Transcript
  • 2009-10 UDM Mens Tennis Year Book2009-10 UDM Mens Tennis Year Book

  • 2009-10 UDM Mens Tennis Year Book 2222000000000009999999999--------11111111110000000 UUUUDDDDMMMMM MMennss TTTTeeeennnnnniiisssss YYYYeeaaarrr BBBooookk22200000000999999999--------111111111000000 UUUUDDDMMMM MMenss TTTTeeeennnniiisssss YYeeaarr BBooookk

    SCHOHOOLO INFNFORORO MAMATIIIOONONONLoLoLL catit onononn: ..................... ............. ... ........... .................................. ...................................................DeDDeeetrtrtrtroioit,t, MMMMMMMMiiciciiicicicicich.hhh.hhh.h.hh..FFoFoF unundededed:dd ........... ..... ................................. ...... ................................... ............................. ... .................................................... 111818111877777777777EnEnEnEnrorororor llllmememem ntntntntn :::: . ...................................... ............... .... .................................. .................. ..... ................................................................. 5,5,5,5 7070707 000000000NiNiickckckckcknananann memememe:::: ........... ....... ............... ....................... .......... ....... ................. ..... ..... ........... ... ..... .................................TiTiTT tatatatansnsnsnsCooolololorsrssssrsrsr ::::: . .... ............. ........................ .......... ............ ...... ... .............. .... ...... ... ReRed,d WWWWWhhhhihhhhhih tetetee a aaandndndd BBBBlulul eeeHoHoHoHomeme C Cououuuourtttrtrrtrtrtrtsss::::. . TiTitatan n TeTeTennnnnn isiss C CComomomplplplexex, FrFranankklkklklklklliinininiin A A A Athththt leleeetititit c c ClClClC ububububAffiffiffiffiffi lililil atatataatiioioion:n::n ........... ......................................................................... ........ .....NNNNNCNCCNNNCN AAAAAAA DDivivvisissi ioiooon nnn IIICoConferenceee:::: ........................ ....... ............................................. .... HHoHoHoHoriririr zozoz n n n LeLeLeeagaga ueueePresidennt:t::: ....................................................... ........FrFrF . . GeGeraraardrdrdr L LLL.. . StStSttococoockhhkhkhauausessen,n, SSSS.JJJJ

    ATATHLLETTTTICICICICCCC DDDEEPEPEPEPARARAARTMTMMENENTT TT ININNINFFOFORMR ATTTTIOOIOOI NNNNAthlettttiicici DDDDDiirrecececectotor:: ................................................................................... KeKeKeKeriririri G G G GaiaiaiaiththththererererSeeniooror Assssss oococciaiaii tete A AD:D:D:D: . ........ ........... ... ... .......DaaDarrooon nn n MoMoMoMontntntgogogogomemememeryryryryAsAsAsAAAssisisisisistststststanananananttt tt AADADD f fororo F Faca ili itieiees:s:s:s: .. ........................................ ....................... .........GlGlGlG enenenenn nn n KnKnKnKnototototttttAsAsAsAsA sisisisiststststananana t tt ADAD f fororor N NN NCACACACAAAA A CoCoCCompmpmpmplilililianananancece: . ............. StStStSteeveveve ee CoCoCoCordrdrdrderererrAsAsAAsAssisisisiss ststststtananaaananant tttt t ADDADA /B/B/B/ ususu ininese s/SWA: ................. ..... ... ...............TeTeTeriririri K K KKrorooomrmrmreieieiDiDiDiDir.r.rr oo oof f f f MaMaMaMarkrkrkkkrkketeteetining gg & && PrPrP omo ototioionsn : ... Brannndodoooooon nnn LLononoongmgmgmgmeieieieierererDiDiDiDirerererectctctctorororor o oo of f ff TiTTiTT ckckckkketetete O OOOpeppeerarararatit onns/s/s/s/SaSaS leles:s .... .....GrGrGrrrrrreeegeeeg HHHHaaaaa papapaalalalalaDiDiDiDirerererectctctctorororor o ooof f fff SpSpSpS orororrtsttststst M MMedede iccicininninninne: ........................................MiMiMMiMiMiMiMM kekekkekkk MMililillelerrDiDiDiDirerererectctctctctororororrr oo ooff f StStStStrererereeeeengngngnnngngthththt & &&& C C Cononnnddidd tiononno ining:g:g:g: ................ ..JooJoee ToToToToToTTT ff ff ere iiFaFaFaFacucucucultltltlty y y y AtAtAtAthlhhhletettticicici R RRRRepepepepprerereresesesentntatatatatativvi e:e: ................................ ..ErErEriciccck k BaBarnnrnr esesesOffiOffiOffiffiOffi cececece P P P Phohohohonnnenenen ::: ...... ............... ................. ........ ............................. ............................ 31313-3-99993-177000000000FaFaFaFax:x:x:x: ................ ............................................................. ... .......................... ..................................... ........ ....... .. 31313-3-99993-3-24244949MaMaMaMaililililininining g g g g AdAdAdAddrdddrrdreseeeeee s:ss:s::s ..... ..... .............................................. ... 400101011 W W. McMcNiNichcholols s RdRdRdRd.. . ....................................... ............ .................................. ........................................................... ....................... DeDeeetrtrttrtroioioio t,tt,t, M MMMMMII I 4848484848222222211

    SPSPSPSPORORORORTSTSTSTS I I I INFNFNNFFOROOORRMAMAAMAMAM TITITIT ONONONNAsAsAsAssisisisiststststs ananananntt tt ADADADDAD fff fforor S SSSpopoportrtttttsss s sss InInInInnnnffoformrmation:: .... ............ ...Maarkrk EEngnggngeellllAsAsAsAsAAAA ststststs . . . . SISSIIID DDD DD D (M(M(MMMenennnensss T T Tenennennennnnnnininininninn ss CCoCoC ntntacact)): .............. .......... P.PPP.J.J.JJJ. GG Graradodowsw kkkikkiEmEmEmEmaiaiaiail:llll ...... ... ... ............ ........... ............................. ........ ............. ................gradowwwpjpjpj@u@u@u@udmdmmdmmd ererrerercycycycycy.e.ee.eddudududuuuSpSpSpSpororororrtstststst IIIInfnfnfn oo.o.o.o.o.. OOO O OOOOOOffi ffi ffiffi ffi ffi ffi fficcc cccce e ee PhPhhPPPPhonono e:e: ......................................... 313113-3-3-3-999999993-3-3-17171717744544555SpSpppSppororororrtstststs I IIInnfnfnnfnfnffnfnfffo.o.o.oo.oo. OO OO OOOOOffi ffiffi ffiffiffi c ce e ee FaFaFaF x:x:x: . ............................... ....... .............. 31313-3-9999993-3-3-3-171717176656565666555

    MEMENNN S S S TETETETENNNNNNNNISISIS S S SSTATATATAFFFFFFFHeHeHeeadadadadddddd C C CC oaoaoaoachchchc ::: . .....................................GrGrGG anantt t AsAAA heer r (M(MMMMiciccccccichihihihihhhh ggagaggan nn n StStatte e 99999292229222))ReReReRecocococordrdrdrd a a at t UDUDUDM:MM:M . ...... ... ...................... ..................................5-1313 (( (SeSeSeSeeSeSeSecococococococcooc nnd Seaeaaasssosososoososossonn)n)n)n)CaCaCaCarererereererrr H H Heaeae d d CoCoacacachihiiingngngg R RRRRecececororord:d:d .... ......................................... ............ .........SSSaSaSaSaSaS mmmmmemmmmmmEmEmEmmEEE aiaiaiail:ll:l: . ........................................................ .......................................... ..... asa heersrsg@g@@ududddududdmmmemeeeemmem rcrccr y.yy.y.y.yy.y.eeedddddedeedduuuAsAsAssAsAsAsssisisiis ststststanananant t tt CoCoacach:h::................. ............... ........ SaSaSSaam m PoPoole e (W(Wayayneneeene S S SSS tatatatateteteteeet 070770777) ) ) ) ) ))MMMeMeMeMeMeMeMMMMM nnnnnn s ss s TeTeTeT nnnnisis O Offi ffi c ce:e: ..................................................................... . 31313-3-3--9999999999 33-3-3-17177711 00000000000

    MEMEMEMEEEM NNNNNNNNNNN SSS SS TETENNNNISIS Q QQQUIUIU CKCKK O O OOOVEVEVEV RVRVR IEIEWWLeLeLeLetttttttteeerererereeere wwwwiww nnnnererrs s s ReRetuturnrninining/g/g//LoLoLoL sttst:: ............... .................... ......... ....... ..... ............. .... .. 4/4/4/44/333NeNeNeNewcwcwcwccccccomoomomommoo erers:s: .............................. ..... ..... .......... .......................... .... ...... ... .............................................. ........................55552020202008080808--0-000--0-00-0-0- 99 9 ReReR cocordrd:: . .............. ................................ .......... ........................................ 5-5-5-1313333, ,, 1-1-1 6 66 6 6 6 HHHLHLH

    TATATATABLBLBLLE E EE OOOOFOFOFOFOFOOOOF CC ONONONONTETEENTNTNTTSSS20202 09090909--1-1-1110 0 000 TTTTTiTTTTiT tataaan n n n RoRoRostststererrr/S/S/SS/Schchchheededdululule:e:. ................ ........................ ................................ ...................................22ThThe e e HoHoHoHoooooooriririririizzzzozozzzz n nn LeLeLeLeagagaga ueueue::............... ........... .................................. .......................... ...... ...... ........................................... .....333SeSeasasasooonoonnnnonnn P P PPPPP Prrererererrrr vviviv ewewwe ::: . . .......... ........... ............................................... ...................... ... ... .................................. ........ ...........5555555555HeHeadaddd CCCCCoooaoaao chchchch G GGrararaantnttn A AAAAshshshss ererer::: . ....................................... ................................ ............................................................ 7777AsAsAAssisisis stsststststtttaanaaananna t t CoCoCoC acacaa h hh SaSaSaSaSS m m m PoPoPoololole:e:e . .............. .............................. .......... ... ........ .............................................. ..8888ThThThhhe ee ee 2020202000001101000 T TTTitittitannaans:s:s:s ............................. ...... ............................ ......... ............ ................................ ....... ...................... .... ....... ..........99202220200202000800808080888888-0--0-0-099 9 SeSeSeasaasononon R RRRevevve ieiewww:::: ........... .............................................................. .................................... ............ 1818YeYeYeYeYeYeYeYeYeaaararaaaar-B-By-y-y-y YeYeYeYearararar R R Resesesululu tststts:: . ................................................ ....... ................................. ....................... ...... ... .. 1919ReRReR cococ rdrdrd B BBooooookkk:: ...... ...................... ..... ... ... ....................................................................................................... ......... ...... 2323AlllAllAlAAA l-l-l-l-l-l TiTiTiTiT mememem R RRosososo tetetet r:r:r: . .................................... ........................... ............................................ .......................... 2424UDUDUDUDDDU MMM M FaFaFacicicililililililitititiititieseseeses:::::: ........................... ........................ ............ .......... ............................. ... ....... .................... 2525

    Year Book CreditsThe 2009-10 Mens Tennis Year Book is a production of the UDM Sports Information Offi ce. The publication was written, designed and edited by Assistant SID P.J. Gradowski. Editorial assistance provided by the UDM Sports Information offi ce. Photos by Tim Busch, University and the UDM Sports Information staff . Poster/Cover designed by Jeff Mitchell.

    SCCHOHOOLL IINNFORORORRMATITIIONONOO MMMMMEENNSS TETETETENNNNNNNNISISISS SSSTATATAAFFFFFF

    Quick FactsQuick Facts

    1

  • 2009-10 UDM Mens Tennis Year Book2009-10 UDM Mens Tennis Year Book

    2020202009090 -1-11110 0000 UnUnUnnnivvvivivivveerersisitytyytyyty o o oo of f fff DDDDeDeDDetrtrtrttroioioio t t t MeMeMMercrcrcy y y MeMeMeM nnss TeTennissss R R R Rosossteteerryyy y

    NaNaNameem YYrYrYYYrYYr... HtHtHHtHt.. WtWtttt...... Homemememetototowwnwn/H/Higigigghh h ScScSchohoh ololoogggChChriiiststopheher r ChChhChChCheueueueuuueungngngngngngngg F F FFFr.r.r. 5 5-1-111 1 131313330 0 0 000 Miissssssisisisisssasaaugugga,a, O OON/N/N/ErErErE ininindadadaalelel SSSSececececonononondadadaryryyryy ChChC rir s s DiDiididio o o FrFrFrF .. 5-5-8 8 88 121212121277 77 77 MaMaaacococoooombmbmbm , MIMI/D/D/De ee LaLaLaaSaSaSaSalllllllee e CoCoollllllegegegegiaiaiatetee RuRussssss K Kovovvvararar FFFFrr.r.r. 6 666666666-5-5-5-5--5-5 11111676766 FForort t t t GrGGrGG atata ioioot,t, M MI/I/PoPoPortrtrt H H Hurururrononon N NNorororrthththhheeere nnn nn AlAlAlAlAlAlAAlAlAAlAAlAAAA exexexexexeexexx LL LL L L Latatatatatatososososossininininininskskskskskkkky yyyy FrFrFrFrFrFrFr. . ... 6-6-6--2 2 2 14141414141 2 2 SaaS rnrnniaiaiaia, , , ONONON/S/S/St.t. C Chrhrh isistotophphherererssss PjPjPjPjPjjPjjPjjPjPjPjotototototo rsrsrssrsrsrrssrss N NNNNNNN NNececececececce ajajajajajajaa evevevevevs ss SrSrSSrSrSS . .. 6-6-1 1 177177771 11 1 RiR gaga, , LaLaLaL tvtvtvvvtviaiaiaii /H/H/H/ erererdedederararar V Vididddusuusuusskskkskskoloololollaa a a aCeCeCeCeCesaas r r EEsEsE cocoobbababbababar rr r r SeSS rrano FrFFF . 55-5-555 7 7 151551 3 3 MeMerlr ioot,t, EE El l SaSaSaaSalvvlvvadadadadorororor/E/E//EEEduddududuucacacacaaammmmemememeeDaDaDaaaviviv d d d StStttabababababableleleleleley yyyy SoooSoo.. . 6-6-66-6-6-11 1 111 115151515151 9999 99 UtUtUtUtUUticicicica,a,, M MI//EiEisesenhnhnhn oowowwwererererer NiNiNiNiNiNNiNiNickckkkckckckck TTTTT Tolololomomomeiiei S S o.o. 5 5 55 5-99-9-999- 116262626662 R RRRRRRococoocoo hehehestststtsterererererrerer,, , MIMIMIMMIMIMMIMMMMI/A/A/A/Addadaamsms PPaPaPaPaPaatrtrtrtrtricicicicickk kk k TrTrTTrTTrTrT oyoyoyoyoyooyo S SSS S r.r.r. 6 6666 6-0-0-00-0-0 1 11 5050505050500050 B BB eve ererllllyly H HHHHHH HHHHilililillssls, ,, MIMIMIMIMMI/B/B/B/B/B/Brorooorothththththherererererer R R R R RRiciciciciciceee eHeHHHeadad CCoao chch: G Grarantnt A AAAAshhshhshshs erererrrererer ( ( ( ((SeSeSSeSSSS cocoococ ndnddndn Y YYYYY eeaeaee r r - - - MiiM cchchcc igiggaaann SStatatete 9292929292229 ))))))AsA sistant CoC ach: SSSSammm PPPPoooooleleee ((((SSSeSeccondndnd YYYeaar WWWWaa nnee StSttatatatee e 000007)7)7)7))

    000000009009009-1110 0 0 000 0 SSS SSSSchhchc edededulululeee

    D DDDayayaya DaDaDaDatetetete OpOpppopopopop neeeeeeentntntntnntntnntntttttppppppp LoLocacatitionononn TiiTimmmeme/R/Resesulu tsSSSSSSS SSSSS SSS S SSSatatatataaaaa .-.-.-SuSuSun.nn.n. S S S S epepeppt.tt 1112-2-1313 IIPFPFFFFFWWW W WW FaaaFaaallllllllllllllll IIInnvnvitite e e e F F orort t WaWaynyne,ee IIN NN NN 4 4 -- FlFligightht TitlesF F FFF FF F FFFFFFFF riririririririiririririrriririii..-.--. SuSuSuSSunnn.n.. S SS SSepepepee t.tt. 1 18-8-2020 FFFFFrararararrr nknknknkkkkkk BBB BBeeeeemamaaan n n IInInviv tete EEasastt LaLansnsini g,g, M MMI I 11 - - FlFligighht Title F F FFFFF FFFFFFFFFFFFFFFFriririririririririririririririririririri -.-.-.-.-.-.-.-------.. SuSuSSuSSuuSSSuSuSS n.nn.n.n.n... SSSepepept.t.. 225-5-2727 BBBBalaall l SSStStSttaatatte e InInnvvitatitionall MMununcicie,e, I IN N 2 2 2 - - RuRunnnn er-Up T T TTTThuhuhuuuhur.r.r.rrr.-MM-M-M-M-M-M-M-MM-M--M-M-M----MMonononnnoo . OcOcOct..t 11 15-5-55-1999 IIIITATAAAATTAA M MMMididwewwewestt RRegioonanal l AnAnn n ArArbobor,r, MMI I NNoNo.. 111 DoDDDoubles in QF F FFFFFFFFrirrirririrririrrirriririririrririrrrrrir dadadadadadadadadadadadadadadadadaaadadadaadddaddaay yy yy y y y yy y yy yyyyy JaJan.n. 1 15 5 5 DDDuDuDuDuDuququq esesse nnen SSououththfi fi eleld,d, M MI I 77:0:00 0 p.pp m. FF FF FFFririririiiiirrriririddadadadaadddadddddddddddddd y y yyy y JaJaann.n 2222 2 2 IIIIPPFPFW WW SoSoututhfihfi e eldld, MIM 7:7:7 0000 p.m. SSSSS S S SS unuunndadadday yy JaJan.n.n.nn 2 2 224 44 4 444 atatta W W eseseesttetern Michihigan n KaKalalamamazozoo,o, MMM I I 6 66:0:00 0 p.m. F Friridaday y JaJaJaJaJaJaJannn.n.n.n.n. 2 22229 9 99 vsvsvs. . NoooN rrthehern Illllinoiois EaEastst L Lanansisisiiiingngn , MIMIMIMMM 1 1:0:00 00 p.m.S SS S SSatatatattata urururuururdadadadadadadaay y yy y yy y JaJJaJan.n.n. 3333300 0 atatt M Miicchihh gan n Sttata e EaEastst L Lanansis ngng, MIMIMIM 44:4:4 0000000 ppp.m.m. SSSSS Sunununununuuu dadadadadad y y y y y yy FFeFeFeFeFFFeb.b 7 aatat T Tolloleeeddo o ToTooleleddddododd ,, OHOH 99:99::00000 a a aa.m.mm. . SSunnuununununddaddddadadadaddd yyyyyy y FeFeFeFeFebbbb.b.. 77 777 vvs.ss. C Casasase e WeWestern ReReseserve ToToleledodo, , OHOH 1:1::000000000 p p.m.m. FFFFFFFFririririiiddddadadadad y y yy FeFeFeFeFeFeFeb.b.b.b.b.b.b. 1 11111 112 2 2 WWW ayaya nenenen S Statatee S Sououththfi fielle d,d,dd M MMI I 7 77:0:0000:000 0 00 p.p.p.p.m.m.m. SSSSSSSuununuuuu dadadaday y y FFFFFFFFF FFFFFFebebebebebeebebeebeee . 1414141111111 aat t ChChhiccicccaagaga oo StStatate e ChChicicago, IIL LL TTTTTBABABAAABBA SSS SSSSaaataaata urururddadaay y FeFeeFeF bbbb.b.bbbbb 2222222222777 7777 aatatataa B Balalll l StStStatate e MuMuncncieie, , INNN 6:6:6:6:303303 p ppp.mm.m. . . MMMMMononoo .-.-.-. FFrFrFri. MMMMararraaar. . . 8-8-8-8-8-8-8 122122 a aaaaaat ttt SppSpS riringngngngngg B Brereakak M Matatchcheses T TBABAA TBTBTBTBT A A F F FFFFFFrirrir ddadad y y y y MaMaMaM r.r.r. 1 111999 99 aaaa t tt tttttt WWWrWrWrWW igighhththththhhhh SSStatatete * * DaDayttonononn, , OHOHOH 6:6:6:6:00000 p.mm.m.mmmmmmm. . S S SSSSununnuu dadaday y yy MaMaMarr.r. 2 22221 1 11 attttat B BBBBBB BBB BBBBBututututtutu lelelell r r ** *** * * I ndndiaiai nananapopopolililis,s, IIN N 11110:00:0 30 aaaa.m.m.mmmm. . F FFFririrriirrr dddadaadd y yy y MaMar..r 22 2226 6 6 6 VaVaaaVaaaV lplplplppppplplppplplparaarraaaaaaaaa aaaiaiaia sosososooos * * DeDDetrtroioioit,t,t M MMI I 22222:0: 0 p...mmmm.m.. SS SSatatatattattururrrrrrdadadaday yy MaMar.r. 2 27 777 UIUIU CC C C CC * * * ** *** DDD D etetettroroitit, , MIMI 66:6:6:00 pp.m.m.mmm.m.. FFFrrrir ddadadaaaadaaddayy y yyyyy ApAppr.r 9 9999 aa t t GGrGrGrrrGrG eeeeeeeeeeeeeeeen n nn BaBaBaBaBaBaBBaB y yyyy * ****** G GGG rereenen B Bayay, WIWW 4:44 00 pppppp.m.mmmmmm... . SSSaatuuruurrrurrrdddddadadadadd y yy ApApr.r.rrr 1117 7 7777 ClClevvvvve eleleleleleellaaaanananaaaaa d d StStStSStStStStSStSttSSS atatattatatatataattata e eee eeee *** * DHDHDD DeDetrtrt oioit,t MMMI II 1 0:000000000000000000 a a a aaa aa m.m.m. . SSSuuunundaddadaaaaaaaayyy y y y yy ApAppr.r 18 8888 YoYoY unnnungsgsgsgsgsgsgsgsgggggggggg ttotottotottt wnwwwwwnw S SSSSStatatataaataataaatatetetetetttttetttt *** *** DeDeDetrtrtrroiooioit,t,t, M M MI I TTTTTTTBBBABABABABABABBABAAAAAA

    HHHHHHHomommmomommmoo e e inndodooror mmmatatchchchhheeseseeses p p plaaal yeyeyeyeyeyed d d d dd aatataaa F Frarannkkkkkkkkkn lililillililinnnn nnnnnn AAtAA hlhlleetete icicic C CCCCCCCCCCCCCluuulululululululuulululuuluuuuubbb bb bbbbbbbbb inini SS S Souoououuthththththhfifi fi fi fi elelelelelld,d,dd,d, MM M MMIIIIHHomoomomommmommomme e ououtdtdoooor rr mamamaaamatctcctctcctt hehehehehh ss pplplpllayayayayayayededededed a a at tt TiTitaan n n TTeTTeTeTeTeT nnnnn isssss CCCoommpllllexexexex oo oooooooooooooooonn n n thththththththe eeee ee cacacacacampmpmppususu ooof f f UDUDUDDDUDDMMMMMM** --- HHHHH Hooorooo izonon L Leaeaaguguguue e e e ee CoCCoCoCContntnn esessstttDDH HHHH -- DDDDDoDoDD ububleleheheeeheeadadaddadaa ererererererer w ww wwitith h UUUDDUDMMMs ss wowomeem nns s tetettteamaamamm

    2010 Roster/Schedule

    Sophomore David Stabley

    2

    AsAssiststanant tt CoCoacacch:h:h:: SS S SSSaaaamamamammmm PPPPPPoooooooooooleleleeeleleleee (((( ((( ((SSeSeSSeSeeS cocococc ndnddn YYYY Y Yeaaeaear - WWWWaWaaW yynne e SStSt

    20020000

  • 2009-10 UDM Mens Tennis Year Book 2222000000000009999999999--------11111111110000000 UUUUDDDDMMMMM MMennss TTTTeeeennnnnniiisssss YYYYeeaaarrr BBBooookk22200000000999999999--------111111111000000 UUUUDDDMMMM MMenss TTTTeeeennnniiisssss YYeeaarr BBooookk

    EnnE teteeetetet ririririinnnngngnggnnngg iiii ii iitttstststststststst 3333 333111111stt season ooof fff opopperreratatttttatiioiioioioioionnnnn n inin ttttthhehehehhehheheheeee 2 2 2220000 9-101 aacac deemic yeeeeeara , , thhtheee eHoHoHooHoHoHoHoHooooorriririrrizzoon LeLeaggueuu conontinues to o asaspip rereerre tttototoototoowwaardrdr i itststs gg ggoaoaoao l l ofof beieing one oof thhe e eenan tit ononsss l leaeaeaeadidididingngngng a a aaththththleletiticscs cconfeererenncesesee whwhilile eee bebebeeininining g gg rererer cococogngngngnizzzedded aas a leeeadaderr i in nthhtttt e e dedededeveveveeloloolopmpmpmpmenenenent t tt ofofofof sstutututudededded ntnttt-aththleeetetes s asas lleaeaeaadedeeersrsrsrs aa aandndndnd r rrrolololole ee e momomooodeddededelsls.

    ThTThThhhhe e HoHoHoHoriririr zozozozon n n n LeLeLeLeagagggaggueueue m eme bersshihip pfefeffeatatataturururureseeses tt ttenenenen p ppubububububuu lil il c c cc ananaa d dd prprivatate einininnststststitititutututu ioioioi nsnsnsns ttttthahahhahhat tt hahahahaveveveve iimppm ressivive e acacacacadadadadememmicicicic r rr repeppppututtutatatatatioionsss aaaandn a sstotorieded trtrtrtradadadadititittioioioonn n ofoff b b brororooadad-b-bbbasasasededdd aththleletitic cprprrp oggogograaamsmsmsm . .. C C Cururuurrerenttntnt m mmemmembebeeersrsr hihip p inininclclcludududdeses B BBButututleleel r r rr UnUnivvvi erersityty, , ClClevevelelelllananand d StSttS atata e e UnUnUnU ivivivi erere sisitytyttyy, , ththhhe UnUnUnivvii erersisityty o of f Deetrtrtrtrtroioiooooo t t MeMeM rcrccy,y, t thehehee UU Unin veeversrrsititty y ofofo IIllllininoioiss atatatatat CC CCCCCChihicacac gogooo,, LoLoLoLL yoyoolalaa UUUniveversr ititittity y ChChicicagago,o, VaVVVVV lppararaisos Unin veveersrsitity,y, tthehee U Uninin veversrsitity y ofof WWWiWW sconsiin-GrGreeeen n BaBay,y, tthehe U Unininivevev rsrssitity y ofofofofofo W Wiscoonsinn-M-M-MMililili wawaaaukuku eeeee, , WrWrWrrigigighththt S S Statatatetete UnUUUnUnUnivivvi ersiis tytyyy aaa andndd Y YYououo ngngnggstststs owowowwn nn StSStSttatatatatate eeeeeUnniviviviviiverererrerereersisisisitytytyty. .

    Thhe e HoHoHooooHoH riririririizozozozozz n nn n LeLeLeLeagagagagueueueuesss pp ppririririmmamammmaryryyyy f f ffocococusus isiss o o oo oonnn nn n dadaddadddidididiiinggggngngngngnngggg vvvv v v alalalalala ueueeueue t t tto o oo ththththhht e e eee ededdddeducuccu atatioioi nnan ll exxpepeepeppp riririieenenenencecececeec ttt tthrhrhhrhrhhhrhhhroououuuuuuuooououuouo ghghggg i itsts f fouour rr plplaatatfoforms:s:s:s atatatatatathlhlhleteteticic p perrrerrr ffffofofoooooofoormrmrmmmaananceeece, , acaccadadadademeee icicicc acachihieveveme enennnnnnttt,t,tt,t,, c ccccomommmumum ininityty ooututuu reeacacaa h,h and pepeerrsrsooooonnnnono aalalalal r resespopoponsnsibibili l itity y ananand d dacaccocoununtataabbbbibbiilllililiitytyyyy.. IIIt t isiss tthehhe LL Leaeagugug ees ss bebeliliefeff ththhatat a athththhleleleelettititiitt cscssscs i i is s a a popowewewerfrfulul a andd v visisibiblele reresosourrurrcceec tttooooooo l l ththataa ccanan bbe ee ususeded t to o eeneneneneeneeee hahahahahaaaaaannncncnn e e ssssttuuududdu enent-t-atathlhlhleteteses cocolllll egeggiaiatetee exexexxpepeperirirrienene cecec . ThThThThThee e e HoHoririizozoooz n nn nn LeLeLeeLeagagagagueueueuessss g gg goaoaooalslslllls arararararararareeee e e e tototototoototo ee e enhnhnhnhanananceceec tthehe hh lolisiistiticc ununniviviviverererersisisisiitytyttyty exexpeperiririiieneneneencececee f f f forororor ttt theheh sstutudeentn -athlete, tottot crcreaeaeatetete a aaan n affiffiaffiffiffi liliiiiatattatioioioion nnn n ofoff i iinsnsn titutitit onono s with sisisiimimimim lalalar r r atata hlhlhletettete icici ggggoaoaoaoaooo lslslsls, , anannd d d to aaaaadhdhddhdd ere etototoo t theheheh p ppriririncncncccipipipalals s s ofofofofoffff i iiiintntntntegegegriritytytyy, , diveeeeeeersrsititititity,y,yy,yy exexcececcelllllllenenenencecececeeee a andndddn g gg ggrororoororrrrowtwtwtwtwtww h.h.hhh.

    ThTThee e e HoHooriir izozzon n n n LeLLeeeeL agagagagagaggueuueueuu sspopoponsnsorrrrrors s cocompmpmpmpetetete itittiooion nn inininn 1 119 9 99 spspspspsppspororoorrrtstststtts n ninine fofoffor r memennn nn(b(b(b( asasassebebebebalalall,l,l, b b bbbasaasasskekkeekek tbtbtbtbtbtbalalllallaa l,l,l,l,l, c c c c crorororossss c cououuouuuntryy,gogogogolflflff, , , sosososoccccccc erererer,, , swswswwswswimimmimimmmmimimimimimingngngngn a a ndndn d ddiviving,g ininnndododooror t t trararackckckkk a aaaandndndndd fi fifififi e eeeeeldldldldddl , , ,, ouoouoo tdtdoooooooooooo rr rr rr trt ack ananand d dd fi fi fifieleleld d d anannnd dd teteteennnnnnnnnnisissis) ) ) ))) ananananand d dd teteteten n n fofoooor rr r r wwwowowww men(b(b(basasasaskekeketbtbtbt alalaa l,l,l, c cccrororosssssss cccououououoo ntntntntntntryryryrr , , ggoogogollflflff, sosoccer,sososos ftftff bababab llllll, , , swswswwwwimiimmimiimmimimimiiingngngng a a andndndndn d ddddivivivivivvinininni g,g, i indn oortrtrtrtrt acacack k k k ananananaaa d d d fi fi fififieleleeelee d,dd,d,dd o oooooutututututu dododod oroorororor t t ttrararaaaackck a andnd fi eld,tetettettennnnnnnnnisisis a aaandndnnndnd v vvvvvololololollleleleleleybybybybbbbaaalalalallllll)l)l)l)lll))).. .

    ThThThThe e e e LeLeLeLeLeLeagagagagagueueueueuee r rrrrrrrreecececeecceieiieieieieie vvvevevevevees s s auauauauutotot mamatic bidss tototoo N N NNNNNCACACAACCC A AA AAA chchchhhhhamamamammammmmppppipipipiononononononshshshshshshipippipps s ss inin bbasasebball, mememem nnnnnnss s sss anaananaananannndd d d dddd wwwwowowowowwwoow memememememeennnnnnnns s s s bababababasksks etetballl , mennsss s ss

    gogogolflff, , mememememem nnnns s aananaa d d wowowoomemememememennnnnnnnnnsssss sooccccerer, ,, sosoooftftftftbabababallllllll, , , memeeemennnn s s ss ss aananaa d ddd wowowowwwwwow mememmemeeeeeennns s teteennnnnnnnisisisis, , , wowowowomemmemennnn s s ss vovovoovooollllllleyeyeyeye baballlll,, , ,, anaananananaanddddddddd d d d fofofoorrr r ththththee eee fifififififfff rsrssrst t tt titititimmemem i in n LeLeLeeLL agagaga uee hh hhhhiisisisisisistotooryryyyyry, , ,, wwwwowowwow memememennnns s ss gogogogolflflflf.

    ThThT ee HHoHoHoHoHoHH riririzozozoon n nn LeLeLeeeeeL agagaggagaa ueueeueu i ii is s s s heheheheadaddadquququq ararteterered d din IInndndndndnnddn iaiaiaanananapopopopolilililis,s,s,s, tttttt t tt heheheheheehe AmAmAmAmatatataa eueueuue r r SpSpporortsts CaCaaaaappipipppitatataal l ofofof t ttthehehh WWW Worororrrorrrrldldldldldldlll ,,,,, wwwww itititithh hh ofofooffificeces s ininn tththhhththhhe e e e PaPaPaan nn AmAmAmAmererericiciccanananan P PP Plalaaaalalazazazazazazzzazz ((( (202020201 11 1 S.S. C Capapititolol AAAAvAvvAAvAA eneeenueue),), l llocococcatatatateddeded aaaa b b b blolololooooooloolo kckckckkcc ff rorom m LuLucacas s OiOiOiO l l StSStS adadddiuiuiuum mmm anana d d d d jujujuustststst m mmmmmmmmm mmininnii ututeses f frorom m mCoCoCoConsnsnsececececo oo o FiFiFF elele dhdhdhhououoouo sesesese, , ththththhe e e e StStStStSStaaataaaaa e e CaCaC pipiip totol l BuBuBuBuilililildididd ngngng, , ViViictctttororo y y yy FiFiFiFieleleleld dd d (h(h(hhhhh(hhhomomommoomooo e ofof t ttthehehe InInInIndidididiananananapapapapololissisis I I I Indndndndiiaiaiansnsnsns) ) ) ) ananananddddd ddddd dd thtthhe e NCNCAAAAAAA nanananatitititiononononalalalal o o o offi ffi ffi ffi c c ce.e.e.e.

    A A AA PRPRPRPROUOUOUOUD D D D HIHIHIHISTSTSTSTORORORORYYYYFoFoFoFounununundedededed d d d ononoon J J Jununune e 161666,, 19199999991979797979799797979, ,, asass t ttheheheh

    MiMMMM dwdwdwdwesesesesteteteternrnrn C C Citittity y y CoConfnffererererrrreenenenenenenenencccececcece w ww witititth h hsisissiiixx xxx chchhhararararteteteter rr r mememem mbmbm ererrs,s, t t ttthhhhhhehehehhhe LLeaeaeaeagugugugue e chchhhaananaaaa gegeed d dd itititits ss s nananan memem t to o o o thththhee e MiMMiMMMidddwdwwwesesesteteternrnrnnn Coollllllegegegegegegegege iatetete CCCCononononfefefeererererencncncn ee eee iininniinnnn 1 989898855 5 ananannnd ddadded ddd wowowwwwww mememenns s s spspspsporortstststs fff ffffoorororrorro t tthehehehe 1 11989898986-6-6-6878878787787 aaa aaacacaccc dedeemimimmimmmm c c cc yeyeyyy ararr. CCC CCCCChhahahhhahahahartrtrtrtrtrtrtttteererer m mmmmememembebebersrsrs ofofff ttttttthehehehehehehe cc c cccononononfefeeffefeererereereer ncncncncnn eeeeee inininininiininininclclcluduudededede c ccururururrererentntn memembmberrs s BuBuBuBuB tltltlt erereeee aaaaaa andndndndn LLLoyyo oloola a asasas w wwelelell l ll asas ththe e UnUniviverersisityty oooofff f EvEvEvEvEvEvEvEvanananananananansvsvvsvssvvilililillillelelle, , OkOklalaahohoh mama CiCCiCitytytyty UUU Uninininiveveveversrsrsrsitititity,y,y,y,y,y OOOOOOOrrararaararallll ll RoRoRoooRoRoRooR bbbebbebbbb rtts s UnUnUnUUniivivivivvereererersisiiisisitytytyttyty anananaand d d XaXaXaXaXaXaXavivivivivivvivv ererererererrer UUUUUU U UUnnininininiveveversrsitititittttttyy.y.y.y.yy

    AAmAmmAmonononggg g oother r cccccucuuuuuc rrenent tt mememeembmbmbmbbereere s,ss, DeDeeDDDDDD trtrt oioit t t jojooinned innn n n n n 119119111 800, , anannna dd d ClCClClCleeevevelelananndd d StSStSStStSSSS attte,e, UU UUUICIC, GrGrrreeeeeeeeenn n nn n Bay,y,yy MMMMiiilwwwawawawawauuuku eeee andd WrWrWrWrWrWWrWW igigiggightth S SSStatatt tete ccccccaaaaamaa e e ee aababoaoaaaardrrdrdddr i in n n 19191994949494 (a(alooloongngngngngngnng ww ww w wwwitititititith hh hh NoNoNooNoNN rrtrttrthhheh rnrnnnn I IIlll innooiioiiiiiiisss ss UnUnivivivverererersisisis tytytyty) ) ) )inin t thehee llll lararararrargegegegegeegegegestststststtstsst n nnnnnnnnnoooooooono ---m-mmmere gegeeeerrr r rr r cocococ nfnfnfererererenenenencececece exexee papansnsioion n n ininininnn h hhhisisisssissstttot rryryyyr . . .YoYoununngsgsgsgsgsgsgsgstotot wnw SStateee jojoooininininining g inin 2 22000000000011 111 ananana dd d dd VVValpppaaararraiaiaiiiaa sssosos in 2007777. .

    OnO Junnee ee 4,44,4,4,4,4 22222 22222222 22 0000000000000000001,1, tthehe H HHororororrorizizizizzizononononononn LLeaeaeae gggugugugugguguug e eunununveveveilileded its ccururrrrereererererer ntntntntnttntt n nnnnnamaamee ee anananannandddddd uususuuusushhhehehehheeeeeheeheerrrrrer d dininin aaa n n newew d dynamamicicc d ddddddd d d diriririrrririii ecececececeeeee tttititiionon t thaaaaaaahatttt tttttttt hahhahh s sbrbrbb ouououghghht t ththht e eee Leagagueue c cclolooololoolosesseseseseseesessesesses r r r toto i itststststssss ssssss sssssssstttttaaaattateteeted d dddddd dgogogoalalala o ooof f f bebebeb ing gg onone e ofof t theheeeeehehehh nnnnnnn nn ata ioioioooooooooooonnnnnns ss ss tot p pp ppppppteteeen n n n cococolllll egegege iaiatet aththleetitic c cocooooococc nfnfnfnfnfnnfnnnnn eeeeerererrrrerreenennnneeennceceeceecees ssssssssswiwiwithththh a aa f ffocococussu oon ennhahancncining g ththththheee ee ststssssstss uuudududduuu enenenennnentt-tt-ttatathlhlhhlhletettesess exexexxpeeririenencece b by y upupppuppgggrgrgradaddaa ininininninni ggg g gggtththe ee LeLeLeagagaagueues mmararkeket t anand d cococommmpmpppppmmppeteetette ititi ivivveee eepopoposisisis tititiononons.s.s

    ATATATTHLHLHLHHLETETEETTICC S SUCUCCECESSSSInnIn tt theeheehe p pppasast fefew w yeyearars,s, t thheeheee H H HHHoorororrrrrrrriiizzziii onononoononnnnon

    LeLeLLeagagaggueueue hhhhhasaas eenjnjoyoyeded u unpnpnpprererececeeeceededeeeeeeeeeedennnntnttnnn eedededddededdddddddd susuus cccccccesese s s onon t thehe n natatat ioioonanaaan ll ll ststttttaaggggggaaaage,ee,e,e hihhihighghghhg lililighghgg teted d byby t thrhreeee S Sweweweew etetetetetett S Sixxxxxxxtteteteeteeeeen apapappepepearararara anana ceces s (B(BBututlel r rr 202202020202220003030000 , 2202020200002002000000707;MiMiM lwlwwaauaua kekeee e 20200505) ) anand ddd nininin neneneneeee w w wwininnss s ssss iininininninni t tt t tttt tt tthehehehhhhhhhhh NCNCNCAAAAAAA MMenenss B Basaskekek tbtbtbbbalalaalll ll ChChChhhCChamamama pipipipipippiip oonononononnonoooooononono shshshshshshshshhshshshhhshshshsshshshhss ipipippipipippipipiipipippipppppipipipip ininnnn t tthehehe p pasasa t t seseveven n seeseasasassononononono s.ss

    InInn o oththherer s sspoporttts,s,s,s,, L L LLeaeagugugugggugggueee teteeteamamams s shahaaveveve w wononn a at t leleasast t t t onononne e e eeee gggagagaggagagamemememe i i in nn ththeieir r rerer spsppececctitiveve NNNCACAAAA A AA ChChChChChhhamamammamaaampipiononshshipips s eaeachch ofoff t thehee l lasastt seseveveeeven nnn seseeeasasasasasa oonons s inin m menenss ssococcecerr (M(Mililwawaw ukukukukukeeeeeeee 2 2 2 2200000002-2-2-2-2-2-2 005055, , UIUIC C 20200606-0-08)8), , wiwithth UIUIUICC C jujujjuststs o oo onennneeee w wwww wwwwinininininiiiininin a aawawway y frfromom t thehe CColo leegegeCuCuCuCuC p pppppp iniininin 22 2 220000000000 7.7.77.. IIIInInnnI ss ofoftbtbalall,l, LLeae gugue e teteamams wowww n a gagagamememeee i i iiinnn n n thttht e e e nanatitiononala touournrnamenttfofourur s straiighhhghtt ttttt yyeyearars s eaearlrlieier inin thehe ddeccadade e(U(U(UICICIC 22 2000002,22, 2222000004;4; W Wriighght StStatate e 20200303;;GrGreeeeee n nn BaBaBaBay y y y 222020202005050550 ) ) whwhile adadvav ncn ining g inintoo the e sesecoondndddd r r r rououo ndn iin wowomemens sosoccerer ththtt rerereree e e ofo thhehee l lllasast t fi veve sseaeasosonsns ((DeDetrt oioitt2020202004040404, , , MiMiMiMilwlwaauauaa kekkek e e 20200505-06)6).

    The Horizon League

    3

  • 2009-10 UDM Mens Tennis Year Book2009-10 UDM Mens Tennis Year Book

    The Horizon LeagueGrGrGrrrGreeeeeeeeeee nn nnnnnn BaaBayyy s wowowomemenns s s s bababababaabaassskskskketetette bababab lllll

    teteteteaamama aaaaddddddd ededededed ttt tt o oo ththhatatttatat rr r r rrssssssumummummumum wiwiwithththt a aa vivv cttctorory y in tt ttttheheheh 22 200000000000000777777777 7 NCNCNNNCNCNCNCNN AAAAAAAAAAA WWW Womomennenssss BaBaB skskettbaballll CCCChahahaampmpmpmmpmppmpmpmm ioioioioiooioioonsnsnssnsnsnsn hihihihiihihhipp.p.p. BuBuuBuutltltltlererersss ViV ctc ororo ia MMiti chchelelelelee l l l l l bebebeebeebeb cacacacacacacamememememmmmm t tthehehe L LLeaeagugug ees s sfi fifirsrst t NCNCN AAAAAA iindndndnddivivivivviivvididididdidididuauauauauauual l l chchchc amammampippiononon w wwheheheen nn n nshshshe e e wowow n n thththt e e e e 3,3,3,3,3,3,000000000000000-0-00-00 mememeteteter r r stststteeeee plplplpppp ecececececcccccecechhhahahhahasesesee atatatatatatatattatataatatatataataa ttttt tt tt hehehehehehehe 2 2 2 22 2000000000005 5 5 5 55 NCNCNCNNCNCCCAAAAAAA O OOOOutututu dodododoororororororo T TT T T T Trararararackckckk a a ndndnd FFFiFiFiFFiFiFiiieeleleleleee dd dd dd ChChChChChChChhChChC amamamamamammampiipipipipp onoonono shshshhhipipiiips.ss.s.s

    AAACACAA ADAADADEMEMEMMEMMICICICICICIC S SSSUCUCUCCU CESSSSHHoHHoHoHoHoHoHoH riririririzozozon n LeLeLeagaggueueue s s stututudededentntt-a-aththththhleleetetetetetes s sss aalaala soso

    exexexexexxceceececel lll inininininnn t tt ttthehehhhhehehheh cc ccclalaalalaasssssssssrororoooomomomo a a s s s momomorereerer ttt ttthahahahahah n n 50555000 hahavee bbeeen n naamemed ddd totototooo t ttt tthehehehehhehehee A AAA A Acacacac dededeemimimimimimim c ccccHoHonoon r RooRollll e eaccchhh h ofofofofofofoff tt tt tt ttheehehehhehe ppp ppppasassasasasasasastttttt ttt sesesesseseveevev n nn sesesesemememem ststss ererrrs ss fofofofofooofoorrrrrr r cacacacacacacarrrrrrrrrrrrrrrrrrryiyiyiyiyingng aa g graraadededed -p-p-ppppoioiioo ntntt avavavavererereragagagagagaggggeeeee e e ofofofofofofof 33333 33 333 222222.2.22 o or r beeb tttttttere , inclclududininng g g momomomoooorereeererr ththhthththtthhananannnn 66 666666000000000000 ff f forororor t tt thehehee lllasaaaa t foofof uru ssememesestetetersrsrsr . .. TTTwTwTwTwTwTwenenenentytytyty-f-f-f-fiivivive ee ststststududududenenenentt-t-atatthlhlleteeteteses wwerereree eee nanananamemememedd d d totooo E E E ESPSPSPPN N N ThThThThe e ee MaMaMaM gagagaagazizzzz nenene/C/C/CoSoSIDIDA AAcAccadadememicicc A Allll-D-DDDDisisisstrtrtrtrt icicicictt t t teteteteamamaams s inni 2 200008-8-0909, , whwhilile e e eieighghght t t eaeaeaearnrnrnrnedededed A A A Acacaac deddemim c c AlAll-l-AmAmmAmerere icica a hohoononoorsrs..

    COCOMMMMM UNUNNNITTITTY Y Y Y SESESEERVRVRVVICICICICCEEInInnn a aadddddddititioioon n n n tototo ii i tststs a aa aththththleleetitititicscs s ssucuccecessss, ,

    ththhthththththtttthtththhtthththhthe e ee HoHoHoririr zozozozooonn n nnn n nn nnnn LeLeLeLeLL agagagagueueue h h hasasas ssssececurureded a a wwelell-l-l-eaeaeaeeaeaeaeaeaaaeaeaeeaaeaaeeee rrrnrnrrnnrrnrrrrrrrrrrrnedededde r rrreeepepepepepeppepepepepepeppepepeppepepepepeppuuututututtttutuuuuuuuuuuttutuuuu atatataa ioioioion nnn fofofor rrr ititti s ss coc mmmmununnitity y yseseseseseeeeeeeeseeseeeeeeeeeervrvrvrvrvrvrvrvrvrrvrvrvrvrvrvvrvrvrvvvrvviiciciccicce eee e iinininininiininniinninnnininninnnnnnititiititttitititittttitiitititiiiititiiaiaiaiaiaiaaiaiaiaiaiaaaiaiaiaiiai ttttittiitt veveves.ss..s EEaEachchc J Janannuauauaryryry, ,mememememmembmbmbmbbbbbmbbbbbbbbbbbmmbbbbeererrereeeeeeeeee i iinsnnssnsn tiittiitututututitititiononons s ss papapartrtneener r wiwiw ththth l llocococcalalallala eleelllellle emememememememememememmememeemememeeeememeemmmeemmmemmeneneneneneneneneneeneeeeeneneeentatatatatatatataatatatatatattattatatt ryryryyryry s sschchchc oooooolslsls f foror a an n arara t,t,t,t m mmmusuususssusicicicici ananananannnnd dddd d d d dd ddddd esesesesesessasasaaaaaaasasayy y y y cococooontntnnteseest t t hihhighghg liliighghgghtititingngngngngg t tttheheh llililililliilllilil fffefefef oo of ff DrDrDr. . MaMaMaartrttinin L Lututheheher rr r KiKiKiKKiK ngngngngngngngg,, , JrJrJrJrJrr.. wiwiiwiwiww ththththhhththt wiwiinnnnere s s rerecocoogngnizizzededededde a aa a a aat t t t t LeLeLeLeLLLeagaggueueueu ggg amamesesessesss onnonononono tt t ttthehehehehe w w w wwwwwweeeeeeeeeeeekekekekekekkendndndndndndn o o off ff MLMLMMMLMMLK KK K DaDaDaDayy.y.

    ThThThThThTThT e eee HoHoHoHooririririr zozozzzzozoozon nn LeLeLeagagagueueeee S S S SStutudeentnttntnttnt-A-A-A-A-A-AAththththhhlleleleleleletetettteteeeeee AddddAddvivivivivivissosososososss ryryryryryyyrryry CCCCCCCCCCCCCC Comomomoooomomo mimimimimim tttttteeeeeeeeeee ( ( ( ((SASAASASASAAACACACACCCCC))))) )) ) alalalalalalssso hhhasasasasasasasasas ccococoococonnnntntttn inininueueuu d d a trtradadaddadddadaditititttti ioioioooiooioioiooooioion n nn n nnnn n ofofofofofofoff w w www wwwororro kikikingnggg w wwwwitititithhh hyyoyoyoyoyoyoy uututh h h h ininiin I Indndiananapoopoolililililis ssssss dududdudududududddududddddduriririrrrrr ngngngnngnnnnn ii ittsts aa aannnnnnuauauau l l llsssususususus mmmmmmerere m meeee titingng. .

    InInnn a aaadddddddition, sevevereralalaa L LLLLLeaeaeaeaaeaaee gugugggggg e e ee mememenn sbbbababbabaab ssskketetttbbaballl cccoachchese ccoaoaoachchhchc eededddede b bb b bbarareffefooooooottt totoototooo s s ssupuppu popopp rtt SSSamamararititanannss F FFeeeeeeet,tt, aaa a ndndn t thehee LeLeLeLeeeagaagagagagagueueueesss schhoolss aandnd f faanns s ss ddodood nananananan tetete t to o KoKoKoommemememmmm nn n n ffoff r tht e e CuCurere f foror b bbrereasassasa t t t cacacaaaancncncncnccereer awwawawarararrrrrrenenenennneneennenneseesess s duduriringng i tsts a annnnnnuauauu l l wwwowoomemememememem nnns ssbaabasks eetetetetttetbbbababababbb lllll chahampmpioionsnshihip.p.ppp

    OOnOO cccccamamamamamamammammma puuppus,s, s stutudedentnt-a-aththleleleeetetetettet s s s hahaaaaah vevevevevve raaraisisisis deded mmmmmmmononnnononoo eyye aandnd a awawarerer nenneessssssssssss f ffforororo ssucucucccuch h h h hhcacacaaususu eses aaaaass s s bbbbrbbbrb eastst c canancecec r,r, dddddiaiaiaiaaiai bebebbebebetetett s s anananananand dd dddhuhuhuh rrrricicananeeeeee ee rerreeeerelil efef, , whwhilile e e hohhohoooststststststinininiinggg g blbllooooooo d dddrdrivivveses, , neeneeeigggii hhbhbhhhhh ororhohoododddodd c cc cccleleleleleeanaanananana -u-upspsss, , , BiBiB g g g BrBrB ototo heheher/r/BiBiBiiggg g gg SSSSiSiSS ststerere pppppprorooorooogrgrgrgrgrrgramamamamaaams s and d mmmomorere.

    SPSPSPPOROROO TSMAMAMAMANSNSNSHIHHIPPOnOne e of thehehehe H HHoorrizizonon L LLeaeaeae guguguguees s s popopopoininintststst

    ofofofofofff e e e e e emphaaaassisis s s isis ffosososteteteririr ngngngn c ccololo leleeegigigig alalall ee ne ne ne ne nnv iv ro n mn mn mn m e nee nt st s f fo ro ro ro c cco mo moo p ep ep ep t it it ii t it it i o no no no n amamamamamong g ssststududu enent-t-ataathlhlhletette eseses, , cococooacacacachehehehes,ss, adada mininiiistststtrarararrr totoorssr aandndd fffanana s s ss inininin a a a p proroo-a-a-aactctcctivivive e apapproaoachchchchh. A AAmmomongng t thehehe v vvehehehiciciccleleless s isis tttheheheeeh Ethicaal l CoCoCondnddnn ucuct tt PlPlP ededgegege, whwhicichh isisis sssigigiggggnneneneneneddd ddeaeaee chch seaeaasososooon n n n n n bybybb ss stutuudededed ntnt-a-aaaaththththhleleleleettetetteeesss,s, coooaacaca hehes,s oofffffficicicciaiaiaalsllsls, , , anananand dd d ccacacacampmpmpmpmppususuussuss aaaaandndndnd LeLeLeLeLeagggagueueueuue a a dmdminisistrtratatttororors.s. ItItItItItss sss pupupurprpposose is totoot m mmmakakkaakaake e e alalallll l thththththhht eeeeeeee iinininnninininnnvovovovvovvvvv lllvlvlvedede g groroupups s awawarraraaara e e ee ee ofofofofooo tttheheeh H Hororiiizizononnnnnnn LL L L eaeaeaaee gugugugugugue ee eee exexexexexpepepepepepectctctctctctatatatatatatioioioioioionsnsnnnns o ooofffffff f beehhahaahh vivivioooror ddurining g cococococ nfnfnfnfnfnfnfeereererrere eneneneenenene cecececececece eeee e evvevevvevev ntntntntntntnts.s.

    GGGOGOOOG VEVEVEERRRNRNRNRNANANANANANCCEECCECCECCCCECEThThThThThhhTTTThee e e e HoHoHoHoHHH riizozonn n LeLeLLeLeLeeLeLeeaaaagagaaaggggueueueueueue i iii i issss ss gogogovevevevevernrnrnnnnedededededed bb b y y y a a

    BoBooB aarararrrrd d dd ofofo D Direecececce tototototoooootorrsrsrrs c comomprrised of thhe e teteeennn n nmemem mbmbmbbbm ere iiiiinsnsnsnsnnsttititittiittutututt tit ons chief execuc tive offioffioffioffioffi cecec rsrssss.. D DDDDDDrrr.rr. DD DD DDavavid Sweet, PrPrese ididenent off YoYoYoYoYoununuunuu gsgsstototototootottoowwwwnwnwnnwnwn S Stat te, seserves aas s Boararrrd d d Chhair rththht roroooougughh h h JuJuuuuunen 30, 2010.0 RoRon n n StSttrororollllllo,o,o, ExEExxececceccututu ivvvve e ee DDDiDiDiDirer ctor oof f InInInnntetetetetet rcrcrcrcololololo lllelee iigigig atta e eAtAttAtthlhlhlhllletetete icics s attat Y Y Y YY YYouooo ngngnggngnggsststststs owowo nn n StStStatatate,ee, s serererveveves sasass c ccchhahah irir ooooooof f ff ff thththththththhhhheeeee ee EEExExExecececututivivee e CoCCoCounununcicicil,l,ll,, a a andndnd ChChhririririsssts innnnnnnee ee ee eeee MMMMoMoMoelellelerr,r,r, A AAsssssss iisisi tatantnt A Aththleletitic c DiDiDiDiDirerrerectc orooorororooro /////S/S/Senenioiooorrr r WoWoWoomaman n AdAdmimininiststraratotor r atatatataaaa C CCCleleeeeeevveveelalandnddd S S Stttatatet , isis tthee VVicce e Chaiair r anand dSShShheeeieieee lalaal PPatatttetersonon of f ClC evelanand d Sttatate eseseeeesseerrvrvvesese aaaas s cchhaiir off tthehe Facculu ty Aththleetiticscs RRRRReeRReprprp esseseneentativev s.s.

    LELEADADDA ERE SHIPPJoJonanan ththaan BB. (Jono ) LeLeCrCronone iss iin n hihis s

    18118thhh yyear r ass C Commim sssionener r ofof t thehe HoHoriizzooonn LeL agagueu , hahavivingng b been n nanamememmm d d tototo t thehehe pposositition onn MMaya 11,1, 1 199992,2, a andnd i is s ththhe e fi fi fififtftf h-h-lolongngesst t tetenunurered d cocommmmisissisiononerer amma ononnongg g g ththe e 313 DDivisioion n I I coconfnfererenenceces. HeHeH i is ss thththe e fi fi ftfth h cocommmmisissisiononerer iin n LeLeagagueue hihihihihhiststs ororyy,y,yy sss sucucceceededining g DaDaninielel BB. . TTucuckekeeeerrrr DDiDiiDDDDDDD EEdEdEdEE wawaaaaaaaardrdddrdrdo oo (1(198989-9-9292),), J Jamameses W W. . ShShaffaff eer rr(1(11(111( 9989888899999999999 4-4-4-44 89999999899)),),)))) CCCececilil N N. CoColelemaman n (1(198980-0-848488 ) ) ) aannnnannnnana dd d ddddddd ddd JaJaaJaJJ mememeeeemmem s s s s J.J M McCcCaffaff eeeeeeeertrtrrrr y y (1(19779-80080).).

    LeLeLeLeeeLeLeCCCCrCrCrrCCrCrCCrCCC onononooooo e ee isissisis i in nn ththhe e e sesecocoonddndnd y yyeaeaeae r r ofoffoff a a foofoouuururrrruru -y-y-y-y-yyy-y-y-yyeeeaeaeaee rrrr rrr teettttt rmrmmmmm o o n n thththe ee NCNCNCCAAAAAA D DDivivivisisissioion n I I LeLeaadadddddddeerererrerrree shshs ipi C CCCCCCCCCCCououououououououoouuouo ncncnccnccilililli a a aftfterere c comomplpletete ining g g a a fi fi veeve-y-yyyyyyyy-yyy-yyyyyeaeaeaaaeaeaeaaear rrrr teteteeteet rmmmmmmm o o oooonn nn nnnnnnnnn ththhhheee ee DiDiDiDD vivivisisisionnonnn I I M MMeneensss BaBaskks eetetettetetetetbbbaabababababbaallllll Comommmmimimiittttttttttttttttttttteeeeeeeeeeeeeeeeeeeeeeeeeeeeee......

    VIVISIIBBIBIILILILILL TYYTTThT e e HHoorirrirrizzoozonn n LeLeeagaggueueueueueueeeeueuee h hhhhhasa enhhhanananancecececeedd d d ititits ss

    memediiidiaa viisssisibibibbbilililitytyy wwwitititititititttttthh hh h h h h aaa a numbmbmbmbbereree

    ofofo iininititiitiatattatativivivvivesesesessses. . TT TT Thehehehehh LLeaaagugue is in a fifif veve-yy-yeaear r agagrereeeeememememmmmemeemee eeenennenent wiwithth ESPN that inininnclclclccc udududu esese s sselelececteted dd rerregugulalar-r-season mmens bababaskskskskskskkketeteteteteetbababbbbb llllll a actctioioon n (E(ESSPN2) and thememennnss chchhhhcc amamamammmamamammmmppiiononnnshshs ipip g gama e (ESPN) and fefeatururesess i iincnccccncrereerrerreasasasa eeded eexpxposures each year onon E ESPNUNUNN p pp lulululull ssss ininclclususioion in the annualOOReReilillyy E EESSPSPPPPPPPPPPSPPNNNNNUUUUNNNNU BBrara kkckketBusters, one of cocollllege e bababab skskkkks etettettee babab lllls premier in-season eve ene tsst .

    InInnn aaaaaddddddddititittioion,n,n, tttheeh H Horizon League haspapapartrttnenenenererereed dd wiwiththh CCC BSBSSB College Sports s to prppp ovovididde ee ththhe ee offioffioffioffi ccicc alalal ww ebebeb ssiti e at wwwwww.horirizozozoonlnln eaeagugugue.ee.oooorroo g,g,g, w wwhihih chcch o ffere s ththemomoostst c ccoommompprprp ehehehenenee sisisivevevv c ccoveragage e ofof HoHoriririzozoz n n LeLeLeagagagagueueueu t t tteeaeaaeaamsmsss o o o on n nn ththththe eee nenen t.t.

    HOHOOORIRIR ZOZOONN N N LELELEAGAGAGAGUEE NNNN NNETETWOWOWOWORKRKRKRKThThT e e HoHoririzozozoon n n LeLeLeeaga ueeee iiiii iss ss a a reecocococogngngngnizizizizededede

    leleleadaderer iin n n vviviv dedeeeeo o oo streamamammammammamminnnininng,g,g,g,g,gg,gggggg thrououghg thththe e HoHooririzozoonn n n LeLeLeeeaaga ue NNNNNNetettetwowowowowoowowwowowowowowworkrkrkrkkkrkrkrkrkrrrrrrrrrrrr ( ( ( ((HLN), hahaavivingng ppproroodudududd cecececed ddd moreeeee t thhahahannn n nn 1,1,1,202020220002002 000000000 00000 frfrfrfrfrfrfrfrfrfrfrfrfrrfrffrfrf eeeeeeeeeeee , ,liivevee eeveventntts s ss inininin t ttthehhhe passsttt t foffofofofooouuuuuurururu yeaaarsrs. HHLLLLLHLLH NNNNNN NNNNNNNNNallla sososo ff ffeaeaeaeaeatututuut rereres s vivignettttttetteteeesss s ss sss ooofofofof a all 19 LeLeLeaggaa ueeeeeu chchhchamamamampipipip ooononshippppps,s,s,s,s,s,s,s,, w wwwwwwweeeeklk y y highhhlil ghghhghhttt tviviviidedededeosososo durrrrrininininnniningg ggggg g g ggg ththththththththththththe e eeeeeee mmmmememememememmememem nnnnnnnnss s ananand d d woow memennnnsssssssssssssssbababaskkskskkks eteteteetetetbababababbbbbaalllllllllll s eaeaeaasososos n nnn anananand ddd ototottheheheheher rr spspspsppececececececccccecccciiiiaiaaiaiaaiaiiaaaiaaaiai lllllproggggggggggrrararararaaammmmmmm inng.g

    CommissionerJon LeCrone

    4

  • 2009-10 UDM Mens Tennis Year Book 2222000000000009999999999--------11111111110000000 UUUUDDDDMMMMM MMennss TTTTeeeennnnnniiisssss YYYYeeaaarrr BBBooookk22200000000999999999--------111111111000000 UUUUDDDMMMM MMenss TTTTeeeennnniiisssss YYeeaarr BBooookk

    Season PreviewIfIfIfIff t tttttthehehehehehehhe fff falallalllllll sesss assa on is

    anananannny y y y inininininddiddddd catiionononnnnn,, , ,,,, ththththe UnUnUnUnnnivivivivivvverererererererersisisss tytyty oof f f DeDeDeDeDeDeDDetrtrrtrtrtrtrroioioo t tMeMeMeMeeercrcrcrcrcrcy y y y yy memmemmm nnssss ttteetennnn isisss teteeteamamamam hhh h hh hasaaasasaas ccccomomomomo ee ea aa a lololololooongngngngngng w w www w w wayayayayyyyy ssssss siinnniiincecccecec thhthhe e e e prprprprrrogogogogogogogograraram m m mmmmmmm wawawawas ssrereviviviviveveveveddd d d d llalalalalal sststtttttt y y yyy y y yyeaeaear.r. I In nnnthhe e fafafafallllllll, , , , ththththhhheeeee eee eee TTTiTiTTiTTTitattatatatat nsns wowowowowonn nn sisisisisisix x x x sississs nnngngggggnggleleleeelees s s ss sss fl flfl fliggii htht tititltlt esesss aa aandndnnnnnd aaaaaa d d d ddddddoououououooououblbblblb esese chchhamamamampipipipiiiononononsshshhhhshhhsshipipppipipipip. .. . .. EvEvEvEvvenennee momomoorererere i i i impmpmpmpmpprrereeeessssssssssssssssivivvvivi e e eewawaas ss s ththththe e eee totottotopp ppppp dddodododododood uububuublelelees s ssteteeamammam oo oof f f seseses nnniiiin orooroorrroroo P PP jojojotrtrs ss(P(Petetette)ee)e) N NNNecececececccajajajjjevevveevss s s anand d frfrfrf eseseseshmmhmhmhmmaaanannna AlAlAlexexexex LL L Latatatatoosossso ininni skskkskky y ymamamamakikikik nggngngng t tt hehheee q q quauauaaartrttrttrterererr---

    fi fififi nanananalslslsls o oof f ff thththhhhe e e e ITITI A AMiMiMiMidwdwwdwdwwwesesesee t t t t ReRReR gigionnonnnnnaaaalaal ChCChChChamamamampipipionono shshipipipipipipppi s.s.s.

    IIIt t t wwaw s a a ggggrgggrgg eaeaeaeat t tt accooompmppppmpmpplilililishshhshshshmemeeentnttnt f f f forororor nn n notototot ooonlnnnn y y DeDeDetrtrtrtroioiit t asas a ssececececececcce onononndd-d-d yeyeeearararar prprprprogogogograram,m bbbbbbututtutututututut f fff oororo tt thehhe w wwhohoholelee H HHoororizizizononon L Leaeaguguguuuueee,ee,e,ee sasasasaididid hhhheaeaaad d ddcoacch h GrGrGrG ananannttt tt AsAsAsAAshehehehehehehheher.rr. ThThe e MiMiM dwdwdweesestt hhaas s soososommmeemmemmmmmme o o oof f thttht e e bebbeeststss teteteteteaaamaamss iin theh c cooouuuouuntntntryry, wiithththth qquiiuiuitetetete aaaa ffewew rraanannnankekekeked d vevveryry h hhigigigighh hh and for our teteeeaamamamm tto o plplpplayayayay w w wwitith h ththemememm s shohooowwwwwswssw w wwwheheheherererere w ww we eee hahahaveveveve come aas s aa pprprroooogggrararraram.m.m

    ThThee 22009999-11--1110 00 seseseeasasa ononon wwwililill l hahahaavevevee f ffouo r Tiitaaaaansnsnsns r rr retetetetururururn n nn frfrf omomomom l l l lasasasast t tt yeyeara s ssquuquuadddadd,, wwhwhwhwhw icich hh popooststededdd a aa a 5 5-1-13 3 duduallll rrr rececececorororord d dd inininin i i i itstststs fi fi fi fi r r r rstststst action aaaas aa aa vvaaarsrsrsrsitity y prprp oogoggrararaam m m sisincnce 191 9595. TwwwwTTT oo o o seseseseninininiorororors,s,s,s, t t t twowowowo sosophppp omommorrreeeseses aaandndnn fifi v ve e e frfrrfresese hmhmenen wwili l weweaaara ttthehehehe r r rredededed, ,, whwhwhwhitititite e e e anananananndddd blblblblblueueueuue aa aa as s s tthhhe e teteeamam looooksks tt t to o o o nonononot t t ononononlyly i immmppmprororor veveveve i i i itstststs o o ooveveveverarararallllllll rerererecocococordrdrdrd, ,,, buububub t ttt momoveeve u u upp pp inininin tt t thehehehe ccccononononfefefeferererer ncncnnce ee assssa wwelelelell.l.l.l.

    TTTTT hehehehehehe g ggggoaoaoaal l isiis tto oo wiwiw n n a a championshipppp,,, s ss saiaiaia dd d ddd AsAsheheheher.r.r.r. LLLLasasasasttt t yeyeyeyearararr w w w wwasassassa j jjususust t a a ststs arart t annd d I did not tt ththtt ininnnkk kkk weewee wowowowooooululululd d dd bebebebe t t tthhihihiihis s s fafaar r r alalononong,g,g b bbutu wwe e hahavve guys lilikekekekekekek PePePePetetetete a a a andndndnd PP P Patatatta ririririckckckk l lleaeaeaaee dididid ngngng u uus s s s anaa d d a a grgrgreaeat t yoyounnu ggggg grgrgrgrououououp p p p ofofofof p p p pplalaallayeyeyeey rssrs t tthahahahahaaat t I I I thththinink kkk aararaa e reeer adadaa y y tootto p plalay y anna dddddd dddwiwiwiwin.n.n.n.

    NeNeNeNecacacacajejejejevsvsvsvs w w w wilill l bbebebe b bbbacacca k k k kk tototot ll leaeadd dd thhthttt e e teeeteamam a at t NoNoNoNo... . 1 1 1 1 sisisisingngngnglelelelees sss ananananand d ddd dodododododooububbbu lelelees.s.s. T Thehe s ssseeneeenioior r wawas s ththththe e e e dedededefi fi fi fi ninininin titititionononon oooooooff f f f anananannn i iimmmmmmmmededediaiatete iimmmmpm acct t plplayayerer gagagagarnrnrnrnererererininining g g g HoHoHoHoririirir zozozzozzon nnn LeLeLeLeLeagagagaagueueue P PPlalayyeyeyeyer r and d NNeNeN wcwcomomerer ofofofof t t t thehehehe Y Y Y Yeaeaeaear r r r acacacaa cococococolalaalaaadeddded s.s.s.s. W W W Wititith h ththee e e ee hhhohohh nors, , hehee bebebebecacacacamemememee t tt thehehehee fi fififi rrrststssts mmmmmmmennnenssss t tttenenene ninin ss s s s s ppplppplpp ayayer in lleeaagagagueee hihihihiststststorororory y y y totototo w w w wininnn b b b bototottoo hh h awawwarararrdsddss i iiiin n nnn tththe e samee sss seaaeeeee soson n afafafafteteteter r r r popopopoststststininining ggg 38383838 tttototototalalala w winiinnnnsss s ss oononnono t thehe seasooon n nn wiwwww thth aa 2525252522 -4-4-4-4 s ss sininininnnnglglglglglesesese rrrececeecororoo d,d,d, i i incncncncncccccllulululululuuddddididdid ngng a a p erfecttt 77-0-0-00-0 mm mara k ininnniin t t tt theheheheh c cccononoonnono fefeefeffererereencncncee,e,e,,, aa aa aaaaa lllllllllllllllll a aaaaaaatt tt NoNoNo. . 1 1 sis ngles. TTooo shhhhowowwoww ththththatatatat w ww wwasasaassass nn no oo o flfl fl fl flflukukuukukukkkkkkke,e,e,e,e,e,e, NNNNN N NNNNecececece ajajajevevevs s cacame backk k k inin t t tthehehe f f f falalala l ll ltotototot t t t taalalalaaallylylylyly aaaa 1 1 12-2-2-2-2--2222 222 2 2 22 sisisisisssssiinnngnggggleleleles s s mamamamarkrkr ,, wiwitht two t ttopop fl fl i ighghht tt ttittit tlttltltlesesesess, , , aa a rurrururururuunnnnnnnnnnnnnnnnn eeereererrre -u-uu-u-up p pppp effeffeffeff o o ortrtrt a at t Ball Stateeee a andnd a a w winin i in nn

    thhhht eeee ee fififi fi fifififirst rorooounununund d dd ofofofof t t t thehehehe m mmmmmmm mmmaiaiaaiiiiin n n n drdrdrdrawawawaw oooof f ththhe e reregigigig ononononalala . . ThThThThaaatatattssss nnn n ototototot tottotooooo mmmmm ene tionononon t t tthehehehe dd d dououououblbllllllblb eseseseeses q qqq q uauauauartrtrtrterererer-fi-fi-fi-fi nn nnalaalaa s s s innnnn t t tthehehe e eeeveveveventntntntt aaaas sss wewweweweewellllllll..

    HHHHHHHHe hahas s ss clclclcleaeaeaearlrlrly y y esesesstatataataaabblblblbliississisiisisisshehehehed d dd hihihihimsmsmsmselelelee f f asasasas oonenen o ooof ff f ththhththe ee e bebebebeststtstst pppplllpplaayayayayayers ini ttheheheh l llleaeaeaeagugugugueee eeee anaanannnnnndd d d ththththe e ee MiMiMiM dwdwwdwesesst,t,t sasasaididid AAAAshshshshererere . .. TTTTheheheehhh bbbbebbeeb ststssts thingngg a aaabobobob ututu P Peteteteteee,e,,eee t t ttthhhohohohhhhh ugugugugu h,h,h,hh i iis s s ththt atatat hh he ee issi aaaa g grereeer atatatat t t t teaeaeaeaeam mmmmmmpplpplplp aayayyyyyer, alwawaawaysysy ww worororo kikik nnnngggnggn h hhhhhhhharaararaaaaa d d d d ananandd d dd heheelplpppininingg gg hiih s s s teteteamamammmamamamam tetetetetes.ssss.s..

    AAAnAnnnAnA otoo her seseniniiororor, , , PaPaaPatrtrrttrricccicici k kk k TTTrTrTTTrTTroyoyoyo l l looooookekeed d dd lililikekekeke h hhe ee rererecococoveveverererered dddffrff ooomommmmmm a a a a s hohoululdededed r r ininnnjujujuryryryyyry ll l atatatate e eeeee lalaaststst ss seaeaeasososon n nn tototoo p ppicicck k upupup fi fi fi v v ve e ee wiwiwiwinsnsnsnsns inininin t ttthheee f f f ala l, iincncccluluudididid ngnngng g g ggoiooioioiingngngngngn 3 3 333333-0-0-0--- t t to o o wiwiwiwin n n ththhtt e e NoNoNo. .. 2 2 fl fl fl igigigghththtt t t tititititttleleleleel atattat thheheehh IIII IPFPPPFW WW FaFalllll II IInvnvnvitittiteee.e. T TTTTrororoooror yy,y,y,y, w ww wwwwwhohohohohhh i iiis s s thththt e e e ununnquququesesstititiiononononababababbleleleele leel adadadadereree oooo ooff ff tht iss tt teaeam mm m aanand d hahaaah s s ss eveveveveeeneenenee a aaatttttttaiaiaiinenenened d d thththe e nininickckkcknanananamemeeeeee FFFaaacacccceeeeee bbb becececececee auaaa ses h hhe e wawawawas s thththe e ee fafafaaacecececece ooooo oo off f f thththe ee neneew ww prprogogograraram,m,m w wwwilililllll l llcoooommmmpmpmmpetttteee ee ee fofofofoforr r r onone e ofof t thehehe t topop s ssinnniii glglglgg eeesesesesee sspopopotstts f fororor U U UUDMDMDMD i iiin n n thththhthee e eduuuualllala sseaeaeaeaasososoon.nn

    WWWWWhen n PaPaaPaPP trtrttt icicick kk isisisi h hh heaeaeaealtltthyhhyhyy a andndndd ccconononfi fi fififi fidededentntntt, , heheheh ii is s s ononnnnne eeee ofofffofo t thehh bbebebessstts pplalayeyeyersrsrsrs oooo on n n thhthee e teteteteeamammmama ,, s ssssaiaiiidd dd AAssAsAsA heheheheheheeh r.r.rr II I hahahahahahaavveveveve ccc coaoaoao chchcheeded himimmm ssiss ncncnccncccceee eee e ee hihhihihihihiihii hghghghghghghghghghghghh ssss s s hchhhchchchchchhhc ooooooooooooollllll l atataatatatat BBBB Broororororoththththththererereerer R R R R Ricicicee e e anananand ddd III amamam e e excxcititied d tototoo s s seeeeeee hhihihihihihihihh mmmm mm plplayay h hhhisisisis fifi fi fi n n n nalalalal s s sseaeaeaeasosos n.n

    TwTwwTwT o o o o ototototheheheher r rr hohhoholdldlddovovoo ererers s s wiwiw llll l looo k toto ss ssstatatatatatayyyy yy ininiiinii tthehhehe T T TTititititanananann lililiinenenene-u-uu-u-u-uu-u-uuupp p inininin s s ssopopopophohomomoorereress s DaDaDaD vivid d StSStaba leey y ananannnand ddddd NiNNiNN ckcck T Tolommmmo eeeeieiieee .. . . StStStStabababableleleley y y y gagagg rnrnr ererredede 1 10 0 0 wiwiww nsnsns a as s a a frfrreseee hmmanan, , whwwhwhwhwhhhhwhhww ilililiililiiile e ee Tolooommmememememeememm i i i iwawawawas s s s hohohoonononon rered d wiwiththth t t thehehe CCCCoaoaoaoaachchchss AAwawardrd llasast t seseseeseeeasssssassaaaa ononooo aaffftfttttterererere fi fifi fififininininishshshshiniining g ggg ththirird d onon t tttheheh t ttteaeaeaeam m m wiwwwiw thththht 224 44 tootatal l vivictctcttoroorororoorieieeeieiees sss aaanannnnnnndd d ddddd111111111111 ss s inininnglglglg esesese w winins.s. H HHisis 1 133 3 dododoububublelel s sss wiwinsn , alll l ofof wwhihihihichchhhcc cc c amammmamamamme e epplplplplppppppp ayayayyayyayinnini g g g g wiwiiwithth T Troroy y atat N NNo.o. 33 333, , weweew rerer aaalsso o tit eded ffforor t ttheheheeee t t tt teaeaeaammmm mmleleleleeeeadadadadadaaaa ...

    BBBBBBBBBBBBooototttoto h hhhhhhh ofof t thehesese g ggguyuys s s wowowoorkrkrk e eextxtx rereerememem lyly hhara d d anand d hahaahah vviviiiingngngnnn a a aa yeyeyeyearaarara ooooo of f ff exxeee pepep ririeneneee cece u undndereer tt theheheiririr b bbelelt tt wiwillll h helelp p p ththhememmmemm aa a ss s ss wewewewwellllllllllll asasaas g gggivivivvvvvivvvve e eeee ooouuo r r teteamamamam s somome e gogogogooodododod d ddepepththh, aaddddeded A Ashshshherereee . .

    IfIfIfIf t t t thhheheheheheeheeee T TTTiitittanans s ararrre eee e tototot ttt takakaka e ee aa aaa ststststepepepep uup p inn t tthehe H Hororizizizoonono L LLLeaeaaaaaaagguguguugggg e,e,e,e itititit w w wwililili l l bbebbebbebeebbbbe bb bb bbececauauseseee t tttheheheiririrr fi fi fifi vv vve eeee frfrffrf esese hmmmh enen, , LaLatotosisiinsnsnsskykykykyyy, , CChChC ririiiiriiis s sChChChCheueueueungnggggggggnggng, , , ,,, CCCCChhCC riris ss s DiDiD didid o,o,o, RRRuususs ss KoKoKK vavavar r anand d CeCeCesasassar r r EsEsEscococcobababababb r r SeSeSeSerrrrrananananoooooo,,,,, w www wwwilll l hahahah veveve gg groroorownwnwnww u uup pp trtrememe enene dododoousususslylylyl s ssininni cecececec a aaarrrrivvvvvivinnniini g g oonon c cccamamamammmmppupupupuuuuus.s.

    Senior Pjotrs Necajevs

    aaaaUUUUMMttttaaaatttrtwttccmmmwwtt((((aaAAAAmm

    fifififi

    Head coach Grant Asher

    5

  • 2009-10 UDM Mens Tennis Year Book2009-10 UDM Mens Tennis Year Book

    Season Preview

    L Latatosossinini skskky y y y hahahahas ss alalalrererereadadadadyy yyyy mammamam dedeeded a an n imimimimpapapaactctctct s seeeeeeen n n n wiw tththth hihis s pepepep rfrfrfororormamamancncncn e e e atatatat t t tthhehehe r rregeeegioioooonanaanal l wiwiwiw ththtth d dd dououououblblbb esesss p pararrrtntntntntntnererereereererer NeNeNeNecacacac jejejevsvvs. . .. HeHeHeHe aa a alslslsso o oo wewewew ntntntnt 5555-4-4-4-44 iiin n ssingngngn leleees s s wiwiwiwitththth aa flflflfl i iiighgghht tt ttt tititititititiiittltltle e inin thththhththththththtthhtt ee e e eeeee fafafafaf llllll oo oopepepepepepepeeppeeepepepeep nneneneneeennennnnennn r r r r atatatat I I IIPFPFPFPFPFFW.W.W.W TTT Twowowoo o of f f hihihih s s s fofofofourururu s sininglglglgleseee s sssssseeeeetetbbabacckksss s wewewewwewewwweweeeww rreereeerrerererere i i iiii i n nnn n thtthhhhthhhhhhrerererereeereeeree e e eeee ee seseessessssessss tstststs, , wiwiww thththhhh a aanonooththt ererrr l l ososososss s s cocoocomimmimimingngnng i ii innnn n nn ddrdrd opopppipipingng aaaaaaaa a aaaaaa tititititititiiiititiiebbbbbebebebebebrerereeeeakakakkkkkkkkkkkkkka ererererererer iiiiiii iiii iinnnnnn nnnnnn nnnnn boboobob thththhh s ssetettets.ss

    HHHHHHHHHHe ee rerererereeeeeereeeeeeeeeallaalaaaaaaaaallylylyyylylyy s ssshohohoh wewewed d dd tththhatatatatt h hhe e e cocoooulululu d d dd cococooccomemememe iin n nnn aaaaanannaa dd plplplayaay rright awawawwawawawawawwayayayayayayayayayayayyayayayy, , , esesesesesesesesseseseseeseespepepepepepepepepppeeppepeppppppppp ccicicicc alalallylylyl a aat t thththhhe eee ITITA AA chchchchamamamampippip onononooo shshhhipippppsss s s s wwhwherrere e e he lefft aananannaananannaaaaaa i ii i i i impmpmmmmmmmmpmppmmmmmpmpmmm rerererereresssssssssioioioiion n n ononon a aaa l ototott o o oof fff BiBiBiBig g g g TeTeTeTeTTeTen n nn ccocoacaaccheheheheeesss,ss, ssasas ididdd A AAAshsherer.

    ChChCCChChC eueueungngngg pp p icicckekeked d d upupupp fi fififi v v v ve e e e e ssisissisingngnggngleleles s s wiwiwiw nnsnsnsnns iin n n n n tttthhthee ee faalllll,, inincludinng ga a aa wiwiwin n n inini t tthehehe fififi r r rrstststs r r rrououououououo ndndndndndndnd o o off f thththee e ee ITITITITTAAA A MMiMiMMiidwdwdwwdweeeeesee tt t ReRegigigioononaal QuQuQQuQuQ alaalallalaalifiifififiifiififi e ee eer.r.r.r.r.r.r. H HHH HHHeee e ee e alalalalalalsososssos t tteaeaeaaamememememedd d wiwithth NNNececececajajjjjevevevevvvvevvvvssss s ss fofor r thht rreeee e wiw ns ananananana d dd d dd d a a aa ruurururunnnnnnnnnnnnnerererereer-u-u-uuppp aapaappepeeearaaa anncececece iii in n thththththeee ee chhhchhhhhaaaaammaamaa pipip ononnnsshhs ipip matatchch ataaa tttttthehehhheheehee FFFF F Fraraaararraranknknknknkknknknknknkk B BBBB B B Beeeeeeeeemamamamam nnnn InInInInvivivivitttatatittitit onononononalal.

    CCCCCCCChhhrhrhrhhhrh isisis i is s asaas ttalalalallenennennnenenee tetetetetetteed ddd d d asasassass aaa aannynyn ononee e onono tthheeeeeeee tttt teaeamm,m, sasaas idid A Ashsherer. HHHHHHHHHeee eee cacaaan n nn hihiit t somemee uu uunbnbnbbnbbbbnbnn eleeleleleeee ieieieievavavvavv ble ee baballls,ss,s,s bbbbbbuutuutututttuuut tt ttheheh ttthihihiiingngn hhee isi ggggogoogggogog iinniiii g g g ttotoo h avaa e tot wwoororororo k kkkk ononnononno ii iiiis sss hihihiss s shshhhotott sseleleceececcccctitititt onn aa anndndn o oncnce e hehe dddddodoooddd eeeesese t ttthahahahat,tt hhe wiw lll b be e aa aa fofofofoforcrcrcrcce.eeee

    DiDiDiDiDD didid o o o o anana d d Kovav r wiwilllll g g ggggiivivvive e ththththhhe e TiTitatansns aaddddddeeededdeddee d dd d eppppepppppppthththththththththth, , , bubut t boboboooboooththththh www ilillilll loookook to o crcracackk kkk ththththhhee e e rorootataatat tiionon. . DiDidid o o brbrbrbrbbrbrbbbrininnni gsgsgsgsgg aaaaaaaaaa aa nnn nuumumbeber r ofofoff a aaaaaaaacccccccccoololadadadadess t o o DeDetrtroioit,t, i iincncncncnclulul didiidid ngngngn b beieingng a a fffffououuuuoouoouo r-r-rr-rrr tititit mmmememeeem mememeembmbmbmbmbmmmmmm erererer o f ththe e AlAll-l-StStatate e AcAcAccA addaada ememmme icici T Teaeam,m, thhrhhhrhrhrhhreeeeeeeeeee-t-t-t-t-timmime e eee AlAlAlAA l-l-lMaMaMaacocoooooocooccoommmbmbmbmbmmmm CCC Couuntnty y ses leleectctctttioioiooooon nnn n n anananand d twtwtwwt o-o-oo titimeme t teaeaaaaaaaam mm m MVMVMVVVMM P.PP

    KoKoKoKoovavavavaaavvavaavav r r r r lolololookokoks s ththe e pappap rtrtr w wwwitititittth h h h hihihihiis s mamaaam sssssssivive e 6-6-5 5 frrramamamamamamme,e bbutututututuutut h hh h h h ee e cocoommbbmm innninninesesessessesee t t haat t wiwithth g ggrerereatatat a agigigigig lillityty mmmmakakaa ining g hihim m aaa a aa aa a susuusuusupremeemmemme e eee dododoububbu leeess ssss pplpllpllplpplaya er. . InIn h hhigiggh hhhh scscschohohohoolololo , heehee w w w wasasasas a a ttwowo-tiimimmmi eeee e sttstatte e echchchamaamampipiooononnnoono a aaaaa aaat t NoNo. 1 1 dodooububublelees,s,s,s, w www itith h didididiff ff ff eererenent t pap rtnneneeen rrrsrsr , ass weweellll a as s a a sststsssss atatttattta e e chchhhamammpipipiononon a a aat tt t NNoNoNNo. 3 3 3 sissiingngleles s asas a a s ennnioioiooioii r,r whhhwhheerere ee hehe p pppp pososososooosoosteteted dd a a 3838383 -8-8-88 r rr receeccececororo d d anannd d d wawas s ththe e MaM coooombmbmbmmbb A A A Area a CoCoCC nfnfererrenenncceceeeece aaaaannnndndnd R RRegegegegioiooonnananaal ll chchhchamammppipionoon.

    BBBBototototh h hh plplp ayayayyerererers s s hahahah d d dd grgrgrreaeaeatt t t t sususuucccccesesesess inin hh igigggggh h sschooll a ndnd shshshowowoweedeed s ssomomomme e e e fl fl fl asasasa hehees s s s iinini ttttthehehee ffffalalall,l,l,l, nonoteeteedd AsAAAAA heheeer.r. AsAsAAsAsAAsAsAsss ttttt tttthhhehheheheheheheey yycococontntttiniini ueueee tt to o o imimiimprprpprpp ovovovovve,e,e,e, i iiitt wwwwiwilllll o oonlnlnlnlyy yy heellpp w wwititititithhh h h hh ooououououououooouououourrr r deddededeptptpptpthh h h ananannnd dd ddddcococoompmpmpetetettititi ioiooon n nn ininininn tt t thehheeh l l lliniinninee---e-uupupp..

    ThThThTThe e ee wiwiww ldlddd c ccarararardd d d onononono ttt ehehehee t t t teaeaeam m cococ ulld d bebebebebebeeee E E EE Escscobobbobarararar S S SSererererraraar nono, whwhwhw o oo jujujuststst j j joioioinenenen d ddd ttththhthe e TTiTiTiTitatatat nsnssn i iin n n n JaJaJ nunuuuaaararara y y anananand d d d wiwiwiw llllll b b bee e eleleleligiigi ibblelel tototoo c cccomommompepepetetetete i i iinn nn thtthhht e e ddudududuaalal s s seaeaeaassoson.. H HHHHee e wawawaas s ss ononononee e ofofo t thehe ttt topopopopo jujujunininin orooro p plalayeyeyeyersrsrsrss i i in nn n CCeCeCeCeentntntntrararall l AmAmmererrericicicica aa ananand d dd hihihis s lalatete a adddddititttioioioion n n hhhahahaaahhasss ss CoCoCooaccaa hh h AsAsAAssAsssssshhheheheheheheheh rrr r exexexxxxcicicicitetetetedd.dd

    HHHHHHe e ee e e isisisisisis aa a a p p plalaaayyeyer r whwho o isisss e e eextxtxtxtxtttrerereerer memememelylyl t talalenentted d annd d hahaaass ss aaa aaa aa totottototonnn n nn nofofooof ss sucuccecessss playiyingngngg a aa asss s a a jujuuuj ninininininniinioorr iii intnterernanatitiononalallyly,, s saiaiaaid dd d AAAsAsAsAAsAAshhehehheheeeer.r.r. BBBeiieie nggngg aaabllblblblee e e totototo g ggetet hhhimimimimm hh hhhh hheeereerrreeree e ee anananand d popossssiblyy p ppplalaalayiyiyiy ngngngngnggggggggg h h hhhigigigigigggggghhh h h h h iniin ouuour liililinene-u-up pp p p sasasasaysysysyys a a l lotot a abbobobobobooboobobooouutut www whhheheree tthihis s prprogograraaammmmm mm mm mm isisisissii ..

    AsAs fforor tthehe H Horo izon LLeeaeaeaeaaeaaeaaggggugugggggue,e,e,e, C C C Clelevevelalandnd S Statatetteeeeteeeeeeeee ii i iiis s s s ththththhhheeeee eeeee dedededefefefefendndndndinininingggg chchchchammamamampipionon a aafftftftfttfffff eer wwwwininii niningng i itsts s sececooooonononnnno dddd ddd sstsstststststtsttttrarraraigightht coconfnfererenencece t tittlel aa yyyyeaeaeaear r r aaaaaggggaago.o T T TThehe V Vikikiningsgsgss ww w wwwwwwwwiililiilililill ll l l ononoononnonnno cccececec aa agagag inin b bbe eleleleledddd bybyby PPPhihihillll OrOrOrOrnononn , , a a thht reeeeeeee---eeee tititt mememe H Hororizizzzononononnnnn LLLL L L LLLLLLLLeaeaeaeaeaaagggugugugugugugg e e e fi fifirsrst tt teteamm sess leection as welelellllll asasasas a a f forrrrmmmemememmmmmm r r HLHLHLHL P P PPlalalaayyeyeyeyeyyeyeyyey r r ofoofofofoffff tt t thehehe Y YYeaeaee r. UUICIC, , lalaastst years confeference e rurururunnnnnnnnererrr---u-uuu-up ppppppppp anananannddddd d dd d BBBBuBuBuBBBuB tltltltltlllleeeererereerrer ww wwillill l alallsososo b bbbe ee inininin tt t theheheheh mix foor r thhe e totop p teammm i iin n nn ththhhheee eee leleleeeleaggaggaagueueueeueeee..

    Clelevev laandndndn SStatatete is s thththhee e eee teteeeeteeeaammmmaa t t ttto oo bebebbeeaatat ii in n tththisss ll l eaeaeaagugugg e e withth e eveveeryryryrythththinininnng g g g g thththththththeyeyeyeyyyyy h hhhh havavaaa e e ddododododonenene,, s sssaiaiaiaid dd d AsAssA heheheer.r.r.r. PPePePetete i iiiss ss 1-1-1 agagagggaiaiaiaiainsnsnsnsnsttt t PhPhPhPhP ilililill sso o o thhhthee reremamamamatctctctctctctctchhhhhh hh hh wiwiwiwiwiwwww lllllllll b bbee e grgrgrgreaeaeaeat tt t totoototo sseeee..

    OOOveveverararallllll, , I I thththinininkk k wewewe m matata chch u up p p wewewewew llllllll w w wwitititith h hh h tththt e e ototheh r teamms anandd d III I amamammm l l lloooooooookikikikkkingngngngg ff forororwawardrdd t tto oo ththatat c cchaaahhahalllllllllllll eenenennngege. . WeWe have a gogogogoododod n nucucleleusus a andnddd wwwwititititithh h hhhhhh thhthththt e e e deded ptptpth h h wewewee h hh h havave e nonow, that will ononlyly ccrereatate e ththe e cocompmpetete ititioioiooooioiooi nn nnn n nn thththttttt atatat a allll g ggoooood d teteams need. EvE ereryoyonen wwilll l hahaveve a an n opoppopooportrtrtrtr ununununnununununnunnititiiiii y y y totooo p plalay y ana d compete fofor a chana cece tto o plplayay aandnd thhoosesese wwwww whhohhohhoo w wworork k tht e hardest on ana d d offo tht e e cocoururt t wiwillll b be e tht e e ee tetetteamaammmma t ttthhahat t wiwiwiillllll help us get to ththe tot p..

    Freshman Alex Latosinsky

    wwttjjj

    y

    Sophomore Nick Tolomei

    6

  • 2009-10 UDM Mens Tennis Year Book 2222000000000009999999999--------11111111110000000 UUDDDDMMMMM MMennss TTTTeeeennnnnniiisssss YYYeeaaarrr BBBooookk22200000000999999999--------111111111000000 UUDDDMMMM MMenss TTTTeennnniiisssss YYeeaarr BBooookk

    Head Coach Grant Asher

    GrGrG anananant tt AsAsshehehehh r r wawawaw ss hihih reer d d inn N Novovememmbbbebebeb r r ofof 2 2000007 777 asasasassa tttttthhheheheeeehh h h hheaeaaeaad ddddcoocoacach h h ofofofo t ttthehehee n newweww D Detetee rooitii TTitttitanans s memenns s teteamamm, ,, asasassasssisisiistststs ininnnnng ggg gg wiwiwwiwwitththh the e e e e wowwowwww memem nns s teteamamamm d ddurru innng gg ththtt atata yyeaear r asas t thehe m mmenenenssss pp p prorooorogrgrggrraamam bebebebeebeegagan n n inin 2 220000000008.8.8

    I IIII II hohohohohohohoh pepepepepepepe t tt t t t o o o o oo bububububububub ilililililililild d d d d d d d a a aa a a a aa wiwiwiwiww nnnnnnnnnnnnnnninniningg g g g gggggg prprrprprprrogoogogoogooo rararaaraam,m,mmm,, sasasasasass ididididididdd A AAAAAAshshshshshs erererereer. WWWWWWWWWe e e ehhahahhhhhhhh vevevevee a aaaa b bb bbbraraaraandndndndndndndndnnn nnn n neweweweew fffffacacaacaccilililillititititty yy ananaa d dddd wiwiww ththth tt t hehehe t t tttttt lalalalalalala enenenenee t tt ttt ththtththaatt ttttttthehheheheheheeeheeeehe stststtttttssststss atatataaaa e ee ofofo MMMMiciicicchihhihihh gaagaag n nn hahahahhhhhas,s,s I II bb beleeeelieieieieieeeieveveveveveee w w wwwwwwwe e eee eeee e wiwiwiwiwiwiwiwilllllllllllllll h h hhhhhhaavavavavaaa ee e a a a grgrrrgreaeaeaeaeaaaeaaaeaaaaaaaatttt tt tt opopopopopopp-----popoopopoppop rtrtrtrtrtununnittiti y y yyy totototoototo cchhahallllllenengegegg f fororr ttttthehehehehehehe tttt t tttopopopopppoopop s s sspopopopoot tt tt ononoono t t theheehhe HHH HHHHHHHHHHHHHoroorororizizizzonono LeLeLeagagaggaggagueueeeueueuu ...

    CoCoacaccacaca hhhhh h AsAsAsAsAsAsAsAA hehehehehehhh r r r r ququququq icciccklklklklkk y y y y gogogot tttt totototttott w woorororrk kkk rerecrcruitingnggggggg tthehehee fifi fifi rr rstststt memememememennnnss s teteteennnnnnnnisisisisissssiss tttt t tt teaeeaeeeee m m m ssisincncce e eee 19199995955, ,, fofoformrmmining a seseeeeeeeevveveveevv n-n-n--mamamam n n n rorooststtsterererer ththhhatatatatata qqq qqquiuiuiuiuiui kckckckckcklylylylyyylyyyly m mmmmmmaadadadddddaddaaaddddee e e sosomemee w wavavavvesesee i in n thhe e e MiMiMiMiMMiM ddwwwwwdwdwwesesesest.t WWororrkikiik ngngngng wwiwiwiththth fi fi v ve e trtrueueeeeeee fff ffffffffrrrrereerr shshshhmemen n anand d twtwwwo oooo trttrtrana sfsfsfffeerererreer j j jjjununununiooioorsrs, , AsAsAsAsheheheher rleledd DeD troiit t ttttototoootooo aaa 5 55 5-1-113 3 rerecocordrd in n ththe e prprprp ogogogograraaaraaammmms s ss fi fififirsrsrstt tt vavavavarsrrsrsititity yycampmpaiaiigngnn i iiiinnnnn 1313313 y y eaearsrsrs. . DuDuDuriringng ttheheh w wwwayayy, ,, hehhhheehehe h h h helelelelpepepeped ddd mementntntororoor PjPjoototrsrs N NNececececccaaajajajjeevvvevs s toto w wwinnin fi fi vve e HoHoririzozon n LeLeagaggueueueue P P P Plalalalayeyeyeyer r rr ofofof t ttthehehehe WeWeekek h hhhhhooonnonnooorororss s s asas wwelele l l asasas f frereshshmaan n DuDuststininin G GGGololololdedededenbnbnbnbererererg g g g ininini tatatt kikingngggg t theheeeeee wwwwweeeeee klkly y acaccocolaladedede oo onncnce.e. N NNececajajeevvvve s sss wawawawas s s s uululultitititimamamamatetetetelylylyly nanananannnanananan memmeememememmemedddddd dd thththththt ee ee cococococ nfnfn erereenncecess N Newewwcocoocc mememer r anand dddd PllP ayayayayerererer o o o of fff ththththe e e e YeYeYeYearararar afafafaaa teteter r r tatatalllllllyiyiyiy ngngnnn a a 2 2 2225-5-5 44 4 4 sisississingngngnggngleeeles ss s rerererecocococordrdrdrd, , , alalall llll l atatta N NNNo. 1 111, ,, ininininclclclclududududininininggg g aa apepepeeerfrfrfffrfrfrfececececcee tt tt 7-7-7-7 0 0 0000 mamaarkrkr i in n ththe leeague.

    InInIn hh hisiiisis s ssecececononononnd d d d seseseseasasonono , , AsAsher has alreadadaddyy yy tatataaaatakekkkk n n hihihihis s ssrereeeecrcrrcc uiuiuitititiingngg t tto o oo nenenenew w ww hehehheh igighththts s withthth fffouooo r freshmmenennnnnn, , , expapaapandndnddininining g g hihihihis s ss rerereecrcrcrcruiuiuuitittiingngng eeff ff ffororoortstststs a aa a crcrc osososs ss tht e bobobobobobobordrdrdrdrdere to signgn t t tttt tttwowwww ttopopop CaCaCaC nananadidiiananan p ppplalaayeyey rsrss a aass s ssss wwewewewew lllll a aas s anannaa Allllllll-S-S-S-Stataateteteteee p p p performmerereereeerere f f rom mmthththhe e e stststatatata e e e e ofofofo M M Micicichihihihiiiih gagaaagan.n.nn.n.

    AsAsA heheher r r teteeacacachehes ss prprp ofoffofofesesesesssssisisisiisiononononalallyly aa aat t FrFrannnnannklklinin A AAthhththhhhleleleleeeetititiititt ccc ccc ClClClClububbuububb, whwhhicicici h h hh seseservrvrvvesesesss a aaas ss s ththhhhthee ee ininininnndododododododooroorooo h homommmee ee fofor r TTTiTiTiiTiT tatatatan n tetennnnisis. HeeHee a a a alssslso oooooospspsps enennentt t seseseeevevevenn n n ssseseseeeeasasaassononononoonns s ss asasasasa h hhheaeeae d d cocoooaaacaa h foor r BrBrB ototheher r RiRicece H Higigh h h h ScSccchohohohoolololol i i i in n n BiBiBiirmrmrmrmmrmminninnininghghghggghamamamamamam.. . . PrPrPrPrP ioioii rr totoo t tthahat, AAshshshshhherererer h hhadadadad s s s sererererveveveveddd d asass DiDDiDirererectctc oroor o oof ff f TeTeTTennnnnnnnn isssiiis a aaa att t tt CoCoCoCoCoCoC ururuuruu t t t OnOnnnne e eeeee AAAtAAA hleticc CCCC lululuuubsbbsbb i iiiinn n nnn n OkOkOOkOkOkOkOkemememememememooossooss..

    HeHeHee p p plalalal yeyeyeed d d d NoNoNoNNo. . . 1 11 1111 sisisisisingngngnggnglelelelees s s ananandd dd dddddddodod ubu les foooooorr rr r r rr ffofofooururrur y y yeaeaearsrsr a atMiMiMiichchchigigigananann S SSStataatetetet bb bbefefffee orororoore eeee ggrgrggg adaddduauauaatitit ngng in 19999292222292929222292. . HeHeHe w wwasasa n nama eddd thththt e e e teteteteamamamamssssss M MM MMMVPVPVPVPVPV f f ffforororro f f ffououo r r ccococococ nnsnsnsn ececututive yearararrrarss ss anaaaaa dd d eaeaaarnrnneded ththththe e e AlAAllll-l--BiBiBiB g g g TeTTeTeTeTT n n n AwAwAwAwAwA arararrd.dd.d.d.. F F F FF olololollloowiwingng hhis collllleleelllegigiiiigiiiiatatatataaaa e e e e plpp ayayayyyininnngg dadadadaysysysyys, , , AsAsAsAAsAsheheheheheheher r r rr spspspspspppeneneenennttttt t twtwtwtwtwtwtwwwwoooo o ooo yeyeyeyyearara s s onon the prooo c ccirircucuititttitt, , ,,, plplplplplplplplp ayayayayayayayayininiinining g gg g gththththrorororougugugggughohohohohoh ututututut t ttt ttthhehhehehehhehe UU UUU UUUUUnnininininiitetetetetetetedd d d StStStStatateses, Mexico aaaannndnd E EEururopopoppppe.eeee

    GGGGGGGGrantnt w wwwasasaas c ccleleleleararararlylylyly tt t thhhheheheheehhee b b bbbbbbbbbesesesest tt t fifi fifit tt fofoofofor r ththhe e UnUniviverere sisis tytyy a a andndnddndd oooooooouuuuoouuur r ata hleteteteticicicc d d d depepeparararartmtmtmtmmmeeeneeenennentttt,t,ttttt,, a aa andndndd f f fforororor m m m mananannany y rereeereasasonons,s,s, DaDaDaaaroroooron n n nnMMMMMMMMoMooMMoMoMMoM ntgogomemememeryryryry, , UDUDUDU MMMMsss s seseseseseseeeeeninininiororoor a aaasssssssocococociaiaiaiai tetete a aathththleleetitic c dididirerer ctctctororor, , ,nnnnnooonononnooted. HeHee bb brororoougugughthththt a a aaa aa w w wwwwwwwweeeaeaeaae ltltltlth h h h ofofofof pp pplalaal yiyiyiyingngng, , , cococ acaca hihingngg a andndndd ttteeteaaacaaa hingg e eeexpxpxpxperere titit sese, , aaalalaaa ononononnonnnonng g gg wiwiwiw ththththh a a an n n enenthththususiaiaiai smsm ffororo t theheheh spppppspss ooroo t of tenenninis,s,, t tttoo o UDUDDDDUDDM.M.M.M.M. IIII IIII k k kk nononow w ww GrGrGGG ananaa t t t wiwiwillllll d d do o eveveverere ytytythihihhingngngnngg hheeeeehheeh c c anan to ststrerererengngngn thththhennenen o ooooo oooururrurur w www wwwwomomomenenenssss t teaeaae m mmm whwhwhww ilili e e bubuilildidiingngngg aa aaaaa susuuuus cccccccccc esese sffululu m menenenss p ppprororogrgrgrrrgrramamammamaa iii i ii n n nnnnn thththe e ee yeyeeararars ss ahahahheaeaead.d.d

    III mmmmm vvery y exexciciciteteted d d d tototoo b b b be eeee babababaab ccckckckckkckckc i ii nvnvnvvolololveveved dd ininin c coloolo leegege a aathththleeletitiiiticscscsccscss,,,, AAAsAsAAA hhhheeehh r rrrr sasas idd. IImmm h hhhononononoororo edededd ttttt o o oooo rererereeppppprprppppp eseseseneent t t thththe e e UnUnUniviverere sisiitytyty ofofofoffoff D DDDDeettee rorororooroiti MMerercycyy a aaas s heheheadadad m mmmm menenenenensssssss aaandndnd a aasssssssisisistatatantnt w womommenenensss teeeteeennnnnnnnisisisisiiisiii cc ooaoaoaooachch. I knknk owow s s ssucucucu cececesssss cccc omomommmmmommmesese f ffrororom mm hahardrd w wwororo k k kannnnnndddd d dd prprprrprrprrepepepeppee arararara atataaa ioion,n, andndd I I l looooo k k fooooforwrrwwrr arararrara d dd totot t thehe b batattltleesess a andndndndnd chchhhhhhaaalallalllleengngngggggn eseseseseeee ttthahahahahhatt tt t lilie e ahaheaead.d.

    TTTThThThhThT e e 4040-y-yyyyyy- eaeaaaaeeaeaee r rrr olololllddd dd AsAsAsAA heheher r cucuc rrrrenennttltlttly yyy y rreeeesisisisidededes s inninn nn n neaeaaaaarbrbbbrbrbbbyyyy y y yHuHuuuuuunttntntntnntnntnntntininininiininininnnnnnngtgtgtgtgtgtgtgtgtggtgtgtgtgtgtgg ooooonononooononononoononononoonon WWWWWWWWWWWW WW WWWWWooooooooooooooooo dsdsdsdsdsdss wwww w wititititiith hh h hihihhihih s ss s wiwiwwiwwifefeefe, KaKaKaKaKattitiie e e OOOOOO CoCoCCoCoCoC nnnnnnnnnnororoo , a seenininininiiooororor atatatataatatattataatatttttotototototottottoornneyey a at t BuBuButztztztzelelelel L L L Lono g g in DDDDettetetetettroroorororororoitititititititittt. ..... ThTThTThThTTTTTTT e e couppplee h hhhasasasasasas fi fi fififi fi v v v vve-e-yeyearararr-o-o-ooldldldld t t t twiwiwiwinsnsnsn , , , CoCoCoColililinn nn ananand d d PaPaytyty on.

    UUUUUUUUDDDDDDDDDDMMMMMMMMM MMMennss TTTTTTTTTTTeeeenniisss YYYYYYeearr BBBBBBooookkUUUUUUUDDDDDDDMMMMMMMM MMMens TTTTTTTTTeeeenniiss YYYYYYeearr BBBBBBooookk

    Head CoachGrant Asher

    Second Season

    7

  • 2009-10 UDM Mens Tennis Year Book2009-10 UDM Mens Tennis Year Book

    SaSam m PooPoolole e joojoinninnededededdd ttt tttttttheehehehee TTTT Tititiitittttananananananananann A A AAA AA ththththt leleletiititic ccccc DeDeDD papaaaarrtrttmmeentntnt a aass s ananannn asasasassisiss stststananaa t t t memmemememeeeeennnnnnnss s s s ss ananananananannnnnddddddd w wwomomenenssss t tttenenennnnninininis s ss cococoacacacch hhhh duduuuddd rririingngngg t t tthhehehehe 222 2200000000000000077-77--7-7--7708080808 s ssseaeaeaeaeaeasososssososon,n,n,nn,n,n,, aaaaaa aandnndndnddn wwassasss eeleevaateted d totoo h h heaeeaeaaaad d d dddd cocococcc acaccachh hhhh fofofofofoofof rr r r tthththhhhhe wowommmemememeemmmem nnnnn nnnooononononooo M MMMMMMMayayayayayy 4 4 44, , , 2020202009090909. .. HeHeHHH hhhhasasa undndououbtbtbtbtededededdlylylylyyy sss strttrenenennnnngtgtggg hehenneedd d d dd ttthththhthhhhee e eppprprprprp ogogogograrararam m m m dudduduririiringnggng hh h hisisisis t tttimime e e onoonon t thehe j jobobob a aaat tt UUDUDUDUUU M,M,M a aaaanndnn iiiss ss s ss rerererereeeaadadadaa y yfofofofor rr r ththththe eee chhchhalalalalleleeengngngge e e e ththththatatata l lllieieees sss ahaa eaeead.d.

    HeHeH wwilill l alalsoso s ssserererervevevevev a a a as ss s asasasassisisiststanna t t memennss coocoacacacaccch h hhh ununnndedededdeededdeddd rr rrr GrGrantAsAsheher.r.

    PoPoPooololo e,e, a a p pprorooduduductttct o o oof f f f CaCaCaCaC ssssss TTTeceeech h HiHiHH ghgh SSchchhoooooll ininnnn D Detetttrorororoitititittit, fi rstplplayayeded ccccololollelelegigigigiatatatatelelele y y yy atatatat E E E Easaastetternrn MMicichihigagan n UnUnUnivivvvvereererere sisiss tytyy u uuuuuntntntntttililiillil t heehehe memenns s tetennnnnnisisis pp p prororogrgrgrgramamamm aat ttt EMEMMEE U UU wawas s didiscsconoontitit nunuunun eded. . HeHeHeHeHeHeeHe ttt tt ttttthhehehehehehhhhheenn n trtrtrt anannansfsfsferererrerer d d d totototo C C Chihihih cacacagogogogo SS S Staaateteete, , whwhw erere e hehe cc coommmpepeeteteteted d foooooooor rrrrrr r r jjjujujujujujjjjuj ststst o onene seseesesesesessssesseseessseseeseasasasasononon p pppriririririiororrororoororooroooo t ttt tto o o o rereretututurnrnrr inininng ggg tottoo DDetetroroitit. . PoPooololole ee ululu tititittitimammam teeeteeeeeelllylylyyy fi fi fi nnisishehehehed d dhihihihihihihhihihhihhhihihhh ss ssssss sssssssss babababbbachchchcheeeleeelelellelleleleleeellellee ororororororoororororororoororoororoororoooooo sssssss d dddegegegeggrereree e e inininii ee edudducacatitiononn a at t t WaWWaWaaaynyynynynnynne e e StStStStttSSSS aaatttee e inin 222000000007.7

    ThThThThThThThThThThThThThThThThThThThThThThThThTheee e eeeeee 30330000330000000000-y-y-y-y-y-y-y-y-y-y-yy-y-yy-yyyyyyeaeaeaeaeaeaeaeaeaeaeaeaeeaeaeaaeaeaeaeaeaeeaeaeee rrrrrr rrrr rrrr rrrr olololo d d d DeDeDD trtrtroioit t t nanatit veveve i iis ss addaddddidididididd ctcctctededdedddd t ttttoo o tthhhe e e sporort thehehhehhh k kkkkknnonononoononooonoooooonnoonoooowswswswwswsw a aaanddndndn l l lovovoveseseses, , ananand d hehehhe ttrarar veveveleleleeed d dddd alaalalallll l ovovvvvoovveeerer tthehee ccouo ntryy wwwiwiwwiwiiwiiiwiiwiwiiwiiwiwiwiiiiwiw ththththththhthththththththhthththththtththhh d dd d d ddd d ddddddddddddozozozozzozozozozozozozzzzozzozozzozenenenenenneeeeeeeeee s s s ofoofo jj junununioiioioor r plplayayererrs s prprprp ioioioor rr r totototototo ss sseetee tlllinininininingg g babaackckc dowwn n in sososososooooututututututututututuutuuttttttttuttheheheheheheasasasssssssasastttttttttt tt MiMiMiM chchcchchiggiganan. . HeHee h hasassa w wwororororo kekekkkkekeeddd d d wwithththhhththh a a a a aaaaaaa mmmyryriaaai ddd ofof pplalayeersrs aatatataatatata a aallllll lllevevevelells s dududud riringng t thehehe p p ppppasasassasasasssttt t tt t t 10101010100 y yeaeaeaeaeaeaearsrsrrr , , ,,,, wwwwwwwiiwwww thththth eeeexpxppx ere ience ata GrGrosossee PPoiointnttees s HuHuHuuuuntntntntntnnt C C C C C CClululululuuub,bbb,b W WWWWWimimimblblb ededddonononononoo R RRRRRacacacququetetet CClulub annd

    F FFrararaanknknkklilil n n n AtAtAthlhlhh eteteteticicic CCClulubbbb b ininnn SSououuo thththhfi fififield.d.SSSSamamama h hhasass a a aa u uunininin qququue ee e cocoooooacacchhihiiingngngng styyleleleeelee,, , anananananandd heheheheheheheeeeee ppppppppp p p pppp pppppuuuususususususussusssususuusshhhehehhhehhhhess s ououuuuuuuuuuouoo rrrr r rr

    ststtudududdenent-t-t-t-atatthlhlhlhleteteteseseses f fffrrorommm m m m ststttararaarrt t tototooo fi fi fififi n nnnish innninnn eeeeveveveveveeeryryryryyryryryryryryryryyryryryrryyyryyy ppppppppppp pp ppp p pppprararraraarararactctctctctc iciciccicicee,ee, fffof rmrmmmrmeeeereerUDUDUDUDM M M hehehh adadadad c c c coaoaoaoachcchc D DDDDDararrrooonon M MMonononntgommmmmmmererereerrrrrrrryyyyy y yyyyyyyy y y nnonononoteted.dd HeHeHH bbbrir ngggggss enennnerererergygygy, , enennththththusussu iiaiasmsmmms aa aaaaanndndn p ppasasssisis oon to ooo oooo thththtththththhththt ee e prprprprogogograraraam.m.m.m. I I I I t tthihinkn hhhhhee eeeeehahahah s s s a a a lololot t tt tototo o ooffff ererere t tttooo o thththhhe e e spspsppporororo t t t t ofofofof coloolollllllelelellelegege t tttenenenenninninisss. HHisis llococococall rrooooo ttstsssstmamam keke hhhimimm aa a p p ppppppererereeerfefefeefecctctct fi fifit ttt f ffororor TTT Titanann t tttttenennnininiis.s.s.s

    PoPoPoPoololee,ee, w wwwwhohohohoho t t tteaeeaeaeaee chchhcheseesesese ffff fuluulu ll-timee aaaaat DeDeDeetrtrtroiioioitttss s MiMidtdtowown n n AcAcAcAcadadda eeeemememmmmmmemmyy,y,y,y,yyyyyyyisisisis oo o onnenenene o o ooofff f f ththththhhthtthhhrererereeeee e e chchchchili drdd en. HeHeHeHeHeHeeee hhassa aa b bbroror ththerer ( KrKrisistotooophphphpherererrer))) ) )) ananannnanandd dd a aa sisisisisistststststeerereer ( ( (SaSaSammmanthaa).))

    Assistant Coach

    Assistant CoachSam Poole

    Second Season

    8

  • 2009-10 UDM Mens Tennis Year Book 2222000000000009999999999--------11111111110000000 UUUUDDDDMMMMM MMennss TTTTeeeennnnnniiisssss YYYYeeaaarrr BBBooookk22200000000999999999--------111111111000000 UUUUDDDMMMM MMenss TTTTeeeennnniiisssss YYeeaarr BBooookk

    Your Titan Netters

    20200090009 FFFalalaa ll:l: P PPututut f fffororo thth a anononnoththt erer domomommmininatatining g fafafalllllll ss ssseeaaaeasososooooosssos n n nnnn gogogogog ininininnngg g ggg 121212-2-2-2 i i n n n sisingngnngleleel s,s,s,s w wititth hh twt o o totop p sisingngglelel s s flfl fligighthtt ttttitititititlleleeelees,s,,ss aaa a as ss s weweweweww llllllll assas 9 9 9 3-3-3 rrrecececcororord d innnn d dououuublees wwwwitith h a a chchamampipiononnshshhshipipippipRRR eeeceececcee eieieieie vvevevev d dd a bibibibibiid ddddd totoo t thehe m mmaiaiaiain drrawawaws s ss ofoff tthehe I ITATA M Mididdwewewestststst RRRReeegeggge ioiooionanalchchchchchhhamampipiononshshhhipipi ssDeeDefefeeatatededddd A Alalaasdsdaiair r GrGraeaetztztz o oof f f fff DDeDDeDeD PPaaP uuluul, , 77-5,5, 6-1,1, iin ththe fi firsr t tt roroounund d ofof tthehe t touournrnamamenenent tt bebebeeeb fofoooorererererere f f alala liliiingngnng t ttto o oo oo 77777 th-rannkeked MaMattt AAllllarare e ofof O OOhihihio o o StStatate e 7-7-7 6 6 6 (5(5(5(5(( )),),),),) 7 7 777 77-6-6 ((4)44)4)44)4)44))HHHHHHHHHeeeee ee eeaalalso teaamem d d wiwiw thththth ffrererer shshmamam n n n AlAlAlexexex LLLatatttosososinininnskskskkkky yyy y inininnnn dd ddououo blblblblleeeeesese p plalalalalaaayy yy y yyaaadadadada vavvancinnng g gg alalalall l ll thhthe ee wawaw y y tototo t tttheheehe q q quauauartrttr erereer-fi-fififi n nnnalalala sssAlAlonnnnnnnggg ggggggg tthththheee e wawawaaaaaw y,y,y,y,y,yy ththththhhthe eee eee TiTiTiTiTTT tatataan n nn dudududud o o o dododownwnw eded W WWWisisisiscocococoonsnsn ininnnnnnssssss 1 11 112t2t2t2 h-h-h-seseededddddddeededeeed tt teaeaeaeamm mm ooofofofoffofoo Michchhaeaeaeeeea lll l l DiDiDiD ebebebebbeberererergegegeg r r rr anananand d d PaPaPaPatrtrrricicccck kkkkkk PooPooPP hlhlhlh mamamam nnnn, 8-55,5,5,5,5,5,55 aaaandndndnd HHHL L L ririririvavavavalslslsls inin J Johohohohohohnnnn nn HaHaHaHaHaHaHaHHHH leleleleeleleleyy y yy y ananananannd d dd RoRoRoR bebebebeb rttrtrt FF FFFFoxooxoo o oof f f ClCleveve eelannd d d SSSStStSSttatataa e,e