DNA Transcription and Translation

Sections 12.3 and 12.4

Do Now

1. What is RNA

2. How does it differ from DNA?

3. What is protein?

Gene

Segment of DNA that codes for a protein

DNA codes for RNA and RNA makes protein

One Gene – One Enzyme The Beadle and Tatum experiment

showed that one gene codes for one enzyme.

One gene codes for one polypeptide.

polypeptide - a chain of covalently bonded amino acids.

(proteins are made of one or more polypeptide)

12.3 DNA, RNA, and Protein

Let’s make some observations about RNA’s structure

RNA

RNA stands for: Ribonucleic acid

RNA is found: Nucleus and Cytoplasm

RNA Structure

Like DNA, RNA is made up of subunits called _____________, which are made of three parts: Sugar (ribose) Phosphate Nitrogen Base

RNA’s Nitrogen Bases

Adenine (A) Cytosine (C) Guanine (G) Uracil (U)

There are 3 types of RNA: Messenger RNA (mRNA) Ribosomal RNA (rRNA) Transfer RNA (tRNA)

All RNA is …

Single stranded Many different shapes “Cheap copy” of DNA

Do Now

1. What is a protein made of?

2. Explain the process between DNA and proteins.

Transcription

First step in making proteins Process of taking one gene (DNA)

and converting into a mRNA strand DNA -> RNA Location:

Nucleus of the cell

Steps to Transcription

1. An enzyme attaches to the promoter (start signal region) of a gene and unwinds the DNA

Steps to Transcription (Cont.)

2. One strand acts as a template.

Steps to Transcription (Cont.)

3. A mRNA copy is made from the DNA template strand by RNA polymerase

4. A mRNA copy is made until it reaches the termination (stop signal) sequence

5. The two strands of DNA rejoin.

Template vs. Non Template Strand

Transcription animations

http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html

http://www.fed.cuhk.edu.hk/~johnson/teaching/genetics/animations/transcription.htm

Transcribe this DNA to mRNA

Think- Pair- Share 1. Where in the cell does transcription occur? 2. What nucleic acids are involved in the

process of transcription? 3. What is the importance of transcription? 4. In transcription, how come the whole DNA

molecule is not copied into mRNA? 5. How does one gene differ structurally from

another? 6. Because one gene differs from another, what

molecules in the cell will also be different?

mRNA Processing

Pre-mRNA – the original sequence of RNA created during transcription

mRNA reaches the ribosomes

RNA Processing

What is RNA Processing?

After transcription the pre-mRNA molecule undergoes processing 5’ cap is added Poly A tail is added to the 3’ end Introns are removed.

Do Now

Label the Transcription diagram

RNA Processing In Eukaryotes only Introns- non-coded sections Exons- codes for a protein Before RNA leaves the nucleus, introns are

removed and exons are spliced together A cap and poly A tail are added to ends of the

sequence mRNA leaves the nucleus through the nuclear

pores

Why is it necessary to add the poly A tail and 5’ cap?

Let’s try an activity (11.5)

http://www2.pearsonsuccessnet.com/snpapp/iText/products/0-13-115075-8/index.html

Pg. 339

Pg. 339

Let’s an example…

Original DNA Sequence (DNA): 5’ GTACTACATGCTATGCAT 3’ Translate it (RNA): 3’ CAUGAUGUACGAUACGUA 5’

Add the 5’ cap: 3’ CAUGAUGUACGAUACGUA 5’ cap

Finish the job!

Remove the introns “UGUA” and “AUAC”:3’ CAUGAUGUACGAUACGUA 5’ cap

3’ CAUGACGGUA 5’ cap

Add a poly A tail onto the 3’ end

3’ CAUGACGGUA 5’ capPoly A tail

Get a new partner!

DNA Strand of non-template strand:

5’ ATCGGTAGAGTATTTACAGATA 3’

Remove introns: CGGUA UUACAG

Think, Pair, Share

Take a minute think on your own, then pair with your partner, and share your ideas!

Evolutionary, why do you think there are introns?

Where did they come from? Why do we have them? Remember there is NO wrong answer!

PROTEINS!

Proteins are made up of amino acids!!!

Proteins are polymers of amino acids

Only 20 different amino acids BUT there are hundreds of thousands

of different proteins

How can this be?

Let’s compare to it to the English language How many letters are in the alphabet?A,b,c,d,…26 How many words are there?Miss, Ings, is, smart, .. Almost infinite! Each word has a unique structure of letters.

Similar to proteins and amino acids

Proteins- (PCFNa)

-made of 20 different Amino Acids

- Amino Acids bond to form polypeptide chains

How do amino acids form these peptide chains?

Peptide Bonds – Link each amino acids together to form proteins

How many amino acids are in a dipeptide chain?

How about a tripeptide chain?

How many water molecules are formed from 2 amino acids?

How many water molecules are formed from 100 amino acids?

Do Now Perform transcription on this DNA segment:

GCTTCATACGA

Do RNA processing and remove the introns: GAA and UGC

How does this mRNA sequence leave the nucleus?

Where does it go?

Protein

Structure

http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm

Translation

Production of proteins from mRNA mRNA goes to the ribosomes in the

cytoplasm or the RER and produces proteins

Steps to Translation 1. mRNA leaves the nucleus and

binds to a ribosome 2. the 5’ end of mRNA binds to

ribosome

Ribosome

Two subunits to the ribosome 3 grooves on the ribosome (A, P, E) A: tRNA binding site P: polypeptite bonding site E: exit site

Steps to Translation (Cont.)

3. Ribosome looks for the start Codon (AUG) Codon: group of 3 nucleotides on the

messenger RNA that specifies one amino acid (64 different codons)

Steps to Translation (Cont.)

4. Amino acids attached to a tRNA molecule and are brought over to the mRNA.

5. This tRNA has an anticodon that matches the codon on the mRNA strandAnticodon:

Group of 3 unpaired nucleotides on a tRNA strand. (binds to mRNA codon)

tRNA

Think-Pair-Share The mRNA sequence reads the following

codons: What amino acids do they stand for? AUG GGA GAG CAA

** What amino acid does the anticodon CGU stand for?***

Steps to Translation (Cont.)

6. tRNA binds to the mRNA sequence and adds an amino acid

7. Each amino acid matches up with 1-6 tRNA molecules

8. tRNA leaves and amino acids bond together through a polypeptide bond

Think – Pair - Share

Find the amino acid sequence for the following mRNA sequence (translation)

AUGCGACGAAUUUAA

Translation Animations

http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html

http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/translation.swf

Steps to Translation (Cont.)

9. The mRNA sequence continues until a stop codon is reached.

10. The amino acids disconnect from the mRNA sequence and a protein is formed.

Think-Pair-Share

Get with a partner, one partner transcribes and the other translates.

Do Now

Do transcription on this DNA sequence:

CGTACGCTCCCTAGACTA

Do Translation- Remember to start the right place!

Do Now

Do transcription on this DNA sequence:

TTTTATACTGAGGGTTAACTCGT

Do Translation- Remember to start the right place!

1. 2. 3.

4. 5. 6.

1. Initiation The two ribosomal subunits

come together with the mRNA and the first tRNA molecule which attaches to the start codon (AUG).

This is the only tRNA that will attach to the P site.

The first amino acid is always methionine.

2. Codon Recognition

The tRNA anticodon will hydrogen bind to the mRNA codon in the A site.

3. Bond Formation

The amino acid in the P site will form a peptide bond with the amino acid in the A site.

4. Translocation

The tRNA's and the mRNA move down one site. The empty tRNA is released from the exit site.

5. Repeat

This process will repeat hundreds of times.

6. Termination

Translation is terminated with the stop codon is reached. There are three different stop codons UGA, UAA, UAG.

The release factor recognizes the stop codon and releases the polypeptide strand. All the factors break apart and are reused.

Do Now Take the following amino acid

sequence, do reverse transcription and translation (find RNA and DNA).

Methionine, Arginine, Alanine, Serine, Tryptophan, Tyrosine, Leucine, Valine, stop

What do you notice about your DNA sequences?

Do Now

Template strand of DNA: 5’ TTACGGCTAGGAGTAGCCGAATTCTG

3’

Remove the introns: CUCAUC

Determine protein sequence

Do Now

How do cells know what protein to make when?

Gene Regulation: ability of an organism to control which genes are transcribed.

Controlling Transcription

Transcription factors ensure that a gene is used at the right time and that protein are made in the right amounts

The complex structure of eukaryotic DNA also regulate transcription.

HOX Genes

Everyone develops from a zygote Zygote undergoes mitosis Cell differentiation: cells

become specialized Certain gene sequences determine

cell differentiation

HOX Genes

Homeobox Genes (Hox Genes) are sequences of DNA

Hox genes are responsible for the general body pattern of most animals.

HOX Genes

Are transcribed at specific times, and located in specific places on the genome

Mutations:

Telephone

We are going to play the game telephone.

Every time a DNA makes a copy (spreading of a message), mutations can happen (mistakes in a message)

Mistakes in DNA

Cell make mistakes in replication, and transcription

Most often these mistakes are fixed

EX.

Mutations

A permanent change that occurs in a cell’s DNA is called a mutation.

Three types of mutations: Point mutation Insertion Deletion

Point Mutation

Substitution: A change in just one base pair Missense Mutation: amino acid is change Nonsense Mutation: amino acid is changed

to a stop codon

Frameshift Mutations Causes the reading

frame to shift to the left or the right

Insertion: Addition of a nucleotide

Deletion: Removal of a nucleotide

ACGAAATACAGACAT

Decide what type of mutation occurred:

ACGAAATAGAGACAT

ACAAATACAGACAT

ACGAAATACAGGACAT

Causes of Mutations Mutations can happen spontaneously Mutagens: Certain chemicals or

radiation that can cause DNA damage Causes bases to mispair and bond

with the wrong base High-energy forms of radiation, such

as X rays and gamma rays, are highly mutagenic.

Sex Cell vs. Somatic Cell Mutations

Somatic cell mutations are not passed on to the next generation.

Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring

Chromosomal Mutations

Piece of chromosome can be broken off, duplicated, or moved to another chromosome

Fragile X Syndrome

Repeat of CGG about 30 times

Causes mental and behavior impairments

Protein Folding and Stability

Substitutions also can lead to genetic disorders.

Ex. Sickle Cell Anemia (caused by a substitution mutation)

Can change both the folding and stability of the protein

Sickle Cell Anemia

Causes of Mutations Mutations can happen spontaneously Mutagens: Certain chemicals or

radiation that can cause DNA damage Causes bases to mispair and bond

with the wrong base High-energy forms of radiation, such

as X rays and gamma rays, are highly mutagenic.

Sex Cell vs. Somatic Cell Mutations

Somatic cell mutations are not passed on to the next generation.

Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring