTR, is
a class II mutation. Class III CFTR mutations fold properly and result in normal trafficking to the
cell surface; however, they suffer a defect in regulation, resulting in severely decreased channel
activity. An example for this class of mutation is the G551D substitution. This mutation is
located in the ATP binding site on NBD1 that results in defects in binding and hydrolysis of ATP
(Li et al. 1996). Class IV mutations result in reduced channel conductance due to lower chloride
permeability and opening probability. Class V mutations cause partly defective production or
processing of the protein, which results in a reduction in the number of functional channels.
Class VI mutations produce functional CFTR, but the protein is unstable at the cell surface and
undergoes rapid endocytosis and degradation (Figure 1.4) (De Boeck 2014).
http://www.genet.sickkids.on.ca/cftr
12
Figure 1.4: Overview of CFTR mutations. Class I, II, V and VI mutations reduce the quantity
of functional CFTR protein at the cell surface. Class III and IV mutations reduce the function of
CFTR at the cell surface. (Modified from De Boeck 2014)
13
1.2.5 ∆F508-CFTR
The most common mutation, identified in approximately 90% of CF patients, is the
deletion of phenylalanine at position 508 (∆F508) in NBD1 (Wang and Li 2014). ∆F508-CFTR
is primarily a class II mutation and is a folding-impaired mutant that is retained in the ER and is
defective in trafficking to the plasma membrane at 37º. Even when a very small amount of
∆F508-CFTR does reach the plasma membrane, it is unstable (Sharma, et al. 2001). The ∆F508
mutation lies in the interface between NBD1 and ICL4 of MSD2 (Mornon et al. 2008). This
mutation destabilizes the NBD1-MSD2 interface as well as the folding of NBD2 (Rabeh, et al.
2012; Du et al. 2005), which disrupts domain-domain interaction of CFTR that is essential for its
proper folding. As a result, the mutant is trapped in the endoplasmic reticulum (ER) and is
eventually targeted for degradation by the ERAD pathway and the proteasome (Riordan, 2008).
Recent studies suggest that fixing the ΔF508 defect requires correcting NBD1 stability and
NBD1:CL4 interactions (Rabeh et al. 2012).
The biosynthesis of CFTR starts at the ER where it is synthesized and acquires core
glycosylation. After exiting the ER, CFTR is processed in the Golgi apparatus where it acquires
complex glycosylation and is transported to the plasma membrane (Cheng, et al. 1990) (figure
1.5). Thus, when immunoblotting for CFTR, WT-CFTR appears as two bands, a prominent band C
around 180 kDa that represents the mature, fully glycosylated form of CFTR, and a minor band B
around 150 kDa that represents the core glycosylated, immature form. ΔF508-CFTR, which exhibits
impaired maturation, is observed mainly as band B. As a large transmembrane protein, WT-CFTR
exhibits inefficient folding and processing compared to other proteins, where up to 80% of the
WT-CFTR gets degraded in the ER (Lukacs et al.1994). This is, in part, due to slow domain
assembly of CFTR and fast degradation by ERAD (Lukacs and Verkman, 2012). In comparison,
99% of ΔF508-CFTR is degraded before some of it reaches the plasma membrane (Ward and
Kopito, 1994). As a result, little of ΔF508-CFTR reaches the plasma membrane. However,
ΔF508-CFTR can be rescued at low temperature and with chemical chaperones such as glycerol
(Denning, et al. 1992; Sato, et al. 1996). WT-CFTR has a half-life of about 16h on the plasma
membrane and is efficiently recycled back to the cell surface after internalization. On the other
hand, rescued ΔF508-CFTR is quickly removed from the plasma membrane with a half-life of
about 2h (Sharma et al. 2004; Swiatecka-Urban et al. 2005). Even when ΔF508-CFTR reaches
the plasma membrane, it only exhibits partial channel activity in response to PKA (Bear et al.,
14
1992). Thus, strategies to correct ∆F508-CFTR trafficking defects should not only aim at
promoting its trafficking to the plasma membrane, but also to improve its cell surface stability
and function. A possible strategy to correct the ∆F508-CFTR trafficking defect might be through
affecting the chaperones involved in the processing of CFTR. This strategy not only helps
∆F508-CFTR fold, but can also reduce its degradation.
15
Figure 1.5: ΔF508-CFTR trafficking and folding defects. ΔF508-CFTR belongs to class II
CF-causing mutations where the protein is misfolded, retained in the ER and acquires core
glycosylation. On the other hand, WT-CFTR can fold properly where it gets processed in the
Golgi apparatus and acquires complex glycosylation. WT-CFTR is then trafficked to the plasma
membrane as a functional chloride channel although its processing is also inefficient. (Modified
from Cravatt et al. 2007)
16
1.3 Chaperone systems involved in the processing of CFTR
In cells, degradation of misfolded protein is necessary to prevent the formation of large
aggregates, which are toxic to cells. However, when degradation occurs too rapidly, the protein
might not have sufficient time for proper folding. This is the case for CFTR, since
nonubiquinated CFTR intermediates do exist during its biosynthesis in the ER and requires time
for proper folding (Chanoux and Rubenstein 2012). In cells, CFTR biosynthesis is scrutinized at
multiple quality control checkpoints. This process is performed by complex systems of
chaperones such as the ER-associated chaperones as well as the peripheral quality control
systems at the plasma membrane (Lukacs and Verkman 2012). A summary of the chaperone
systems involved in CFTR trafficking and recycling is depicted in Figure 1.6.
1.3.1 ER-associated and cytosolic chaperone systems
The synthesis of CFTR is a complex process that is controlled by various chaperone
systems. CFTR biosynthesis is a very inefficient process due to its early folding steps where the
majority of CFTR is degraded in pre-Golgi compartments (Ward and Kopito 1994). In order for
CFTR to fold correctly, it requires not only the proper folding of individual domains, but also
appropriate domain-domain interactions and arrangements. The first step in the CFTR folding
process is the folding of the nascent chain protein, which is controlled by the ER-associated
chaperones, both membrane-bound and cytosolic (Chanoux and Rubenstein 2012).
1.3.1.1 Hsp70 and its co-chaperones
The Hsp70 heat shock protein family is a family of conserved and ubiquitously
expressed heat shock proteins. Hsp/Hsc70s are one of the first chaperones described to bind to
the nascent CFTR chain and to mediate its folding cotranslationally (Yang, et al. 1993).
Although Hsp/Hsc70 serves to help proteins fold, later studies have shown that they can facilitate
both the folding and degradation of CFTR nascent chains depending on its association with other
co-chaperones (Meacham et al. 1999; Meacham et al. 2001). As a member of the chaperone/co-
chaperone DNAJ family, Hdj-2 forms a complex with Hsc/Hsp70, which binds to and promotes
folding of the ribosomal-bound intermediates CFTR during translation of NBD1 (Meacham et
al., 1999). During translation of the R region and MSDII, the binding of the Hdj-2/Hsc70
http://en.wikipedia.org/wiki/Heat_shock_protein
17
complex diminishes greatly. Thus, it has been hypothesized that the Hdj-2/Hsc70 complex
preferentially binds to ΔF508-CFTR and prevents the aggregation of NBD1.
Depending on the co-chaperones associated with Hsp70, the chaperone complex can also
target the partially folded polypeptide chain for degradation. An example is the C-terminus of the
Hsc70-Interacting protein (CHIP), which is another co-chaperone that can form a complex with
Hsc/Hsp70 (Meacham et al. 2001). However, unlike the Hdj-2-Hsp70 complex, the CHIP-Hsp70
complex senses the folded state of the nascent chain of CFTR and targets aberrant proteins for
degradation via the proteasome (Meacham et al. 2001). CHIP acts as an E3 ligase in cooperation
with the E2 UbcH5a, which facilitates the degradation of nascent CFTR chains (Younger et al.
2004)
1.3.1.2 ER membrane-bound and luminal chaperones
Besides the CHIP/Hsc70 complex that targets CFTR for degradation, another ER
membrane-associated ubiquitin ligase complex, consisting of the E3 RMA1, the E2 Ubc6E, and
Derlin-1, can also recognize folding defects of CFTR during the synthesis of MSD1, and target it
for degradation (Younger et al. 2006). The mechanism of action for this RMA1 complex
involves Derlin-1, an ER membrane protein, which senses the folding status of MSD1/2 and
forms a complex with misfolded CFTR. Following complex formation, Derlin-1 recruits RMA1
and Ubc6e to facilitate ubiquitination and degradation of CFTR (Younger et al. 2006).
The role of ER luminal chaperones such as calnexin on folding of CFTR is poorly
understood (Chanoux and Rubenstein 2012). Calnexin was initially thought to bind to immature
CFTR and retain ΔF508-CFTR in the ER (Pind et al. 1994). However, other studies have shown
that calnexin has a positive regulatory role in the synthesis of ΔF508-CFTR. Overexpression of
calnexin created a pool of ΔF508-CFTR and reduced the degradation and aggregation of the
mutant protein (Okiyoneda et al. 2004). Moreover, knocking down calnexin did not seem to
improve the trafficking of ΔF508-CFTR (Okiyoneda et al. 2008). The role of calnexin is
controversial, but combined data from various studies suggests that calnexin alone is not
sufficient for the retention of ΔF508-CFTR in the ER.
18
1.3.1.3 Hsp90
Another chaperone associated with CFTR maturation that is widely studied is Hsp90,
which is shown to stabilize CFTR folding intermediates (Loo, et al. 1998). Similar to Hsp70, the
activity of Hsp90 depends on the presence of its co-chaperones. Hsp90 cochaperone Aha1 was
shown to down-regulate the rescue of misfolded CFTR and accordingly, knockdown of Aha1 led
to rescue of ΔF508-CFTR (Wang et al. 2006). Other cochaperones of Hsp90 such as p23 were
found to mediate the folding of ΔF508-CFTR by stabilizing the mutant and prevent its
degradation (Wang, et al. 2006).
1.3.2 Peripheral chaperone systems
One of the defects of rescued ΔF508-CFTR is its instability at the plasma membrane
(Lukacs 1993). The instability of the protein is due to the peripheral chaperone systems that
rapidly degrade the protein (Okiyoneda et al. 2010). In fact, many of the chaperones that are a
part of the ER control machinery also belong to the peripheral chaperone system (Okiyoneda et
al. 2010). CHIP was found to be the main E3 ligase responsible for the ubiquitination of rescued
ΔF508-CFTR (Okiyoneda et al. 2010). Knocking down CHIP reduced the internalization of
mutant CFTR and restored its recycling. Moreover, Hsp70, Hsp90 and a subset of their
cochaperones such as Aha1, Hdj-2, and BAG-1 were also identified to be part of the peripheral
quality control machinery that participates in the degradation of the rescued mutant. Thus, the
peripheral protein quality-control mechanism most likely participates in the preservation of
cellular homeostasis by degrading damaged plasma membrane proteins that have escaped from
the endoplasmic reticulum quality control. The studies of these chaperones systems suggest a
different therapeutic approach to correct the trafficking defects of ΔF508-CFTR. In addition to
focusing on rescuing ΔF508-CFTR itself, manipulating the chaperones involved in the
processing of CFTR might also serve to rescue the mutant.
19
Figure 1.6: Overview of the chaperone system that is involved in the trafficking of CFTR.
As CFTR is synthesized, numerous chaperones and co-chaperones binds to it. Depending on its
co-chaperone, Hsp70 and Hsp90 can both fold or degrade CFTR. Failure to achieve productive
folding at any step in the folding pathway is detected by persistent binding of Hsp70, which
serves to recruit E3 ligases (i.e., RMA1 and CHIP) that ubiquitinate CFTR and target it to the
26S proteasome. (Modified from Kim 2012)
20
1.4 Screens to identify correctors of ∆F508 CFTR
The ∆F508 defect can be partially corrected by treating cells expressing ΔF508-CFTR at
low temperature or chemical chaperones, such as glycerol, leading to some cell surface
expression of the mutant (Denning et al., 1992; Sato et al., 1996). Moreover, it was suggested
that that even partial correction as low as 10-25% rescue of CFTR activity may be sufficient to at
least partially restore airway epithelial function (Zhang et al. 2009). Thus, several groups have
developed high-throughput screens to identify small molecules that can correct the
folding/trafficking defect of ∆F508.
1.4.1 High-throughput screens for correctors of ΔF508-CFTR
High-throughput screens (HTSs) of large libraries of compounds using functional or
biochemical cell-based assays have been the most commonly utilized screens to identify
correctors for ΔF508-CFTR. In these assays, rescue of the mutant is indicated by either an
increase in anion transport or the appearance of the protein at the cell surface (Pedemonte et al.
2012). However, these screens provide little information regarding the mechanism of action of
the compounds on rescue of the mutant. Nevertheless, utilization of these HTS proved fruitful,
as it identified a number of compounds that could be used to correct CF defects. These CF drugs
can be divided into two different types: correctors, which correct the trafficking defect of ΔF508-
CFTR, and potentiators, which increase channel activity as in the case of G551D-CFTR.
The first HTS was performed by the Verkman group, where they screened a library of
150,000 chemically diverse compounds followed by a secondary screen of 1,500 analogs of the
active compounds (Pedemonte et al. 2005). Through the screen, bithiazole corr-4a was shown to
partially rescue ΔF508 function in primary human airway epithelial cells obtained from ΔF508
homozygous CF patients. Following the success of the first screens conducted by the Verkman
group, several other groups have utilized HTS to identify other correctors of ΔF508-CFTR. For
example, the FDA approved drug sildenafil that showed some rescue of ΔF508 was identified by
screening a library of 42,000 compounds (Robert et al. 2008). Following its identification,
sildenafil was shown to have a dual effect on the mutant protein as it worked both as a corrector
and potentiator of ΔF508-CFTR (Leier et al. 2012). However, the high doses of the drug required
for the rescue of CFTR are detrimental, thus limiting its use in the clinic. To date, many groups
continue to use HTS to identify new ΔF508-CFTR correctors.
21
1.4.2 Discovery of VX-809 and VX-770 and their clinical trials
The most successful screen so far was performed by Vertex Pharmaceuticals, which
identified several compounds in the quinazolinone class acting primarily at the ER level to
facilitate folding of the protein (Van Goor et al. 2006). This screen has led to further discovery of
some very promising drugs such as the corrector VX-809 (Van Goor et al. 2011) and the
potentiator VX-770 (Van Goor 2009). VX-770 is currently being used in the clinic for the
treatment of CF patients bearing the G551D mutation, which affects channel gating activity
(Ramsey et al. 2011). Unfortunately, VX-809 was not as successful as VX-770. Although VX-
809 demonstrated a 25% rescue of ΔF508-CFTR in primary airway epithelial cells, its efficacy
was limited in improving lung function of CF patients (Clancy et al. 2012). However, a
combination of VX-809 (Lumacaftor) and VX-770 (Ivacaftor) did yield a small improvement
(http://investors.vrtx.com/releasedetail.cfm?ReleaseID=856185). Unfortunately, recent studies
showed that VX-770 destabilizes cell surface ∆F508 rescued with VX-809 (Cholon et al. 2014,
Veit et al. 2014). This disappointing result underscores the need to not only identify more
effective correctors of ∆F508, but to also ensure that drug combinations do not adversely affect
each other.
1.4.3 Our screens using high-content halide exchange (Cellomics) assays
As stated above, most of the HTS performed by various groups have focused on
identifying compounds that rescue the mutant CFTR without understanding their mechanism of
action. Taking a different approach, our lab developed a high-content functional screen using the
Cellomics KineticScan technology (halide exchange assays) aiming at identifying proteins and
small molecules (and the pathways in which they participate) that correct the trafficking defect of
ΔF508-CFTR (Trzcinska-Daneluti et al. 2009, Trzcinska-Daneluti et al. 2012). Moreover, we
chose a drug-repurposing approach where the small molecules chosen (kinase inhibitors) for our
screens are already in the clinic or in clinical trials for the treatment of other diseases, such as
cancer or inflammation (Trzcinska-Daneluti et al. 2012). In this screen, our lab utilized human
HEK293-GT cells that stably express ΔF508-CFTR and a mutant YFP, YFP(H148Q/I152L)
whose fluorescent signal can be quenched by halide exchange (I− for Cl−) (Galietta et al. 2001).
When the cells are exposed to high iodide/ low chloride media and stimulated with FIG
(Forskolin/IBMX/Genistein), which activates CFTR, the Cl−/I
− exchange via CFTR leads to
22
quenching in fluorescent signal. In the absence of functional CFTR on the plasma membrane,
minimal quenching of fluorescent signal is observed. Thus, the quenching of fluorescent signal
serves to indicate the level of CFTR activity (Figure 1.7). This approach proved fruitful as our
lab identified several proteins that when overexpressed rescue the function of ΔF508-CFTR.
Among the hits were several chaperones, signaling proteins and transcription factors. One of the
best hits identified was STAT1 (Signal Transducer and Activator of Transcription 1) as well as
FGFR1 (Trzcinska-Daneluti et al. 2009). Knocking down of PIAS1, an inhibitor of STAT1, also
rescued ΔF508-CFTR, further supporting our findings. Moreover, this screen is capable of
identifying small molecules that can rescue ΔF508-CFTR function and we identified multiple
kinase inhibitors that can rescue this mutant (Trzcinska-Daneluti et al. 2012). Thus, an advantage
of our screen is that when we focus on identifying proteins that rescue the mutant, we can
identify the pathways that are involved in the rescue of ΔF508-CFTR.
23
Figure 1.7: Overview of the Cellomics assay. The mutant YFP protein (H148Q/I152L), which
is expressed in HEK293-GT cells, is halide sensitive, and its fluorescence is quenched by iodide.
The assay is performed with HEK293-GT expressing the mutant YFP and either WT-CFTR or
ΔF508-CFTR. In cells expressing WT-CFTR channel exposed to high iodide/ low chloride
media and stimulated with FIG (Forskolin/IBMX/Genistein), the Cl−/I− exchange via CFTR leads
to quenching in fluorescent signal. In cells expressing ΔF508-CFTR, the quenching is
significantly less due to the absence of functional CFTR channel at the cell surface unless
rescued. Quenching in fluorescent signal indicates the level of CFTR activity.
24
25
1.5 Kinases and FGFR signaling
1.5.1 Kinases
Kinases are enzymes that phosphorylate their substrates by transferring a phosphate
group from a high energy molecule (such as ATP) to the substrate molecule through
phosphorylating them on their serine, threonine, tyrosine, or histidine residues (Lahiry et al.
2010). This change in the phosphorylation state of a molecule can affect its activity, reactivity,
and its ability to bind to other molecules. Thus, kinases are critical in cell signaling, protein
regulation, cellular transport, secretory processes, and countless other cellular pathways (Lahiry
et al. 2010). As a result of their key role in regulating cellular growth and metabolism, mutations
in kinases are often associated in cancer. Thus, efforts have been made to discover inhibitors of
these kinases in the treatment of certain types of cancer (Yadava et al. 2014).
1.5.2 FGFR signaling
Fibroblast Growth Factor (FGF) receptors are members of the receptor tyrosine kinase
(RTK) family. In humans, the FGFR family consists of 4 receptor genes encoding closely related
transmembrane RTKs (Turner and Grose 2010). They play critical roles in regulating cellular
differentiation, proliferation, animal development, angiogenesis and tissue regeneration. Ligand
(FGF) binding to FGFRs induces receptor dimerization, which activates its kinase activity and
auto phosphorylation of multiple cytoplasmic tyrosine residues. This phosphorylated site, in turn,
serves as binding sites for effector molecules such as FRS2α and PLCγ, which further activate
downstream signaling such as the PI3K/Akt pathway and Ras/Raf/Erk (MAP kinase pathways)
leading to cellular effects (Turner and Grose 2010). The major signal transduction pathways of
FGFR are depicted in figure 1.8.
26
Figure 1.8: Overview of FGFR1 signaling. FGFR1 regulates many downstream signaling
pathways. Some of the major downstream effectors of FGFR1 are Akt, FRS2α, PLCγ and
Erk1/Erk2. Proteins that are known to positively regulate signalling as well as negative
regulators are shown in blue or green and pink, respectively. (Modified from Turner and Grose
2010)
27
1.5.3 MAP Kinase Pathway and chaperones
The MAP kinases are a family of serine/threonine kinases that respond to a variety of
extracellular growth signals. Growth factors such as FGF are known to activate the MAPK
pathway. Activation of this pathway begins when a signaling molecule binds to the receptor such
as FGFR1 on the cell surface (Eswarakumar et al. 2005). This initiates a signaling cascade
whereby the Ras GTPase exchanges GDP for GTP, which can now activate MAP3K (Raf). In
turn MAP3K activates MAP2K, which activates MAPK (ERKs). ERKs can then activate
transcription factors leading to cellular effects (Seger et al. 1995). Relevant to my work,
activation of the MAPK pathway is known to suppress the activity of heat shock factor 1
(HSF1), which is a transcription factor that induces the expression of numerous heat shock
proteins such as Hsp70. (Pirkkala et al. 2001; Mendillo, et al. 2012). In cells, HSF1 exists as an
inactive monomer in the cytoplasm that is associated with multiple chaperones such as Hsp40,
Hsp70 and Hsp90. In response to stress, HSF1 trimerizes and translocates to the nucleus where
it binds to heat shock elements in the promoters of stress-responsive genes (Neef et al. 2011)
(Figure 1.9). Moreover, HSF1 can also be regulated by phosphorylation. ERK1/2 is known to
inhibit HSF1 by phosphorylating the protein at Ser307. This phosphorylation primes the protein
for a second phosphorylation on Ser303 by GSK3. The phosphorylation on Ser303 and Ser307
represses HSF1 function and inhibit subsequent expression of HSPs (Chu et al. 1996). As such,
defects in the MAP/ERK pathway are found in many cancers (Manzo-Merino et al. 2014). Many
compounds can inhibit the steps in the MAP/ERK pathway and are currently being investigated
as potential drugs for treating certain types of cancer. Such drugs include AZD0530, which is
currently being tested in a phase 2 clinical trial for the treatment of postmenopausal breast
cancer. Interestingly our lab showed that AZD0530 can rescue ∆F508-CFTR in cell culture,
suggesting the possibility that drugs targeting the same pathways can be used to treat CF
(Trzcinska-Daneluti et al. 2012).
28
Figure 1.9: Activation of HSF1. In the absence of cellular stress, HSF1 exists as an inactive
monomer in the cytoplasm. Its activity is repressed via the interaction of the chaperone proteins
HSP90, HSP70 and HSP40, as well as its phosphorylation on Ser303 and Ser307 residues. In
response to proteotoxic stress, HSF1 forms homotrimers and translocates to the nucleus to bind
to heat shock elements in the promoters of stress-responsive genes. (Modified from Neef et al.
2011)
29
1.6 Project Rationale and goals
Our group has developed a high content functional screen (Cellomics assay) aimed at
identifying proteins and small molecules that rescue the trafficking defect of ΔF508-CFTR.
Using this approach, our lab performed an esiRNA (RNA interference) kinome screen and a
complementary small molecule kinase inhibitors screen (using compounds already in the
clinic/clinical trials) in order to identify kinases that inhibit rescue of ΔF508-CFTR. By
identifying kinase suppressors of ΔF508-CFTR rescue, it is hoped that the signaling pathways
involved in rescue of ΔF508-CFTR can be identified. Most importantly, the identification of
kinases that inhibit rescue of ΔF508-CFTR allows for drug repurposing, which can expedite the
treatment of CF. In both complimentary kinome screens, we identified that inhibition of FGF
receptors (FGFRs) led to a substantial rescue of ∆F508-CFTR.
The goal of my project was to validate the top hits from the esiRNA kinome screen as
well as to identify the signaling pathway(s) and chaperones involved in FGFRs –mediated
inhibition of rescue of ΔF508-CFTR.
30
Chapter 2 : MATERIALS AND METHODS
2. Methodology
2.1 Media and Reagents
Dulbecco‟s Modified Eagle‟s Medium (DMEM), Dulbecco‟s Phosphate Buffered Saline (D-
PBS), Fetal Bovine Serum (FBS), trypsin, G418, blasticidin and zeocin were obtained from
Invitrogen. The mouse M3A7 anti-CFTR monoclonal antibody was purchased from Millipore,
the mouse HA.11 (16B12) monoclonal antibody was from Covance, the rabbit polyclonal anti-
vinculin antibody was from Abcam and SuperSignal West Femto Maximum Sensitivity kit was
from Pierce. The High Capacity cDNA Reverse Transcription kit was obtained from Applied
Biosystems, the Platinum® SYBR® Green qPCRSuperMix-UDG was from Invitrogen and the
SA-HRP was from eBioscience. The kinome RNA interference (esiRNA) library was kindly
provided by Dr. Laurence Pelletier (The Samuel Lunenfeld Research Institute). shRNA clones
were from the RNAi Consortium (TRC) (Moffat et al. 2006), Open Biosystems via The Hospital
for Sick Children and SIDNET/SPARC BioCentre. For the overexpressed chaperones, the entry
clones compatible with Gateway® system (Invitrogen) were obtained from SIDNET/ SPARC
BioCentre and PlasmID (The Dana-Farber/Harvard Cancer Center DNA Resource Core), and
were subsequently cloned into the destination vector, pcDNA3.1(eYFP H148Q/I152L). All
constructs were sequence verified.
2.2 Cells
HEK293-GT cells stably expressing ΔF508-CFTR or wild type CFTR (WT-CFTR) protein
were stably transfected with eYFP(H148Q/I152L) cDNA in pcDNA3.1/zeo vector using calcium
phosphate as described (Trzcinska-Daneluti et al. 2009). At 24 h post-transfection, the cells were
seeded onto 5 × 10 cm dishes at various densities and selected under 100 μg/ml Zeocin and
expanded. Expression of WT-CFTR or ΔF508-CFTR was validated by immunoblotting using
M3A7 anti-CFTR monoclonal antibodies. Expression of eYFP(H148Q/I152L) was validated by
fluorescent microscopy. HEK293-GT cells stably co-expressing eYFP(H148Q/I152L) and
ΔF508-CFTR or WT-CFTR protein were cultured in DMEM medium supplemented with 10%
FBS, 1× nonessential amino acids, 0.6 mg/ml G418, 10 μg/ml Blasticidin, and 50 μg/ml Zeocin,
31
at 37 °C, 5% CO2 in humidified atmosphere. The triple hemagglutinin (3HA) tag was cloned by
PCR based on the sequence used in BHK ΔF508-CFTR 3HA cell line (Carlile et al. 2007), and
inserted after Asn at position 901 (N901) in the fourth external loop of CFTR. The full length
CFTR bearing 3HA tag (wild type or ΔF508) was subsequently cloned into the pLVE/zeo vector.
The plasmids were then transfected into HEK293-GT using calcium phosphate precipitation. The
transfected cells were seeded at different concentrations to isolate individual colonies under
selection with 100 µg/ml zeocin. Individual clones were picked, expanded and WT-CFTR or
ΔF508-CFTR expression verified by immunoblotting. Madin Darby Canine Kidney (MDCK)
cells stably expressing ΔF508-CFTR protein were cultured in DMEM supplemented with 10%
FBS, 1×PenStrep and 5μg/ml Blasticidin at 37 °C, 5% CO2. Primary human bronchial epithelial
(HBE) cells from lung transplant patients homozygous for ΔF508-CFTR were kindly provided
by Dr. P. Karp at the University of Iowa Cell Culture Facility, and grown on collagen-coated
permeable millicell inserts (12 or 6.5 mm, Millipore). Nasal cells from CF patients were kindly
provided by Dr. Theo Moraes and Dr. Tanja Gonska and were grown on collagen coated
transwell inserts (0.4 µm pore size) at a density of 105 cells/cm2.
2.3 Cellomics YFP Halide Exchange Screen
The Cellomics halide-exchange assay was performed as described below. Briefly, 50,000
∆F508-CFTR cells (HEK293-GT cells stably co-expressing eYFP(H148Q/I152L) and ∆F508-
CFTR) per well were seeded in the 96-well plates. The next day the cells were transfected with
esiRNA duplexes from the library (final concentration 40 nM), luciferase (non-silencing
control), EG5 (transfection control) or AHA1 esiRNA (positive control), using Lipofectamine
2000. Medium was changed 6 h after transfection, and the cells were placed at 37oC, 5% CO2 for
72 h. The 96-well transfection protocol was optimized using EG5 (KIF11) esiRNA as a
transfection control. The transfection was considered successful if more than 80% of the EG5
control cells exhibited round-shape phenotype 72 h post-transfection. After 72 h of incubation,
the medium was replaced with 152 µl of chloride solution (137 mM NaCl, 2.7 mM KCl, 0.7 mM
CaCl2, 1.1 mM MgCl2, 1.5 mM KH2PO4, 8.1 mM Na2HPO4, pH 7.1), in the absence or presence
of FIG (25 µM Forskolin, 45 µM IBMX, 50 µM Genistein), at 37oC. After 20-min incubation, 92
μl of iodide buffer (137 mM NaI, 2.7 mM KCl, 0.7 mM CaCl2, 1.1 mM MgCl2, 1.5 mM
KH2PO4, 8.1 mM Na2HPO4, pH 7.1) was added (final I- concentration 52 mM). Using the
Cellomics KSR Reader (Thermo Fisher) and a modified Target Activation algorithm, objects
32
(individual cells or sometimes clusters of cells) were defined by eYFP(H148Q/I152L)
fluorescence intensity, and the fluorescence quenching over 24-s time course at 37oC, 5% CO2,
was recorded. Valid wells contained between 70 and 300 objects per field (single field per well).
Genes that displayed a difference in the YFP fluorescence intensity (between FIG-stimulated
sample and non-silencing control) lower than 0.09 were rejected after the first two runs of the
screen. This cut-off value equaled three times the standard deviation from the mean value of the
control (AHA1). The rest of the esiRNA duplexes (56 genes) were subjected to the third run of
the screen. Twenty top hits of the screen were subjected to further validation of ∆F508-CFTR
rescue by functional assay, immunoblotting and ELISA following shRNA-mediated knockdown.
2.3.1 shRNA Knockdown and qPCR quantification of knockdown
ΔF508-CFTR cells were transfected with target genes or luciferase (nonsilencing control)
shRNA constructs using Lipofectamine 2000, according to the manufacturer's instructions.
Medium was changed 6 h after transfection, and ΔF508-CFTR cells were placed at 37 °C, 5%
CO2. 48 h after transfection the cells were incubated with media containing Puromycin (5 μg/ml,
3 days). Knockdown was validated by two-step RT-qPCR. For the RT-qPCR experiment, total
RNA was isolated using the RNeasy 96 kit (Qiagen, Dorking, Surrey, UK), and cDNA was
prepared using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster
City, CA). Real time PCR reactions were performed using Platinum® SYBR® Green qPCR
SuperMix-UDG (Invitrogen) and CFX96 Real-Time System (BioRad). Primers were obtained
from Integrated DNA Technologies. For standard curves, real time PCR was performed on a five
fold dilution series DNA.
2.3.2 Cellomics shRNA analysis
∆F508-CFTR cells (stably expressing eYFP(H148Q/I152L)) were transfected with
shRNA constructs targeting the top twenty hit genes identified in the esiRNA screen or luciferase
(non-silencing control), using Lipofectamine 2000, according to the manufacturer‟s instructions.
Medium was changed 6 h after transfection and ∆F508-CFTR cells were placed at 37oC, 5%
CO2. 48 h after transfection the cells were incubated with media containing puromycin (5μg/ml,
3 days) and the Cellomics halide-exchange assay was performed as described above. A total
number of 133 shRNA clones was screened (multiple shRNA clones per gene) (appendix table
A1).
33
2.3.3 Combination drug treatment
For drug combination testing, 8x104 ∆F508-CFTR cells (i.e. HEK293-GT cells stably co-
expressing eYFP(H148Q/I152L) and ∆F508-CFTR) per well were seeded in 96-wells plates. The
next day, the cells were treated with SU5402+VX-809, AZD4547+VX-809 or SU5402+VX-770
with concentration ranging from 1M to 10M. The cells were incubated at 37°C, 5% CO2 for
48 hr, and then analyzed by the Cellomics halide-exchange assay, as described above.
2.4 Immunoblotting
∆F508-CFTR expressing cells were transfected with shRNA constructs (TRC) for the
identified genes or non-silencing (scrambled) control for 48 h at 37°C, or incubated for 48 h at
27°C (positive control). After transfection the cells were incubated with media containing
puromycin (5μg/ml, 3 days). ∆F508-CFTR cells were then rinsed in cold PBS and lysed in lysis
buffer (50mM Hepes pH7.5, 150mM NaCl, 1.5mM MgCl2, 1mM EGTA, 10% glycerol (v/v), 1%
Triton X-100 (v/v), 2 mM PMSF, 2x PAL(Pepstatin A, Aprotinin, Leupeptin,) inhibitors).
Proteins were resolved on SDS-PAGE, transferred to nitrocellulose membranes and
immunoblotted with anti-CFTR (M3A7, 1:1000) or anti-vinculin (1:2000) antibodies.
Membranes were washed with 5% Blotto, incubated with HRP-conjugated anti-mouse or anti-
rabbit antibodies (1:10000) and washed with PBST (PBS + 0.05% Tween). Signal was detected
with SuperSignal West Femto reagent.
2.5 ELISA assay
ΔF508-CFTR 3HA cells expressing triple HA tag at the ectodomain of ΔF508-CFTR were
biotinylated with 0.5 mg/ml biotin in PBS (15 min), washed with ice-cold PBS and lysed. To
capture CFTR or ΔF508-CFTR, 50 g of total lysate protein (per well) were incubated with anti-
HA antibody (1:400) in 96-well plate, for 2 h at 4°C. The plates were then washed with PBST
(PBS + 0.05% Tween) and SA-HRP (1:1000) was added in ELISA buffer (PBST + 0.5% BSA)
into each well (20 min). After washing, the plates were incubated with TMB substrate. The
reaction was stopped with 1N H2SO4 and the signal read at 450 nm.
34
2.6 Short-circuit Current (Isc) Measurements in Ussing Chambers
Cell inserts or Snapwells, seeded with MDCK, HBE cells or nasal cells and polarized were
mounted on an Ussing chamber apparatus (Physiological Instruments, San Diego, CA) and
studied under voltage clamp conditions. The buffer used in the assay composed of 1x Hank‟s
Balanced Salt Solution (HBSS) supplemented with 21mM of NaHCO3, 1.2mM of CaCl2, and
1.2mM of MgCl2.Prior to stimulation of CFTR, ENaC channels were inhibited with 10 μM
amiloride (Sigma), and non-CFTR chloride channels were blocked with 250 μM DNDS (4,4′-
dinitrostilbene-2,2′-disulfonate, Sigma). CFTR currents were then stimulated using FIG, and
after the indicated time (min) inhibited using 15–50 μM GlyH-101 (Gly). Data were recorded
and analyzed using Analyzer 2.1.3.
2.7 Salivary Secretion Assay (SSA)
The salivary secretion assay, described previously (Quinton et al. 2005), was modified as
follows. Male ΔF508 mice (CFTRtm1Eur
on a 129/FVB background) and their wild-type
littermates (kindly provided by Dr. C. Bear) 9-12 weeks of age were intra-peritoneally injected
with DMSO or SU5402 (dissolved in DMSO at the concentration of 6 mg/ml) at 25 mg/kg body
weight, every day for one week. The mice were weighed daily and the dosages adjusted
accordingly. The mice were then anaesthetized by inhaling isoflurane until the end of the
procedure. Cholinergic antagonist, atropine (1 mM, 50 µl) was subcutaneously injected into the
right mice cheek to block potential cholinergic stimulation of the salivary gland. A small strip of
filter paper was placed against the injected cheek, for 4 minutes. Isoprenaline (10 mM, 37.5 µl)
was subsequently injected in the same spot to stimulate an adrenergic secretion of saliva (time 0).
Filter strips (pre-weighed in an Eppendorf tube) were replaced every 5 minutes, over a period of
30 minutes. All 6 filter strips were weighed at the end of the collection and the results were
normalized relative to mg/g body weight. All animal work was done in accordance with
SickKids Institutional guidelines and approval of the Animal Care Committee.
35
2.8 Intestinal Organoids Experiments
Intestinal organoids derived from crypts isolated from the terminal ileum of ΔF508/ΔF508-
CFTR mice and wild-type littermates were generated and maintained in culture, as described
(Sato et al. 2011). For forskolin-induced swelling (FIS) experiments, organoids were seeded in
24-well tissue culture plates, pretreated with kinase inhibitors (SU5402, 10 µM) and/or VX-809
(3 µM), and stimulated with 5 µM forskolin, as outlined in (Dekkers, et al. 2003). FIS was
observed by brightfield live-cell microscopy with an automated xy-stage (Nikon TE-2000 with
Solent Scientific enclosure, 20x)
2.9 Chaperone array
Human Bronchial Epithelial (HBE) cells from ΔF508/ΔF508-CFTR patients (P2 cells) were
obtained from the University of Iowa Cell Culture Facility and grown on collagen-coated
permeable millicell inserts. The cells were treated with DMSO (control), 1 M or 10 M
SU5402 for 48 h prior to RNA extraction. Total RNA was extracted using the PureLink RNA
Mini Kit (Life technologies) and cDNA was synthesized from 1 g of mRNA using the High
capacity cDNA reverse transcription kit (Applied Bioscience) according to the manufacturer‟s
instructions. Array analysis was performed using the RT² Profiler™ PCR Array Human Heat
Shock Proteins & Chaperones kit (Qiagen). mRNA expression levels were determined relative to
actin, GAPDH and B2M using the ΔCt method. Changes in chaperone expression level relative
to DMSO control were determined using the ΔΔCt method (Livak and Schmittgen 2001). The
chaperone array experiment was performed 3 times and average values are shown in a heat map.
2.10 Validation of Chaperone Array Hits
Seventy thousand ∆F508-CFTR 3HA cells per well were seeded in a 6-well plate format. The
next day the cells were transfected with the clones for the analyzed chaperone genes (shRNA or
overexpression) or luciferase control, using PolyJet™ DNA In Vitro Transfection Reagent
according to the manufacturer‟s instructions. 48 hr post-transfection, the cells that were
transfected with shRNA were further incubated with media containing puromycin (5μg/ml, 3
days). The cells that were transfected with the chaperone overexpression clones were
biotinylated, and ELISA was performed as described above.
36
2.11 HSF1 experiments
The pcDNA3.1(eYFP H148Q/I152L) plasmid containing the wild type HSF1 was used to
construct a constitutively active mutant of HSF1 (Nakai et al. 2000) using site directed
mutagenesis consisting of one-step PCR using two overlapping internal primers at the mutagenic
site. The internal primers used were
5‟GAACGACAGTGGCTCAGCACATGGGCGCCCATCTTCCGTGGAC 3‟ and
5‟GTCCACGGAAGATGGGCGCCCATGTGCTGAGCCACTGTCGTTC 3‟. DNA sequencing
was performed to verify the constructs. Seventy thousand ∆F508-CFTR 3HA cells per well were
seeded in 6 well plate. The next day the cells were transfected with the eYFP constructs for wild
type HSF1 , mutant HSF1, or luciferase control using PolyJet™ DNA In Vitro Transfection
Reagent, according to the manufacturer‟s instructions. 48 hr post transfection, the cells were
biotinylated and ELISA was performed as described above.
37
Chapter 3 : RESULTS
3. Results
3.1 Kinome esiRNA screen for identifying suppressors of rescue of ∆F508-CFTR
Delineation of pathways and proteins that prevent rescue of ∆F508-CFTR is important for
the identification of drugs that target these pathways. Using the high-content functional screen
(Cellomics) that our lab previously developed (Trzcinska-Daneluti et al. 2009), a library of 759
esiRNAs targeting different kinases and associated proteins was used to knock down target genes
to identify kinases that suppress ΔF508-CFTR maturation. This kinome esiRNA screen also
servers to complement our previous kinase inhibitor screen that was published recently
(Trzcinska-Daneluti et al. 2012). In the current kinome esiRNA screen, HEK293-GT cells stably
co-expressing the Cl− sensitive eYFP (H148Q/I152L) mutant and ΔF508-CFTR (ΔF508-CFTR
cells) were transfected with esiRNA for 72h at 37oC. Cells were then stimulated for 20 minutes
using a mixture of Forskolin (25 μM)/IBMX (45 μM)/Genistein (50 μM) (FIG) and exposed to
low Cl-/high I
- solution. The quenching of fluorescence caused by Cl
-/I
- exchange by CFTR or its
mutant, was recorded and quantified over time. Figure 3.1 shows several representative “hit”
suppressors that when knocked down lead to varying degree of ∆F508-CFTR rescue. The top 20
suppressors that showed the strongest level in fluorescence quenching, ∆FIavg (between FIG
stimulated sample and FIG stimulated non-silencing control) is provided in table 1. Many of the
genes from the top “hit” list are involved in the Ras/Raf/MEK/Erk, PI3K/Akt, p38 or NFκB
signaling pathways.
38
Figure 3.1: Representative hits of the kinome esiRNA screen.
Average normalized fluorescence intensity (∆FIavg) values of ∆F508-CFTR cells (co-expressing
eYFP(H148Q/I152L)) that were transfected with esiRNA directed towards (A) FGFR1, (B)
RIPK4, (C) MET, (D) SHPK, (E) MAP3K13, (F), BRAF, (G) DUSP22, (H), CDK10, (I) IPMK,
or luciferase (non-silencing control), and grown at 37oC. After 72 h ∆F508-CFTR cells were
stimulated with FIG (25 µM Forskolin, 45 µM IBMX and 50 µM Genistein) and quenching of
YFP fluorescence due to Cl-/I- exchange was quantified by Cellomics KST Reader (70-300 cells
per well). (J) Quantitation of rescue (difference in average fluorescence intensity ∆FIavg) of
∆F508-CFTR at 24 s after adding iodide solution from 3 independent experiments (a single field
per well, 70-300 cells per field). Data are mean ± SEM. The fluorescence intensity was
normalized by subtracting the fluorescence intensity of the unstimulated sample from the
stimulated sample.
(Performed by Dr. Agata Trzcinska-Daneluti)
39
40
Table 1. Results of the esiRNA screen.
20 hit genes that displayed a difference in average fluorescence intensity ∆FIavg (between FIG-
stimulated sample and non-silencing control) of at least 9%. The cut-off value of 9% (0.09) was
chosen as it equals three times the standard deviation from the mean value of the control
(AHA1).
(Performed by Dr. Agata Trzcinska-Daneluti)
41
Gene name Protein name Accession
No.
Rescue (%)
RIPK4 Receptor-interacting serine/threonine-
protein kinase 4 P57078
22
SHPK Sedoheptulokinase Q9UHJ6 20
MAP3K13 Mitogen-activated protein kinase kinase
kinase 13 O43283
19
FGFR1 Fibroblast growth factor receptor 1 P11362 16
CDK10 Cyclin-dependent kinase 10 Q15131 16
RPS6KC1 Ribosomal protein S6 kinase delta-1 Q96S38 16
PANK4 Pantothenate kinase 4 Q9NVE7 14
DTYMK Thymidylate kinase P23919 14
ERN1 Serine/threonine-protein
kinase/endoribonuclease IRE1 O75460
14
BRAF Serine/threonine-protein kinase B-raf P15056 13
DUSP22 Dual specificity protein phosphatase 22 Q9NRW4 13
IPMK Inositol polyphosphate multikinase Q8NFU5 13
PCK2 Phosphoenolpyruvate carboxylase Q16822 13
CLK3 Dual specificity protein kinase CLK3 P49761 13
MET Tyrosine-protein kinase Met P08581 12
CAMK2B Calcium/calmodulin-dependent protein
kinase type II subunit beta Q13554
12
SOCS1 Suppressor of cytokine signaling 1 O15524 11
NEK10 Serine/threonine-protein kinase Nek10 Q6ZWH5 11
PRKAR2B cAMP-dependent protein kinase type II-
beta regulatory subunit P31323
9
PANK1 Pantothenate kinase 1 Q8TE04 9
42
3.2 Validation of top hits of esiRNA screen with shRNA
Since both the transfection and knockdown efficiency, as well as possible off target effects,
can influence the level of rescue in the esiRNA kinome screen, we decided to validate the top 20
hits from the esiRNA screen with another RNAi technology, shRNA. For this experiment, we
screened 133 TRC-shRNA clones targeting these top 20 “hit” genes (multiples clones for each
gene)(appendix table A1). These clones, or luciferase (non-silencing control), were transfected
into HEK293-GT cells stably expressing ΔF508-CFTR and the halide-sensitive YFP mutant and
were analyzed with the Cellomics assay. In parallel, qPCR was performed to determine the
knock-down efficiency of these constructs. In general, the degree of ∆F508-CFTR rescue
correlated with knockdown efficiency. In the case of MET and BRAF genes, cell death was
observed upon knockdown higher than 60-70% and therefore, shRNA clones that resulted in the
best rescue exhibited knockdown of 30% (B-Raf)-60% (MET). Figure 3.2 and table 2 shows the
results from the shRNA validation analysis using the Cellomics assay. The results from both the
esiRNA screen and the shRNA validation generally agree with each other and produced
reproducible rescue of ∆F508-CFTR function. Knockdown efficiency for all the shRNA clones
that were used for validating the esiRNA kinome screen is presented in appendix table A1.
43
Figure 3.2: Effect of shRNA-mediated knockdown of the suppressor genes on ∆F508-CFTR
channel activity. Average normalized fluorescence intensity of ∆F508-CFTR cells transfected
with shRNA for (A) FGFR1, (B) RIPK4, (C) MET, (D) SHPK, (E) MAP3K13, (F), BRAF, (G)
DUSP22, (H), CDK10, (I) IPMK, or luciferase (non-silencing control), and grown at 37oC. After
48 h ∆F508-CFTR cells were subjected to puromycin selection (3 days) and stimulated with FIG
(25 µM Forskolin, 45 µM IBMX and 50 µM Genistein). Quenching of YFP fluorescence during
Cl-/I
- exchange of 70-300 cells per field was recorded and quantified simultaneously by
Cellomics ArrayScan VTI. Multiple shRNA clones per gene were analyzed. One representative
shRNA clone is shown. KD, knockdown efficiency (%). (J) Quantitation of rescue (difference in
average fluorescence intensity ∆FIavg) of ∆F508-CFTR at 24 s after adding iodide solution. Data
are mean ± SEM from 2-3 independent experiments (3 fields per well, 70-300 cells per field).
Comparison of normalized average fluorescence intensity of ∆F508-CFTR versus WT-CFTR.
(Performed by Dr. Agata Trzcinska-Daneluti)
44
45
Table 2. Validation of the hits by the halide-exchange assay.
Hits were validated by functional assay (Cellomics). Rescue by the best shRNA clone and the
corresponding knockdown level are shown.
(Performed by Dr. Agata Trzcinska-Daneluti)
46
Gene name
Validation by Functional Assay (Cellomics)
Knockdown level
(%) Analyzed shRNA clones
Rescue by the best
shRNA clone (∆FIavg)
FGFR1 10 0.30 94
RIPK4 2 0.22 26
MET 17 0.16 61
SHPK 3 0.15 52
MAP3K13 4 0.15 65
BRAF 7 0.15 34
DUSP22 7 0.15 71
CDK10 6 0.14 87
IPMK 10 0.13 63
RPS6KC1 2 0.13 96
PRKAR2B 2 0.12 40
PANK4 15 0.12 80
SOCS1 5 0.12 N/A
PCK2 4 0.12 78
CAMK2B 3 0.09 85
DTYMK 10 0.09 88
ERN1 1 0.08 79
CLK3 8 0.08 64
NEK10 10 0.08 84
PANK1 7 0.06 79
47
3.2.1 Immunoblotting for the mature (band C) ∆F508-CFTR
To further validate the top 20 hits, we analyze the maturation of ∆F508-CFTR in
response to knockdown of the identified suppressors using immunoblotting for the mature (Band
C) protein. For this experiment, we obtained pGIPZ-shRNA (with GFP tag) constructs that were
used to knock down the target genes in HEK293-GT stably expressing ΔF508-CFTR. The
presence of a GFP tag allowed easy confirmation of transfection efficiency. Figure 3.3 shows the
results from the immunoblot experiment. The results show that most of the analyzed suppressor
genes led to at least 10% increase of band C/B ratio relative to non-silencing control, suggesting
that the top 20 hits normally suppress ∆F508-CFTR maturation.
48
Figure 3.3: Effect of shRNA-mediated knockdown of the hit genes on maturation of ∆F508-
CFTR. HEK293-GT cells stably expressing ∆F508-CFTR were transfected with shRNA for the
analyzed genes, or non-silencing control (as indicated), grown at 37oC for 48 h, selected on
puromycin, and the appearance of the mature protein (band C) was monitored by
immunoblotting. Band B represents the immature CFTR. Scrambled control, non-silencing
control; 27oC, temp. rescue of ∆F508-CFTR at 27
oC; WT CFTR, wild-type CFTR. The 27
oC and
WT CFTR lanes were loaded with half the amount of protein in comparison to other samples.
Top panels depict the anti-CFTR immunoblot, middle panels depict vinculin (loading) control.
The histogram depicts the quantitation of rescue (increase in the band C/B ratio) of ∆F508-CFTR
following shRNA-mediated knockdown. Data are mean ± SEM from 3 independent experiments.
49
50
3.2.2 Cell surface appearance of ∆F508 analyzed by ELISA
An ELISA assay was performed to demonstrate the appearance of ∆F508-CFTR at the
plasma membrane. For this assay, we generated a new HEK293-GT cell line that stably
expresses ∆F508-CFTR protein with a triple HA tag in the ectodomain (which does not disrupt
channel activity). For this experiment, we used pGIPZ-shRNA constructs that were used in the
immunoblotting experiment. The results from the ELISA experiments are shown in figure 3.4.
The ELISA assay showed varying degree of rescue of ∆F508-CFTR following shRNA
knockdown, revealing a prominent increase (approx. 50%) in the amount of surface ∆F508-
CFTR following knockdown of FGFR1 relative to control knockdown.
51
Figure 3.4: Effect of shRNA-mediated knockdown of the hit genes on surface expression of
∆F508-CFTR. HEK293-GT cells stably expressing ∆F508-CFTR (bearing 3xHA tag at the
ectodomain) were transfected with shRNA for the analyzed genes or non-silencing control (as
indicated), grown at 37ºC for 48 h, selected on puromycin, and quantitation of surface expression
of ∆F508-CFTR was carried out by an ELISA assay. SU5402 represents cells treated with 10µM
SU5402 and serves as a positive control. Data are mean ± SE from 3 independent experiments.
The absorbance absolute value at 450nm for the non-silencing control ranges from 0.35-0.48
absorbance unit.
* p < 0.05 (relative to non-silencing control)
52
3.2.3 Ussing chamber analysis to measure function of rescued ∆F508-CFTR
In order to validate the functional rescue of these kinase suppressors, functional assays
using short-circuit current (Isc) analyses by Ussing chambers were carried out in MDCK cells
stably expressing ∆F508-CFTR. Since MDCK cells are of dog origin, only 10 of the top 20 hit
genes have shRNA that are compatible between human and dog. As a result, 10 human-to-canine
compatible shRNA clones (CDK10, PANK1, PANK4, RPS6KC1, DUSP22, SOCS1, FGFR1,
CLK3, NEK10, BRAF, PCK2, IPMK) were transduced (via Lentiviral infection) into MDCK
cells stably expressing ∆F508-CFTR. Knockdown efficiency was measured by qPCR. PANK1,
PANK4 and NEK10 genes showed no expression in the MDCK cells, and the knockdown level
of 3 others (BRAF, PCK2, SOCS1) was negligible. The remaining genes (CDK10, RPS6KC1,
DUSP22, FGFR1, CLK3, IPMK) exhibited knockdown level of 39 – 86% and were subjected to
the short-circuit current (Isc) analysis in Ussing chambers. Three of the analyzed genes,
RPS6KC1, IPMK and CLK3, partially restored the ∆F508-CFTR function, as demonstrated by
an increase in short-circuit current (21% – 50%) (Figure 3.5). As MDCK cells exhibited an
increased sensitivity toward knockdown of CDK10, DUSP22 and FGFR1 (changes in
proliferation rate and/or cell morphology), we were unable to assess ∆F508-CFTR chloride
channel activity in the cells that expressed shRNAs for these genes.
53
Figure 3.5: Effect of kinase knockdown on ΔF508-CFTR channel activity in polarized
MDCK cells stably expressing ΔF508-CFTR. Representative short-circuit currents (Isc) in
MDCK cells stably expressing ΔF508-CFTR upon knockdown of (A) RPS6KC1, (B) CLK3 and
(C) IPMK. ENaC channels were inhibited with 10 µM amiloride and non-CFTR chloride
transporters were blocked with 250 µM DNDS. ΔF508-CFTR currents were stimulated with FIG
(25 µM Forskolin, 25 µM IBMX and 50 µM Genistein), and after the indicated time inhibit