Worldwide phylogeography of wild boar reveals …...2005/03/10 · facility at the University Copenhagen, Denmark. For two modern individuals (GL143 and GL287), bone samples processed

Worldwide phylogeography of wild boar reveals multiple centers of pig

domestication

Supporting Online Material

I. Materials and Methods

a) Modern and Museum SamplesSequences were determined from 223 individuals, primarily from museum specimens, and

combined with 463 GenBank entries to generate a dataset comprising 686 individuals (362 wild

and feral boars, and 324 modern domestic pigs representing 80 breeds) from 40 countries. 116

haplotypes were identified within wild and feral pigs, 60 exclusively within domestic haplotypes

and 16 haplotypes were shared.

b) Extraction, DNA amplification and sequencingThe 223 new individuals were analyzed in three separate facilities: 137 at the Henry Wellcome

Ancient Biomolecules Centre (HWABC) in Oxford, 70 at the University of Uppsala, and 16 at

the University of Auckland, Department of Anthropology DNA Laboratories. In total, 663 base

pairs of mitochondrial control region DNA was amplified and sequenced. All 223 sequences were

submitted to GenBank, with reference numbers AY884609-AY884831.

The extraction, amplification, and sequencing protocol at the HWABC followed Shapiro et

al.(S1). In the Uppsala laboratory, DNA from hair was extracted according to methods described

elsewhere(S2, S3) and in a dedicated facility for PCR-analysis kindly provided by M. Allen

(University of Uppsala). Bone powder was first digested over night in a 10% SDS and Proteinase

K mix. DNA was then extracted on the next day according to Promega's Wizard Genomic DNA

Purification Kit instructions from the lysis step. In the Auckland laboratory, DNA was extracted

from fresh tissue samples using Roche’s High Pure PCR Template preparation kit and from tusk

using a silica/guanidinium thiocyanate method(S4). Sequencing using an ABI PRISMTM

377 and

an ABI 3100 was carried out at the University of Auckland Sequencing Facility. At all three

locations, a variety of overlapping primer combinations was used (Table S4) depending on the

nature of the sample.

Stringent ancient DNA protocols(S5) including the use of multiple extraction and PCR blanks

were followed in both Oxford and Auckland. In total, 64 samples were extracted and amplified at

least two times independently and 10 samples were independently replicated in a separate aDNA

facility at the University Copenhagen, Denmark. For two modern individuals (GL143 and

GL287), bone samples processed in Oxford, and tissue samples processed in Uppsala, resulted in

consistent sequences.

Cloning reactions were performed using the Invitrogen (UK Ltd) Topo-TA cloning kit according

to manufacturers instructions, and were amplified using the primers T7 and M13R (Invitrogen).

Eight sequences from each cloning reaction were sequenced to evaluate template damage and

check for the presence of contaminating sequences and/or numts.

c) Analysis of sequence data448 sequences from previous published studies and 15 unpublished sequences deposited on

GenBank were aligned by eye with the 223 new sequences using Se-Al(S6). Phylogenetic

analysis was performed using MrBayes 3(S7) and model parameters identified by ModelTest(S8)

(HKY85+G+I). Under this model, parameter estimates (including posterior probabilities) and

consensus trees resulting from five MrBayes runs of 30 million generations each were recorded

and contrasted. The posterior probabilities on the tree in Figures 1 and S1 represent the lowest

recorded values amongst all the runs.

Median-joining networks were created using Network 4.1(S9) to provide more resolution

between domestic pigs and their geographically proximate wild boar counterparts in Europe and

Asia. Initial median-joining networks were constructed and subsequent character weighting

(down-weighting of frequently hit sites) and re-analysis followed software recommendations.

Hypotheses of demographic expansion were tested using Tajima’s D and Fu and Li’s F statistic.

A total of four alignments of wild boar and domestic pig haplotypes within the European and

Asian clades were subjected to the analysis using the DnaSP software package(S10). The results

are summarized in the following table.

Population Subset Fu and Li’s F Tajima’s D

European wild boar (17 haplotypes) -1.44 (p>0.10) -1.42 (p>0.10)

European domestic pigs (36 haplotypes) -2.94 (p<0.05) -1.79 (0.05 < p <0.10)

Asian wild boar (24 haplotypes) -1.93 (p>0.10) -0.95 (p>0.10)

Asian domestic pigs (51 haplotypes) -3.01 (p<0.05) -1.62 (0.05 < p <0.10)

These results indicate that the data is consistent with recent population expansions of both

European and Asian domestic pigs (strongly supported by Fu and Li’s F, and weakly supported

by Tajima’s D). A recent population expansion amongst wild boar in both regions is also

possible, though neither of the statistics reached significance.

II. Supporting Text and Figures

Table S1. This table lists all novel specimens obtained, extracted, and sequenced by the authors

of this paper.

Information presented in each of the columns in Table S1 is as follows:

Extraction #: The code given to each individual.

Complete Sequence: A blank in this column indicates the complete sequence of 663bp of

mitochondrial control region was obtained. An ‘I/C’ indicates some portion of the sequence was

not successfully obtained.

Replicated at ABC: A ‘Y’ in this column indicates that the sample was replicated at least once at

the Ancient Biomolecules Centre in Oxford.

External replication: A ‘Y/C’ indicates that this sample was independently replicated by Tina

Brand at the University of Copenhagen. A ‘Y/L’ indicates that this sample was independently

replicated by Meiying Fang at the University of Uppsala.

Cloned: A ‘C’ indicates that this sample was cloned at the Ancient Biomolecules Centre in

Oxford. At least eight cloned sequences were examined in each case.

Source: The codes for the museums and individuals from which material was generously

provided are as follows:

AD: Alain Ducos, Productions Animales - UMR INRA Cytogénétique, Ecole Nationale

Vétérinaire de Toulouse, France

CG: Chris Gerrard, Department of Archaeology, University of Durham, UK

EM: Elizabeth Maclean, Ossabaw Hog Farm North Carolina, USA

FL: Marco Masseti, University of Florence, Italy & Paolo Agnelli, Museum of Natural

History, University of Florence, Italy

FM: Field Museum, University of Chicago (B. Stanley), IL, USA

FMan: Filippo Manconi, Tempio Pausania, Italy

IFE: Institute for Forest Ecology and Forest Inventory, Eberswalde, Germany (Jurgen

Goretzki and Manfred Ahrens)

IPA: Institute of Portuguese Archaeology, Lisbon, Portugal (Simon Davis)

JL: Jonathan Lee, Northern Australia Quarantine Strategy, Australia

LAC: Laboratoire d'Anatomie Comparée, Paris (Jean-Denis Vigne), France

NHMB: Natural History Museum Berlin, Germany (Peter Giere)

OB: Oliver Brown, Department of Archaeology, University of Sydney, Australia

PBD: Pig Biodiversity Consortium (http://www.projects.roslin.ac.uk/pigbiodiv/)

RF: Ross Fraser President of the Rare Breeds Conservation Society of New Zealand. 58 Wills

Rd, West Plains, RD4, Invercargill 9521, New Zealand

RI: The Roslin Institute, Edinburgh, Scotland

SAM: South Australia Museum, North Terrace, Adelaide, SA5000, Australia (Terry Bertozzi

& Steve Donnellan)

SB: Sue Bulmer, Bulmer & Associates, 10 Tansley Ave, Epsom, Auckland, New Zealand

SMNH: Smithsonian Museum of Natural History, Washington, D.C., USA

UA: Umberto Albarella, Dept. of Archaeology, University of Sheffield, UK

UH: University of Hildeseim, Germany (Horst Kierdorf)

OUM: Oxford University Museum of Natural History, UK (Malgosia Nowak-Kemp)

RR: Prof. Richard Redding, University of Michigan Museum of Anthropology, USA

ZIY: Zoological Institute in Yerevan, Armenia (Ninna Manaserian)

Species: The genus and species names listed in this column are taken directly from the museum

labels, many of which are over 150 years old. As such, some may not reflect current taxonomic

opinion.

Status: The assigned status of “wild”, “feral”, or “domestic” were established either directly from

the museum label and/or specimen catalogue or provided by the individual who donated the

sample.

Med-Feral indicates that the sample is from either Corsica or Sardinia. We have differentiated

these samples because although none of the samples in this study came from known domesticates

on the islands, the status of so-called wild boar on both islands is contentious.

NG-Feral indicates that he sample is from New Guinea and that the status of these pigs

remains contentious.

Wild-oop indicates that this sample does not conform to the phylogeographic pattern exhibited

by the majority of samples used in this study. Those specific samples are:

GL86 Malaysia – Though all other Malaysian samples from this region cluster in the basal clade,

this sample falls in the main Asian clade.

GL103 Indonesia - Though all other Indonesian samples from this region cluster in the basal

clade, this sample also falls in the main Asian clade.

GL141 Armenia – All other Armenian samples fall outside the main European cluster, but this

sample is a member of haplotype A, the most frequent haplotype found amongst domestic

samples in Europe and may represent a feral pig or an introduced wild boar.

GL220 Corsica – This pig is the only Corsican pig that doesn’t cluster inside the main European

clade. It falls instead within a general group of pigs that includes all the Turkish, Armenian, and

Iranian specimens, though it is identical to none of these. It may therefore represent either a

lineage whose ultimate origins were in the Near East.

GL228 Sri Lanka – This sample is the only wild boar in the basal clade (Figure 1) that does not

herald from the western portion of ISEA.

GL252 Italy - All other Italian samples fall outside the main European cluster, but this sample is

a member of haplotype A, the most frequent haplotype found amongst domestic samples in

Europe. This sample originates from the Florence area where introductions of European boars

have occurred for centuries. All the other Italian samples are from the Maremma region, and are

possibly members of an original, native Italian population(S11, S12). It must be noted that all

samples were chosen from historic specimens collected in the late 18th

and early 19th

centuries,

which therefore predate the massive introductions of central and eastern European wild boars that

have occurred in Italy since World War II(S12).

The designation wild-metdom indicates that though this sample is called wild on the museum

label, both its relative position on the network (Figure S3) and subsequent metrical analysis

suggest that the pig may in fact be feral. The two cases are:

GL83 Assam, India – Not only does this sample possess the same haplotype as five East Asian

domestic breeds (AL), it also possesses a very small jaw and teeth.

GL232 Amoy, China – This sample is not only small, it also falls into the same haplotype (D) as

27 domestic and known feral samples indicating that this sample is unlikely to be wild.

Haplotype: This column indicates which named haplotype the sample belongs to. Details

regarding each specific haplotype can be found in Table S3.

TABLE S1

complete replicated external

Extraction# sequence @ABC replication cloned Source Source # Species Country Location element Status Breed Haplotype

Specimens extracted at the ABC, Oxford

GL43 Y C SMNH 104855 Sus scrofa Indonesia Natuna Islands, Bunguran, near Lingung Island mand Wild

GL44 Y SMNH 258837 Sus scrofa China Sichuan, Wen Chuan mand Wild

GL45 Y SMNH 143543 Sus scrofa Indonesia Sumatra, Pulo Payong mand Wild

GL46 Y Y/C SMNH 199497 Sus scrofa India Kashmir, Valley of Kashmir mand Wild BW

GL47 Y SMNH 321950 Sus scrofa USA Hawaii, Parker Ranch mand Feral L

GL48 Y SMNH 114416 Sus scrofa Indonesia Sumatra, Pulo Tuengku mand Wild

GL51 Y SMNH 282629 Sus scrofa Papua New Guinea San Sapor mand NG-Feral

GL52 Y SMNH 154146 Sus scrofa Spain Burgos, Palacios De La Sierra mand Wild

GL53 Y SMNH 358646 Sus scrofa Taiwan Nan Tou, Jen-Ai, Hua-Chi Village mand Wild

GL54 Y SMNH 375925 Sus scrofa Pakistan Lahore, Sailkot mand Wild

GL55 Y Y/C SMNH 327738 Sus scrofa Turkey Izmir, North of Yeni Foca mand Wild

GL56 Y Y/C SMNH 290146 Sus scrofa Nepal Dharan Bazar mand Wild

GL57 Y SMNH 396070 Sus scrofa New Zealand Auckland County, Coromandel peninsula, Mercury Bay mand Feral A

GL59 Y Y/C SMNH 283111 Sus scrofa Iran Hamadan mand Wild BQ

GL60 Y SMNH 104094 Sus scrofa Burma Tenasserim, Bok Pyin mand Wild BM

GL61 Y SMNH 199858 Sus celebensis Indonesia Celebes, soemalata mand Wild

GL62 Y SMNH 114177 Sus scrofa Indonesia Simalur island, Sumatra mand Wild

GL63 Y SMNH 194177 Sus scrofa Germany Hartz Mts mand Wild A

GL64 Y SMNH 218145 Sus scrofa China Shanxi Fen Chow mand Wild BP

GL65 Y SMNH 198012 Sus scrofa Italy Sinnai, Cagliari, Sardinia mand Med-Feral

GL67 Y SMNH 124206 Sus scrofa Burma Tenasserim, Kisseraing Island mand Wild

GL68 Y SMNH 837303 Sus scrofa Thailand Trang Trong mand Wild

GL69 IC Y SMNH 278414 Sus scrofa Mariana Is. Guam, Ritidian Point mand Feral D

GL70 Y SMNH 142469 Sus scrofa Malaysia Johore mand Wild

GL71 Y SMNH 233985 Sus scrofa France Cote D'Or, Is-sur-Tille mand Wild AJ

GL72 Y SMNH 20933 Sus scrofa Japan Honshu, Tokio market mand Wild

GL73 Y SMNH 476855 Sus scrofa Morocco Ougda, Taforalt mand Wild C

GL75 Y C SMNH 61310 Sus scrofa Sri Lanka mand Wild

GL76 Y SMNH 276986 Sus scrofa Papua New Guinea Admiralty Islands, Ponam Islet, North of Manus Is mand NG-Feral

GL77 Y SMNH 341614 Sus scrofa Iran Mazanderon, 25km East of Gorgon mand Wild

GL78 Y SMNH 172658 Sus scrofa China Shensi, Yen-An-Fu mand Wild BP

GL79 Y SMNH 255338 Sus scrofa China Mt Omei, Sichuan mand Wild

GL80 Y SMNH 218146 Sus scrofa China Hunan Kiangsu mand Wild

GL81 Y SMNH 238015 Sus scrofa China Gansu Nanking mand Wild GX

GL83 Y SMNH 279145 Sus scrofa India Assam, 3rd Tank area mand Wild - metdom AA

GL84 Y SMNH 141168 Sus scrofa Indonesia Nias Samasama mand Wild CD

GL85 Y SMNH 113034 Sus scrofa Indonesia Lingga archipelago, Lingga island mand Wild

GL86 Y SMNH 152119 Sus scrofa Malaysia Johore, Muar mand Wild - oop AL

GL87 SMNH 111971 Sus scrofa Burma Tenasserim, Tanjong Budak mand Wild

GL88 Y SMNH 144380 Sus scrofa Indonesia Rhio archipelago, Pulo Jombol mand Wild

GL89 Y SMNH 464967 Sus scrofa Nepal Royal Chitawan National Park, Charara Grassland mand Wild

GL91 Y SMNH 199860 Sus celebensis Indonesia Celebes, kwandang, mdeng kapoti mand Wild

GL92 SMNH 199862 Sus celebensis Indonesia Celebes, sungai, paleleh mand Wild

GL93 SMNH 199864 Sus celebensis Indonesia Celebes, kwandang mand Wild

GL94 SMNH 199873 Sus celebensis Indonesia Celebes, toli toli maloe mand Wild

GL95 SMNH 199874 Sus celebensis Indonesia Celebes, toli toli maloe mand Wild

GL96 Y SMNH 218063 Sus celebensis Indonesia Celebes, toboli mand Wild

GL97 Y/C C SMNH 199881 Sus celebensis Indonesia Celebes, kampa mand Wild

GL99 IC Y SMNH 141166 Sus scrofa Indonesia Nias Feliwaa mand Wild CD

GL100 Y SMNH 141029 Sus scrofa Indonesia Nias, Tarussan Bay mand Wild

GL101 Y SMNH 144421 Sus scrofa Indonesia Rhio archipelago, Pulo Penjait river mand Wild

GL102 SMNH 140958 Sus scrofa Indonesia Sumatra, Engano island mand Wild

GL103 Y/C SMNH 114282 Sus scrofa Indonesia Sumatra, Pulo Babi mand Wild - oop

GL104 Y Y/C SMNH 143540 Sus scrofa Indonesia Sumatra, Rau Bay mand Wild

GL105 Y SMNH 144303 Sus scrofa Indonesia Sumatra, Siak river mand Wild

GL107 Y UH 44 Sus scrofa Germany Czech / German border max inc Wild

GL108 Y IFE 111 Sus scrofa Germany WFG Wriesen max inc m Wild A

GL109 Y IFE 812 Sus scrofa Germany Rathsdorf max can f Wild C

GL110 Y NHMB 64495 Sus scrofa France Corsica incisor root Med-Feral A

GL111 Y NHMB 69753 Sus scrofa Italy Sardinia incisor root Med-Feral A

GL112 Y NHMB 37544 Sus scrofa Holland Het Loo incisor root Wild A

GL113 Y NHMB 28761 Sus scrofa Macedonia incisor root Wild

GL132 Y OUM 15028 Sus cristatus India left upper I2 Wild

GL133 Y OUM 19261 Sus scrofa Norway Stene I Bo, lofoten Islands 1st ml/UR1prem Feral E

GL134 Y OUM 15029 Sus scrofa papuensis Papua New Guinea lower left I3 NG-Feral BX

GL135 Y OUM 15027 Sus scrofa India Monghyr, Bengal lower right molar Wild BW

GL136 Y OUM 19243 Sus scrofa India Monghyr, Bengal 4th RU/lLL3prem Domestic Indian BW

GL138 Y SMNH 125463 Sus scrofa Malaysia Johore, Mount Austin mand Wild

GL139 SMNH 279015 Sus scrofa Mariana Is. Rota island mand Feral D

GL140 Y/C SMNH 267712 Sus scrofa USA Oahu, Hawaii mand Feral BX

GL141 Y Y/C ZIY No1 BTUA Sus scrofa Armenia P3 Wild - oop A

GL142 ZIY No 870 Sus scrofa Armenia Vaik region I3 Wild BQ



GL143 Y/L UA Spec. C Sus scrofa France Near Levie, Corsica tooth Med-Feral

GL144 UA 81 Sus scrofa Italy Near Tempio, Gallura, Sardinia tooth Wild AJ

GL146 SMNH 218142 Sus scrofa China Hunan Yochow mand Wild AE

GL147 SMNH 172657 Sus scrofa China Shanxi Tai-Yuan-Fu mand Wild BP

GL148 Y/C SMNH 258186 Sus scrofa China Sichuan, Suifu mand Wild

GL154 SMNH 122925 Sus scrofa Indonesia Sumatra, Pulo Ungar mand Wild

GL155 SMNH 104857 Sus scrofa Indonesia Natuna Islands, Pulo Laut mand Wild

GL156 SMNH 538819 Sus scrofa Indonesia Halmahera island, Wasile district, Kampung, Loleba mand Wild

GL162 SMNH 173817 Sus scrofa India Kashmir, Woolar Lake mand Wild BW

GL190 NHMB 69704 Sus scrofa Italy Sardinia incisor root Med-Feral

GL191 NHMB 69909 Sus scrofa Russia Vladivostock incisor root Wild CB

GL192 NHMB 69741 Sus scrofa Russia Vladivostock incisor root Wild CB

GL193 ZIY 6 assg by UA Sus scrofa Armenia lower P2 Wild

GL194 ZIY 7 assg by UA Sus scrofa Armenia lower P1 Wild

GL195 SMNH 124215 Sus scrofa Burma Tenasserim, Boyse's Point mand Wild

GL220 IC Y LAC 85 Sus scrofa France Alta Roca, Corsica lower 2nd inc Med-Feral - oop

GL221 IPA no 870 Sus scrofa Spain Asturias I3 Wild

GL222 IPA no 834 Sus scrofa Portugal Estremadra I2 Wild

GL224 C OUM 19244 Sus barbatus Malaysia Labuan, British north Borneo (Malaysia) up left premolar Wild

GL225 OUM 19283 Sus barbatus Malaysia Labuan, British north Borneo (Malaysia) low rgt premolar Wild

GL226 IC OUM 15026 Sus cristatus India up right molar Wild

GL227 OUM 15031 Sus papuensis Vanuatu Gaua, New Hebrides up lf/rt premol Feral

GL228 OUM 15019 Sus cristatus Sri Lanka up lft molar Wild - oop

GL229 OUM 10560 Sus papuensis Vanuatu low rgt pre/molar Feral

GL230 OUM 19271 Sus andamensis India Andaman Is lower left molar Feral

GL231 OUM 19230 Sus taivanensus Taiwan up right premolar Wild

GL232 OUM 19238 Sus scrofa China Amoy low rgt premolar Wild - metdom D

GL233 OUM 19241 Sus taivanensus Formosa low left premolar Wild

GL235 SMNH 253299 Sus scrofa India Surguja, Ambikapur mand Wild

GL236 ZIY 3 assg by UA Sus scrofa Armenia lower P1 Wild BQ

GL237 NHMB 69736 Sus scrofa Russia South-East Siberia incisor root Wild

GL240 SMNH 124013 Sus scrofa Burma Tenasserim, Champang mand Wild BM

GL241 SMNH 16152 Sus scrofa India mand Wild

GL242 CG Sus scrofa Spain Aragon metatarsal Wild

GL243 EM Sus scrofa USA North Carolina teeth/gum Domestic Ossabaw Hog D

GL244 C FL 11909 Sus scrofa Italy Maremma Region bone Wild

GL245 FL 11913 Sus scrofa Italy Maremma Region bone Wild BH


GL247 FL 11921 Sus scrofa Italy Maremma Region bone Wild BG

GL248 FL 11924 Sus scrofa Italy Maremma Region bone Wild BG

GL249 FL 11983 Sus scrofa Italy Maremma Region bone Wild



GL252 FL 18271 Sus scrofa Italy near Florence bone Wild - oop A

GL254 RR Sus scrofa Iran premolars Wild

GL270 C ZIY 2 assg by UA Sus scrofa Armenia lower I2 Wild

GL271 ZIY 5 assg by UA Sus scrofa Armenia 2nd phalanx Wild BQ

GL284 LAC 83 Sus scrofa France Alta Roca, Corsica skull frag Med-Feral A

GL285 LAC 84 Sus scrofa France Alta Roca, Corsica skull frag Med-Feral A

GL286 IC LAC 86 Sus scrofa France Ota, Corsica incisor frags Med-Feral

GL287 IC Y/L UA B Sus scrofa France Near Levie, Corsica upper canine Med-Feral BK

GL288 NHMB 69511 Sus scrofa Italy Sardinia incisor root Med-Feral A

GL289 NHMB 69492 Sus scrofa Italy Urzulei, Ogliastra, Sardinia incisor root Med-Feral BK

Specimens from the University of Chicago that failed to amplify

GL171 FM 92906 Sus scrofa Iran hair Wild

GL172 FM 65997 Sus sp Thailand hair Wild

GL173 FM 62827 Sus barbatus Philippines hair Wild

GL174 FM 98915 Sus scrofa Turkey hair+tissue Wild

GL175 FM 68002 Sus cebifrons Philippines hair Wild

GL197 FM 65998 Sus sp Thailand hair Wild

GL198 FM 112487 Sus sp Iran hair Wild

GL199 FM 62831 Sus barbatus Philippines hair Wild

GL200 FM 65456 Sus cebifrons Philippines hair Wild

GL201 FM 31737 Sus celebensis Indonesia hair Wild

GL202 FM 31739 Sus celebensis Indonesia hair+tissue Wild

GL203 FM 31791 Sus scrofa Vietnam hair Wild

GL204 FM 39326 Sus scrofa China hair Wild

GL205 FM 42439 Sus scrofa Iraq hair Wild

Specimens extracted at the Roslin Institute but PCR'd and Sequenced at the ABC, Oxford

325 RI 325 Sus celebensis Indonesia Sulawesi, Kabaena Island tissue Wild

326 RI 326 Sus celebensis Indonesia Sulawesi, Kabaena Island tissue Wild

327 RI 327 Sus celebensis Indonesia Sulawesi mainland tissue Wild




329 RI 329 Sus celebensis Indonesia Sulawesi mainland tissue Wild CC




333 RI 333 Sus celebensis Indonesia Sulawesi, Buton Island tissue Wild

334 RI 334 Sus celebensis Indonesia Sulawesi, Buton Island tissue Wild



Specimens extracted, PCR'd, and sequenced at Uppsala University

LDomDuroc02 PBD Sus scrofa UK Blood Domestic Duroc A

LDomGermBunte01 PBD Sus scrofa Germany Blood Domestic German Bunte A

LDomPortBisaro01 PBD Sus scrofa Portugal Blood Domestic Portugese Bisaro A

LDomHampshire02 PBD Sus scrofa Germany Blood Domestic Hampshire A

LDomGermanAngler PBD Sus scrofa Germany Blood Domestic German Angler A

LDomLargeWhite05 PBD Sus scrofa UK Blood Domestic Large White A

LDomLandrace14 PBD Sus scrofa Germany Blood Domestic Landrace A

BK01 - berkshire PBD Sus scrofa UK Blood Domestic Berkshire A

LDomHampshire01 PBD Sus scrofa UK Blood Domestic Hampshire A

LDomPietrain05 PBD Sus scrofa France Blood Domestic Pietrain A

LDomLeicoma01 PBD Sus scrofa UK Blood Domestic Leicoma A

LDomLandrace04 PBD Sus scrofa Denmark Blood Domestic Landrace BK

LDomHungaryMangalica01 PBD Sus scrofa Hungary Blood Domestic Hng. Mangalica BK

LDomLandrace12 PBD Sus scrofa UK Blood Domestic Landrace BK

LDomLandrace10 PBD Sus scrofa UK Blood Domestic Landrace BK

LDomLandrace05 PBD Sus scrofa Denmark Blood Domestic Landrace BK

LCorsica82 UA 82 Sus scrofa France Corsica tissue Med-Feral BK

LNSardinia88 Fman Sus scrofa Italy Sardinia tissue Med-Feral BK

LDomBritishLop01 PBD Sus scrofa UK Blood Domestic British lop eared C

LDomIberiaBlack01 PBD Sus scrofa Spain Blood Domestic Iberian black C

LDomMidWhite01 PBD Sus scrofa UK Blood Domestic Middle white C

LDomLandrace13 PBD Sus scrofa France Blood Domestic Landrace D

LDomUKTamworth01 PBD Sus scrofa UK Blood Domestic Tamworth D

LDomFranceCreole01 PBD Sus scrofa France Blood Domestic Creole France D

MJ01 - manchado jabugo PBD Sus scrofa Spain Blood Domestic Manchado Jabugo D

LDomLarWhite07 PBD Sus scrofa UK Blood Domestic Large White D

LDomLandrace09 PBD Sus scrofa Iceland Blood Domestic Landrace E

LDomDuroc03 PBD Sus scrofa Germany Blood Domestic Duroc E

LDomBritishOldSpot01 PBD Sus scrofa UK Blood Domestic Britrish old spot FH

LDomLarWhite02 PBD Sus scrofa Germany Blood Domestic Large White FH

LAusFerBon18 OB Sus scrofa Australia Cuddie Springs, Darling River basin Bone Feral FH

LAusFerBon3 OB Sus scrofa Australia Cuddie Springs, Darling River basin Bone Feral FH

LDomLargeWhite06 PBD Sus scrofa UK Blood Domestic LargeWhite FH

LDomLarWhite10 PBD Sus scrofa Germany Blood Domestic Large White GX

LB01 - large black PBD Sus scrofa UK Blood Domestic Large Black GX

LAusFerBon5 OB Sus scrofa Australia Cuddie Springs, Darling River basin Bone Feral I









LAusFerHair02124 JL JML02124 Sus scrofa Australia West coast of Cape York, Koolatah 9 Hair Feral J

LAusFerHair02131 JL LML02131 Sus scrofa Australia West coast of Cape York, Rutland 14 Hair Feral J

LAusFerHair02135 JL JML02135 Sus scrofa Australia West coast of Cape York, Rutland Boomerang Hair Feral J

LAusFerHair02170 JL JML02170 Sus scrofa Australia West coast of Cape York, Delta Downs Hair Feral J

LAusFerHair02145 JL JML02145 Sus scrofa Australia West coast of Cape York, Rutland savannah Hair Feral J



LAusFerHair02176 JL JML02176 Sus scrofa Australia West coast of Cape York, Delta Hair Feral J

LAusFerHair02127 JL JML02127 Sus scrofa Australia West coast of Cape York, Dunbar Swan swamp Hair Feral J

LAusFerHair02129 JL JML02129 Sus scrofa Australia West coast of Cape York, Rutland pear tree yard 13 Hair Feral J

LAusFerHair02182 JL JML02182 Sus scrofa Australia West coast of Cape York, Delta Hair Feral J

LAusFerHair02159 JL JML02159 Sus scrofa Australia West coast of Cape York, Vanrook Crupper dam Hair Feral L

LAusFerHair02163 JL JML02163 Sus scrofa Australia West coast of Cape York, Vanrook Crupper dam Hair Feral L

LAusFerHair02154 JL JML02154 Sus scrofa Australia West coast of Cape York, Vanrook homestead Hair Feral L

LDomLandrace11 PBD Sus scrofa UK Blood Domestic Landrace L

LDomLargeWhite08 PBD Sus scrofa France Blood Domestic Large White M

LDomLandrace06 PBD Sus scrofa Finland Blood Domestic Landrace N

LDomPietrain03 PBD Sus scrofa Germany Blood Domestic Pietrain R

LDomLandrace08 PBD Sus scrofa Norway Blood Domestic Landrace

LDomNegroCanaria01 PBD Sus scrofa Spain Blood Domestic Negro Canaria



LDomNegroCanaria12 PBD Sus scrofa Spain Canary Island Blood Domestic Negro Canaria

LDomPietrain04 PBD Sus scrofa UK Canary Island Blood Domestic Pietrain

LDomBritSaddle01 PBD Sus scrofa UK Blood Domestic British Saddleback

French Wild Boar AD Sus scrofa France Blood Wild

LDomSwedLinderod01 PBD Sus scrofa Sweden Blood Domestic Swedish Linderod AF

LDomMeishan02 PBD Sus scrofa UK(China) Blood Domestic Chinese Meishan

Specimens extracted, PCR'd, and sequenced by Judith Robins & Lisa Matisoo-Smith

Code

AuckIs-1 RF Sus scrofa New Zealand Auckland Islands, East coast of Auckland Island tissue feral A





PNG1 SAM ABTC43845 Sus scrofa Papua New Guinea Doido tissue NG-feral BX

PNG2 SB Sus scrofa Papua New Guinea Kairouk, Jimi Valley tusk NG-feral BX

PNZKK001 RF Sus scrofa New Zealand North Island tissue Domestic Kune Kune I

PNZKK002 RF Sus scrofa New Zealand North Island tissue Domestic Kune Kune I

PNZKK004 RF Sus scrofa New Zealand North Island tissue Domestic Kune Kune D

PNZKK005 RF Sus scrofa New Zealand Invercargill Region tissue Domestic Kune Kune I




PNZKK009 RF Sus scrofa New Zealand Invercargill Region tissue Domestic Kune Kune D


Table S2. This table provides information regarding pig sequences from previous studies(S13-

S23) and 15 additional sequences deposited on GenBank from unpublished studies.

Code: This column lists the code name used in this study for each of the samples published by

previous studies. These codes are also listed in Table S3.

# of Pigs: All but three of the references whose published sequences are used in this study

assigned a GenBank accession number to every individual pig. For those publications, the

number placed in this column of the table is 1. The three studies(S21-S23) which assigned

GenBank numbers to haplotypes and not to individuals are listed at the end of this table. In order

to identify how many wild and domestic pigs are associated with each haplotype, a careful

examination of Table 2 in Okumura et al. (S23) was required. The numbers and titles found in

that table are replicated here in this column. Because it was not clear which of these accession

numbers are associated with the three references listed above, the codes used for these accession

numbers represent a best guess.

A total of six Japanese wild boar and three European wild boar from taken from the three studies

listed above are possibly not wild boar, but may be feral pigs. Five of the Japanese wild boar fall

into haplotypes L and AL, where they are joined by numerous domestic pigs. The sixth wild boar

is distinctive, but the location of all three haplotypes on the network (Figure S3) suggests that

these pigs are feral. The three European wild boar in question all cluster inside the Asian clade

(Fig S1) and are almost certainly feral pigs derived from improved European domestic breeds.

The listing for each of these pigs is placed in bold in the Table S2.

Other columns: All information listed in the other columns is taken directly from the papers in

which they were originally published. Lastly, a blank in the haplotype column indicates that this

sequence is shared by no other pigs and thus, on Figures S2 and S3, the code for the individual

sample is presented instead of a haplotype.

TABLE S2

Code # of pigs Accession # Species Country Location Status Breed Haplotype

Alves et al.2003

IB15 1 AY232856 Sus scrofa Iberia Domestic Iberian Red A

IB26 1 AY232867 Sus scrofa Iberia Domestic Iberian Blond A

D3 1 AY232877 Sus scrofa ? Domestic Duroc A

B 1 AY232891 Sus scrofa Iberia Domestic Basque A

LR1 1 AY232884 Sus scrofa ? Domestic Landrace A

P1 1 AY232886 Sus scrofa ? Domestic Pietrain A

MG 1 AY232892 Sus scrofa Hungary Domestic Hungary Mangalitza A

IB17 1 AY232858 Sus scrofa Iberia Domestic Iberian Red BK

D4 1 AY232878 Sus scrofa ? Domestic Duroc BK

IB3 1 AY232844 Sus scrofa Spain Guadiana Valley Domestic Black Hairless C

IB12 1 AY232853 Sus scrofa Iberia Domestic Black Hairless C

IB4 1 AY232845 Sus scrofa Portugal Domestic Portugese Red C

IB5 1 AY232846 Sus scrofa Spain La Serena Domestic Black Hairless C





IB19 1 AY232860 Sus scrofa Iberia Domestic Iberian Red C





IB25 1 AY232866 Sus scrofa Iberia Domestic Black Hairy C

SJ 1 AY232890 Sus scrofa Spain Domestic Spotted Black Jabugo D

LW1 1 AY232882 Sus scrofa ? Domestic Large White D

IB23 1 AY232864 Sus scrofa Iberia Domestic Black Hairy E

D1 1 AY232875 Sus scrofa ? Domestic Duroc M

D2 1 AY232876 Sus scrofa ? Domestic Duroc M

D7 1 AY232881 Sus scrofa ? Domestic Duroc N

IB11 1 AY232852 Sus scrofa Iberia Domestic Black Hairless O

IB21 1 AY232862 Sus scrofa Iberia Domestic Black Hairy O

MS1 1 AY232888 Sus scrofa ? Domestic Meishan P

MS2 1 AY232889 Sus scrofa ? Domestic Meishan P

LR2 1 AY232885 Sus scrofa ? Domestic Landrace Q

LW2 1 AY232883 Sus scrofa ? Domestic Large White S

D6 1 AY232880 Sus scrofa ? Domestic Duroc V

IB8 1 AY232849 Sus scrofa Spain La Serena Domestic Black Hairless W

IB1 1 AY232842 Sus scrofa Spain Domestic Blond Alentejano BZ

IB2 1 AY232843 Sus scrofa Spain Domestic Blond Alentejano BZ

IB20 1 AY232861 Sus scrofa Iberia Domestic Iberian Red BZ

IB22 1 AY232863 Sus scrofa Iberia Domestic Black Hairy

IB24 1 AY232865 Sus scrofa Iberia Domestic Black Hairy

SWB1 1 AY232868 Sus scrofa Spain Wild BY



SWB6 1 AY232871 Sus scrofa Spain Wild

SWB4 1 AY232872 Sus scrofa Spain Wild CA

SWB5 1 AY232873 Sus scrofa Spain Wild CA

SWB7 1 AY232874 Sus scrofa Spain Wild

P2 1 AY232887 Sus scrofa ? Domestic Pietrain

D5 1 AY232879 Sus scrofa ? Domestic Duroc

Giuffra, et al. 2000

GiuMangalicaD 1 AF136557 Sus scrofa ? Domestic Mangalica BK

GiuCookIsD 1 AF182446 Sus scrofa Cook Islands Feral O

GiuChinMeishanD 1 AF136567 Sus scrofa China Domestic Meishan P

GiuHampshire2D 1 AF136559 Sus scrofa Sweden Domestic Hampshire Q

GiuUKHampshire1D 1 AF136558 Sus scrofa Sweden Domestic Hampshire R

GiuUKLandrace1D 1 AF136560 Sus scrofa Sweden Domestic Landrace N

GiuUKDurocD 1 AF136568 Sus scrofa Sweden Domestic Duroc Z

GiuUKLandrace2D 1 AF136561 Sus scrofa Sweden Domestic Landrace AC

GiuUKLargWht2D 1 AF136562 Sus scrofa Sweden Domestic Large White

GiuUKLargWht1D 1 AF136566 Sus scrofa Sweden Domestic Large White T

GiuPolEWB1 1 AF136555 Sus scrofa Poland Wild BA

GiuPolEWB2 1 AF136556 Sus scrofa Poland Wild C

GiuItalEWB3 1 AF136563 Sus scrofa Italy Wild

GiuAWB10 1 AF136564 Sus scrofa Japan Wild AK

GiuAWB11 1 AF136565 Sus scrofa Japan Wild BC

Ursing & Arnasson 1998

UrsSwedeSlaughter 1 AJ002189 Sus scrofa Sweden Domestic N

Yang et al. 2003

ZhongMeishanD 1 AF486855 Sus scrofa China Domestic Zhong Meishan

ZangD 1 AF486856 Sus scrofa China Domestic Zang

NinxiangD 1 AF486857 Sus scrofa China Domestic Ninxiang AA

YangDurocD 1 AF486858 Sus scrofa Europe Domestic Duroc E

XiangD 1 AF486859 Sus scrofa China Domestic Xiang AE

RongChangD 1 AF486860 Sus scrofa China Domestic Rong Chang AE

YangErhualianD 1 AF486861 Sus scrofa China Domestic Erhualian

TongChengD 1 AF486862 Sus scrofa China Domestic Tong Cheng GX

YangJinhuaD 1 AF486863 Sus scrofa China Domestic Jinhua Y

MindD 1 AF486864 Sus scrofa China Domestic Mind

QingPingD 1 AF486865 Sus scrofa China Domestic Qing Ping

YangLandraceD 1 AF486866 Sus scrofa Europe Domestic Landrace U

WuzhistanD 1 AF486867 Sus scrofa China Domestic Wuzhistan AB

YimengheiBlackD 1 AF486868 Sus scrofa China Domestic Yimenghei Black

DiannanShortEarD 1 AF486869 Sus scrofa China Domestic Diannan Short Ear

DahuabaiD 1 AF486870 Sus scrofa China Domestic Dahuabai AA

YushanheiBlackD 1 AF486871 Sus scrofa China Domestic Yushanhei Black GX

JiangquhaiD 1 AF486872 Sus scrofa China Domestic Jiangquhai GX

YangWannanhuaD 1 AF486873 Sus scrofa China Domestic Wannanhua

YangLargWhtD 1 AF486874 Sus scrofa Europe Domestic Large White GX

Kijas & Andersson 2001

Kijas01SwedishWB 1 AF304203 Sus scrofa Sweden Wild

Kim et al. 2002

KimChinese TongChengD 1 AF276923 Sus scrofa China Domestic Tong Cheng GX

KimChineseWannanhua1D 1 AF276925 Sus scrofa China Domestic Wannanhua GX

KimChineseYanxin 1 AF276927 Sus scrofa China Domestic Yanxin S

KimUKBerkD 1 AF276936 Sus scrofa Europe Domestic Berkshire T

KimUKWelshD 1 AF276937 Sus scrofa China Domestic Welsh U

KimChineseGondonghei 1 AF276928 Sus scrofa China Domestic Gondonghei AG

KimAussieFeral 2 AF276921 Sus scrofa Australia Kangaroo Island Feral Westran - feral

KimSKoreaCheju1D 1 AF276935 Sus scrofa South Korea Cheju Island Domestic Cheju



KimChineseNeijangD 1 AF276929 Sus scrofa China Domestic Neijang

KimChineseEurhulianD 1 AF276922 Sus scrofa China Domestic Eurhulian

KimChineseJinghuaD 1 AF276930 Sus scrofa China Domestic Jinghua

KimChinesePutianD 1 AF276931 Sus scrofa China Domestic Putian

KimChineseWananD 1 AF276924 Sus scrofa China Domestic Wanan FH

KimChineseWannanhua2D 1 AF276926 Sus scrofa China Domestic Wannanhua FH

KimChineseWanhuaD 1 AF276932 Sus scrofa China Domestic Wanhua FH

Gongora et al. 2003

GongFinnish1 1 AF535161 Sus scrofa Finland Domestic AF

GongFinnish3 1 AF535162 Sus scrofa Finland Domestic A

GongFinnish36 1 AF535163 Sus scrofa Finland Wild BA

GongFinnish41 1 AF535164 Sus scrofa Finland Wild

Randi et al. 2002

RandiSus1 1 AJ314542 Sus scrofa ? Wild C

RandiSus2 1 AJ314543 Sus scrofa Japan Wild BU

RandiSus3 1 AJ314544 Sus scrofa Italy Sardinia Med-Feral A

RandiVerr1 1 AJ314538 Sus verrucosus ? Wild BV

RandiVerr2 1 AJ314539 Sus verrucosus ? Wild BV

RandiBarb1 1 AJ314540 Sus barbatus ? Wild

RandiBarb2 1 AJ314541 Sus barbatus ? Wild

Yue unpulished paper

YueSchHall 1 AY230819 Sus scrofa Domestic Schwabisch-Hallisches A

YueLargeWhite 1 AY230822 Sus scrofa Domestic Large White A

YueGermLandrace 1 AY230823 Sus scrofa Domestic German Landrace

YueMeishan2 1 AY230827 Sus scrofa Domestic Meishan

YueErhualian1 1 AY230826 Sus scrofa Domestic Erhulian



YueMeishan1 1 AY230821 Sus scrofa Domestic Erhulian

YuePietrain 1 AY230820 Sus scrofa Domestic Pietrain

YueErhualian4 1 AY230818 Sus scrofa Domestic Erhulian AG

Huerta unpublished

HuertaMexHair2 1 AF082018 Sus scrofa Mexico Domestic Mexican Hairless

HuertaMexHair3 1 AF082020 Sus scrofa Mexico Domestic Mexican Hairless T




Watanobe, et al. 1999, Watanobe et al. 2001, Okumura et al. 2001

Wat99EuroAmerDom1D 5 D42170 Sus scrofa ? Domestic BK

Wat99SatsumaD29 15 AB015091 Sus scrofa Japan Domestic D

Wat99OkinawaD 4 AB015092 Sus scrofa Japan Domestic Okinawan FH

Wat99EuroAmerDom3D 6 D42185 Sus scrofa Europe Domestic I

Wat99domesticus 18 - 3JapWB/15D D42182 Sus scrofa Japan Both L

Wat99EuroAmerDom2D 2 - 1 EWB/1D D42180 Sus scrofa Germany Domestic S

Wat99RyukyuW2 1 AB015088 Sus scrofa Japan Wild



Wat99JapW4 33 D42174 Sus scrofa Japan Wild



Wat99JapW6 2 D42176 Sus scrofa Japan Wild BC

Wat99JapW3 13 D42173 Sus scrofa Japan Wild BC

Wat99JapW56 1 - japwild AB015084 Sus scrofa Japan Wild BD

Wat99JapWB55 7 AB015085 Sus scrofa Japan Wild BU

Wat99JapWB72 2 AB015086 Sus scrofa Japan Wild

Wat99RyukyuW1 3 AB015087 Sus scrofa Japan Wild BS

Wat99RyukyuW0 1 D42184 Sus scrofa Japan Wild BS

Wat99EastAsianDom1D 6 D42181 Sus scrofa Japan Domestic

Wat99Domesticus2 8 - 2JapWB / 6D D42183 Sus scrofa Japan/EuroAm Both AL

Wat99YucutanminiD 3 AB015093 Sus scrofa Mexico Domestic Yucatan Mini

WA99JapW2 6 D42172 Sus scrofa Japan Wild AK



Wat99EuroUmItalWB1 2 AB015094 Sus scrofa Italy Wild BH

Wat99EuroUmItalWB3 1 AB015095 Sus scrofa Italy Wild BG

Wat01LargeWhite4D 1 AB041494 Sus scrofa EuroAm Domestic Large White A

Wat01PietrainD 1 AB041489 Sus scrofa EuroAm Domestic Pietrain A

Wat01HampshireD 10 AB041488 Sus scrofa EuroAm Domestic Hampshire A

Wat01Okayama1D 1 AB041485 Sus scrofa EuroAm Domestic Berkshire A

Wat01Okayama2D 3 AB041486 Sus scrofa EuroAm Domestic BK

Wat01KagoshBerkD 3 AB041484 Sus scrofa EuroAm Domestic Kagoshima Berkshire E

Wat01MeishanD 7 AB041474 Sus scrofa East Asia / EuroAm Domestic Meishan GX

Wat01LargeWhite1D 1 AB041490 Sus scrofa EuroAm Domestic Large White GX

Wat01LargeWhite3D 1 AB041493 Sus scrofa EuroAm Domestic Large White M

Wat01LargeWhite2D 8 AB041492 Sus scrofa EuroAm Domestic Large White U

Wat01Kanagawa4D 3 AB041498 Sus scrofa EuroAm Domestic Landrace V

Wat01Kanagawa3D 1 AB041497 Sus scrofa EuroAm Domestic Landrace W

Wat01Jinhua1D 3 AB041475 Sus scrofa East Asia Domestic Jinhua Y

Wat01Jinhua3D 1 AB041477 Sus scrofa East Asia Domestic Jinhua Y

Wat01Okayama3D 7 AB041487 Sus scrofa EuroAm Domestic Duroc Z

Wat01Moncai1D 3 AB041480 Sus scrofa East Asia Domestic Moncai AA

Wat01ShizBerkD 6 AB041483 Sus scrofa East Asia / EuroAm Domestic Shizuoka Berkshire AA

Wat01YontsuanD 1 AB041478 Sus scrofa East Asia Domestic Yontsuan AB

Wat01Moncai3D 1 AB041482 Sus scrofa East Asia Domestic Moncai AB

Wat01Landrace2D 2 AB041499 Sus scrofa EuroAm Domestic Landrace AC

Wat01Tokushima 1 AB041467 Sus scrofa Japan Wild

Wat01Gunma 14 AB041468 Sus scrofa Japan Wild

Wat01Miyazaki1 5 AB041469 Sus scrofa Japan Wild





Wat01JinHua2D 1 AB041476 Sus scrofa East Asia Domestic Jinhua

Wat01Potbelly 1 AB041479 Sus scrofa East Asia Domestic Potbelly

Wat01Moncai2D 1 AB041481 Sus scrofa East Asia Domestic Moncai

Wat01MongWB1 1 AB041464 Sus scrofa Mongolia Wild BD

Wat01MongWB2 1 AB041465 Sus scrofa Mongolia Wild

Wat01ChineseWB 1 AB041466 Sus scrofa China Wild

Wat01LandraceD 3 AB041496 Sus scrofa EuroAm Domestic Landrace

Wat01Kanagawa2D 1 AB041495 Sus scrofa EuroAm Domestic Landrace

Wat01Kanagawa1D 2 AB041491 Sus scrofa EuroAm Domestic

OkuBerkD 1 AB059650 Sus scrofa EuroAm Domestic Berkshire

OkuEuroWB4 1 AB059651 Sus scrofa Italy Wild-oop

OkuJpWB5 1 AB059652 Sus scrofa Japan Wild-oop

Oku00Paethiopicus 1 AB046876 P. aethiopicus Wild - outgroup

MacDom 25 D16483 Sus scrofa EuroAm Domestic A

Table S3. This table list the specimens found in each named haplotype. The total number of pigs

found in the haplotype is listed above the name. The words next to the code indicate with which

major clade the haplotype clusters. Below the haplotype are the codes of the specimens that

possess the identical sequence. Numbers to the right of the code indicate the total number of pigs

associated with that code. The background colors for each of the specimens is as follows: No

color = domestic, Green = wild, Orange = feral, Blue = unknown status (either wild or feral)

because 1) they are from Corsican, Sardinian, or New Guinea 2) they do not match the signature

of other pigs found in the same region (see above), or 3) they have been designated as such by the

publication from which they are derived. Red = the two pigs discussed above whose status is in

question based upon unpublished metric data.

TABLE S3

76 20 21 27 8 12 17 22 11 23

A - Europe BK - Europe C - Europe D - Asia E - Europe FH - Asia GX - Asia I - Asia J - Asia L - Asia

LDomDuroc02 LDomLandrace04 LDomBritishLop01 LDomLandrace13 LDomLandrace09 LDomBritishOldSpot01 LDomLarWhite10 LAusFerBon5 LAusFerHair02124 LAusFerHair02159

LDomGermBunte01 LDomHungaryMangalica01 LDomIberiaBlack01 LDomUKTamworth01 LDomDuroc03 LDomLarWhite02 LB01 - large black LAusFerBon6 LAusFerHair02131 LAusFerHair02163

LDomPortBisaro01 LDomLandrace12 LDomMidWhite01 LDomFranceCreole01 LAusFerBon01 LAusFerHair02135 LAusFerHair02154

LDomHampshire02 LDomLandrace10 MJ01 - manchado jabugo LAusFerBon18 KimChinese TongChengD LAusFerBon04 LAusFerHair02170

LDomGermanAngler LDomLandrace05 Alves IB3 12 -2 LDomLarWhite07 Alves IB23 LAusFerBon3 KimChineseWannanhua1D LAusFerBon11 LAusFerHair02145 LDomLandrace11

LDomLargeWhite05 Alves IB4 LAusFerBon19 LAusFerHair02168

LDomLandrace14 LCorsica82 Alves IB5 6 7 10 13 19 -6 GL243-Ossabaw LDomLargeWhite06 Wat01MeishanD -7 LAusFerBon192 LAusFerHair02172 Wat99domesticus -3W/15D

BK01 - berkshire LNSardinia88 Alves IB9 14 16 -3 GL232-Amoy Wat01KagoshBerkD -3 Wat01LargeWhite1D LAusFerBon9 LAusFerHair02176

LDomHampshire01 Alves IB18 25 -2 KimChineseWananD LAusFerBon13 LAusFerHair02127 GL47 Hawaii

LDomPietrain05 Alves IB17 D4 - 2 Alves SJ LW1 -2 Yang03DurocD KimChineseWannanhua2 Yang03LargWhtD LAusFerHair02129

LDomLeicoma01 KimChineseWanhuaD Yang03JiangquhaiD LAusFerHair02182

GiuMangalicaD GL109 Germ Wat99SatsumaD29 -15 Yang03YushanheiBlackD Wat99EuroAmerDom3D -6

Alves IB15 Randi01Sus1 GL133 Norway Wat99OkinawaD -4 Yang03TongChengD

Alves IB26 D3 B LR1 P1 -5 Wat99EuroAmerDom1D -5 GiuPolEWB2 GL139 - Guam PNZKK001

Alves MG(mangalica) GL73 Morocco GL81 China PNZKK002Wat01Okayama2D -3 PNZKK004 PNZKK005

Wat01LargeWhite4D PNZKK009 PNZKK006

Wat01PietrainD GL287Corsica PNZKK007Wat01HampshireD - 10 GL289Sardinia PNZKK008

Wat01Okayama1D PNZKK010

AuckIs1-AuckIs5 -5

GongFinnish3

GL285Corsica

GL284Corsica

GL57 NZ

GL108 Germ

GL110 Corsica

GL112 Holland

GL141Armenia

GL252 Italy

GL63 Germany

GL111 Sardinia

GL288 Sardinia

Randi01Sus3Sardinia

YueSchHall

YueLargeWhiteMacDom - 25

4 4 3 3 2 2 4 3 10

M - Europe N - Europe O - Europe P - Asia Q - Europe R - Europe S - Asia T - Asia U -Europe

Alves D1 LDomLandrace06 Alves IB11 21 -2 Alves MS1 MS2 -2 Alves LR2 LDomPietrain03 Alves LW2 GiuUKLargWht1D KimUKWelshD

Alves D2 Alves D7 GiuCookIsD GiuChinMeishanD GiuHampshire2D GiuUKHampshire1D KimChineseYanxin KimUKBerkD Wat01LargeWhite2D -8

LDomLargeWhite08

GiuUKLandrace1D Wat99EuroAmerDom2D -2 HuertaMexHair3 Yang03LandraceD

Wat01LargeWhite3D

UrsSwedeSlaughter

4 2 5 8 13 3 3 3 2

V - Europe W - Europe Y - Asia Z - Asia AA - Asia AB - Asia AC - Europe AE - Asia AF - Europe

Alves D6 Alves IB8 Wat01Jinhua1D -3 GiuUKDurocD Wat01Moncai1D -3 Wat01YontsuanD GiuUKLandrace2D Yang03XiangD GongFinnish1Wat01Kanagawa4D -3 Wat01Kanagawa3D Wat01Jinhua3D -1 Wat01Okayama3D -7 Wat01ShizBerkD -6 Wat01Moncai3D Wat01Landrace2D -2 Yang03RongChangD LDomSwedLinderod01

Yang03JinhuaD Yang03NingxiangD Yang03Wuzhistan GL146China

Yang03DahuabiD

Kijas01Landrace

GL83 IndiaEast

3 2 55 9

AG - Asia AJ - Europe AK - Asia AL - Asia

KimChineseEurhul GL71 France GL237-SE russia Wat99Domesticus2 - 2W/6D

YueErhualian4 GL144Sardinia Wat01Miyazaki2D -11 GL86 Malaysia

Wat99JapW2

KimChineseGondonghei Wat99JapW5 - 42 for W2,W5,W7

Wat99JapW7

GiuAWB10

TABLE S3 continued

2 3 16 5 3 6 4 2 2

BA - Europe BB - Asia BC - Asia BD - Asia BG - Italy BH - Italy BK - Celeb BL - Celeb BM - Burma

GongFinnish36 Wat99JapW2 GiuAWB11 Wat99JapWB56 GL247Italy GL245 Italy 329 GL94 Sulawesi GL60 Burma

GiuPolEWB1 Wat99JapW5 Wat99JapW6 -2 Wat01MongWB1 GL248Italy GL246 Italy 330 GL95 Sulawesi GL240 Burma

Wat99JapW7 Wat99JapW3 -13 Miyazaki5 -3 Wat99EuroUmItalWB3 GL250 Italy 331

GL251 Italy 332Wat99EuroUmItalWB1 -2

4 3 4 4 8 2 4 3

BO - Indo BP - china BQ - Iran/Arm BS - Asia BU - Asia BV - Indo BW - India BX - PNG

GL101 Indonesia GL64b China GL59 Iran Wat99RyukyuW0 Randi01Japan Randi01Verr1 GL46 India GL134 PNG

GL138Malaysia GL78b China GL142 Armenia Wat99RyukyuW1 -3 Wat99JapWB55 -7 Randi01Verr2 GL135 India GL 140 Hawaii

GL70Malaysia GL147 China GL236 Armenia GL136 India PNG1 - Doido

GL88Indonesia GL271 Armenia GL 162 India PNG2- Jimi Valley

3 3 2 2 4 2

BY - Europe BZ - Europe CA - Europe CB - Vladivostok CC - Sulawesi CD- Basal

SWB1 IB1 SWB4 GL191 Vladivostok 329 GL84 Indonesia

SWB2 IB2 SWB5 GL192 Vladivostok 330 GL99 Indonesia

SWB3 IB20 331

332

Table S4. Different combinations of the following primers were used to amplify overlapping

sequences, which were then concatenated to produce the final 663bp fragment of the

mitochondrial control region. All primers are listed 5’ to 3’.

Primers used at the HWABC in Oxford and in Uppsala:

Forward primers

L530*

ACATACAAATATGTGACCCCA

L119(S22)

CAGTCAACATGCATATCACC

L15387§

CTCCGCCATCAGCACCCAAAG

L15593§

CCCTATGTACGTCGTGC

L104n(S22)

TGGAYTAATGACTAATCAGCCC

Reverse primers

H15902§

AGTGGGCGATTTTAGGTGA

H764§

TGCTGGTTTCACGCGGCA

H648n§

GCTYATATGCATGGGGACT

H15880n§

GGYCCTGAAGTAAGAACCAG

H124n(S22)

ATRGCTGAGTCYAAGCATCC

H16108n§

GCACCTTGTTTGGATTRTCG

H16445n§

ATGAGCTAATAATTTACCTGC

*Designed by Tom Gilbert§Designed by Greger Larson

Primers used at the University of Auckland:

Forward primers

mitL3(S24)

ATATACTGGTCTTGTAAACC

P28-L�G CAAACCAAAACGCCAAGTA

L104(S22)

TGGACTAGTGACTAATCAGCCCAT

L119(S22)

CAGTCAACATGCGTATCACC

Reverse primers

PJH 1� ACCATTGACTGAATAGCACC

P208-H�ACATGCTTATATGCATGGGGA

P500–H�AGTCCATCGAGATGTCTTAT

EGL 3H�CCATCTAAGCATTTTCAGT

�Designed by Judith Robins at Auckland University�Designed by Elizabeth Matisoo-Smith at Auckland University

Figure S1. This figure is a more detailed version of the identical tree shown in Figure 1 of the

main text. In this version, the tips are labeled with extraction codes for the novel sequences.

Accession numbers are listed for those sequences taken from GenBank. In cases where the tip

represents a haplotype shared by more than one pig, only one representative member of that

haplotype is listed followed immediately by the haplotype code printed in highlighted bold capital

letters. Others members of that haplotype can be found in Table S3.

Red tips have additional labels (‘Wild-oop’, ‘Wild-metdom’, ‘Med-feral’, or ‘NG-feral’)

explained in the text. Orange tips indicate that this sequence or haplotype is (or possesses) a

known feral pig or domestic pig.

Figure S2. A median-joining network depicting the relationships between European domestic

breeds and European wild boar. This figure is identical to Figure 2 in the text except in two

regards. Firstly, all nodes have been labeled with codes found in the tables described above.

Secondly, this network depicts the entire median-joining network in contrast to Figure 2 in the

main text which depicts a single parsimonious extract.

Figure S3. A median-network depicting the relationships between Asian domestic breeds and

closely related Asian wild boar from Mongolia, China, and Japan. This figure is identical to

Figure 3 in the main text except that all nodes have been labeled with codes found in the tables

described above.

Figure S4. A median-joining network depicting the relationships between members of the basal

cluster of Sus scrofa, the Pacific clade, and domestic and wild Asian pigs located in the portion of

Figure 1 labeled D3. As in the other network figures, red dots denote inferred haplotypes, yellow

dots are actual samples, and black perpendicular lines each signify a single base pair change.

REFERENCES:

S1. B. Shapiro et al., Science 306, 1561 (2004).

S2. L. Vigilant, Biol. Chem. 380, 1329 (1999).

S3. M. Allen et al., J. Forensic Sci. 43, 453 (1998).

S4. E. Matisoo-Smith, J. S. Allen, T. N. Laefoged, R. M. Roberts, D. M. Lambert,

Electrophoresis 18, 1534 (1997).

S5. A. Cooper, H. N. Poinar, Science 289, 1139 (2000).

S6. A. Rambaut, Se-Al: Sequence Alignment Editor. http://evolve.zoo.ox.ac.uk/ (1996).

S7. F. Ronquist, J. P. Huelsenbeck, Bioinformatics 19, 1572 (2003).

S8. D. Posada, K. A. Crandall, Bioinformatics 14, 817 (1998).

S9. H. J. Bandelt, P. Forster, A. Rohl, Mol. Biol. Evol. 16, 37 (Jan, 1999).

S10. J. Rozas, J. C. Sanchez-DelBarrio, X. Messeguer, R. Rozas, Bioinformatics 19, 2496

(2003).

S11. C. Vernesi et al., Mol. Ecol. 12, 585 (2003).

S12. M. Apollonio, E. Randi, S. Toso, Bollettino Zoologico 3, 213 (1988).

S13. E. Alves, C. Ovilo, M. C. Rodriguez, L. Silio, Anim. Genet. 34, 319 (2003).

S14. E. Giuffra et al., Genetics 154, 1785 (Apr, 2000).

S15. B. M. Ursing, U. Arnason, J. Mol. Evol. 47, 302 (1998).

S16. J. Yang et al., J. Hered. 94, 381 (2003).

S17. J. M. H. Kijas, L. Andersson, J. Mol. Evol. 52, 302 (2001).

S18. K. I. Kim et al., Anim. Genet. 33, 19 (2002).

S19. J. Gongora, O. A. T. Peltoniemi, I. Tammen, H. Raadsma, C. Moran, Acta Agric. Scand.

Sect. A-Anim. Sci. 53, 161 (2003).

S20. E. Randi, J. P. D'Huart, V. Lucchini, R. Aman, Mamm. Biol. 67, 91 (2002).

S21. T. Watanobe et al., Mol. Ecol. 8, 1509 (Sep, 1999).

S22. T. Watanobe et al., J. Mol. Evol. 52, 281 (2001).

S23. N. Okumura et al., Anim. Genet. 32, 139 (2001).

S24. N. Okumura et al., Biochem. Genet. 34, 179 (1996).

Documents

Worldwide phylogeography of wild boar reveals …...2005/03/10 · facility at the University Copenhagen, Denmark. For two modern individuals (GL143 and GL287), bone samples processed