Role of FGF receptors in rescue of ∆F508-CFTR

By

Kar Ki Anthony Chen

A thesis submitted in conformity with the requirements for the degree of Master of Science

Graduate Department of Biochemistry University of Toronto

© Copyright by Kar Ki Anthony Chen (2015)

ii

Role of FGF receptors in rescue of ∆F508-CFTR

Kar Ki Anthony Chen

Master of Science

Department of Biochemistry

University of Toronto

2015

Abstract

∆F508-CFTR is the most common mutation causing cystic fibrosis (CF), where it

exhibits folding defects and is unable to reach the plasma membrane. To identify signaling

pathways involved in ∆F508-CFTR rescue, we screened a library of esiRNAs that target over

750 different kinases and associated signaling proteins. We identified 20 novel suppressors of

∆F508-CFTR rescue including FGFR1. The top hits of the screen were validated by various

methods: halide exchange assay, immunoblotting and ELISA following shRNA-mediated

knockdown. Inhibition of FGFR1 with SU5402 leads to ∆F508-CFTR rescue in CF patient cells

and in intestinal organoids from ∆F508/∆F508 mice. Chaperone array analysis on Human

Bronchial Epithelial cells identified altered expression of several chaperones and their effects on

∆F508-CFTR maturation were validated by ELISA. We propose that FGFR signaling regulates

specific chaperones that control ΔF508-CFTR maturation, and suggest that FGFRs may serve as

important targets for therapeutic intervention for the treatment of CF.

iii

Acknowledgments

I would like to thank my supervisor, Dr. Daniela Rotin for providing me guidance and

encouragement throughout the Master‟s program. These experiences will definitely aid in my

future endeavors. I would also like to thank my committee members, Dr. Neil Sweezey and Dr.

Walid Houry, for their support and suggestions during the committee meetings.

I want to thank Dr. Agata Trzcinska-Daneluti, who is a mentor, a colleague, and a friend.

She not only performed the Cellomics studies, but also provided me with helpful suggestions

throughout the project. I want to thank Dr. Chong Jiang for teaching me lab techniques as well as

ordering regents since I started in the lab and I want to thank Leo Nguyen for teaching me lab

techniques especially the Ussing chamber analysis. I also want to thank all of the lab members,

Avi, Chen, Ruth and Frozan who made my journey fulfilling and exciting. Finally, I want to

thank my friends and my family for supporting me throughout this time.

iv

I performed the majority of the work presented in this thesis. However, the kinome

esiRNA screen as well as its validation with the Cellomics assay was performed by Dr. Agata

Trzcinska-Daneluti (Figure 3.1,3.2). Knockdown efficiency of the shRNA constructs was

determined by Leo Nguyen (Table A1). The saliva secretion assay was performed by Dr. Chong

Jiang and the intestinal organoids experiments were performed by Ryan Murchie (Figure 3.8).

Most of the work in this thesis was published in the journal Molecular Cell Proteomics under the

title „RNA interference screen to identify kinases that suppress rescue of deltaF508-CFTR.”

where I am sharing a co-first authorship with Dr. Agata Trzcinska-Daneluti.

v

Table of Contents

Abstract ........................................................................................................................................... ii

Acknowledgments .......................................................................................................................... iii

List of Tables ............................................................................................................................... viii

List of Figures ................................................................................................................................ ix

Abbreviations ................................................................................................................................. xi

Chapter 1 : INTRODUCTION .................................................................................................... 1

1. Introduction ................................................................................................................................ 1

1.1 Cystic Fibrosis .................................................................................................................... 1

1.2 CFTR and CF causing mutations ........................................................................................ 5

1.2.1 CFTR structure ........................................................................................................ 5

1.2.2 Channel gating of CFTR by ATP hydrolysis .......................................................... 8

1.2.3 CFTR regulation by phosphorylation ................................................................... 10

1.2.4 CF causing mutations ............................................................................................ 11

1.2.5 ∆F508-CFTR ......................................................................................................... 13

1.3 Chaperone systems involved in the processing of CFTR ................................................. 16

1.3.1 ER-associated and cytosolic chaperone systems .................................................. 16

1.3.2 Peripheral chaperone systems ............................................................................... 18

1.4 Screens to identify correctors of ∆F508 CFTR ................................................................. 20

1.4.1 High-throughput screens for correctors of ΔF508-CFTR ..................................... 20

1.4.2 Discovery of VX-809 and VX-770 and their clinical trials .................................. 21

1.4.3 Our screens using high-content halide exchange (Cellomics) assays ................... 21

1.5 Kinases and FGFR signaling ............................................................................................ 25

1.5.1 Kinases .................................................................................................................. 25

1.5.2 FGFR signaling ..................................................................................................... 25

1.5.3 MAP Kinase Pathway and chaperones ................................................................. 27

vi

1.6 Project Rationale and goals ............................................................................................... 29

Chapter 2 : MATERIALS AND METHODS ........................................................................... 30

2. Methodology ............................................................................................................................ 30

2.1 Media and Reagents .......................................................................................................... 30

2.2 Cells .................................................................................................................................. 30

2.3 Cellomics YFP Halide Exchange Screen .......................................................................... 31

2.3.1 shRNA Knockdown and qPCR quantification of knockdown ............................. 32

2.3.2 Cellomics shRNA analysis ................................................................................... 32

2.3.3 Combination drug treatment ................................................................................. 33

2.4 Immunoblotting ................................................................................................................. 33

2.5 ELISA assay ...................................................................................................................... 33

2.6 Short-circuit Current (Isc) Measurements in Ussing Chambers ....................................... 34

2.7 Salivary Secretion Assay (SSA) ....................................................................................... 34

2.8 Intestinal Organoids Experiments ..................................................................................... 35

2.9 Chaperone array ................................................................................................................ 35

2.10 Validation of Chaperone Array Hits ................................................................................. 35

2.11 HSF1 experiments ............................................................................................................. 36

Chapter 3 : RESULTS ................................................................................................................ 37

3. Results ...................................................................................................................................... 37

3.1 Kinome esiRNA screen for identifying suppressors of rescue of ∆F508-CFTR .............. 37

3.2 Validation of top hits of esiRNA screen with shRNA ...................................................... 42

3.2.1 Immunoblotting for the mature (band C) ∆F508-CFTR ....................................... 47

3.2.2 Cell surface appearance of ∆F508 analyzed by ELISA ........................................ 50

3.2.3 Ussing chamber analysis to measure function of rescued ∆F508-CFTR ............. 52

3.3 FGFR mediated inhibition of rescue of ∆F508-CFTR ..................................................... 55

3.3.1 shRNA knockdown of FGFRs and selected downstream effectors. ..................... 55

vii

3.3.2 SU5402 partially rescues ∆F508-CFTR in mice .................................................. 59

3.3.3 SU5402 mediated rescue of ∆F508-CFTR in nasal cells from CF patients ......... 62

3.4 Identifying the chaperones involved in rescue of ∆F508-CFTR downstream of FGFR inhibitor ............................................................................................................................. 65

3.4.1 Change in chaperone expression level upon SU5402 treatment ........................... 65

3.4.2 Validation of the top hits from the chaperone array ............................................. 69

3.5 Combination drug treatment ............................................................................................. 73

Chapter 4: DISCUSSION ........................................................................................................... 78

4. Discussion ................................................................................................................................ 78

4.1 Identification of Kinases and Associated Signaling Proteins that Suppress Rescue of

∆F508-CFTR ..................................................................................................................... 78

4.2 FGFR signaling plays an important role in the maturation of ∆F508-CFTR ................... 80

5. FUTURE DIRECTIONS ....................................................................................................... 85

5.1 Investigate the role of specific chaperones/chaperonins in rescue of ∆F508-CFTR ........ 85

5.2 Investigate the role of specific kinases in rescue of ∆F508-CFTR ................................... 85

5.3 Test the effect of FGFR (and other kinase inhibitors) on rescue of ΔF508 in samples

from ∆F508/∆F508 patients. ............................................................................................. 86

6. SUMMARY ............................................................................................................................ 87

7. CONCLUSION ....................................................................................................................... 88

REFERENCES ............................................................................................................................ 89

Appendix ..................................................................................................................................... 101

viii

List of Tables

Table 1: Results of the esiRNA screen 40

Table 2. Validation of the hits by the halide-exchange assay 45

Table 3: Top Up- or Down -regulated chaperones following SU5402 treatment of

F508/F508-CFTR HBE cells 68

Table 4: Rescue of ∆F508-CFTR in cells treated with VX-809 and FGFR inhibitors analyzed

with the Cellomics assay 76

Table 5. Cellomics data for ∆F508-CFTR cells treated with VX-770 and SU5402 77

Table A1. Knockdown efficiency of shRNA clones that were used to validate the esiRNA

kinome screen. 100

Table A2: Extent of knockdown of shRNA clones for the down-regulated chaperones used in the

ELISA assay 106

ix

List of Figures

Figure 1.1: Pulmonary pathogenesis in cystic fibrosis 4

Figure 1.2: CFTR schematic diagram and homology model. 7

Figure 1.3: Schematic diagram of the opening and closing of CFTR by ATP 9

Figure 1.4: Overview of CFTR mutations 12

Figure 1.5: ΔF508-CFTR trafficking and folding defects 15

Figure 1.6: Overview of the chaperone system that is involved in the trafficking of CFTR 19

Figure 1.7: Overview of the Cellomics assay 24

Figure 1.8: Overview of FGFR1 signaling 26

Figure 1.9: Activation of HSF1 28

Figure 3.1: Representative hits of the kinome esiRNA screen 39

Figure 3.2: Effect of shRNA-mediated knockdown of the suppressor genes on ∆F508-CFTR

channel activity 44

Figure 3.3: Effect of shRNA-mediated knockdown of the hit genes on maturation of ∆F508-

CFTR 49

Figure 3.4: Effect of shRNA-mediated knockdown of the hit genes on surface expression of

∆F508-CFTR 51

Figure 3.5: Effect of kinase knockdown on ΔF508-CFTR channel activity in polarized MDCK

cells stably expressing ΔF508-CFTR 54

Figure 3.6: Correction of the ∆F508-CFTR defect following knockdown of FGF receptors and

downstream signaling proteins 57

x

Figure 3.7: Effect of shRNA-mediated knockdown of FGFRs and selected downstream effectors

on surface expression of ∆F508-CFTR. 58

Figure 3.8: Rescue of ΔF508-CFTR in ΔF508/ΔF508 CF mice or intestinal organoids from these

mice. 61

Figure 3.9: Rescue of ΔF508-CFTR in CF patient nasal cells 64

Figure 3.10: Chaperone expression analysis following FGFR inhibition by SU5402 67

Figure 3.11: Validation of chaperone hits 71

Figure 3.12: Effect of mutant HSF1 on cell surface expression of ∆F508-CFTR in HEK293-GT

cells stably expressing ∆F508-CFTR-3HA 72

Figure 3.13: Rescue of ∆F508-CFTR in cells treated with VX-809 and FGFR inhibitors 74

Figure 3.14: Cellomics data for ∆F508-CFTR cells treated with VX-770 and SU5402 75

Figure 4.1: Current model explaining how inhibition of FGFR via SU5402 leads to rescue of

∆F508-CFTR 84

xi

Abbreviations

ΔF508-CFTR deletion of phenylalanine at position 508 in CFTR

ΔIsc difference in maximal stimulated current

HEK293-GT genetically engineered HEK 293 cell line expressing the human macrophage

scavenger receptor

5% Blotto 5% dry milk made with PBST

ABC adenine nucleotide-binding cassette

ASL airway surface liquid

ATP adenosine triphosphate

BHK baby hamster kidney cell

CAMK2B calcium/calmodulin-dependent protein kinase II beta

cAMP cyclic adenosine monophosphate

CF cystic fibrosis

CFTR cystic fibrosis transmembrane conductance regulator

CHIP carboxyl terminus of Hsc70 interacting protein

CK2 casein kinase 2

CL4 cytoplasmic loop 4

Corr-4a corrector 4a

DMEM Dulbecco‟s Modified Eagle‟s Medium

DMSO dimethyl sulfoxide

xii

DNA deoxyribonucleic acid

DNDS 4,4-dinitrostilbene-2,2- disulfonic acid

ECL enhanced chemiluminescence

ENaC epithelial sodium channel

ER endoplasmic reticulum

ERAD ER-associated degradation

ERK extracellular signal-regulated kinase

esiRNA endonuclease-prepared siRNA

FBS fetal bovine serum

FGFR fibroblast growth factor receptor

FIG mixture of forskolin, IBMX, Genistein

FRS2α fibroblast growth factor receptor substrate 2

G551D-CFTR glycine to aspartic acid substitution mutation at position 551 in CFTR

GFP green fluorescent protein

Gly GlyH-101

Gsk3β glycogen synthase kinase 3 beta

HA hemagglutinin

HBE human bronchial epithelial

HBSS Hank‟s balanced salt solution

Hdj human DnaJ homologue

xiii

HEK human embryonic kidney cell

HRP horseradish peroxidase

Hsc heat shock cognate protein

HSF1 heat shock factor 1

Hsp heat shock protein

HTS high-throughput screen

IBMX 3-isobutyl-1-methylxanthine

ICD intracellular domain

ICL intracellular coupling loop

IPMK inositol polyphosphate multikinase

Isc short-circuit current

JNK c-Jun N-terminal kinase

LPS lipopolysaccharide

MAP3K mitogen-activated protein kinase kinase kinase

MDCK Madin-Darby canine kidney epithelial cell

MEK MAPK/ERK kinase

MSD membrane-spanning domain

mTOR mammalian target or rapamycine

NAS nonsense-associated alternative splicing

NBD nucleotide-binding domain

xiv

NFκB nuclear factor kappa-light-chain-enhancer of activated B cell

PAL mixture of pepstatin, aprotinin, and leucine

PBS phosphate buffered saline

PBST phosphate buffered saline with Tween 20

PI3K phosphoinositide 3 kinase

PKA protein kinase A

PKC protein kinase C

PLCγ Phospholipase C-gamma

PMSF phenylmethylsulfonyl fluoride

PRKAR2B cAMP-dependent protein kinase type II-beta regulatory subunit

R region regulatory region

RNA ribonucleic acid

RNAi RNA interference

RPS6KC1 ribosomal protein S6 kinase delta-1

RTK receptor tyrosine kinase

RT-qPCR quantitative real time polymerase chain reaction

SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis

shRNA small/short hairpin RNA

siRNA small-interfering RNA xvii

STAT1 signal transducer and activator of transcription 1

xv

SUMO small ubiquitin-like modifier

TAK TGF-beta activated kinase

TMB 3,3',5,5'-Tetramethylbenzidine

WT-CFTR wild-type CFTR

YFP yellow fluorescent protein

1

Chapter 1 : INTRODUCTION

1. Introduction

1.1 Cystic Fibrosis

Cystic Fibrosis (CF) is an autosomal recessive disorder that is caused by lack of

functional cystic fibrosis transmembrane conductance regulator (CFTR) proteins at the apical

surface of secretory epithelia (Ratjen and Döring 2003). As the only known ABC transporter-

class ion channel, CFTR not only functions as an anion channel, it also regulates other channels

such as the Epithelial Na+ Channel (ENaC) (Stutts et al. 1995), as well as bicarbonate transport

(Quinton 2010; Kim and Steward 2009). CF is associated with a wide range of defects in

secretory epithelia, and patients with CF exhibit abnormalities in the respiratory, gastrointestinal

and genitourinary system (Ratjen and Döring 2003). However, the most prominent changes are

observed in the airway, where reduction in chloride secretion coupled with increased sodium

absorption due to elevated activity of ENaC results in dehydration and thickening of airway

surface liquid (ASL) as seen in figure 1.1 (Boucher 2003). These changes impair the

mucociliary clearance of bacteria and lead to bacterial colonization and chronic infections of the

lung, which causes severe morbidity and ultimately death (Boucher 2003)

While several classes of mutation in CFTR have been identified to date, the most

common mutation among CF patients is the deletion of phenylalanine at position 508 (ΔF508) of

the CFTR protein (Kerem, et al. 1989). ΔF508-CFTR is a trafficking mutant that is prone to

aberrant folding where it is retained in the ER and unable to reach the plasma membrane (Cheng

et al. 1990). During biosynthesis, ΔF508-CFTR is recognized by the ER quality control system

(ERAD) and targeted for ubiquitin-dependent proteasomal degradation (Riordan 2008). Several

ER-associated chaperone complexes both in the cytoplasm and ER lumen are involved in the

folding or degradation of CFTR (Valentine et al. 2012). It has been shown that even when the

mutant protein is matured by low temperature rescue (27°C) and reaches the plasma membrane,

its cell surface stability is significantly reduced and it is sorted for lysosomal degradation

(Sharma et al. 2001). Studies have demonstrated that cell membrane chloride conductance can be

partially restored by maneuvers that correct or rescue ΔF508-CFTR biosynthetic processing,

2

thereby promoting its exit from the ER and targeting it to the cell surface (Wilke, et al. 2012;

Van Goor, et al. 2006). Interestingly, other studies have suggested that even partial correction as

low as 10-25% rescue of CFTR activity may be sufficient to at least partially restore airway

epithelial function (Zhang et al. 2009). However, to date, there are no effective correctors in the

clinic that can recue this trafficking defect.

3

Figure 1.1: Pulmonary pathogenesis in cystic fibrosis. In normal airways, the balance between

sodium absorption is mediated by ENaC and anion secretion is mediated by apical CFTR as well

as other anion channels. The balance between sodium absorption and anion secretion determines

the volume of the airway surface liquid (ASL). This process maintains the viscosity of the ASL

where effective mucus clearance occurs. Normally CFTR downregulates ENaC activity.

However, this process is absent in cystic fibrosis due to lack of functional CFTR. Thus, in cystic

fibrosis, reduction in chloride secretion coupled with increased sodium absorption due to

elevated activity of ENaC results in dehydration and thickening of ASL. This impedes mucus

clearance, which promotes accumulation of airway secretory products such as growth factors,

glycosaminoglycans (GAGs) and chemokines that promote inflammation. (Modified from

Frizzell and Pilewski 2004)

4

5

1.2 CFTR and CF causing mutations

1.2.1 CFTR structure

CFTR is a member of the adenine nucleotide-binding cassette (ABC) family of

transporters (Gadsby et al. 2006). ABC transporters utilize the energy of ATP binding and

hydrolysis to transport various substrates across cellular membranes (Jones and George 2004).

Although CFTR retains the core structure of other ABC transporter, it is the only known ABC

transporter that functions as a chloride channel (Kartner et al. 1991). CFTR is a glycoprotein

composed of 1480 amino acids. The protein consists of five domains: 2 membrane spanning

domains (MSD1, MSD2) each composed of six transmembrane segments, 2 nucleotide binding

domains (NBD1, NBD2), which possess a binding site for ATP, and a unique regulatory (R)

region (Riordan 2008). The two MSD domains form the anion pore of the channel while the

NBD domains play a role in the activation and inactivation of CFTR (Riordan 2008).

Phosphorylation of the R region controls the activity of the CFTR channel. To date, there are no

high resolution structures of the full length CFTR protein. Information from high resolution

structure of CFTR will allow us to understand the drug binding mechanism of the protein which

aids in the development of novel drugs to treat CF patients. A homology model has been built for

the full length CFTR based on the structure of the bacterial ABC transporter Savv1866, as shown

in figure 1.2 (Mornon et al. 2008).

6

Figure 1.2: CFTR schematic diagram and homology model. Panel A shows the schematic

diagram of CFTR, which consists of 2 membrane spanning domains (MSD), 2 nucleotide

binding domains (NBD) and a unique regulatory region (R). Panel B shows the homology model

of CFTR based on the bacterial ABC transporter Savv1866. The intracellular coupling helix/loop

(ICL) of the MSDs (ICL1, ICL2 of MSD1 and ICL3, ICL4 of MSD2) provide the contacts with

NBDs to create the MSD/NBD interfaces (Modified from Lyczak et al. 2002 ; Mornon et al.

2008).

7

8

1.2.2 Channel gating of CFTR by ATP hydrolysis

Compared to other members of the ABC family, which use energy from ATP hydrolysis

for active transport, CFTR utilizes ATP to regulate the opening and closing of the channel.

Similar to other members of the ABC family, the hydrolysis rate of ATP is different between the

two NBD domains. The ATP in the binding site of NBD1 is very slowly hydrolyzed, while ATP

in the site of NBD2 readily undergoes hydrolysis (Aleksandrov et al. 2008). Opening of CFTR

requires cAMP/PKA-dependent phosphorylation of the R region followed by the binding of two

ATP molecules in NBD1 and NBD2 (Jih and Hwang 2012). When both ATP molecules are

bound to the NBDs, it induces dimerization of the NBDs in a head-to-tail fashion and leads to

opening of the channel (Jih and Hwang 2012). Channel closing is caused by ATP hydrolysis at

NBD2 and the subsequent release of ADP and Pi drives disassembly of the NBD dimer (Vergan

et al. 2005). The gating mechanism of CFTR by ATP is depicted in Figure 1.3.

9

Figure 1.3: Schematic diagram of the opening and closing of CFTR by ATP. ATP (yellow)

remains tightly bound to NBD1 (green). ATP binding to NBD2 (blue) is followed by a slow

channel opening step that proceeds through a transition state (square brackets) in which the

intramolecular NBD1–NBD2 tight heterodimer is formed but the transmembrane pore (grey

rectangles) has not yet opened. The open state becomes destabilized by hydrolysis of the ATP

bound at NBD2, which leads to disruption of the tight dimer interface where the channel closes.

(Modified from Gadsby et al. 2006)

10

1.2.3 CFTR regulation by phosphorylation

Unlike other ABC transporter proteins, CFTR possess a unique R region that harbors

multiple serine and threonine residues that can be phosphorylated by PKA (Seibert et al. 1999).

NMR studies have shown that the R region assumes a disordered structure where its

conformation as well as its interdomain interaction changes based on its phosphorylation state

(Baker et al. 2007). At its native state, the R region restrains channel activity and its inhibition is

released upon phosphorylation by PKA. Interestingly, partial deletion of the R region produces a

constitutively active channel (Ostedgaard et al. 2002). Moreover, channel opening of CFTR is

contingent upon PKA phosphorylation, whereby this phosphorylation increases channel activity

over 100-fold (Ostedgaard et al. 2001). Results from mutagenesis studies (Seibert et al. 1999), as

well as evidence of structural rearrangement of the R region upon phosphorylation (Dulhanty

and Riordan 1994) suggest that regulation of CFTR is dependent on the conformational change

of the R region. Even though the R region remains unstructured and disordered upon

phosphorylation, it has been shown to interact with other domains of CFTR. In particular, NMR

studies have shown that phosphorylation of the R region reduced interactions with NBD1, which

may play an important role in conferring the regulatory effect of the R domain on CFTR (Baker,

et al. 2007).

CFTR can also be phosphorylated by other kinases, most notably by PKC, to modulate its

activity. Phosphorylation by PKC is essential for acute activation of CFTR by PKA (Jia et al.

1997). However, the R region does not undergo conformational changes when phosphorylated by

PKC (Dulhanty and Riordan 1994). Although the exact mechanism of how PKC directly regulate

CFTR is unknown, it has been hypothesized that PKC phosphorylation facilitates subsequent

PKA phosphorylation by exposing sites that are otherwise inaccessible (Chang et al. 1993)

Aside from the phosphorylation of CFTR by PKA and PKC, phosphorylation by other

kinases has not been extensively studied. Studies by the Luz group have shown that Casein

kinase 2 (CK2), was able to regulate CFTR through direct phosphorylation, which affects both

channel conductance and trafficking of the protein to the plasma membrane (Luz et al. 2011).

Thus, the regulation of CFTR through phosphorylation has been shown to be a dynamic and

complex process. Future work is being done to elucidate the mechanism of how phosphorylation

11

affects CFTR activity and whether other kinases may play a role in regulating both channel

activity and trafficking of the protein.

1.2.4 CF causing mutations

To date, more than 2000 CFTR mutations have been identified

(www.genet.sickkids.on.ca/cftr). These mutations can be classified into six classes (De Boeck

2014). Class I mutations produce a stop codon leading to premature transcription termination

signals. These mutations result in truncated or no protein expression. Class II mutations are

usually missense mutations causing the protein to misfold, leading to premature degradation and

failure to reach the plasma membrane. The most common CF-causing mutation, ΔF508-CFTR, is

a class II mutation. Class III CFTR mutations fold properly and result in normal trafficking to the

cell surface; however, they suffer a defect in regulation, resulting in severely decreased channel

activity. An example for this class of mutation is the G551D substitution. This mutation is

located in the ATP binding site on NBD1 that results in defects in binding and hydrolysis of ATP

(Li et al. 1996). Class IV mutations result in reduced channel conductance due to lower chloride

permeability and opening probability. Class V mutations cause partly defective production or

processing of the protein, which results in a reduction in the number of functional channels.

Class VI mutations produce functional CFTR, but the protein is unstable at the cell surface and

undergoes rapid endocytosis and degradation (Figure 1.4) (De Boeck 2014).

http://www.genet.sickkids.on.ca/cftr

12

Figure 1.4: Overview of CFTR mutations. Class I, II, V and VI mutations reduce the quantity

of functional CFTR protein at the cell surface. Class III and IV mutations reduce the function of

CFTR at the cell surface. (Modified from De Boeck 2014)

13

1.2.5 ∆F508-CFTR

The most common mutation, identified in approximately 90% of CF patients, is the

deletion of phenylalanine at position 508 (∆F508) in NBD1 (Wang and Li 2014). ∆F508-CFTR

is primarily a class II mutation and is a folding-impaired mutant that is retained in the ER and is

defective in trafficking to the plasma membrane at 37º. Even when a very small amount of

∆F508-CFTR does reach the plasma membrane, it is unstable (Sharma, et al. 2001). The ∆F508

mutation lies in the interface between NBD1 and ICL4 of MSD2 (Mornon et al. 2008). This

mutation destabilizes the NBD1-MSD2 interface as well as the folding of NBD2 (Rabeh, et al.

2012; Du et al. 2005), which disrupts domain-domain interaction of CFTR that is essential for its

proper folding. As a result, the mutant is trapped in the endoplasmic reticulum (ER) and is

eventually targeted for degradation by the ERAD pathway and the proteasome (Riordan, 2008).

Recent studies suggest that fixing the ΔF508 defect requires correcting NBD1 stability and

NBD1:CL4 interactions (Rabeh et al. 2012).

The biosynthesis of CFTR starts at the ER where it is synthesized and acquires core

glycosylation. After exiting the ER, CFTR is processed in the Golgi apparatus where it acquires

complex glycosylation and is transported to the plasma membrane (Cheng, et al. 1990) (figure

1.5). Thus, when immunoblotting for CFTR, WT-CFTR appears as two bands, a prominent band C

around 180 kDa that represents the mature, fully glycosylated form of CFTR, and a minor band B

around 150 kDa that represents the core glycosylated, immature form. ΔF508-CFTR, which exhibits

impaired maturation, is observed mainly as band B. As a large transmembrane protein, WT-CFTR

exhibits inefficient folding and processing compared to other proteins, where up to 80% of the

WT-CFTR gets degraded in the ER (Lukacs et al.1994). This is, in part, due to slow domain

assembly of CFTR and fast degradation by ERAD (Lukacs and Verkman, 2012). In comparison,

99% of ΔF508-CFTR is degraded before some of it reaches the plasma membrane (Ward and

Kopito, 1994). As a result, little of ΔF508-CFTR reaches the plasma membrane. However,

ΔF508-CFTR can be rescued at low temperature and with chemical chaperones such as glycerol

(Denning, et al. 1992; Sato, et al. 1996). WT-CFTR has a half-life of about 16h on the plasma

membrane and is efficiently recycled back to the cell surface after internalization. On the other

hand, rescued ΔF508-CFTR is quickly removed from the plasma membrane with a half-life of

about 2h (Sharma et al. 2004; Swiatecka-Urban et al. 2005). Even when ΔF508-CFTR reaches

the plasma membrane, it only exhibits partial channel activity in response to PKA (Bear et al.,

14

1992). Thus, strategies to correct ∆F508-CFTR trafficking defects should not only aim at

promoting its trafficking to the plasma membrane, but also to improve its cell surface stability

and function. A possible strategy to correct the ∆F508-CFTR trafficking defect might be through

affecting the chaperones involved in the processing of CFTR. This strategy not only helps

∆F508-CFTR fold, but can also reduce its degradation.

15

Figure 1.5: ΔF508-CFTR trafficking and folding defects. ΔF508-CFTR belongs to class II

CF-causing mutations where the protein is misfolded, retained in the ER and acquires core

glycosylation. On the other hand, WT-CFTR can fold properly where it gets processed in the

Golgi apparatus and acquires complex glycosylation. WT-CFTR is then trafficked to the plasma

membrane as a functional chloride channel although its processing is also inefficient. (Modified

from Cravatt et al. 2007)

16

1.3 Chaperone systems involved in the processing of CFTR

In cells, degradation of misfolded protein is necessary to prevent the formation of large

aggregates, which are toxic to cells. However, when degradation occurs too rapidly, the protein

might not have sufficient time for proper folding. This is the case for CFTR, since

nonubiquinated CFTR intermediates do exist during its biosynthesis in the ER and requires time

for proper folding (Chanoux and Rubenstein 2012). In cells, CFTR biosynthesis is scrutinized at

multiple quality control checkpoints. This process is performed by complex systems of

chaperones such as the ER-associated chaperones as well as the peripheral quality control

systems at the plasma membrane (Lukacs and Verkman 2012). A summary of the chaperone

systems involved in CFTR trafficking and recycling is depicted in Figure 1.6.

1.3.1 ER-associated and cytosolic chaperone systems

The synthesis of CFTR is a complex process that is controlled by various chaperone

systems. CFTR biosynthesis is a very inefficient process due to its early folding steps where the

majority of CFTR is degraded in pre-Golgi compartments (Ward and Kopito 1994). In order for

CFTR to fold correctly, it requires not only the proper folding of individual domains, but also

appropriate domain-domain interactions and arrangements. The first step in the CFTR folding

process is the folding of the nascent chain protein, which is controlled by the ER-associated

chaperones, both membrane-bound and cytosolic (Chanoux and Rubenstein 2012).

1.3.1.1 Hsp70 and its co-chaperones

The Hsp70 heat shock protein family is a family of conserved and ubiquitously

expressed heat shock proteins. Hsp/Hsc70s are one of the first chaperones described to bind to

the nascent CFTR chain and to mediate its folding cotranslationally (Yang, et al. 1993).

Although Hsp/Hsc70 serves to help proteins fold, later studies have shown that they can facilitate

both the folding and degradation of CFTR nascent chains depending on its association with other

co-chaperones (Meacham et al. 1999; Meacham et al. 2001). As a member of the chaperone/co-

chaperone DNAJ family, Hdj-2 forms a complex with Hsc/Hsp70, which binds to and promotes

folding of the ribosomal-bound intermediates CFTR during translation of NBD1 (Meacham et

al., 1999). During translation of the R region and MSDII, the binding of the Hdj-2/Hsc70

http://en.wikipedia.org/wiki/Heat_shock_protein

17

complex diminishes greatly. Thus, it has been hypothesized that the Hdj-2/Hsc70 complex

preferentially binds to ΔF508-CFTR and prevents the aggregation of NBD1.

Depending on the co-chaperones associated with Hsp70, the chaperone complex can also

target the partially folded polypeptide chain for degradation. An example is the C-terminus of the

Hsc70-Interacting protein (CHIP), which is another co-chaperone that can form a complex with

Hsc/Hsp70 (Meacham et al. 2001). However, unlike the Hdj-2-Hsp70 complex, the CHIP-Hsp70

complex senses the folded state of the nascent chain of CFTR and targets aberrant proteins for

degradation via the proteasome (Meacham et al. 2001). CHIP acts as an E3 ligase in cooperation

with the E2 UbcH5a, which facilitates the degradation of nascent CFTR chains (Younger et al.

2004)

1.3.1.2 ER membrane-bound and luminal chaperones

Besides the CHIP/Hsc70 complex that targets CFTR for degradation, another ER

membrane-associated ubiquitin ligase complex, consisting of the E3 RMA1, the E2 Ubc6E, and

Derlin-1, can also recognize folding defects of CFTR during the synthesis of MSD1, and target it

for degradation (Younger et al. 2006). The mechanism of action for this RMA1 complex

involves Derlin-1, an ER membrane protein, which senses the folding status of MSD1/2 and

forms a complex with misfolded CFTR. Following complex formation, Derlin-1 recruits RMA1

and Ubc6e to facilitate ubiquitination and degradation of CFTR (Younger et al. 2006).

The role of ER luminal chaperones such as calnexin on folding of CFTR is poorly

understood (Chanoux and Rubenstein 2012). Calnexin was initially thought to bind to immature

CFTR and retain ΔF508-CFTR in the ER (Pind et al. 1994). However, other studies have shown

that calnexin has a positive regulatory role in the synthesis of ΔF508-CFTR. Overexpression of

calnexin created a pool of ΔF508-CFTR and reduced the degradation and aggregation of the

mutant protein (Okiyoneda et al. 2004). Moreover, knocking down calnexin did not seem to

improve the trafficking of ΔF508-CFTR (Okiyoneda et al. 2008). The role of calnexin is

controversial, but combined data from various studies suggests that calnexin alone is not

sufficient for the retention of ΔF508-CFTR in the ER.

18

1.3.1.3 Hsp90

Another chaperone associated with CFTR maturation that is widely studied is Hsp90,

which is shown to stabilize CFTR folding intermediates (Loo, et al. 1998). Similar to Hsp70, the

activity of Hsp90 depends on the presence of its co-chaperones. Hsp90 cochaperone Aha1 was

shown to down-regulate the rescue of misfolded CFTR and accordingly, knockdown of Aha1 led

to rescue of ΔF508-CFTR (Wang et al. 2006). Other cochaperones of Hsp90 such as p23 were

found to mediate the folding of ΔF508-CFTR by stabilizing the mutant and prevent its

degradation (Wang, et al. 2006).

1.3.2 Peripheral chaperone systems

One of the defects of rescued ΔF508-CFTR is its instability at the plasma membrane

(Lukacs 1993). The instability of the protein is due to the peripheral chaperone systems that

rapidly degrade the protein (Okiyoneda et al. 2010). In fact, many of the chaperones that are a

part of the ER control machinery also belong to the peripheral chaperone system (Okiyoneda et

al. 2010). CHIP was found to be the main E3 ligase responsible for the ubiquitination of rescued

ΔF508-CFTR (Okiyoneda et al. 2010). Knocking down CHIP reduced the internalization of

mutant CFTR and restored its recycling. Moreover, Hsp70, Hsp90 and a subset of their

cochaperones such as Aha1, Hdj-2, and BAG-1 were also identified to be part of the peripheral

quality control machinery that participates in the degradation of the rescued mutant. Thus, the

peripheral protein quality-control mechanism most likely participates in the preservation of

cellular homeostasis by degrading damaged plasma membrane proteins that have escaped from

the endoplasmic reticulum quality control. The studies of these chaperones systems suggest a

different therapeutic approach to correct the trafficking defects of ΔF508-CFTR. In addition to

focusing on rescuing ΔF508-CFTR itself, manipulating the chaperones involved in the

processing of CFTR might also serve to rescue the mutant.

19

Figure 1.6: Overview of the chaperone system that is involved in the trafficking of CFTR.

As CFTR is synthesized, numerous chaperones and co-chaperones binds to it. Depending on its

co-chaperone, Hsp70 and Hsp90 can both fold or degrade CFTR. Failure to achieve productive

folding at any step in the folding pathway is detected by persistent binding of Hsp70, which

serves to recruit E3 ligases (i.e., RMA1 and CHIP) that ubiquitinate CFTR and target it to the

26S proteasome. (Modified from Kim 2012)

20

1.4 Screens to identify correctors of ∆F508 CFTR

The ∆F508 defect can be partially corrected by treating cells expressing ΔF508-CFTR at

low temperature or chemical chaperones, such as glycerol, leading to some cell surface

expression of the mutant (Denning et al., 1992; Sato et al., 1996). Moreover, it was suggested

that that even partial correction as low as 10-25% rescue of CFTR activity may be sufficient to at

least partially restore airway epithelial function (Zhang et al. 2009). Thus, several groups have

developed high-throughput screens to identify small molecules that can correct the

folding/trafficking defect of ∆F508.

1.4.1 High-throughput screens for correctors of ΔF508-CFTR

High-throughput screens (HTSs) of large libraries of compounds using functional or

biochemical cell-based assays have been the most commonly utilized screens to identify

correctors for ΔF508-CFTR. In these assays, rescue of the mutant is indicated by either an

increase in anion transport or the appearance of the protein at the cell surface (Pedemonte et al.

2012). However, these screens provide little information regarding the mechanism of action of

the compounds on rescue of the mutant. Nevertheless, utilization of these HTS proved fruitful,

as it identified a number of compounds that could be used to correct CF defects. These CF drugs

can be divided into two different types: correctors, which correct the trafficking defect of ΔF508-

CFTR, and potentiators, which increase channel activity as in the case of G551D-CFTR.

The first HTS was performed by the Verkman group, where they screened a library of

150,000 chemically diverse compounds followed by a secondary screen of 1,500 analogs of the

active compounds (Pedemonte et al. 2005). Through the screen, bithiazole corr-4a was shown to

partially rescue ΔF508 function in primary human airway epithelial cells obtained from ΔF508

homozygous CF patients. Following the success of the first screens conducted by the Verkman

group, several other groups have utilized HTS to identify other correctors of ΔF508-CFTR. For

example, the FDA approved drug sildenafil that showed some rescue of ΔF508 was identified by

screening a library of 42,000 compounds (Robert et al. 2008). Following its identification,

sildenafil was shown to have a dual effect on the mutant protein as it worked both as a corrector

and potentiator of ΔF508-CFTR (Leier et al. 2012). However, the high doses of the drug required

for the rescue of CFTR are detrimental, thus limiting its use in the clinic. To date, many groups

continue to use HTS to identify new ΔF508-CFTR correctors.

21

1.4.2 Discovery of VX-809 and VX-770 and their clinical trials

The most successful screen so far was performed by Vertex Pharmaceuticals, which

identified several compounds in the quinazolinone class acting primarily at the ER level to

facilitate folding of the protein (Van Goor et al. 2006). This screen has led to further discovery of

some very promising drugs such as the corrector VX-809 (Van Goor et al. 2011) and the

potentiator VX-770 (Van Goor 2009). VX-770 is currently being used in the clinic for the

treatment of CF patients bearing the G551D mutation, which affects channel gating activity

(Ramsey et al. 2011). Unfortunately, VX-809 was not as successful as VX-770. Although VX-

809 demonstrated a 25% rescue of ΔF508-CFTR in primary airway epithelial cells, its efficacy

was limited in improving lung function of CF patients (Clancy et al. 2012). However, a

combination of VX-809 (Lumacaftor) and VX-770 (Ivacaftor) did yield a small improvement

(http://investors.vrtx.com/releasedetail.cfm?ReleaseID=856185). Unfortunately, recent studies

showed that VX-770 destabilizes cell surface ∆F508 rescued with VX-809 (Cholon et al. 2014,

Veit et al. 2014). This disappointing result underscores the need to not only identify more

effective correctors of ∆F508, but to also ensure that drug combinations do not adversely affect

each other.

1.4.3 Our screens using high-content halide exchange (Cellomics) assays

As stated above, most of the HTS performed by various groups have focused on

identifying compounds that rescue the mutant CFTR without understanding their mechanism of

action. Taking a different approach, our lab developed a high-content functional screen using the

Cellomics KineticScan technology (halide exchange assays) aiming at identifying proteins and

small molecules (and the pathways in which they participate) that correct the trafficking defect of

ΔF508-CFTR (Trzcinska-Daneluti et al. 2009, Trzcinska-Daneluti et al. 2012). Moreover, we

chose a drug-repurposing approach where the small molecules chosen (kinase inhibitors) for our

screens are already in the clinic or in clinical trials for the treatment of other diseases, such as

cancer or inflammation (Trzcinska-Daneluti et al. 2012). In this screen, our lab utilized human

HEK293-GT cells that stably express ΔF508-CFTR and a mutant YFP, YFP(H148Q/I152L)

whose fluorescent signal can be quenched by halide exchange (I− for Cl−) (Galietta et al. 2001).

When the cells are exposed to high iodide/ low chloride media and stimulated with FIG

(Forskolin/IBMX/Genistein), which activates CFTR, the Cl−/I

− exchange via CFTR leads to

22

quenching in fluorescent signal. In the absence of functional CFTR on the plasma membrane,

minimal quenching of fluorescent signal is observed. Thus, the quenching of fluorescent signal

serves to indicate the level of CFTR activity (Figure 1.7). This approach proved fruitful as our

lab identified several proteins that when overexpressed rescue the function of ΔF508-CFTR.

Among the hits were several chaperones, signaling proteins and transcription factors. One of the

best hits identified was STAT1 (Signal Transducer and Activator of Transcription 1) as well as

FGFR1 (Trzcinska-Daneluti et al. 2009). Knocking down of PIAS1, an inhibitor of STAT1, also

rescued ΔF508-CFTR, further supporting our findings. Moreover, this screen is capable of

identifying small molecules that can rescue ΔF508-CFTR function and we identified multiple

kinase inhibitors that can rescue this mutant (Trzcinska-Daneluti et al. 2012). Thus, an advantage

of our screen is that when we focus on identifying proteins that rescue the mutant, we can

identify the pathways that are involved in the rescue of ΔF508-CFTR.

23

Figure 1.7: Overview of the Cellomics assay. The mutant YFP protein (H148Q/I152L), which

is expressed in HEK293-GT cells, is halide sensitive, and its fluorescence is quenched by iodide.

The assay is performed with HEK293-GT expressing the mutant YFP and either WT-CFTR or

ΔF508-CFTR. In cells expressing WT-CFTR channel exposed to high iodide/ low chloride

media and stimulated with FIG (Forskolin/IBMX/Genistein), the Cl−/I− exchange via CFTR leads

to quenching in fluorescent signal. In cells expressing ΔF508-CFTR, the quenching is

significantly less due to the absence of functional CFTR channel at the cell surface unless

rescued. Quenching in fluorescent signal indicates the level of CFTR activity.

24

25

1.5 Kinases and FGFR signaling

1.5.1 Kinases

Kinases are enzymes that phosphorylate their substrates by transferring a phosphate

group from a high energy molecule (such as ATP) to the substrate molecule through

phosphorylating them on their serine, threonine, tyrosine, or histidine residues (Lahiry et al.

2010). This change in the phosphorylation state of a molecule can affect its activity, reactivity,

and its ability to bind to other molecules. Thus, kinases are critical in cell signaling, protein

regulation, cellular transport, secretory processes, and countless other cellular pathways (Lahiry

et al. 2010). As a result of their key role in regulating cellular growth and metabolism, mutations

in kinases are often associated in cancer. Thus, efforts have been made to discover inhibitors of

these kinases in the treatment of certain types of cancer (Yadava et al. 2014).

1.5.2 FGFR signaling

Fibroblast Growth Factor (FGF) receptors are members of the receptor tyrosine kinase

(RTK) family. In humans, the FGFR family consists of 4 receptor genes encoding closely related

transmembrane RTKs (Turner and Grose 2010). They play critical roles in regulating cellular

differentiation, proliferation, animal development, angiogenesis and tissue regeneration. Ligand

(FGF) binding to FGFRs induces receptor dimerization, which activates its kinase activity and

auto phosphorylation of multiple cytoplasmic tyrosine residues. This phosphorylated site, in turn,

serves as binding sites for effector molecules such as FRS2α and PLCγ, which further activate

downstream signaling such as the PI3K/Akt pathway and Ras/Raf/Erk (MAP kinase pathways)

leading to cellular effects (Turner and Grose 2010). The major signal transduction pathways of

FGFR are depicted in figure 1.8.

26

Figure 1.8: Overview of FGFR1 signaling. FGFR1 regulates many downstream signaling

pathways. Some of the major downstream effectors of FGFR1 are Akt, FRS2α, PLCγ and

Erk1/Erk2. Proteins that are known to positively regulate signalling as well as negative

regulators are shown in blue or green and pink, respectively. (Modified from Turner and Grose

2010)

27

1.5.3 MAP Kinase Pathway and chaperones

The MAP kinases are a family of serine/threonine kinases that respond to a variety of

extracellular growth signals. Growth factors such as FGF are known to activate the MAPK

pathway. Activation of this pathway begins when a signaling molecule binds to the receptor such

as FGFR1 on the cell surface (Eswarakumar et al. 2005). This initiates a signaling cascade

whereby the Ras GTPase exchanges GDP for GTP, which can now activate MAP3K (Raf). In

turn MAP3K activates MAP2K, which activates MAPK (ERKs). ERKs can then activate

transcription factors leading to cellular effects (Seger et al. 1995). Relevant to my work,

activation of the MAPK pathway is known to suppress the activity of heat shock factor 1

(HSF1), which is a transcription factor that induces the expression of numerous heat shock

proteins such as Hsp70. (Pirkkala et al. 2001; Mendillo, et al. 2012). In cells, HSF1 exists as an

inactive monomer in the cytoplasm that is associated with multiple chaperones such as Hsp40,

Hsp70 and Hsp90. In response to stress, HSF1 trimerizes and translocates to the nucleus where

it binds to heat shock elements in the promoters of stress-responsive genes (Neef et al. 2011)

(Figure 1.9). Moreover, HSF1 can also be regulated by phosphorylation. ERK1/2 is known to

inhibit HSF1 by phosphorylating the protein at Ser307. This phosphorylation primes the protein

for a second phosphorylation on Ser303 by GSK3. The phosphorylation on Ser303 and Ser307

represses HSF1 function and inhibit subsequent expression of HSPs (Chu et al. 1996). As such,

defects in the MAP/ERK pathway are found in many cancers (Manzo-Merino et al. 2014). Many

compounds can inhibit the steps in the MAP/ERK pathway and are currently being investigated

as potential drugs for treating certain types of cancer. Such drugs include AZD0530, which is

currently being tested in a phase 2 clinical trial for the treatment of postmenopausal breast

cancer. Interestingly our lab showed that AZD0530 can rescue ∆F508-CFTR in cell culture,

suggesting the possibility that drugs targeting the same pathways can be used to treat CF

(Trzcinska-Daneluti et al. 2012).

28

Figure 1.9: Activation of HSF1. In the absence of cellular stress, HSF1 exists as an inactive

monomer in the cytoplasm. Its activity is repressed via the interaction of the chaperone proteins

HSP90, HSP70 and HSP40, as well as its phosphorylation on Ser303 and Ser307 residues. In

response to proteotoxic stress, HSF1 forms homotrimers and translocates to the nucleus to bind

to heat shock elements in the promoters of stress-responsive genes. (Modified from Neef et al.

2011)

29

1.6 Project Rationale and goals

Our group has developed a high content functional screen (Cellomics assay) aimed at

identifying proteins and small molecules that rescue the trafficking defect of ΔF508-CFTR.

Using this approach, our lab performed an esiRNA (RNA interference) kinome screen and a

complementary small molecule kinase inhibitors screen (using compounds already in the

clinic/clinical trials) in order to identify kinases that inhibit rescue of ΔF508-CFTR. By

identifying kinase suppressors of ΔF508-CFTR rescue, it is hoped that the signaling pathways

involved in rescue of ΔF508-CFTR can be identified. Most importantly, the identification of

kinases that inhibit rescue of ΔF508-CFTR allows for drug repurposing, which can expedite the

treatment of CF. In both complimentary kinome screens, we identified that inhibition of FGF

receptors (FGFRs) led to a substantial rescue of ∆F508-CFTR.

The goal of my project was to validate the top hits from the esiRNA kinome screen as

well as to identify the signaling pathway(s) and chaperones involved in FGFRs –mediated

inhibition of rescue of ΔF508-CFTR.

30

Chapter 2 : MATERIALS AND METHODS

2. Methodology

2.1 Media and Reagents

Dulbecco‟s Modified Eagle‟s Medium (DMEM), Dulbecco‟s Phosphate Buffered Saline (D-

PBS), Fetal Bovine Serum (FBS), trypsin, G418, blasticidin and zeocin were obtained from

Invitrogen. The mouse M3A7 anti-CFTR monoclonal antibody was purchased from Millipore,

the mouse HA.11 (16B12) monoclonal antibody was from Covance, the rabbit polyclonal anti-

vinculin antibody was from Abcam and SuperSignal West Femto Maximum Sensitivity kit was

from Pierce. The High Capacity cDNA Reverse Transcription kit was obtained from Applied

Biosystems, the Platinum® SYBR® Green qPCRSuperMix-UDG was from Invitrogen and the

SA-HRP was from eBioscience. The kinome RNA interference (esiRNA) library was kindly

provided by Dr. Laurence Pelletier (The Samuel Lunenfeld Research Institute). shRNA clones

were from the RNAi Consortium (TRC) (Moffat et al. 2006), Open Biosystems via The Hospital

for Sick Children and SIDNET/SPARC BioCentre. For the overexpressed chaperones, the entry

clones compatible with Gateway® system (Invitrogen) were obtained from SIDNET/ SPARC

BioCentre and PlasmID (The Dana-Farber/Harvard Cancer Center DNA Resource Core), and

were subsequently cloned into the destination vector, pcDNA3.1(eYFP H148Q/I152L). All

constructs were sequence verified.

2.2 Cells

HEK293-GT cells stably expressing ΔF508-CFTR or wild type CFTR (WT-CFTR) protein

were stably transfected with eYFP(H148Q/I152L) cDNA in pcDNA3.1/zeo vector using calcium

phosphate as described (Trzcinska-Daneluti et al. 2009). At 24 h post-transfection, the cells were

seeded onto 5 × 10 cm dishes at various densities and selected under 100 μg/ml Zeocin and

expanded. Expression of WT-CFTR or ΔF508-CFTR was validated by immunoblotting using

M3A7 anti-CFTR monoclonal antibodies. Expression of eYFP(H148Q/I152L) was validated by

fluorescent microscopy. HEK293-GT cells stably co-expressing eYFP(H148Q/I152L) and

ΔF508-CFTR or WT-CFTR protein were cultured in DMEM medium supplemented with 10%

FBS, 1× nonessential amino acids, 0.6 mg/ml G418, 10 μg/ml Blasticidin, and 50 μg/ml Zeocin,

31

at 37 °C, 5% CO2 in humidified atmosphere. The triple hemagglutinin (3HA) tag was cloned by

PCR based on the sequence used in BHK ΔF508-CFTR 3HA cell line (Carlile et al. 2007), and

inserted after Asn at position 901 (N901) in the fourth external loop of CFTR. The full length

CFTR bearing 3HA tag (wild type or ΔF508) was subsequently cloned into the pLVE/zeo vector.

The plasmids were then transfected into HEK293-GT using calcium phosphate precipitation. The

transfected cells were seeded at different concentrations to isolate individual colonies under

selection with 100 µg/ml zeocin. Individual clones were picked, expanded and WT-CFTR or

ΔF508-CFTR expression verified by immunoblotting. Madin Darby Canine Kidney (MDCK)

cells stably expressing ΔF508-CFTR protein were cultured in DMEM supplemented with 10%

FBS, 1×PenStrep and 5μg/ml Blasticidin at 37 °C, 5% CO2. Primary human bronchial epithelial

(HBE) cells from lung transplant patients homozygous for ΔF508-CFTR were kindly provided

by Dr. P. Karp at the University of Iowa Cell Culture Facility, and grown on collagen-coated

permeable millicell inserts (12 or 6.5 mm, Millipore). Nasal cells from CF patients were kindly

provided by Dr. Theo Moraes and Dr. Tanja Gonska and were grown on collagen coated

transwell inserts (0.4 µm pore size) at a density of 105 cells/cm2.

2.3 Cellomics YFP Halide Exchange Screen

The Cellomics halide-exchange assay was performed as described below. Briefly, 50,000

∆F508-CFTR cells (HEK293-GT cells stably co-expressing eYFP(H148Q/I152L) and ∆F508-

CFTR) per well were seeded in the 96-well plates. The next day the cells were transfected with

esiRNA duplexes from the library (final concentration 40 nM), luciferase (non-silencing

control), EG5 (transfection control) or AHA1 esiRNA (positive control), using Lipofectamine

2000. Medium was changed 6 h after transfection, and the cells were placed at 37oC, 5% CO2 for

72 h. The 96-well transfection protocol was optimized using EG5 (KIF11) esiRNA as a

transfection control. The transfection was considered successful if more than 80% of the EG5

control cells exhibited round-shape phenotype 72 h post-transfection. After 72 h of incubation,

the medium was replaced with 152 µl of chloride solution (137 mM NaCl, 2.7 mM KCl, 0.7 mM

CaCl2, 1.1 mM MgCl2, 1.5 mM KH2PO4, 8.1 mM Na2HPO4, pH 7.1), in the absence or presence

of FIG (25 µM Forskolin, 45 µM IBMX, 50 µM Genistein), at 37oC. After 20-min incubation, 92

μl of iodide buffer (137 mM NaI, 2.7 mM KCl, 0.7 mM CaCl2, 1.1 mM MgCl2, 1.5 mM

KH2PO4, 8.1 mM Na2HPO4, pH 7.1) was added (final I- concentration 52 mM). Using the

Cellomics KSR Reader (Thermo Fisher) and a modified Target Activation algorithm, objects

32

(individual cells or sometimes clusters of cells) were defined by eYFP(H148Q/I152L)

fluorescence intensity, and the fluorescence quenching over 24-s time course at 37oC, 5% CO2,

was recorded. Valid wells contained between 70 and 300 objects per field (single field per well).

Genes that displayed a difference in the YFP fluorescence intensity (between FIG-stimulated

sample and non-silencing control) lower than 0.09 were rejected after the first two runs of the

screen. This cut-off value equaled three times the standard deviation from the mean value of the

control (AHA1). The rest of the esiRNA duplexes (56 genes) were subjected to the third run of

the screen. Twenty top hits of the screen were subjected to further validation of ∆F508-CFTR

rescue by functional assay, immunoblotting and ELISA following shRNA-mediated knockdown.

2.3.1 shRNA Knockdown and qPCR quantification of knockdown

ΔF508-CFTR cells were transfected with target genes or luciferase (nonsilencing control)

shRNA constructs using Lipofectamine 2000, according to the manufacturer's instructions.

Medium was changed 6 h after transfection, and ΔF508-CFTR cells were placed at 37 °C, 5%

CO2. 48 h after transfection the cells were incubated with media containing Puromycin (5 μg/ml,

3 days). Knockdown was validated by two-step RT-qPCR. For the RT-qPCR experiment, total

RNA was isolated using the RNeasy 96 kit (Qiagen, Dorking, Surrey, UK), and cDNA was

prepared using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster

City, CA). Real time PCR reactions were performed using Platinum® SYBR® Green qPCR

SuperMix-UDG (Invitrogen) and CFX96 Real-Time System (BioRad). Primers were obtained

from Integrated DNA Technologies. For standard curves, real time PCR was performed on a five

fold dilution series DNA.

2.3.2 Cellomics shRNA analysis

∆F508-CFTR cells (stably expressing eYFP(H148Q/I152L)) were transfected with

shRNA constructs targeting the top twenty hit genes identified in the esiRNA screen or luciferase

(non-silencing control), using Lipofectamine 2000, according to the manufacturer‟s instructions.

Medium was changed 6 h after transfection and ∆F508-CFTR cells were placed at 37oC, 5%

CO2. 48 h after transfection the cells were incubated with media containing puromycin (5μg/ml,

3 days) and the Cellomics halide-exchange assay was performed as described above. A total

number of 133 shRNA clones was screened (multiple shRNA clones per gene) (appendix table

A1).

33

2.3.3 Combination drug treatment

For drug combination testing, 8x104 ∆F508-CFTR cells (i.e. HEK293-GT cells stably co-

expressing eYFP(H148Q/I152L) and ∆F508-CFTR) per well were seeded in 96-wells plates. The

next day, the cells were treated with SU5402+VX-809, AZD4547+VX-809 or SU5402+VX-770

with concentration ranging from 1M to 10M. The cells were incubated at 37°C, 5% CO2 for

48 hr, and then analyzed by the Cellomics halide-exchange assay, as described above.

2.4 Immunoblotting

∆F508-CFTR expressing cells were transfected with shRNA constructs (TRC) for the

identified genes or non-silencing (scrambled) control for 48 h at 37°C, or incubated for 48 h at

27°C (positive control). After transfection the cells were incubated with media containing

puromycin (5μg/ml, 3 days). ∆F508-CFTR cells were then rinsed in cold PBS and lysed in lysis

buffer (50mM Hepes pH7.5, 150mM NaCl, 1.5mM MgCl2, 1mM EGTA, 10% glycerol (v/v), 1%

Triton X-100 (v/v), 2 mM PMSF, 2x PAL(Pepstatin A, Aprotinin, Leupeptin,) inhibitors).

Proteins were resolved on SDS-PAGE, transferred to nitrocellulose membranes and

immunoblotted with anti-CFTR (M3A7, 1:1000) or anti-vinculin (1:2000) antibodies.

Membranes were washed with 5% Blotto, incubated with HRP-conjugated anti-mouse or anti-

rabbit antibodies (1:10000) and washed with PBST (PBS + 0.05% Tween). Signal was detected

with SuperSignal West Femto reagent.

2.5 ELISA assay

ΔF508-CFTR 3HA cells expressing triple HA tag at the ectodomain of ΔF508-CFTR were

biotinylated with 0.5 mg/ml biotin in PBS (15 min), washed with ice-cold PBS and lysed. To

capture CFTR or ΔF508-CFTR, 50 g of total lysate protein (per well) were incubated with anti-

HA antibody (1:400) in 96-well plate, for 2 h at 4°C. The plates were then washed with PBST

(PBS + 0.05% Tween) and SA-HRP (1:1000) was added in ELISA buffer (PBST + 0.5% BSA)

into each well (20 min). After washing, the plates were incubated with TMB substrate. The

reaction was stopped with 1N H2SO4 and the signal read at 450 nm.

34

2.6 Short-circuit Current (Isc) Measurements in Ussing Chambers

Cell inserts or Snapwells, seeded with MDCK, HBE cells or nasal cells and polarized were

mounted on an Ussing chamber apparatus (Physiological Instruments, San Diego, CA) and

studied under voltage clamp conditions. The buffer used in the assay composed of 1x Hank‟s

Balanced Salt Solution (HBSS) supplemented with 21mM of NaHCO3, 1.2mM of CaCl2, and

1.2mM of MgCl2.Prior to stimulation of CFTR, ENaC channels were inhibited with 10 μM

amiloride (Sigma), and non-CFTR chloride channels were blocked with 250 μM DNDS (4,4′-

dinitrostilbene-2,2′-disulfonate, Sigma). CFTR currents were then stimulated using FIG, and

after the indicated time (min) inhibited using 15–50 μM GlyH-101 (Gly). Data were recorded

and analyzed using Analyzer 2.1.3.

2.7 Salivary Secretion Assay (SSA)

The salivary secretion assay, described previously (Quinton et al. 2005), was modified as

follows. Male ΔF508 mice (CFTRtm1Eur

on a 129/FVB background) and their wild-type

littermates (kindly provided by Dr. C. Bear) 9-12 weeks of age were intra-peritoneally injected

with DMSO or SU5402 (dissolved in DMSO at the concentration of 6 mg/ml) at 25 mg/kg body

weight, every day for one week. The mice were weighed daily and the dosages adjusted

accordingly. The mice were then anaesthetized by inhaling isoflurane until the end of the

procedure. Cholinergic antagonist, atropine (1 mM, 50 µl) was subcutaneously injected into the

right mice cheek to block potential cholinergic stimulation of the salivary gland. A small strip of

filter paper was placed against the injected cheek, for 4 minutes. Isoprenaline (10 mM, 37.5 µl)

was subsequently injected in the same spot to stimulate an adrenergic secretion of saliva (time 0).

Filter strips (pre-weighed in an Eppendorf tube) were replaced every 5 minutes, over a period of

30 minutes. All 6 filter strips were weighed at the end of the collection and the results were

normalized relative to mg/g body weight. All animal work was done in accordance with

SickKids Institutional guidelines and approval of the Animal Care Committee.

35

2.8 Intestinal Organoids Experiments

Intestinal organoids derived from crypts isolated from the terminal ileum of ΔF508/ΔF508-

CFTR mice and wild-type littermates were generated and maintained in culture, as described

(Sato et al. 2011). For forskolin-induced swelling (FIS) experiments, organoids were seeded in

24-well tissue culture plates, pretreated with kinase inhibitors (SU5402, 10 µM) and/or VX-809

(3 µM), and stimulated with 5 µM forskolin, as outlined in (Dekkers, et al. 2003). FIS was

observed by brightfield live-cell microscopy with an automated xy-stage (Nikon TE-2000 with

Solent Scientific enclosure, 20x)

2.9 Chaperone array

Human Bronchial Epithelial (HBE) cells from ΔF508/ΔF508-CFTR patients (P2 cells) were

obtained from the University of Iowa Cell Culture Facility and grown on collagen-coated

permeable millicell inserts. The cells were treated with DMSO (control), 1 M or 10 M

SU5402 for 48 h prior to RNA extraction. Total RNA was extracted using the PureLink RNA

Mini Kit (Life technologies) and cDNA was synthesized from 1 g of mRNA using the High

capacity cDNA reverse transcription kit (Applied Bioscience) according to the manufacturer‟s

instructions. Array analysis was performed using the RT² Profiler™ PCR Array Human Heat

Shock Proteins & Chaperones kit (Qiagen). mRNA expression levels were determined relative to

actin, GAPDH and B2M using the ΔCt method. Changes in chaperone expression level relative

to DMSO control were determined using the ΔΔCt method (Livak and Schmittgen 2001). The

chaperone array experiment was performed 3 times and average values are shown in a heat map.

2.10 Validation of Chaperone Array Hits

Seventy thousand ∆F508-CFTR 3HA cells per well were seeded in a 6-well plate format. The

next day the cells were transfected with the clones for the analyzed chaperone genes (shRNA or

overexpression) or luciferase control, using PolyJet™ DNA In Vitro Transfection Reagent

according to the manufacturer‟s instructions. 48 hr post-transfection, the cells that were

transfected with shRNA were further incubated with media containing puromycin (5μg/ml, 3

days). The cells that were transfected with the chaperone overexpression clones were

biotinylated, and ELISA was performed as described above.

36

2.11 HSF1 experiments

The pcDNA3.1(eYFP H148Q/I152L) plasmid containing the wild type HSF1 was used to

construct a constitutively active mutant of HSF1 (Nakai et al. 2000) using site directed

mutagenesis consisting of one-step PCR using two overlapping internal primers at the mutagenic

site. The internal primers used were

5‟GAACGACAGTGGCTCAGCACATGGGCGCCCATCTTCCGTGGAC 3‟ and

5‟GTCCACGGAAGATGGGCGCCCATGTGCTGAGCCACTGTCGTTC 3‟. DNA sequencing

was performed to verify the constructs. Seventy thousand ∆F508-CFTR 3HA cells per well were

seeded in 6 well plate. The next day the cells were transfected with the eYFP constructs for wild

type HSF1 , mutant HSF1, or luciferase control using PolyJet™ DNA In Vitro Transfection

Reagent, according to the manufacturer‟s instructions. 48 hr post transfection, the cells were

biotinylated and ELISA was performed as described above.

37

Chapter 3 : RESULTS

3. Results

3.1 Kinome esiRNA screen for identifying suppressors of rescue of ∆F508-CFTR

Delineation of pathways and proteins that prevent rescue of ∆F508-CFTR is important for

the identification of drugs that target these pathways. Using the high-content functional screen

(Cellomics) that our lab previously developed (Trzcinska-Daneluti et al. 2009), a library of 759

esiRNAs targeting different kinases and associated proteins was used to knock down target genes

to identify kinases that suppress ΔF508-CFTR maturation. This kinome esiRNA screen also

servers to complement our previous kinase inhibitor screen that was published recently

(Trzcinska-Daneluti et al. 2012). In the current kinome esiRNA screen, HEK293-GT cells stably

co-expressing the Cl− sensitive eYFP (H148Q/I152L) mutant and ΔF508-CFTR (ΔF508-CFTR

cells) were transfected with esiRNA for 72h at 37oC. Cells were then stimulated for 20 minutes

using a mixture of Forskolin (25 μM)/IBMX (45 μM)/Genistein (50 μM) (FIG) and exposed to

low Cl-/high I

- solution. The quenching of fluorescence caused by Cl

-/I

- exchange by CFTR or its

mutant, was recorded and quantified over time. Figure 3.1 shows several representative “hit”

suppressors that when knocked down lead to varying degree of ∆F508-CFTR rescue. The top 20

suppressors that showed the strongest level in fluorescence quenching, ∆FIavg (between FIG

stimulated sample and FIG stimulated non-silencing control) is provided in table 1. Many of the

genes from the top “hit” list are involved in the Ras/Raf/MEK/Erk, PI3K/Akt, p38 or NFκB

signaling pathways.

38

Figure 3.1: Representative hits of the kinome esiRNA screen.

Average normalized fluorescence intensity (∆FIavg) values of ∆F508-CFTR cells (co-expressing

eYFP(H148Q/I152L)) that were transfected with esiRNA directed towards (A) FGFR1, (B)

RIPK4, (C) MET, (D) SHPK, (E) MAP3K13, (F), BRAF, (G) DUSP22, (H), CDK10, (I) IPMK,

or luciferase (non-silencing control), and grown at 37oC. After 72 h ∆F508-CFTR cells were

stimulated with FIG (25 µM Forskolin, 45 µM IBMX and 50 µM Genistein) and quenching of

YFP fluorescence due to Cl-/I- exchange was quantified by Cellomics KST Reader (70-300 cells

per well). (J) Quantitation of rescue (difference in average fluorescence intensity ∆FIavg) of

∆F508-CFTR at 24 s after adding iodide solution from 3 independent experiments (a single field

per well, 70-300 cells per field). Data are mean ± SEM. The fluorescence intensity was

normalized by subtracting the fluorescence intensity of the unstimulated sample from the

stimulated sample.

(Performed by Dr. Agata Trzcinska-Daneluti)

39

40

Table 1. Results of the esiRNA screen.

20 hit genes that displayed a difference in average fluorescence intensity ∆FIavg (between FIG-

stimulated sample and non-silencing control) of at least 9%. The cut-off value of 9% (0.09) was

chosen as it equals three times the standard deviation from the mean value of the control

(AHA1).

(Performed by Dr. Agata Trzcinska-Daneluti)

41

Gene name Protein name Accession

No.

Rescue (%)

RIPK4 Receptor-interacting serine/threonine-

protein kinase 4 P57078

22

SHPK Sedoheptulokinase Q9UHJ6 20

MAP3K13 Mitogen-activated protein kinase kinase

kinase 13 O43283

19

FGFR1 Fibroblast growth factor receptor 1 P11362 16

CDK10 Cyclin-dependent kinase 10 Q15131 16

RPS6KC1 Ribosomal protein S6 kinase delta-1 Q96S38 16

PANK4 Pantothenate kinase 4 Q9NVE7 14

DTYMK Thymidylate kinase P23919 14

ERN1 Serine/threonine-protein

kinase/endoribonuclease IRE1 O75460

14

BRAF Serine/threonine-protein kinase B-raf P15056 13

DUSP22 Dual specificity protein phosphatase 22 Q9NRW4 13

IPMK Inositol polyphosphate multikinase Q8NFU5 13

PCK2 Phosphoenolpyruvate carboxylase Q16822 13

CLK3 Dual specificity protein kinase CLK3 P49761 13

MET Tyrosine-protein kinase Met P08581 12

CAMK2B Calcium/calmodulin-dependent protein

kinase type II subunit beta Q13554

12

SOCS1 Suppressor of cytokine signaling 1 O15524 11

NEK10 Serine/threonine-protein kinase Nek10 Q6ZWH5 11

PRKAR2B cAMP-dependent protein kinase type II-

beta regulatory subunit P31323

9

PANK1 Pantothenate kinase 1 Q8TE04 9

42

3.2 Validation of top hits of esiRNA screen with shRNA

Since both the transfection and knockdown efficiency, as well as possible off target effects,

can influence the level of rescue in the esiRNA kinome screen, we decided to validate the top 20

hits from the esiRNA screen with another RNAi technology, shRNA. For this experiment, we

screened 133 TRC-shRNA clones targeting these top 20 “hit” genes (multiples clones for each

gene)(appendix table A1). These clones, or luciferase (non-silencing control), were transfected

into HEK293-GT cells stably expressing ΔF508-CFTR and the halide-sensitive YFP mutant and

were analyzed with the Cellomics assay. In parallel, qPCR was performed to determine the

knock-down efficiency of these constructs. In general, the degree of ∆F508-CFTR rescue

correlated with knockdown efficiency. In the case of MET and BRAF genes, cell death was

observed upon knockdown higher than 60-70% and therefore, shRNA clones that resulted in the

best rescue exhibited knockdown of 30% (B-Raf)-60% (MET). Figure 3.2 and table 2 shows the

results from the shRNA validation analysis using the Cellomics assay. The results from both the

esiRNA screen and the shRNA validation generally agree with each other and produced

reproducible rescue of ∆F508-CFTR function. Knockdown efficiency for all the shRNA clones

that were used for validating the esiRNA kinome screen is presented in appendix table A1.

43

Figure 3.2: Effect of shRNA-mediated knockdown of the suppressor genes on ∆F508-CFTR

channel activity. Average normalized fluorescence intensity of ∆F508-CFTR cells transfected

with shRNA for (A) FGFR1, (B) RIPK4, (C) MET, (D) SHPK, (E) MAP3K13, (F), BRAF, (G)

DUSP22, (H), CDK10, (I) IPMK, or luciferase (non-silencing control), and grown at 37oC. After

48 h ∆F508-CFTR cells were subjected to puromycin selection (3 days) and stimulated with FIG

(25 µM Forskolin, 45 µM IBMX and 50 µM Genistein). Quenching of YFP fluorescence during

Cl-/I

- exchange of 70-300 cells per field was recorded and quantified simultaneously by

Cellomics ArrayScan VTI. Multiple shRNA clones per gene were analyzed. One representative

shRNA clone is shown. KD, knockdown efficiency (%). (J) Quantitation of rescue (difference in

average fluorescence intensity ∆FIavg) of ∆F508-CFTR at 24 s after adding iodide solution. Data

are mean ± SEM from 2-3 independent experiments (3 fields per well, 70-300 cells per field).

Comparison of normalized average fluorescence intensity of ∆F508-CFTR versus WT-CFTR.

(Performed by Dr. Agata Trzcinska-Daneluti)

44

45

Table 2. Validation of the hits by the halide-exchange assay.

Hits were validated by functional assay (Cellomics). Rescue by the best shRNA clone and the

corresponding knockdown level are shown.

(Performed by Dr. Agata Trzcinska-Daneluti)

46

Gene name

Validation by Functional Assay (Cellomics)

Knockdown level

(%) Analyzed shRNA clones

Rescue by the best

shRNA clone (∆FIavg)

FGFR1 10 0.30 94

RIPK4 2 0.22 26

MET 17 0.16 61

SHPK 3 0.15 52

MAP3K13 4 0.15 65

BRAF 7 0.15 34

DUSP22 7 0.15 71

CDK10 6 0.14 87

IPMK 10 0.13 63

RPS6KC1 2 0.13 96

PRKAR2B 2 0.12 40

PANK4 15 0.12 80

SOCS1 5 0.12 N/A

PCK2 4 0.12 78

CAMK2B 3 0.09 85

DTYMK 10 0.09 88

ERN1 1 0.08 79

CLK3 8 0.08 64

NEK10 10 0.08 84

PANK1 7 0.06 79

47

3.2.1 Immunoblotting for the mature (band C) ∆F508-CFTR

To further validate the top 20 hits, we analyze the maturation of ∆F508-CFTR in

response to knockdown of the identified suppressors using immunoblotting for the mature (Band

C) protein. For this experiment, we obtained pGIPZ-shRNA (with GFP tag) constructs that were

used to knock down the target genes in HEK293-GT stably expressing ΔF508-CFTR. The

presence of a GFP tag allowed easy confirmation of transfection efficiency. Figure 3.3 shows the

results from the immunoblot experiment. The results show that most of the analyzed suppressor

genes led to at least 10% increase of band C/B ratio relative to non-silencing control, suggesting

that the top 20 hits normally suppress ∆F508-CFTR maturation.

48

Figure 3.3: Effect of shRNA-mediated knockdown of the hit genes on maturation of ∆F508-

CFTR. HEK293-GT cells stably expressing ∆F508-CFTR were transfected with shRNA for the

analyzed genes, or non-silencing control (as indicated), grown at 37oC for 48 h, selected on

puromycin, and the appearance of the mature protein (band C) was monitored by

immunoblotting. Band B represents the immature CFTR. Scrambled control, non-silencing

control; 27oC, temp. rescue of ∆F508-CFTR at 27

oC; WT CFTR, wild-type CFTR. The 27

oC and

WT CFTR lanes were loaded with half the amount of protein in comparison to other samples.

Top panels depict the anti-CFTR immunoblot, middle panels depict vinculin (loading) control.

The histogram depicts the quantitation of rescue (increase in the band C/B ratio) of ∆F508-CFTR

following shRNA-mediated knockdown. Data are mean ± SEM from 3 independent experiments.

49

50

3.2.2 Cell surface appearance of ∆F508 analyzed by ELISA

An ELISA assay was performed to demonstrate the appearance of ∆F508-CFTR at the

plasma membrane. For this assay, we generated a new HEK293-GT cell line that stably

expresses ∆F508-CFTR protein with a triple HA tag in the ectodomain (which does not disrupt

channel activity). For this experiment, we used pGIPZ-shRNA constructs that were used in the

immunoblotting experiment. The results from the ELISA experiments are shown in figure 3.4.

The ELISA assay showed varying degree of rescue of ∆F508-CFTR following shRNA

knockdown, revealing a prominent increase (approx. 50%) in the amount of surface ∆F508-

CFTR following knockdown of FGFR1 relative to control knockdown.

51

Figure 3.4: Effect of shRNA-mediated knockdown of the hit genes on surface expression of

∆F508-CFTR. HEK293-GT cells stably expressing ∆F508-CFTR (bearing 3xHA tag at the

ectodomain) were transfected with shRNA for the analyzed genes or non-silencing control (as

indicated), grown at 37ºC for 48 h, selected on puromycin, and quantitation of surface expression

of ∆F508-CFTR was carried out by an ELISA assay. SU5402 represents cells treated with 10µM

SU5402 and serves as a positive control. Data are mean ± SE from 3 independent experiments.

The absorbance absolute value at 450nm for the non-silencing control ranges from 0.35-0.48

absorbance unit.

* p < 0.05 (relative to non-silencing control)

52

3.2.3 Ussing chamber analysis to measure function of rescued ∆F508-CFTR

In order to validate the functional rescue of these kinase suppressors, functional assays

using short-circuit current (Isc) analyses by Ussing chambers were carried out in MDCK cells

stably expressing ∆F508-CFTR. Since MDCK cells are of dog origin, only 10 of the top 20 hit

genes have shRNA that are compatible between human and dog. As a result, 10 human-to-canine

compatible shRNA clones (CDK10, PANK1, PANK4, RPS6KC1, DUSP22, SOCS1, FGFR1,

CLK3, NEK10, BRAF, PCK2, IPMK) were transduced (via Lentiviral infection) into MDCK

cells stably expressing ∆F508-CFTR. Knockdown efficiency was measured by qPCR. PANK1,

PANK4 and NEK10 genes showed no expression in the MDCK cells, and the knockdown level

of 3 others (BRAF, PCK2, SOCS1) was negligible. The remaining genes (CDK10, RPS6KC1,

DUSP22, FGFR1, CLK3, IPMK) exhibited knockdown level of 39 – 86% and were subjected to

the short-circuit current (Isc) analysis in Ussing chambers. Three of the analyzed genes,

RPS6KC1, IPMK and CLK3, partially restored the ∆F508-CFTR function, as demonstrated by

an increase in short-circuit current (21% – 50%) (Figure 3.5). As MDCK cells exhibited an

increased sensitivity toward knockdown of CDK10, DUSP22 and FGFR1 (changes in

proliferation rate and/or cell morphology), we were unable to assess ∆F508-CFTR chloride

channel activity in the cells that expressed shRNAs for these genes.

53

Figure 3.5: Effect of kinase knockdown on ΔF508-CFTR channel activity in polarized

MDCK cells stably expressing ΔF508-CFTR. Representative short-circuit currents (Isc) in

MDCK cells stably expressing ΔF508-CFTR upon knockdown of (A) RPS6KC1, (B) CLK3 and

(C) IPMK. ENaC channels were inhibited with 10 µM amiloride and non-CFTR chloride

transporters were blocked with 250 µM DNDS. ΔF508-CFTR currents were stimulated with FIG

(25 µM Forskolin, 25 µM IBMX and 50 µM Genistein), and after the indicated time inhibit