DNA Transcription and Translation
Sections 12.3 and 12.4
Do Now
1. What is RNA
2. How does it differ from DNA?
3. What is protein?
Gene
Segment of DNA that codes for a protein
DNA codes for RNA and RNA makes protein
One Gene – One Enzyme The Beadle and Tatum experiment
showed that one gene codes for one enzyme.
One gene codes for one polypeptide.
polypeptide - a chain of covalently bonded amino acids.
(proteins are made of one or more polypeptide)
12.3 DNA, RNA, and Protein
Let’s make some observations about RNA’s structure
RNA
RNA stands for: Ribonucleic acid
RNA is found: Nucleus and Cytoplasm
RNA Structure
Like DNA, RNA is made up of subunits called _____________, which are made of three parts: Sugar (ribose) Phosphate Nitrogen Base
RNA’s Nitrogen Bases
Adenine (A) Cytosine (C) Guanine (G) Uracil (U)
There are 3 types of RNA: Messenger RNA (mRNA) Ribosomal RNA (rRNA) Transfer RNA (tRNA)
All RNA is …
Single stranded Many different shapes “Cheap copy” of DNA
Do Now
1. What is a protein made of?
2. Explain the process between DNA and proteins.
Transcription
First step in making proteins Process of taking one gene (DNA)
and converting into a mRNA strand DNA -> RNA Location:
Nucleus of the cell
Steps to Transcription
1. An enzyme attaches to the promoter (start signal region) of a gene and unwinds the DNA
Steps to Transcription (Cont.)
2. One strand acts as a template.
Steps to Transcription (Cont.)
3. A mRNA copy is made from the DNA template strand by RNA polymerase
4. A mRNA copy is made until it reaches the termination (stop signal) sequence
5. The two strands of DNA rejoin.
Template vs. Non Template Strand
Transcription animations
http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html
http://www.fed.cuhk.edu.hk/~johnson/teaching/genetics/animations/transcription.htm
Transcribe this DNA to mRNA
Think- Pair- Share 1. Where in the cell does transcription occur? 2. What nucleic acids are involved in the
process of transcription? 3. What is the importance of transcription? 4. In transcription, how come the whole DNA
molecule is not copied into mRNA? 5. How does one gene differ structurally from
another? 6. Because one gene differs from another, what
molecules in the cell will also be different?
mRNA Processing
Pre-mRNA – the original sequence of RNA created during transcription
mRNA reaches the ribosomes
RNA Processing
What is RNA Processing?
After transcription the pre-mRNA molecule undergoes processing 5’ cap is added Poly A tail is added to the 3’ end Introns are removed.
Do Now
Label the Transcription diagram
RNA Processing In Eukaryotes only Introns- non-coded sections Exons- codes for a protein Before RNA leaves the nucleus, introns are
removed and exons are spliced together A cap and poly A tail are added to ends of the
sequence mRNA leaves the nucleus through the nuclear
pores
Why is it necessary to add the poly A tail and 5’ cap?
Let’s try an activity (11.5)
http://www2.pearsonsuccessnet.com/snpapp/iText/products/0-13-115075-8/index.html
Pg. 339
Pg. 339
Let’s an example…
Original DNA Sequence (DNA): 5’ GTACTACATGCTATGCAT 3’ Translate it (RNA): 3’ CAUGAUGUACGAUACGUA 5’
Add the 5’ cap: 3’ CAUGAUGUACGAUACGUA 5’ cap
Finish the job!
Remove the introns “UGUA” and “AUAC”:3’ CAUGAUGUACGAUACGUA 5’ cap
3’ CAUGACGGUA 5’ cap
Add a poly A tail onto the 3’ end
3’ CAUGACGGUA 5’ capPoly A tail
Get a new partner!
DNA Strand of non-template strand:
5’ ATCGGTAGAGTATTTACAGATA 3’
Remove introns: CGGUA UUACAG
Think, Pair, Share
Take a minute think on your own, then pair with your partner, and share your ideas!
Evolutionary, why do you think there are introns?
Where did they come from? Why do we have them? Remember there is NO wrong answer!
PROTEINS!
Proteins are made up of amino acids!!!
Proteins are polymers of amino acids
Only 20 different amino acids BUT there are hundreds of thousands
of different proteins
How can this be?
Let’s compare to it to the English language How many letters are in the alphabet?A,b,c,d,…26 How many words are there?Miss, Ings, is, smart, .. Almost infinite! Each word has a unique structure of letters.
Similar to proteins and amino acids
Proteins- (PCFNa)
-made of 20 different Amino Acids
- Amino Acids bond to form polypeptide chains
How do amino acids form these peptide chains?
Peptide Bonds – Link each amino acids together to form proteins
How many amino acids are in a dipeptide chain?
How about a tripeptide chain?
How many water molecules are formed from 2 amino acids?
How many water molecules are formed from 100 amino acids?
Do Now Perform transcription on this DNA segment:
GCTTCATACGA
Do RNA processing and remove the introns: GAA and UGC
How does this mRNA sequence leave the nucleus?
Where does it go?
Protein
Structure
http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm
Translation
Production of proteins from mRNA mRNA goes to the ribosomes in the
cytoplasm or the RER and produces proteins
Steps to Translation 1. mRNA leaves the nucleus and
binds to a ribosome 2. the 5’ end of mRNA binds to
ribosome
Ribosome
Two subunits to the ribosome 3 grooves on the ribosome (A, P, E) A: tRNA binding site P: polypeptite bonding site E: exit site
Steps to Translation (Cont.)
3. Ribosome looks for the start Codon (AUG) Codon: group of 3 nucleotides on the
messenger RNA that specifies one amino acid (64 different codons)
Steps to Translation (Cont.)
4. Amino acids attached to a tRNA molecule and are brought over to the mRNA.
5. This tRNA has an anticodon that matches the codon on the mRNA strandAnticodon:
Group of 3 unpaired nucleotides on a tRNA strand. (binds to mRNA codon)
tRNA
Think-Pair-Share The mRNA sequence reads the following
codons: What amino acids do they stand for? AUG GGA GAG CAA
** What amino acid does the anticodon CGU stand for?***
Steps to Translation (Cont.)
6. tRNA binds to the mRNA sequence and adds an amino acid
7. Each amino acid matches up with 1-6 tRNA molecules
8. tRNA leaves and amino acids bond together through a polypeptide bond
Think – Pair - Share
Find the amino acid sequence for the following mRNA sequence (translation)
AUGCGACGAAUUUAA
Translation Animations
http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html
http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/translation.swf
Steps to Translation (Cont.)
9. The mRNA sequence continues until a stop codon is reached.
10. The amino acids disconnect from the mRNA sequence and a protein is formed.
Think-Pair-Share
Get with a partner, one partner transcribes and the other translates.
Do Now
Do transcription on this DNA sequence:
CGTACGCTCCCTAGACTA
Do Translation- Remember to start the right place!
Do Now
Do transcription on this DNA sequence:
TTTTATACTGAGGGTTAACTCGT
Do Translation- Remember to start the right place!
1. 2. 3.
4. 5. 6.
1. Initiation The two ribosomal subunits
come together with the mRNA and the first tRNA molecule which attaches to the start codon (AUG).
This is the only tRNA that will attach to the P site.
The first amino acid is always methionine.
2. Codon Recognition
The tRNA anticodon will hydrogen bind to the mRNA codon in the A site.
3. Bond Formation
The amino acid in the P site will form a peptide bond with the amino acid in the A site.
4. Translocation
The tRNA's and the mRNA move down one site. The empty tRNA is released from the exit site.
5. Repeat
This process will repeat hundreds of times.
6. Termination
Translation is terminated with the stop codon is reached. There are three different stop codons UGA, UAA, UAG.
The release factor recognizes the stop codon and releases the polypeptide strand. All the factors break apart and are reused.
Do Now Take the following amino acid
sequence, do reverse transcription and translation (find RNA and DNA).
Methionine, Arginine, Alanine, Serine, Tryptophan, Tyrosine, Leucine, Valine, stop
What do you notice about your DNA sequences?
Do Now
Template strand of DNA: 5’ TTACGGCTAGGAGTAGCCGAATTCTG
3’
Remove the introns: CUCAUC
Determine protein sequence
Do Now
How do cells know what protein to make when?
Gene Regulation: ability of an organism to control which genes are transcribed.
Controlling Transcription
Transcription factors ensure that a gene is used at the right time and that protein are made in the right amounts
The complex structure of eukaryotic DNA also regulate transcription.
HOX Genes
Everyone develops from a zygote Zygote undergoes mitosis Cell differentiation: cells
become specialized Certain gene sequences determine
cell differentiation
HOX Genes
Homeobox Genes (Hox Genes) are sequences of DNA
Hox genes are responsible for the general body pattern of most animals.
HOX Genes
Are transcribed at specific times, and located in specific places on the genome
Mutations:
Telephone
We are going to play the game telephone.
Every time a DNA makes a copy (spreading of a message), mutations can happen (mistakes in a message)
Mistakes in DNA
Cell make mistakes in replication, and transcription
Most often these mistakes are fixed
EX.
Mutations
A permanent change that occurs in a cell’s DNA is called a mutation.
Three types of mutations: Point mutation Insertion Deletion
Point Mutation
Substitution: A change in just one base pair Missense Mutation: amino acid is change Nonsense Mutation: amino acid is changed
to a stop codon
Frameshift Mutations Causes the reading
frame to shift to the left or the right
Insertion: Addition of a nucleotide
Deletion: Removal of a nucleotide
ACGAAATACAGACAT
Decide what type of mutation occurred:
ACGAAATAGAGACAT
ACAAATACAGACAT
ACGAAATACAGGACAT
Causes of Mutations Mutations can happen spontaneously Mutagens: Certain chemicals or
radiation that can cause DNA damage Causes bases to mispair and bond
with the wrong base High-energy forms of radiation, such
as X rays and gamma rays, are highly mutagenic.
Sex Cell vs. Somatic Cell Mutations
Somatic cell mutations are not passed on to the next generation.
Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring
Chromosomal Mutations
Piece of chromosome can be broken off, duplicated, or moved to another chromosome
Fragile X Syndrome
Repeat of CGG about 30 times
Causes mental and behavior impairments
Protein Folding and Stability
Substitutions also can lead to genetic disorders.
Ex. Sickle Cell Anemia (caused by a substitution mutation)
Can change both the folding and stability of the protein
Sickle Cell Anemia
Causes of Mutations Mutations can happen spontaneously Mutagens: Certain chemicals or
radiation that can cause DNA damage Causes bases to mispair and bond
with the wrong base High-energy forms of radiation, such
as X rays and gamma rays, are highly mutagenic.
Sex Cell vs. Somatic Cell Mutations
Somatic cell mutations are not passed on to the next generation.
Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring