Taye Bekele Ayele

Colonization History, Phylogeography and Conservation Genetics of the Gravely

Endangered Tree Species Hagenia abyssinica (Bruce) J.F. Gmel from Ethiopia

Gottingen 2008

OP

TIM

US

k c & - 223 M 1^.

GrsAlZ - UcVfc^Uo-C2V> £>»A T ^t^-A U

' f \Je^C<2^

C o lo n iz a tio n H isto ry, P liy lo g e o g ra p liy an d C o n se rvatio n G en etics of tllie G ra ve ly E n d a n ge re d T re e Sp ecies Httgenia

abyssinica (B ru ce) J .F . G in el from E th io p ia

Dissertation

submitted for the degree of Doctor of Philosophy (PhD)

Department of Forest Genetics and Forest Tree Breeding

Faculty of Forest Sciences and Forest Ecology

Georg-August University of Gottingen

Taye Bekele Ayele

Born in Kurkura (Harar), Ethiopia

Gottingen, 2008

Bibliographic information published by the Deutsche NationalbibliothekThe Deutsche Nationalbibliothek lists this publication in the Deutsche Nationalbibliografie; detailed bibliographic data are available in the Internet at http://dnb.d-nb.de

Referee: Prof. Dr. Reiner Finkeldey

Co-referee: Prof. Dr. Heiko Becker

Date of disputation: 2 September 2008

Printed with generous support from DAAD/gtz

Taye Bekele Ayele:Colonization History, Phylogeography and Conservation Genetics of the Gravely Endangered Tree Species Hagenia abyssinica (Bruce) J.F. Gmel from Ethiopia ISBN 978-3-941274-07-5

All Rights Reserved1. Edition 2008 © Optimus Mostafa Verlag URL: www.optimus-verlag.de

No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, scanning, or otherwise without the prior written permission o f the Publisher. Request to the Publisher for permission should be addressed to service@optimus-verlag.de.

To A tk ilt, Kal & Hamerenoah

with affection

Acknowledgem ents

“How can I repay the LORD for all His goodness to me?” Psalm 116:12. I praise You

Holy Father, for being there for me always and for getting me to the finish line.

It was a challenging but fruitful journey; and there were so many people around me that I

should recognize and thank. All started with an inspiring reply to my e-mail of 2002 that

I received from Prof. Dr. Reiner Finkeldey, expressing his interest to supervise my PhD

project. Prof., 1 admire your patience and support until I step on the open-door of your

office only three years latter. I have enjoyed a freedom of self management, excellent

guidance and encouragement from you in the course of my study. Vielen Dank! 1 am

grateful to Prof. Dr. Heiko Becker for willing to be co-referee for my dissertation and

disputation and Prof Dr. Ursula Kiies for willing to be member of the examination team.

I am indebted to Dr. Oliver Gailing, for excellent guidance in molecular laboratory work

and constructive suggestions throughout the data analysis and writing-up. Your “super”

encouragement and pleasant disposition made my work much easier than I expected. A

special gratitude goes to Prof. Dr. Hans H. Hattemer for scientific and administrative

support all the way through. Many thanks to Dr. Barbara Vomam for the help in aligning

the sequence data and for proof-reading the summaries of the thesis. I am grateful to

Oleksandra Dolyniska, Olga Artes, Thomas Seliger and Gerold Dinkel who are the

champions in the molecular lab and always ready to help. Also, Thomas and Gerold,

thanks for keeping my Laptop running. I appreciate the interactive and friendly environ­

ment in the entire department with special mention to Prof. Dr. Martin Ziehe, Prof. Dr.

Hans-Rolf Gregorius, Dr. Elizabeth Gillet, Dr. Ludger Leinemann and Mr. August Ca-

pelle. 1 am grateful to Marita Schwahn for administrative support and for comforting me

during some difficult times. Many thanks to former PhD students: Drs HT Luu, C-P Cao,

AL Curtu, M Mottura, M Pandey, Abayneh D and VM Stefenon, and the current fellow

PhD students: Sylvia, Akindele, Nicolas, Hani, Yanti, Nga, Amaryllis, Marius, Lesya

and Dorte for the stimulating and useful discussions and memorable time we had. I ex­

press my gratitude to the former and present coordinators of the “PhD Programme-Wood

Biology and Technology”, Drs E Kuersten & G Buettner, for their commendable work,

and the fellow PhD students thereof for useful interactions. I thank Klaus Richter for

translation of the summary of the thesis into German and Assefa Guchi for the production

of the distribution map of the populations of Hagenia. I commend the encouragement and

support I received from Drs Girma Balcha, Kassahun Embaye, Demel Teketay and

Sileshi Nemomissa. I thank the former and present Ethiopian students of Georg-August

University, Goettingen, for the wonderful moments we shared.

The enduring love and care o f my wife S/r. Atkilt Gizaw and my sweetie daughters Kal

and Hamerenoah has been a mystery o f my strength that kept me moving forward. Ti-

naye, you valiantly shouldered the responsibility o f caring for our kids and managing the

multifaceted social challenges during my long absence from home. Kaliye and Bebitaye,

you are brave and I am proud o f you. My special thanks to my mother Mintwab Wol-

deAregay and my father-in-law Aba WoldeAmanuel for their love and blessing, my

brother Ketema Bekele and his family for their encouragement and prayer through out

my study, and to my brother Daniel Bekele for his great help and charming accompany

during the fieldwork. The moral support from all my relatives and friends is gratefully

appreciated. The prayers o f my spiritual father Aba Gebretsadik, and that of brothers and

sisters from Mahibere Selam MedhaneAlem and Mahibere Kidusan kept me energetic.

The congregation o f the Ethiopian Orthodox Tewahido Church in Germany particularly

the brothers and sisters at the Keraniyo MedhaneAlem Sunday School in Kassel kept me

spiritually warm. There are a number o f wonderful people whom I want to recognize

their thoughtfulness and contribution but the space just isn’t enough. May God bless you

all!

Finally, I would like to acknowledge some institutions key to my achievement: the Ethio­

pian Institute of Biodiversity Conservation (IBC) granted me the study leave. My project

was generously funded by the German Federal Ministry o f Economic Cooperation and

Development (BMZ) through the German Technical Cooperation (gtz). The German

Academic Exchange Service (DAAD) executed the grant. The National Meteorological

Service Agency o f Ethiopia provided climatic data free o f charge.

1. General introduction............................................................................................................................ 11.1 Ethiopia in b rief..................................................................................................................................11.2 Conservation genetics of tropical tree species......................................................................... 11.3 Taxonomy and reproductive biology of Hagenia abyssinica................................................ 31.4 Ecology and natural distribution o f Hagenia abyssinica........................................................ 51.5 Economic and ecological significance of Hagenia abyssinica.............................................61.6 Rationale........................................................................................................................................ 71.7 Aims and predictions................................................................................................................... 8

1.7.1 Objectives..........................................................................................................................81.7.2 Hypotheses.........................................................................................................................91.7.3 Major research questions.............................................................................................10

2. Research approaches..........................................................................................................................112.1 Sampling............................................................................................................................................11

2.2 Morphological assessment..............................................................................................................11

2.3 DNA isolation...................................................................................................................................112.4 Chloroplast microsatellites..............................................................................................................12

2.5 DNA Sequencing.............................................................................................................................122.6 AFLP analyses................................................................................................................................. 123 Summary of results.....................................................................................................................133.1 Morphological data.....................................................................................................................133.2 Chloroplast microsatellite d a ta .................................................................................................133.3 Sequence data.............................................................................................................................. 143.4 AFLP data....................................................................................................................................144 General discussion..........................................................................................................................155 Conclusions and outlook.................................................................................................................196 Summary.......................................................................................................................................... 217. Zusammenfassung............................................................................................................................. 248 References........................................................................................................................................289. Papers submitted to journals............................................................................................................33I. Colonization history and phylogeography of Hagenia abyssinica (Bruce) J.F.

Gmel in Ethiopia inferred from chloroplast microsatellite m arkers................................ 33II. Spatial distribution of genetic diversity in Hagenia abyssinica (Bruce) J.F. Gmel

from Ethiopia, assessed by AFLP molecular markers....................................................... 57III. Conservation genetics of African redwood (Hagenia abyssinica (Bruce) J.F.

Gmel): a remarkable but gravely endangered tropical tree species................................. 86

10 Appendices.................................................................................................................................I l l

Table of contents

1. General introduction

1.1 Ethiopia in brief

Within an altitudinal range of 126 meters below sea level at Afar Depression to 4,620

meters above sea level (m asl ) at the spectacular mountaintops of Ras Dejen, Ethiopia’s

varying physiographic features endowed the country with diverse fauna and flora. The

climate of Ethiopia is varying from cool to hot and fundamentally governed by the Inter-

tropical Convergence Zone (ITC). The rainfall pattern is influenced by two wind systems:

monsoon from south Atlantic and the Indian Ocean, and winds from the Arabian Sea. The

country is devided in 2 1 major Tree Seed Zones and 27 sub-Tree Seed Zones that were

delineated based on ecological criteria to facilitate seed transfer within the country

(Aalbask 1993). The vegetation of the Ethiopian mountains belongs to the Afromontane

phytogeographical region (White 1983). Ethiopia is a severely deforested country with

only about 3.5% of its land currently covered by closed forests (WBISPP 2004). The low

living standard of the people coupled with lack of options is the underlying factor causing

severe decline in forest cover. There has been increasing pressure on the forest land for

crop and animal husbandry, and wood for fuel and construction. New settlements in pri­

mary forests are becoming commonplace and hence resulted in the conversion of forest

land into agricultural and other land use systems, subsequently causing forest fragmenta­

tion. Precious tree species such as Hagenia abyssinica are the prime victims o f such mal­

practices.

1.2 Conservation genetics of tropical tree species

Deforestation, forest fragmentation and extraction o f timber in the form of selective log­

ging could have serious consequences on the long-term maintenance of genetic diversity

and fitness in plants (Finkeldey and Hattemer 2007; Laikre and Ryman 1996; Young et

al. 1996). The marvelous biodiversity that has captured our planet is being lost at a pace

that is nearly unprecedented in the history of life (Ehrlich and Ehrlich 1991). Biodiversity

is in a serious decline, with, for example, approximately 50% of the vertebrate animal

l

General introduction

species and 12% of all plant species now considered vulnerable to near-term extinction,

mostly as a result of effects o f habitat alteration associated with human population

growth (Franklin et al. 2002).

The analyses of the amount and distribution o f genetic variation within and among popu­

lations of a species can increase our understanding of the historical processes underlying

the genetic diversity (Dumolin-Lapegue et al. 1997). The maintenance o f natural tree

populations with sufficient genetic variation to adapt to future changes in the environ­

ment is essential. Genetic variation is thought to be positively correlated with popula­

tions' ability to adapt to short-term environmental change, and populations with the high­

est levels of genetic variation are expected to suffer least from the negative effects of in-

breeding depression or genetic drift (reviewed by Barrett & Kohn 1991, Ellstrand & Elam

1993). Examples o f natural and dynamic evolutionary processes that shape genetic di­

versity are mutation, genetic drift, gene flow, natural selection, speciation and hybridiza­

tion (Avise 2004). Sound knowledge of the biology and genetics o f a given organism is

therefore instrumental in providing a scientific basis to its conservation and management.

The two major goals of conservation biology are (1) the preservation of genetic diversity

at any and all possible levels in the phylogenetic hierarchy and (2) the promotion of the

continuance of ecological and evolutionary processes that foster and sustain biodiversity

(reviewed by Avise 2004). Conservation genetics is a discipline dealing with the charac­

terization o f a given taxon and the development of conservation measures to maintain its

variation in order to adapt to changing environmental conditions. The present study in­

vestigates the pattern o f genetic variation in Hagenia abyssinica at morphological and

molecular genetic markers in order to identify populations for conservation and domesti­

cation.

2

General introduction

1.3 Taxonomy and reproductive biology of Hagenia abyssinica

The monotypic Hagenia abyssinica,

fonnerly/synonimously known as

Banksia abyssinica Bruce, Brayera

abyssinica Moq.-Tand, Brayera an-

thelmintica Kunth and Hagenia an-

thelmintica Kunth, is a wind-

pollinated (anemogamous) and wind-

dispersed (anemochorous) broad­

leaved dioecious tree species belong­

ing to the Rosaceae family (Hede-

berg 1989; Legesse 1995). It is

closely related to the monospecific

genus Leucosidea from the same

family in its taxonomic position

(Eriksson et al. 2003). Locally, the

tree is known as Kosso, Heto and

Habbi in Amharic, Oromiffa and Ti-

grigna, respectively (major local lan­

guages in Ethiopia). It is also commonly known as

African redwood, Brayera, Cusso, Hagenia, Kousso,

and Rosewood in English; Mdobore and Mlozilozi in

Swahili (http:/www.worldagroforestry.org), and Ko-

sobaum in German (http://de.wikipedia.org/wiki/-

Hagenia ab-yssinica). The specific name abyssinica

refers to the former name o f Ethiopia.

Fig. I Excellent quality timber tree growing in Che-

cheba (Uraga) forest. Photo: Taye B. Ayele

Fig. 2 compound leaf o f Hagenia Photo: Taye B. Ayele

Hagenia grows up to 35 meters in height (Fig.I). Hagenia trees exhibit varying architec­

tures from croaked to slender, multi-stems or forked to single stem, and thick to thin

crowns. The bark is brownish and readily peels in strips, sometimes very thick in old

3

General introduction

stems. Branchlets are covered by silky brown hairs and ringed with leaf scars (Azene et

al. 1993). The leaves are compound measuring up to 40 cm in length with 7- 19 narrowly

oblong leaflets (Fig. 2), having inconsistent leaflet

arrangement in opposite, alternate or mixed patterns.

Hagenia has distinct male and female trees that are

easily recognized by the appearance and color of the

flowers (Figs. 3 & 4). The flowers o f the female tree

are small and inconspicuous, forming attractive bright

pinkish-red drooping panicles (inflorescence) of up to

60 cm length and 30 cm width on aggregate (Azene et

al. 1993; Legesse 1995). The female flower heads are

bulkier than the more feathery yellowish male heads.

Flowering takes place between October and March

(Legesse 1995). The attractive and appealing appear­

ance o f the flowers o f Hagenia is not typical for wind-

pollinated species, which are usually dull in colour

(Legesse 1995), suggesting that other pollinating vec­

tors such as insects (particularly bees) or birds might

be involved. Fichtl and Admasu (1994) reported that

honeybees collect pollen from the male flowers and Fig 4 Typical mature femaleinflorescence. Photo: Taye B. nectar from the female flowers.

Fig 3 Typical mature male inflo­rescence. Photo: Taye B. Ayele

H. abyssinica has small, hairy and single-seeded fruits,

which have a brown syncarp with a single ovoid carpel

and a fragile pericarp (Fig. 5). It has fairly small and

light seeds (Fig. 5), amounting to 400,000 - 500,000

seeds per kg (Azene et al. 1993). The seeds can germi­

nate within 21 days with a germination capacity o f 40 -

60% without any pre-germination treatment (Azene et

al. 1993; Girma 1999). The seeds withstand desiccation

and hence can be stored for a long time (Girma 1999) in

Fig 5 seeds (top) and fruits (bottom) o f Hagenia, ruler graduation is in cm/mm. Photo: Taye B Ayele

4

General introduction

cold chambers and 6 - 1 2 months without any proper storage facilities (Azene et al.

1993). Protocols have been successfully developed for the micropropagation (Tileye et al.

2005a), in vitro regeneration (Tileye et al. 2005b) and genetic transformation (Tileye et

al. 2007b) of H. abyssinica.

1.4 Ecology and natural distribution of Hagenia abyssinica

Hagenia abyssinica is confined to Africa and its eco­

logical range stretches from Eritrea in the North to

Zimbabwe in the South, including Burundi, Central

African Republic, Congo, Ethiopia, Kenya, Malawi,

Rwanda, Sudan, Tanzania, Uganda, and Zambia (He-

deberg 1989; http:/www.worldagroforestry.org). Fos­

sil pollen records suggested that Hagenia immigrated

into Ethiopia from the south during the late Pleisto­

cene (since 16,700 years Before Present (BP)) and

became abundant in the southern regions o f Ethiopia

about 2500 years BP (Paper I). It grows within an al-

titudinal range of 1,850 to 3,700 m asl (Hedeberg

1989; Friis 1992; Azene et al. 1993; Legesse 1995)

inhabiting the montane forests, montane woodlands

and montane grasslands (Fig. 6-9). Tileye et al.

(2007b) reported

Fig 6 closed Hagenia forest at Dod- dola-Dachosa, Photo: Taye B Ayele

Fig 7 Hagenia tree retained on Bonsho farmland (close to Hagere Mariam), Photo: Taye B Ayele

Fig 8 Typical wooded grassland at Deyu (close to Kofele) dominated by Hagenia. This population is suffering from strangling by Ficus spp. P. Photo: Taye B Ayele

that Hagenia is a late successional species; but field

observations during the present work witnessed sap­

lings emerging in disturbed areas such as road cuts in

Bale and Bonga and hence did not support such a

designation. It was also reported that Hagenia has a

regeneration cycle associated with heavy forest fires

(http://database.prta.org/PROTA-html/Hagenia-

%20abyssinica En.htm), suggesting that it is a pio-

5

General introduction

neer species. Furthermore, Finkeldey & Hattemer

(2007) argued that pioneer species have a larger

seed shadow (typical for wind-dispersed species

like Hagenia) than species of late successional

stages.

Fig 9 Hagenia retained on grazing- land at Doddola-Serofta homestead. Photo: Taye B Ayele

Fig. 10 Traditional beehives placed on Hagenia trees. Photo: Taye B. Ayele

1.5 Economic and ecological significance of Hagenia abyssi­nica

Hagenia abyssinica is one of the best timber species in

Ethiopia and its furniture is preferred for its strength, fine

texture and attractive appearance (Fig. 2c). It is also used

for producing veneers, flooring, cabinets and fuel wood

(Azene et al. 1993; Getachew 2006). The tree is used to

place traditional beehives (Fig 2b) and it also attracts

birds. The concoction made from the powder of dried

female inflorescences is used as a purgative and taenicide

against tapeworm in Ethiopia (Pankhurst 1969; Jansen

1981; Hedeberg 1989; Dawit & Ahadu 1993; Berhanu et al. 1999). Despite its dreadful

and unpleasant taste, the infusion of Kosso has been

most extensively used as vermifuge in rural Ethiopia.

Overdose of Kosso may be fatal and may also cause

abortion. Honey obtained from beehives located

near Hagenia abyssinica trees and collected imme­

diately after their flowering is also effective in ex­

pelling tapeworms (http://database.prota.org/PRO-

TAhtml/Hagenia%-20abvssinicaEn-.htm). The med­

ical use o f Kosso was recorded as early as the six­

Fig. 11 A part of a wooden stage made from Hagenia lumber. Photo: Taye B. Ayele

General introduction

teenth century by an Ethiopian monk known as Aba Bahrey who described that the inha­

bitants of the Northern provinces took the drug to kill and rid their stomachs of certain

little worms (reviewed by Pankhurst 1969). Berhanu et

al. (1999) reported that Merck in Germany produced

the first crystalline substances called kosins from the

female flowers of Hagenia in 1870 and it was then in­

corporated in the European pharmacopoeia. With the

advent of modem medicine that have reliable dosage

and action, kosso is no more used as tapeworm expel-

lant internationally; but it is still locally traded and

used in rural parts of Ethiopia. In some areas farmers

retain scattered Hagenia trees on their farms because it

enriches the soil by generously shedding its leaves dur­

ing the dry season (personal observation, see Fig. 2d).

The leaves, seeds and bark are used as fodder, condiment or spice, and for dyeing textiles

to yellowish red, respectively (http://database.prota.org/PRQTAhtml/Hagenia%20-

abvssinica En.htm). Hagenia is a graceful and beautiful tree of high aesthetic value, es­

pecially when in blossom.

1.6 Rationale

Because of its quality timber, H. abyssinica has been logged heavily and selectively. It is

one of the endangered tree species in Ethiopia (Legesse 1995). The Forestry Proclama­

tion No. 94/1994 of Ethiopia prohibits the felling of Hagenia abyssinica, Cordia afri-

cana, Afrocarpus falcatus and Juniperus procera (Anonymous 1994). Despite the proc­

lamation, the destruction of the populations of these species is continuing unabated be­

cause of the lack of mechanisms to enforce the law. Forest decline has many effects on

the giant gene reservoir that is represented within forest trees (Hattemer and Melchior

1993). Old Hagenia trees are dying without recruiting new generation and this has aggra­

vated the level of threat on the species.

Fig. 12 Hagenia generously enriching a farm soil in Bon- sho (close to Hagere Mariam). Photo: Taye B Ayele

7

General introduction

In order to develop appropriate conservation strategies that, inter alia, preserve maximum

genetic diversity, it is imperative to know the extent and distribution of genetic variation

within a species (Bawa & Krugman 1990; Loveless and Hamrick 1984). Investigation of

intraspecific genetic variation may help to assess extinction risks and evolutionary poten­

tial (fitness) in a changing world (Bawa & Krugman 1990; Hedrick 2001) and is instru­

mental to identify appropriate units for conservation of rare and threatened species (New­

ton et al. 1999). The preservation o f germplasm in genebanks and the establishment of in

situ and ex situ conservation stands requires sound knowledge of the genetic structure of

a given species in order to capture the optimum genetic and demographic variations. The

genetic diversity of few populations of H. abyssinica was investigated using anonymous

RAPD (Kumilign 2005) and ISSR (Tileye 2007b) markers. Both studies covered small

spatial scale contrasting to the widespread distribution of the species in Ethiopia and were

also limited by the number of samples per population. The chloroplast DNA (cpDNA) of

Hagenia has never been investigated before. Therefore, considering the superior econom­

ic and ecological importance and the alarming depletion of the species, it is crucial to in­

vestigate the genetic diversity within and among populations of H. abyssinica at the

chloroplast markers and at the total genome level, covering the species' natural distribu­

tion range in Ethiopia.

1.7 A ims and predictions

1.7.1 Objectives

The research is aimed at the following objectives:

• to examine the colonization history of H. abyssinica in Africa

• to analyze the phylogeographic pattern o f the species in Ethiopia using DNA and

fossil pollen data

• to assess genetic variation and the association with morphological and ecological

diversities

• to assess and compare genetic variation levels in both sexes

• to use the results of the study to establish conservation strategies for the species.

General introduction

1.7.2 Hypotheses

The following major hypotheses were tested using two types of molecular markers:

Chloroplast microsatellites (Paper I: Colonization history and phylogeography of Hagenia abyssinica (Bruce) J.F. Gmel in Ethiopia inferred from chloroplast microsatellite markers)

1) Due to limited seed dispersal and possibly rare long-distance seed dispersal, there is a

strong differentiation among populations but low variation within populations

2) Populations show geographic structuring primarily induced by mutation and isolation

by distance

3) Based on the existing fossil pollen records, Hagenia immigrated into Ethiopia from

the south

AFLP (Paper II: Spatial distribution of genetic diversity in Hagenia abyssinica (Bruce) J.F. Gmel in Ethiopia assessed by AFLP molecular markers)

1) There is high variation within-populations due to effective gene flow from different

pollen and seed sources and very low differentiation among-populations due to long­

distance pollen and seed dispersal

2) The species does not lose genetic diversity during colonization due to effective gene

flow that counteracts effects of genetic drift. Likewise, the populations representing the

two chloroplast lineages show similar levels of genetic diversity, even though the derived

one originated by a single mutational event (from a single seed)

3) Given the wind-dispersed and wind-pollinated nature of Hagenia abyssinica, there is

no fme-scale spatial genetic structure.

9

General introduction

1.7.3 Major research questions

The following major research questions were addressed:

1) What are the levels and patterns o f genetic variation in Hagenia abyssinica (Papers I,

II & III)?

2) Which factors shaped genetic variation patterns of Hagenia in Ethiopia (Papers I &

II)?

3) Is there congruence between molecular data and palynological evidences to infer the

relationships among genealogical lineages and migration routes of the species (Paper I)?

4) Which conservation strategies are appropriate to save Hagenia from extinction (Paper

III)?

10

2 . Research approaches

2.1 Sampling

Twenty two natural and three planted populations were sampled from forests, woodlands

and farmlands known to have stands of H. abyssinica within the various Tree Seed Zones

of Ethiopia. Three of the populations were sampled from church/monastery forests. The

description of the Tree Seed Zones of Ethiopia in which H. abyssinica is growing is an­

nexed (Appendix l). The sampled populations represent most of the extant distribution of

the species in the country ranging from 05°5l'39"N (Hagere Mariam) in the south to

13°lr iO " N (Debark Mariam) in the north, and from 35°4l'59"E (Wonbera) in the west

to 40°l4 '32"E (Dindin) in the east. The distance between populations ranges from 2 1 to

806 km and they are located within an altitudinal range of 2200 m asl at Bonga to 3200 m

asl at Wofwasha. The pairwise geographic distance matrix for the 22 natural populations

of Hagenia is presented in Appendix 3. Temperatures range from an absolute minimum

o f-l°C at Dinsho to a maximum of 33.5 °C at Kosso Ber. Maps showing the spatial dis­

tribution o f individual trees in each population are provided in Appendix 4.

2.2 Morphological assessment

Dimensional, counted and visually observed morphological variables were assessed from

26-50 trees from each population. Details on the traits assessed are given in Paper I.

2.3 DNA isolation

Young leaves were collected and partially desiccated in paper bags before drying with

silica gel and stored at room temperature before DNA extraction. Total genomic DNA

was isolated from 20 mg leaves after shipment to Germany following the DNeasy 96 kit

protocol of Qiagen® (Hilden, Germany).

11

Research approaches

2.4 Chloroplast microsatellitesThree polymorphic consensus chloroplast microsatellite primers (CCMP2, CCMP6 &

CCMP10 (nomenclature according to Weising and Gardner 1999)) were used to screen

273 samples (9-12 individuals per population) from 25 populations. Details on the me­

thods and data analyses are described in Paper I.

2.5 DNA Sequencing

Comparative sequencing o f 18 fragments of the three chloroplast loci was performed to

confirm the amplified regions and to determine the molecular basis for size variation.

Fragments of CCMP2 (224-235 bp) were sequenced directly while fragments o f CCMP6

(140-142 bp) and CCMP10 (96-97 bp) were cloned due to their small sizes. In addition,

fragments from three out-group species from the same family were sequenced for

comparison. Details on the methods and data analyses are described in Paper I.

2.6 AFLP analyses

A total of 596 samples (23-24 individuals/population) were analysed at the nuclear en­

coded AFLP markers using the selective primer combination E41-M67 (nomenclature

according to Keygene N.V. ®). Details on the methods are described in Paper II.

12

3. Summary of results

3.1 Morphological data

The morphological traits observed in Hagenia abyssinica were highly variable among

populations. The ranges o f absolute morphological values are presented in Appendix 2.

The one-way analysis of variance (ANOVA) revealed a strikingly significant differentia­

tion (p<0.00l) among the 22 natural populations in all morphological traits. The cluster

analysis based on the average taxonomic distances matrix of leaf traits grouped the popu­

lations into two major clusters and separated four outlier populations. In general, no clear

association between geographic regions and taxonomic distances could be observed. The

average taxonomic distances for all morphological traits did not show any correlation

with the average Euclidean distances of climatic variables (r = 0 .17062, p = 0.9281), in­

dicating lack of association between quantitative morphological traits and climatic vari­

ables.

The total number of the extant individual Hagenia trees throughout the country (includ­

ing a rough estimation of scattered trees not included in the present study) is estimated as

7,000, the majority of which are old and dying without recruiting new generations. De­

tails on the results of morphological and ecological variables are presented in Paper III.

3.2 Chloroplast microsatellite data

The combination of 8 variants from the three chloroplast loci resulted in six haplotypes

that were phylogenetically grouped into two lineages. The haplotypes demonstrated a

very strong geographic pattern as a result of highly restricted gene flow by seeds. The

two lineages were separated by an indel (insertion/deletion) o f 10 nucleotides in locus

CCMP2. The first lineage encompasses haplotypes H4, H5 & H6, which are distributed

in the south-western and northern regions, while the second lineage contains haplotypes

HI, H2 & H3 in the central and southern regions. A remarkable subdivision o f cpDNA

diversity was found in the species as indicated by a high coefficient o f genetic differentia-

13

Summary o f results

tion ( G st = 0. 899, N st = 0. 926). The analysis of molecular variance (AMOVA) showed

that 92.3% of the total genetic diversity is represented among populations. Details on the

results of the chloroplast microsatellite analyses are described in Paper 1.

3.3 Sequence data

Sequencing confirmed homology of the three chloroplast loci to the expected regions of

the chloroplast genome. The observed variation was due to variable numbers of poly (A)

or poly (T) repeats in the microsatellites o f all loci and a large indel o f 10 bp in the flank­

ing region of locus CCMP2. In total, there were 4 variable sites: 3 short indels in the mi­

crosatellite motifs and one large indel in the flanking region. More details on the se­

quence data is provided in Paper I.

3.4 AFLP data

Moderate to high gene diversities were observed at AFLP loci ranging from 13.9% at

Dodola Serofita to 36.2% at Dinsho. The mean gene diversity in subdivided populations

of Hagenia abyssinica showed high within population variation (19.5%) and moderate

but significant population differentiation (F St = 7.7%). The phylogenetic tree derived

from Nei’s (1978) genetic distances congregated the populations into two major clusters,

but does not reflect the geographic origin of the populations. Despite marked differences

in genetic diversities for some populations, mean genetic diversities for the two sexes are

nearly the same (He = 0.207 ± 0.013 for male, He = 0.201 ± 0.019 for female). A test of

association between geographic and genetic distances based on AFLP markers showed a

very low and non-significant correlation (r = 0.14607, p = 0.9024). The multivariate

taxonomic distances of leaf traits are also not correlated with genetic distances (r= -

0.03484, p = 0.3926), showing that the genetic differentiation at neutral AFLPs is not as­

sociated with the leaf-morphological differences among populations. Ten out o f 21 natu­

ral populations showed significant spatial genetic structure (SGS). Details on the results

o f AFLPs are provided in Paper II.

14

4. General discussion

The palynological data obtained from the existing fossil pollen records suggested a

northward post-glacial colonization of Hagenia in Africa with the oldest available record

from Burundi (ca. 34,000 calibrated years before present (cal yrs BP)). The signal of

Hagenia in the pollen records from Burundi was quite high around 11,500 cal yrs BP

(Bonnefille et al. 1995), whereas its major expansion in the Bale Mountains (southern

Ethiopia) was after 2500 cal yr BP (Mohammed et al. 2004; Mohammed & Bonnefille

1998), suggesting a recent colonization of Ethiopia.

The morphological traits showed a significant differentiation among the 22 natural popu­

lations of H. abyssinica. However, the amount and distribution of morphological trait

variation across different habitats, geographic regions and climatic conditions did not

show any pattern. The maximum height of Hagenia has been reported to be 20 meter in

the existing literature (Hedeberg 1989; Azene et al. 1993; Legesse 1995; Tileye 2007a).

However, the present inventory recorded trees growing up to 35 m (mean maximum

height = 21.2 meters, n=l 109). Similarly, the number o f leaflets was reported to be be­

tween 5 and 8 on each side (i.e., between 10 and 16 on both sides) whereas the present

inventory provided a wider range of 7 to 19 leaflets on both sides, but always in odd num­

bers because of the presence of an apical leaflet. The lack of correlation between the Euc­

lidean distances of morphological and climatic data suggests that the observed morpho­

logical traits are not involved in the adaptation to different climatic conditions.

The chloroplast DNA analysis revealed a strong differentiation among populations, but

low variation within populations. The very high level of genetic variation among popula­

tions o f Hagenia at cpDNA suggested a restricted migration o f seeds among regions,

which is also reflected in the observed geographic structuring of haplotypes (Fig. 3 of

paper I). The coefficient of population differentiation (G st) in Hagenia is higher than or

comparable to Gst values recorded for other species with heterogeneous mode of seed

dispersal, including wind dispersal, investigated by chloroplast markers (Newton et al.

1999, Petit et al. 2003). The geographic distribution of chloroplast haplotypes and their

15

General discussion

genealogical relationships observed in Hagenia demonstrated a highly significant asso­

ciation. The nested clade phylogeographic analysis (NCPA) inferred that restricted gene

flow associated with contiguous range expansion and rare long-distance seed dispersal

shaped the genetic structure in the chloroplast DNA of Hagenia. The chloroplast data

suggests that Hagenia colonized Ethiopia first through the southwest mountains (popula­

tion Bonga, BG).

The moderately high genetic diversity at AFLPs of Hagenia reflects effective gene flow

within populations from different pollen and seed sources, resulting in a very low popula­

tion differentiation, which in turn reflects effective long-distance pollen dispersal. Inter­

estingly, the maximum genetic diversity was recorded for a well-protected Park Forest

(Dinsho) whereas the lowest gene diversities were recorded for the two farmland popula­

tions (Doddola Serofta and Hagere Mariam), pointing to negative human impact on ge­

netic diversity. Nybom (2004) reported a slightly higher mean within-population diver­

sity (Hpop) of 0.22 at RAPD, 0.23 at AFLP and 0.22 at ISSR markers. The overall mean

gene diversity o f Hagenia at AFLPs (He = 0.195) is comparable to some other plant spe­

cies such as the insect-pollinated Hibiscus tiliaceus (Malvaceae, He = 0.198, Tang et al.,

2003) and the wind-pollinated Acanthopanax sessiliflorus (Araliaceae, He = 0.187, Huh

et al., 2005) but lower than the insect-pollinated Malus sylvestris (Rosaceae, He = 0.225,

Coart et al., 2003). H. abyssinica exhibited higher mean gene diversity than some other

tropical and subtropical tree species such as the bird-pollinated Lobelia giberroa (Apocy-

naceae, He = 0.066, Mulugeta, et al. 2007) the insect-pollinated Shorea leprosula (Dip-

terocarpaceae, He = 0.161, Cao et al. 2006), the insect-pollinated Shorea parvifolia (Dip-

terocarpaceae, He = 0.138, Cao et al. 2006), the insect and wind-pollinated Acer skutchii

(Sapindaceae, He = 0.15, Lara-Gomez et al., 2005) and the bird-pollinated Pelliciera

rhizophorae (Pellicieraceae, Ht = 0.117, Castillo-Cardenas et al. 2005) at AFLP loci.

Tileye et al. (2007) reported higher mean gene diversity (0.30) in 12 populations o f

Hagenia from central and southern regions of Ethiopia at ISSR markers. But Qian et al.

(2001) and Nybom (2004) argued that ISSR markers generally over-estimate gene diver­

sity as compared to other markers. Hagenia also showed lower mean gene diversity than

some other tree species growing in Ethiopia investigated with AFLP markers, notably,

16

General discussion

the insect-pollinated Cordia africana (Boraginaceae, He = 0.287, Abayneh 2007) and the

wind-pollinated Juniperusprocera (Cupressaceae He = 0.269, Demissew 2007).

No trend of decreasing genetic diversity during colonization was detected, reflecting ef­

fective gene flow. In contrast, Lobelia giberroa, which entered Ethiopia also from the

south (Mulugeta, et al. 2007), Carpinus betulus (Betulaceae) in Europe (Coart et al.

2005) and Ptercarpus officinalis (Fabaceae) in the Caribbean (Rivera-Ocasio et al. 2002)

demonstrated decreasing diversity during recolonization (all based on AFLP analyses).

Comparable levels of population differentiation were found at AFLPs of Cordia africana

(Abayneh 2007), Acer skutchii (Lara-Gomez et al. 2005), Acanthopanax sessilijlorus

(Huh et al. 2005) and Carpinus spp (Coart et al. 2005). Tileye et al. (2007b) found a

higher coefficient of differentiation among 12 populations of Hagenia at ISSR markers.

Higher coefficients o f population differentiation than Hagenia were also reported for

Shorea species (Cao et al. 2006), Hibiscus tiliaceus (Tang et al. 2003) and Pelliciera

rhizophorae (Castillo-Cardenas et al. 2005). On the other hand, FSt values lower than that

of Hagenia were reported for wild Malus sylvestris (Coart et al. 2003).

The population differentiation is much higher in the chloroplast genome than in the nu­

clear genome of Hagenia abyssinica, as revealed by ISSR (Gst = 0.25; Tileye et al.

2007a) and AFLP markers (F st = 0.077, Paper II). Likewise, Rendell and Ennos (2002)

found a population differentiation that was 10-fold higher in the chloroplast genome of

Calluna vulgaris (L.) Hull (Ericaceae), than in the nuclear genome. In general, maternally

inherited genomes experienced considerably more subdivision (mean G st value of -0.64)

than biparentally inherited genomes (mean G st value o f -0.18) of angiosperm species

(reviewed by Petit et al. 2005). Due to its maternal inheritance, cpDNA in angiosperms is

transmitted only through seeds and therefore show a higher differentiation among popula­

tions than nuclear genes that are biparentally inherited. Consequently, genetic variation in

the chloroplast genome often shows a strong geographical structure than the nuclear ge­

nome (e.g., Cavers et al. 2003).

17

General discussion

A weighted-score population prioritization matrix (WS-PPM) that combines genetic,

morphological and demographic criteria is developed and used for the first time to pri­

oritize populations of Hagenia for conservation and domestication. Paper III describes

the prioritization process and also provides separate priority lists for in situ conservation,

ex situ conservation, and for tree improvement and domestication programs.

5. Conclusions and outlook

The present study at both morphological and molecular markers contributed valuable re­

sults that increased our understanding on the patterns of genetic diversity in Hagenia

abyssinica and provided useful information for planning conservation, tree improvement

and domestication programs. It was possible to infer the phylogeography, colonization

history and the factors shaping the genetic variation of the species from chloroplast mi­

crosatellite and AFLP markers.

The chloroplast haplotypes of Hagenia abyssinica demonstrated a pattern of isolation by

distance. Due to the recent colonization of the country by the species, it was possible to

identify rare long-distance dispersal and mutation events that contributed in shaping the

genetic structure of the species at chloroplast (cp) DNA. A remarkable subdivision of

cpDNA diversity was found as indicated by a high coefficient o f genetic differentiation.

The study demonstrated that restricted gene flow, contiguous range expansion and rare

long-distance seed dispersal events shaped the genetic structure in the chloroplast ge­

nome of Hagenia in Ethiopia. Unlike most of the wind-dispersed tree species, the chlo­

roplast haplotypes found in Hagenia showed a clear pattern of congruence between their

geographical distribution and genealogical relationships.

Despite the relatively recent immigration of Hagenia abyssinica into Ethiopia, popula­

tions showed moderate to high gene diversities (//e = 0.139-0.362), and moderate but sig­

nificant genetic differentiation (Fst = 0.077), reflecting high levels of post-colonization

gene flow among populations. The moderate to high intraspecific variation and a wide

vertical distribution of the populations (2200 to 3200 m asl) may suggest that Hagenia

might have occupied wider areas in the past than at present. The sizes of the extant popu­

lations were reduced to very small patches due to human impact, apparently affecting

their genetic structure.

The populations o f Hagenia abyssinica are severely decreasing without recruiting young

trees except for Bonga, the only viable population in southwest Ethiopia. Hagenia

19

Conclusions and outlook

should, therefore, be recognised as a critically endangered tree species and urgent action

is needed to save it from extinction.

Analysis of cpDNA types, intraspecific genetic variation and palynological inventories,

including all countries where the species is known to grow, 1) would fully resolve the

genealogical relationships within the natural distribution range of the species, 2) help to

identify the glacial refugia, and 3) is indispensable to fully understand the colonization

history of Hagenia in Africa. The screening of a large number of AFLP markers in segre­

gating populations may help to identify markers for sex determination in Hagenia. The

pollination mechanism o f Hagenia that has been reported elsewhere (wind) should be re­

examined in view o f the tree’s investment o f energy to produce alluring flowers.

20

6. Summary

Deforestation and forest fragmentation in general, and extraction of timber in the form of

selective logging in particular have serious consequences on the long-term maintenance

of genetic diversity and fitness in plants. It is imperative to know the extent and distribu­

tion of genetic variation within a given species in order to develop appropriate conserva­

tion strategies that inter alia preserve “optimum” genetic diversity. The genetic variation

of Hagenia abyssinica (Bruce) J.F. Gmel has been investigated at morphological and mo­

lecular markers in order to identify populations for conservation, tree improvement and

domestication programs.

The monotypic species Hagenia abyssinica (Rosaceae) is an anemogamous and anemo-

chorous broad-leaved dioecious tree species that is native to Africa. The major aims of

this study are to 1) examine the colonization history of Hagenia abyssinica in Africa, 2)

analyze the phylogeographic pattern of the species using DNA and pollen data, 3) assess

genetic variation and the association with morphological and ecological diversities, 4)

assess genetic variation levels in both sexes, and 5) use the results to establish conserva­

tion strategies for the species.

The colonization history of Hagenia abyssinica is inferred from the existing fossil pollen

records. The fossil pollen evidences suggested that postglacial colonization of Hagenia

followed a northward route in Africa and that it immigrated into Ethiopia from the south

during the late Pleistocene (since 16,700 years Before Present). Morphological and mole­

cular genetic analyses were performed in 22 natural and 3 planted populations sampled

from the natural distribution range of the species within the Ethiopian highlands. Dimen­

sional, counted and visually observed morphological variables were assessed for a total

of 1109 trees (26-50 individuals per population). Two molecular marker techniques,

namely, chloroplast microsatellites and nuclear encoded AFLP markers were employed

to investigate genetic diversity and to infer the factors shaping the genetic variation, phy-

logeography, and colonization history of the species. The genetic variation of 273 indi­

viduals from 25 populations was analysed at three polymorphic chloroplast microsatellite

21

Summary

markers (CCMP2, CCMP6 & CCMP10). Homology of the three loci to the respective

regions of the chloroplast genome was confirmed by comparative sequencing of 21 frag­

ments. The intraspecific genetic variation o f 596 individuals from 25 populations was

analysed at the AFLP markers using the selective primer combination E41-M67 (nomen­

clature according to Keygene N.V.®).

The analysis o f variance (ANOVA) revealed a significant differentiation among the 22

natural populations of Hagenia abyssinica in all quantitative morphological traits

(p<0.001). However, the global multivariate analyses o f the entire morphological data set

did not clearly separate the individuals among the populations. The average taxonomic

distances for all morphological traits did not show any correlation with the average

Euclidean distances o f climatic variables (r = 0.17062, p = 0.9281), indicating a lack of

association between quantitative morphological traits and climatic variables. The cluster

analysis based on the average taxonomic distances of leaf characters showed a geograph­

ical pattern with few exceptions and assembled the populations into two major clusters

and separated four outlier populations from the rest.

The analysis o f cpDNA using microsatellite markers revealed a total of six haplotypes

that were phylogenetically grouped into two lineages. The chloroplast haplotypes identi­

fied in Hagenia demonstrated a strong pattern o f congruence between their geographical

distribution and genealogical relationships. Eighty percent of the populations were fixed

on one type. A very low haplotype diversity within populations (hs = 0.079, vs = 0.058)

and a remarkable subdivision of cpDNA diversity (G St = 0. 899, NSt = 0. 926) was ob­

served. The study demonstrated that restricted gene flow through seeds, contiguous range

expansion and mutation shaped the genetic structure in the chloroplast genome o f

Hagenia. Due to the recent colonization o f the country by the species, it was also possible

to identify rare long-distance dispersal events that contributed in shaping the genetic

structure of the species in Ethiopia.

Out of 106 unequivocally scored AFLP markers, 91.5% were polymorphic. Despite the

relatively recent immigration of Hagenia abyssinica into Ethiopia, populations showed

22

Summary

moderate to high gene diversities (Hs = 0.139-0.362), and moderate but significant ge­

netic differentiation (Fst = 0.077), reflecting high levels of post-colonization gene flow

particularly by pollen among populations. There were no significant differences in gene

diversity between sexes, even though single populations exhibited marked differences.

AFLP profiles did not show any diagnostic markers for neither of the two sexes. No trend

of decreasing genetic diversity was detected during colonization, confirming effective

gene flow among populations. Despite the dispersal o f seed and pollen o f Hagenia by

wind, a significant non-random fine-scale spatial genetic structure (SGS) is observed up

to 80 m in some populations.

The multivariate taxonomic distances of leaf traits is not correlated with Nei’s genetic

distances (r= -0.03484, p = 0.3926), showing that the genetic differentiation at anony­

mous AFLPs is not associated with the leaf-morphological differences among popula­

tions. As expected, the coefficient of population differentiation is found to be much lower

for the biparentally inherited nuclear genome (represented by AFLPs) of Hagenia abys­

sinica than in the maternally inherited chloroplast genome. Comparative analyses of the

amount and distribution of the genetic diversity of Hagenia abyssinica with other tree

species are provided. In conclusion, population history can be reconstructed by chlorop­

last microsatellite data reflecting seed dispersal while AFLPs identify geographic regions

and populations of high genetic diversity. A weighted-score population prioritization ma­

trix (WS-PPM) that combines genetic, morphological and demographic criteria was de­

veloped and used for the first time to prioritize populations for in situ conservation, ex

situ conservation, and for tree improvement and domestication programs. Extremely ur­

gent decision is needed to launch conservation and massive plantation programs of the

African redwood to ensure the long-term survival o f the species and to boost its economic

and ecological values.

23

7. Zusammenfassung

Besiedlungsgeschichte, Phylogeografie und Erhaltungsgenetik der vom Aussterben

bedrohten Baumart Hagenia abyssinica (Bruce) J. F. Gmel in Athiopien

Abholzung und Fragmentierung von Waldem im Allgemeinen, und im Besonderen die

Entnahme von Holz bei der selektiven Abholzung, haben emste Auswirkungen auf die

Langzeiterhaltung genetischer Diversitat und auf die biologische Fitness von Pflanzen. Es

ist zwingend notwendig das AusmaB und die Verteilung von genetischer Variation in ei-

ner Art zu bestimmen, um angemessene Schutzstrategien zu entwickeln, die unter ande-

rem eine hohe genetische Diversitat erhalten. Die genetische Variation von Hagenia

abyssinica (Bruce) J. F. Gmel wurde mit Hilfe von morphologischen und molekularen

Markem untersucht, um Populationen fur Artenschutz und Zuchtung zu identifizieren.

Die monotypische Art Hagenia abyssinica (Rosaceae) ist eine anemogame und anemo-

chore diozische Laubbaumart, die in Afrika heimisch ist. Die Hauptziele dieser Studie

sind 1) ihre Besiedlungsgeschichte in Afrika zu untersuchen, 2) ihre phylogeografischen

Muster mit Hilfe von DNA- und Pollendaten zu analysieren, 3) die genetische Variation

und ihre Beziehung zur morphologischen und okologischen Diversitat zu berechnen, 4)

das AusmaB an genetischer Variation in beiden Geschlechtem abzuschatzen, und 5) die

Ergebnisse zu nutzen, um ErhaltungsmaBnahmen einzuleiten.

Die Besiedlungsgeschichte von Hagenia abyssinica wurde von anderen Autoren mit Hil­

fe von fossilen Pollenvorkommen rekonstruiert. Die fossilen Pollen deuten auf eine

nordwarts gerichtete postglaziale Kolonisierungsroute von Hagenia in Afrika hin. Die

Art ist vermutlich im spaten Pleistozan (ab 16,700 Jahren vor heute) aus dem Siiden nach

Athiopien eingewandert. Morphologische und molekulare Analysen wurden in 22 natur-

lichen und drei angepflanzten Populationen im natiirlichen Verbreitungsgebiet der Art im

Hochland von Athiopien durchgefuhrt. Morphologische Eigenschaften wurden bei insge-

samt 1109 Baumen (26 bis 50 Baume pro Population) untersucht. Zwei molekulare Mar­

ker, Chloroplastenmikrosatelliten und kemkodierte AFLP-Marker, wurden angewandt,

24

Zusammenfassung

um die genetische Diversitat zu untersuchen und um die Faktoren zu bestimmen, die ge­

netische Variation, Phylogeographie und Besiedlungsgeschichte der Art gepragt haben.

Die genetische Variation von 273 Baumen wurde mit drei Chloroplastenmikrosatelliten

(CCMP2, CCMP6 & CCMP10) analysiert. Die Homologie der drei Genorte zu den zuge-

horigen Regionen des Chloroplastengenoms wurde durch vergleichende Sequenzierungen

von 21 Fragmenten bestatigt. Die intraspezifische genetische Variation von 596 Genoty-

pen aus 25 Populationen wurde mit AFLPs untersucht, wobei die Primerkombination

E41-M67 verwendet wurde (Nomenklatur entsprechend Keygene N.V.®).

Durch Varianzanalysen (ANOVAs) wurde eine signifikante Differenzierung zwischen

den 22 natiirlichen Populationen von Hagenia abyssinica in alien quantitativen morpho­

logischen Merkmalen festgestellt (p<0.001). Allerdings konnten durch umfassende mul­

tivariate Analysen des gesamten morphologischen Datensatzes nicht alle Individuen den

Populationen zugeordnet werden. Die durchschnittliche taxonomische Distanz aller mor­

phologischen Merkmale war nicht mit den durchschnittlichen euklidischen Distanzen

klimatischer Variablen korreliert (r=0.17062, p=0.9281. Clusteranalysen, basierend auf

einer Matrix aus durchschnittlichen taxonomischen Distanzen von Blattmerkmalen, wie-

sen ein geographisches Muster mit wenigen Ausnahmen auf. Es konnten zwei „Haupt-

cluster“ und 4 davon getrennte „Nebencluster“ unterschieden werden.

Die Analyse von cpDNA-Mikrosatelliten ergab sechs Haplotypen, die phylogenetisch in

zwei Linien eingruppiert werden konnten. Die in Hagenia identifizierten Haplotypen

zeigten eine starke Ubereinstimmung zwischen ihrer geographischen Verteilung und ihrer

Abstammung. Achtzig Prozent der Populationen waren auf einen Haplotyp fixiert. Es

wurde eine sehr geringe Diversitat an Haplotypen innerhalb der Populationen (hs=0.079,

vs=0.058) und eine deutliche Untergliederung der cpDNA Diversitat zwischen den Popu­

lationen (Gst=0.899, NSt=0.926) festgestellt. Die vorliegende Studie zeigte, dass einge-

schrankter GenfluB durch Samen, ein gleichmaBige Ausbreitung und Mutationen die ge­

netische Struktur im Chloroplastengenom von Hagenia beeinfluBt haben. Aufgrund der

rezenten Besiedlung des Landes durch die Art war es zusatzlich moglich, seltene Verbrei-

25

tungsereignisse tiber weite Strecken zu identifizieren, die an der Ausbildung der geneti-

schen Struktur der Art in Athiopien beteiligt waren.

Von 106 AFLP Markem waren 91.5% polymorph. Die Populationen wiesen eine mittlere

bis hohe genetische Diversitat (He=0.139-0.362) und eine niedrige aber signifikante gene­

tische Differenzierung auf (Fst=0.077). Diese Ergebnisse spiegeln einen hohen GenfluB

nach der Besiedlung besonders durch Pollenflug zwischen den Populationen wider. Es

zeigten sich keine signifikanten Unterschiede zwischen mannlichen und weiblichen Indi-

viduen hinsichtlich ihrer mittleren genetischen Diversitat, obgleich in den einzelnen Po­

pulationen deutliche Unterschiede auftreten konnten. Die AFLP- Profile zeigten keine

diagnostischen Marker fur die beiden Geschlechter. Anders als in viele anderen Baumar-

ten erhohte sich die genetische Diversitat wahrend der Besiedlung. Daraus kann ge-

schlossen werden, dass GenfluB und Mutationen in Verbindung mit der Besiedlungsge­

schichte einen starken Einfluss auf die intraspezifische Variation von Hagenia hatten.

Die multivariate taxonomische Distanzmatrix der Blattmerkmale ist nicht mit Nei's gene­

tischer Distanzmatrix korreliert (r=-0.03484, p=0.3926), da genetische Differenzierung

an neutralen AFLPs nicht mit blattmorphologischen Unterschieden zwischen Populatio­

nen assoziiert ist. Wie erwartet, ist der Koeffizient der Populations-differenzierung im

biparental vererbten Kemgenom (reprasentiert durch AFLPs) sehr viel kleiner als im ma­

ternal vererbten Chloroplastengenom. Es werden vergleichende Analysen der genetischen

Diversitat und der Differenzierung von Hagenia abyssinica mit anderen Baumarten dar-

gestellt. Zusammenfassend lasst sich feststellen, dass die Populationsgeschichte mit

Chloroplastenmikrosatelliten, welche die Verbreitung der Samen widerspiegeln, rekons-

truiert werden kann, wahrend die AFLP-Daten geografische Regionen und Populationen

mit hoher genetischer Diversitat identifizieren konnen. Eine Weighted-Score Population

Prioritization Matrix (WS-PPM), die genetische und demografische Kriterien vereint,

wurde entwickelt und genutzt, um Schwerpunktpopulationen fur in ,v//«-Erhaltung, ex si-

/w-Erhaltung, und fur Zucht- und Ertragsprogramme zu finden. Sehr schnelle Entschei-

dungen sind notig, um Programme zur Arterhaltung und groBangelegte Plantageprojekte

Zusammenfassung

26

von afrikanischem Rotholz zu starten, die ein Uberleben der Art iiber lange Zeitraume

und ihren okonomischen und okologischen Nutzen sichem konnen.

Zusammenfassung

27

8. References

Abayneh D (2007) Genetic variation in Cordia africana Lam. in Ethiopia. PhD thesis, Georg-August University of Gottingen.

Aalbaek A (1993) Tree seed zones for Ethiopia. National Tree Seed Project, Addis Ababa

Anonymous (1994) Forest Conservation, Development and Utilization Proclamation. Proclamation No. 94/1994. Negarit Gazeta. The Transitional Government of Ethi­opia. Addis Abeba, Ethiopia.

Avise JC (2004) Molecular Markers, Natural History and Evolution, 2nd edn. Sinauer Associates Inc, Sunderland, MA.

Azene BT, Bimie A, Tegnas B (1993) Useful Trees and Shrubs fo r Ethiopia: Identifica­tion, Propagation and Management fo r Agricultural and Pastoral Communities. Technical Handbook No. 5, Regional Conservation Unit, Swedish International De­velopment Authority (SIDA).

Barrett SCH, Kohn JR (1991) Genetic and evolutionary consequences of small popula­tion size in plants: implications for conservation. In: Falk DA & Holsinger KE (eds) Genetics and conservation o f rare plants. Oxford University Press, New York.

Bawa KS, Krugman SL (1990) Reproductive biology and genetics of tropical trees in re­lation to conservation and management. In: Rain Forest Regeneration and Management (eds Gomez-Pampa A, Whitmore TC, Hadley M), pp. 119-136. The Parthenon Publish­ing Group.

Berhanu M. Abegaz, Ngadjui BT, Merhatibeb Bezabih, Mdee LK (1999) Novel natural products from marketed plants of eastern and southern Africa. Pure and Applied Chem­istry 71:919-926.

Bonnefille R, Riollet G, Buchet G, Icole M, Lafont R, Arnold M, Jolly D (1995) Gla­cial/interglacial record from intertropical Africa, high resolution pollen and carbo data at Rusaka, Burundi. Quaternary Science Reviews 14: 917-936.

Cao, C-P., Finkeldey, R., Siregar, I.Z., Siregar, U.J., Gailing, O. (2006). Genetic diversity within and among-populations o f Shorea leprosula Miq. and Shorea parvifolia Dyer (Dipterocarpaceae) in Indonesia detected by AFLPs. Tree Genetics and Genomes 2: 225-239.

Castillo-Cardenas MF, Toro-Perea N, and Cardenas-Henao H (2005) Population genetic structure of neotropical Mangrove species on the Colombian Pacific Coast: Pelliciera rhizophorae(Pellicieraceae). Biotropica 37: 266-273.

Cavers S, Navarro C, Lowe AJ (2003) Chloroplast DNA phylogeography reveals coloni­zation history of a Neotropical tree, Cedrela odorata L., in Mesoamerica. Molecular Ecology 12: 1451-1460.

References

Coart, E., Van Glabeke, S., Petit, R.J., Van Bockstaele, E. and Roldan-Ruiz, 1. 2005). Range wide versus local patterns of genetic diversity in hornbeam (Carpinus betulus L.). Conservation Genetics 6: 259-273.

Coart E, Vekemans X, Smulders MJM, Wagner I, Huylenbroeck JV, Bockstaele EV and Roldan-Ruiz I (2003) Genetic variation in the endangered wild apple (Mains sylve- stris (L.) Mill.) in Belgium as revealed by amplified fragment length polymorphism and microsatellite markers. Molecular Ecology 12: 845-857.

Comps, B., Gomory, D., Letouzey, J., Thiebaut, B. and Petit, R.J. (2001) Diverging trends between heterozygosity and allelic richness during post glacial colonization in the European beech. Genetics 157: 389-397.

Dawit Abebe, Ahadu Ayehu (1993) Medicinal Plants and Enigmatic Health Practices o f Northern Ethiopia. BSPE, Addis Ababa, Ethiopia.

Demissew SD (2007) Genetic variation of Juniperus procera Hochst. Ex Endl. popula­tions in Ethiopia assessed by using microsatellite (SSR) and AFLP markers. MSc. Thesis. Georg-August University of Gottingen.

Dumolin-Lapegue S, Demesure B, Fineschi S, Le Corre V, Petit RJ. (1997) Phylogeo- graphic structure of white oaks throughout the European continent. Genetics 146:

1475-1487.

Ehrlich PR, Ehrlich AH (1991) Healing the planet. Addison-Wesly, Reading, MA.

Ellstrand NC, Elam DR (1993) Population genetic consequences of small population size: implications for plant conservation. Annual Review o f Ecology and Systematics 24 :

217-241.

Eriksson T, Hibbs MS, Yoder AD, Delwiche CF, Donoghue MJ (2003) The phytogeny of Rosoideae (Rosaceae) based on sequences of the internal transcribed spacers (ITS) of nuclear ribosomal DNA and the trnl/f region of chloroplast DNA. International Jour­nal o f Plant Sciences 164: 197-211.

Fichtl R, Admasu A (1994). Honeybee flora o f Ethiopia. DED - Margraf Verlag, Wei- kersheim.

Finkeldey R, Hattemer HH (2007) Tropical Forest Genetics. Springer-Verlag, Berlin.

Friis I (1992) Forests and Forest Trees o f Northeast Tropical Africa: Their Natural Ha­bitats and Distribution Patterns in Ethiopia, Djibouti and Somalia. Kew Bulletin ,

Additional Series XV. Her Majesty's Stationery Office, London.

Getachew Desalegn (2006) Some Basic Physical And Mechanical Properties O f The Valuable Hagenia abyssinica Timber And Their Interactions: Imlpication For Its Ra­tional Utilization, Ethiopian Journal o f Biological Sciences 5 ( 2): 117-135.

29

References

Girma Balcha (1999) Status of forest seed research in Ethiopia: Consequences for devel­opment of forest genetic resources conservation strategy. In: Abebe, et al. (eds). For­est Genetic Resources Conservation: Principles, Strategies and Actions. Proceedings of the National Forest Genetic Resources Conservation Strategy Development Work­shop, June 21-22, Addis Abeba.

Hattemer HH & Melchior GH (1993) Genetics and its application to tropical forestry. In Pancel L (Ed). Tropical Forestry Handbook Vol 1, Springer-Verlag, Berlin.

Hedeberg O (1989) Rosaceae. In: Inga Hedeberg and Sue Edwards, eds. Flora o f Ethi­opia, Vol. 3, Pittosporaceae to Arralaceae. Addis Abeba and Asmara, Ethiopia; Upp­sala, Sweden.

Hedrick PW (2001) Conservation genetics: where are we now? Trends in Ecology and Evolution 16: 629-636.

Heuertz M, Fineschi S, Anzidei MA et al. (2004) Chloroplast DNA variation and post­glacial recolonization o f common ash (Fraxinus excelsior L.) in Europe. Molecular Ecology 13: 3437-3452.

Huh M.K, Huh H.W. and Back K. (2005) Genetic diversity and population structure of Acanthopanax sessiliflorus (Araliaceae) using AFLP. Korean Journal o f Genetics 27: 71-79.

Jansen P.C.M. (1981) Spices, condiments and medicinal plants in Ethiopia, their taxono­my and agricultural significance. Wageningen.

Jump AS, Penuelas P (2007) Extensive spatial genetic structure revealed by AFLP but not SSR molecular markers in the wind-pollinated tree, Fagus svlvatica. Molecular Ecology 16: 925-936.

King RA, Ferris C (1998) Chloroplast DNA phylogeography o f Alnus glutinosa (L.) Gaertn. Molecular Ecology 7: 1151-1163.

Kumilign A (2005) Estimation of sex-related genetic diversity of Hagenia abyssinica (Bruce) J.F. Gmel. M.Sc. thesis, Addis Ababa University.

Laikre L, Ryman N (1996) Effects on intraspecific biodiversity from harvesting and en­hancing natural populations. Ambio 25: 504-509.

Lara-Gomez G., Gailing O., and Finkeldey R. (2005) Genetic variation in isolated Mex­ican populations of the endemic maple Acer skutchii Rehd. Allg Forst- u J-Ztg 176: 97-103.

Legesse N (1995) Indigenous trees o f Ethiopia: Biology, uses and propagation tech­niques. SLU, Reprocentralen, Umea.

Loveless MD, Hamrick JL (1984) Ecological determinants of genetic structure in plant populations. Annual Review o f Ecology andSystematics 15: 65-95.

Luu H.T. (2005) Genetic variation and the reproductive system of Dipterocarpus cf.

30

References

condorensis Pierre in V ietnam . PhD Thesis, G eorg-A ugust University o f Gottingen.

Meister J, Hubaishan MA, Killian N, Oberprieler C (2005) Chloroplast DNA variation in the shrub Justicia areysiana (Acanthaceae) endemic to the monsoon affected coastal mountains of the southern Arabian Peninsula. Botanical Journal o f the Linean Society 148: 437-444.

Mohammed MU, Bonnefille R (1998) A Late Glacial to Late Holocene pollen record from a high land peat at Tamasaa, Bale mountains, South Ethiopia. Global and Plane­tary change 16-17: 121-129.

Mohammed U, Dagnachew Legesse, Gasse F, Bonnefille R, Lamb HF, Leng MJ (2004) Late quaternary climate changes in the Horn o f Africa. In: Past climate variability through Europe and Africa (eds Battarbee RW, Gasse F, Stickly CE. Kluwer Aca­demic Publishers, Dordrecht, the Netherlands.

Mulugeta K, Ehrich D, Taberlet P, Sileshi N and Brochmann C (2007) Phylogeography and conservation genetics o f a giant lobelia (Lobelia giberroa) in Ethiopian and Trop­ical East African mountains. Molecular Ecology 16: 1233-1243.

Nei. M. (1978) Estimation o f average heterozygosity and genetic distance from a small number o f individuals. Genetics 89 : 583-590.

Newton AC, Allnutt TR, Gillies ACM, Lowe AJ, Ennos RA (1999) Molecular phy­logeography, intraspecific variation and the conservation of tree species. Trends in Ecology and Evolution 14: 140-145.

Nybom H (2004) Comparison of different nuclear DNA markers for estimating intras­pecific genetic diversity in plants. Molecular Ecology 13: 1143-1155.

Pankhurst R (1969) The Traditional Taenicides of Ethiopia. Journal o f the History o f Medicine and Allied Sciences (XXIV): 323-334.

Petit RJ, Aguinagalde I, de Beaulieu J-L, et al. (2003) Glacial refugia: hotspots but not melting pots of genetic diversity. Science 300 : 1563-1565.

Petit RJ, Duminil J, Fineschi S, Hampe A, Salvini D, Vendramin GG (2005) Comparative organization o f chloroplast, mitochondrial and nuclear diversity in plant populations. Molecular Ecology' 14: 689-701.

Qian J, Luscombe NM, Gerstein M (2001) Protein family and fold occurrence in ge­nomes: power-law behaviour and evolutionary model. Journal o f Molecular Biology 313: 673-681.

Rendell S, Ennos RA (2002) Chloroplast DNA diversity in Calluna vulgaris (heather) populations in Europe. Molecular Ecology 11: 69-78.

Rivera-Ocasio E, Aide TM, McMillan WO (2002) Patterns o f genetic diversity and bio- geographical history of the tropical wetland tree, Pterocarpus officinalis (Jacq.), in the Caribbean basin. Molecular Ecology 11: 675-683.

31

References

Tang T, Zhong Y, Jian SG, Shi SH (2003) Genetic diversity of Hibiscus tiliaceus (Mal­vaceae) in China assessed using AFLP markers. Annals o f Botany 92: 409-414.

Tileye F, Welander M, Legesse N (2005a) Microporopagation of Hagenia abyssinica: a multipurpose tree. Plant Cell, Tissue and Organ Culture 80: 119-127.

Tileye F, Welander M, Legesse N (2005b) In vitro regeneration o f Hagenia abyssinica (Bruce) J.F. Gmel.(Rosaceae) from leaf explants. Plant Cell Reports 24: 392-400.

Tileye F, Nybom H, Bartish IV, Welander M (2007a) Analysis of genetic diversity in the endangered tropical tree species Hagenia abyssinica using ISSR markers. Genetic Resources and Crop Evolution 54: 947-958.

Tileye F, Zhu L-H, Legesse N, Welander M (2007b) Regeneration and genetic transfor­mation of Hagenia abyssinica (Bruce) J.F. Gmel.(Rosaceae) with rolB gene. Plant Cell, Tissue and Organ Culture 88 : 277-288.

Vos P, Hogers R, Bleeker M, Reijans M, Lee Th van der, Homes M, Frijters A, Pot J, Peleman J, Kuiper M and Zabeau M (1995). AFLP: a new technique for DNA finger­printing. Nucleic Acids Research 23(21): 4407-4414.

WBISPP (2004) Forest resources o f Ethiopia. Woody Biomass Inventory and Strategic Planning project. Addis Ababa.

White F (1983) The vegetation o f Africa: A descriptive memoire to accompany the UNESCO/AETFAT/UNESCO vegetation maps o f Africa. UNESCO, Paris.

Young A, Boshier D, Boyle T (ed.) (2000) Forest Conservation Genetics: Principles and Practice. CABI Publishing.

Young A, Boyle T, Brown T (1996) The population genetic consequences o f habitatfragmentation for plants. Trends in Ecology and Evolution 11: 413—41

32

9. Papers submitted to journals

I. Colonization history and phylogeography of Hagenia abys­sinica (Bruce) J.F. Gmel in Ethiopia inferred from chlorop­last microsatellite markers

Taye Bekele Ayele,*1 Oliver Gailing,* Mohammed Umer* and Reiner Finkeldey*

Forest Genetics and Forest Tree Breeding, Georg-August University, Biisgenweg 2,

37077 Gottingen, Germany

^Department of Earth Sciences, Addis Ababa University, P.O.Box 1176, Addis Ababa,

Ethiopia

A bstract We investigated genetic variation o f 273 individuals from 25 populations

of the monotypic species Hagenia abyssinica (Rosaceae) from the highlands of Ethiopia

at three chloroplast microsatellite markers. The objectives were to infer the factors that

shaped the genetic structure and to reconstruct the colonization history of the species. Six

haplotypes that were phylogenetically grouped into two lineages were identified. Homol­

ogy of the three loci to the respective regions of the chloroplast genome was confirmed

by sequencing. The chloroplast haplotypes found in Hagenia showed a clear pattern of

congruence between their geographical distribution and genealogical relationships. A

very low haplotype diversity within populations (hs = 0.079, vs = 0.058) and a very high

population differentiation (G st = 0.899, N st = 0.926) was observed. Restricted gene flow

through seeds, rare long-distance dispersal, contiguous range expansion and mutation

shaped the genetic structure of Hagenia. Fossil pollen records suggested that Hagenia

immigrated into Ethiopia from the south.

Key words: chloroplast microsatellite, colonization history, genealogical relation­

ships, geographical structure, Hagenia abyssinica, haplotype diversity, phylogeo­

graphy.

33

Paper I: Colonization history and phylogeography

Introduction

Genetic variation is structured not only by the contemporary forces of genetic exchange

but also by historical patterns of relationship (e.g., Schaal et al. 1998) Phylogeographic

analyses can provide insights into the historical processes responsible for restricted dis­

tributions of populations (Cruzan and Templeton 2000). Phylogeography characterizes

population subdivision by recognizing geographical patterns of genealogical structure

across the range of a species (Avise 1994), synthesizing the influence of both history and

current genetic exchange (Schaal et al. 1998). Cladistic gene genealogies can form the

basis of historical approaches to the study of intraspecific processes (Schaal et al. 1998,

Templeton et al. 1987, Templeton 2004). Rare long-distance gene flow events potentially

have great evolutionary significance (Le Corre et al. 1997, Schaal et al. 1998, Cain et al.

2000) and great biological relevance by shaping genetic variation (Ouborg et al 1999).

Rare dispersal events produce fragmented advancing fronts establishing new populations

as a result of dispersal from pioneer populations, as well as from populations that are part

o f the continuous distribution (Cruzan and Templeton 2000). Cain and co-workers (2000)

argued that rare events can control the rate o f population spread and that only dispersal

via seed directly affects colonization of new populations. For plant populations that have

passed through recent episodes of range expansion, long-distance dispersal events are

probably the most important factors o f spatial genetic structuring at maternally inherited

genes at small or medium geographic scales (Le Corre et al. 1997). In the simulation-

based study on colonization dynamics o f maternally inherited loci in oak, Le Corre and

co-workers (1997) demonstrated that stratified dispersal was far more rapid than pure dif­

fusion, even if long-distance dispersals were very rare events. They also argued that long­

distance dispersal events influenced the genetic differentiation o f populations, leaving a

genetic signature that is likely to persist for long periods. This paper demonstrates the

significance o f such rare events, among others, in shaping the genetic structure of the

monotypic species Hagenia abyssinica.

34

Paper I: Colonization history andphylogeography

The chloroplast DNA has been widely used in the investigations of genetic structure (e.g.

Meister et al. 2005; Parducci et al. 2001), phylogeography (e.g., Butaud et al. 2005;

Meister et al. 2005; King and Ferris 1998; Rendel and Ennos 2002) and colonization his­

tory (e.g., Cavers et al. 2003, Petit et al. 2002, 2003; Heuertz et al. 2004) of tree species.

We employed chloroplast microsatellite markers (Weising and Gardner 1999) to investi­

gate genetic structure, phylogeography and colonization routes of Hagenia abyssinica

within its natural range in Ethiopia. The mode of inheritance of the chloroplast genome of

Hagenia abyssinica has not been determined, but it is most likely maternally inherited as

in the majority of angiosperms (Harris and Ingram 1991; Birky 1995; Finkeldey and Hat-

temer 2007). We also examined the available fossil pollen records in order to determine

the colonization history o f Hagenia in Africa. Analysis of fossil pollen helps to recon­

struct past vegetation history, demographic history and dynamics of ecosystems (Darby-

shire et al. 2003; Lamb 2001; Mohammed et al. 2004; Olago et al. 1999).

Hagenia is a wind-pollinated and wind-dispersed broad-leaved dioecious tree species that

belongs to a monotypic genus in the Rosaceae family (Hedeberg 1989; Legesse 1995). It

is confined to Africa and its ecological range stretches from Ethiopia in the North to

Zimbabwe in the South (Hedeberg, 1989, http:Avww.worldagroforestry.org). Fossil pol­

len records indicated that Hagenia immigrated into Ethiopia from the south during the

late Pleistocene and became abundant in the southern regions o f Ethiopia about 2500

years Before Present (BP). At present, the extant Hagenia populations throughout the

country are situated at higher altitudes, often in wetter depressions

The tree has remarkably diversified economic and ecological values (Azene et al. 1993;

Berhanu et al. 1999; Dawit and Ahadu 1993; Jansen 1981; Hedeberg 1989). Hagenia has

been logged heavily and selectively and it is one of the endangered tree species in Ethi­

opia (Legesse 1995).

Genetic inventories of Hagenia abyssinica are rare and restricted only to some parts of

the species’ distribution range. Kumilign (2005) and Tileye (2007) investigated the ge­

netic diversity of a few populations of H. abyssinica using anonymous RAPD and ISSR

35

r

markers, respectively. The present investigation using cpDNA covered the whole range

of the species in Ethiopia and is the first o f its kind. We predicted that 1) due to limited

seed dispersal and possibly rare long-distance seed dispersal, there is a strong differentia­

tion among populations but low variation within populations, 2) populations show geo­

graphic structuring primarily induced by mutation and isolation by distance, 3) based on

the existing fossil pollen records, Hagenia immigrated into Ethiopia from the south.

Two main questions are addressed: 1) which factors shaped the maternally inherited ge­

netic variation of Hagenia in Ethiopia? 2) Is there a congruence between molecular data

and palynological evidences to infer the relationships among genealogical lineages and

migration routes of the species?

Materials and methods

Sampling and DNA Extraction

Twenty two natural and three planted populations were sampled from all regions where

Hagenia is known to grow in Ethiopia. These populations represent most of the extant

distribution o f the species in the country. The distribution of the populations stretches

from 05°51'N (Hagere Mariam) in the south to 13°11 N (Debark Mariam) in the north,

and from 35°42'E (Wonbera) in the west to 40°14'E (Dindin) in the east (Table 1; Fig.

3). The distances between populations range from 21 to 806 km. The populations are lo­

cated within an altitudinal range o f 2200 m a.s.l. at Bonga to 3200 m a.s.l. at Wofwasha,

and temperatures range from an absolute minimum of -1°C at Dinsho to a maximum of

33.5 °C at Kosso Ber populations. The nearest meteorological stations are situated at

lower altitudes than Hagenia populations in most o f the cases, and therefore, higher rain­

fall and lower temperatures are expected than those shown in Table 1.

Young leaves were collected and partially desiccated in paper bags before drying with

silica gel and stored at room temperature before DNA extraction. Genomic DNA was iso-

Paper I: Colonization history and phylogeography

36

Paper I: Colonization history andphylogeography

lated from leaves following the DNeasy 96 kit protocol of QiagerT (Hilden, Germany).

In an initial test, DNA was isolated from dried leaves of different sizes. A size of 1cm2

(about 20 mg) gave the best results with regard to DNA quantity and quality and was

used for all samples.

PCR amplification and genotyping

The ten pairs of consensus chloroplast microsatellite primers (CCMPs) (Weising and

Gardner 1999) were tested on 3 samples from 3 geographically separated populations that

are far from each other. Seven of them gave amplification products, three of which

(CCMP2, CCMP6 and CCMP10) were found to be polymorphic, and were used to screen

273 samples (9-12 individuals from each population). Additional 144 samples were ana­

lysed to study spatial genetic structure in four polymorphic natural populations. DNA

was diluted (1:10) prior to PCR amplification. PCR reactions were performed in a Peltier

Thermal Cycler PTC-200 (MJ Research' ), with a volume of 16 pi reaction mixture con­

taining 2 pi HPLC H2O, 8 pi hot star master mix (containing lOmM Tris-HCL (pH 9.0),

1.5 mM MgCh, 50mM KC1, 0.2 mM each of dNTPs, 0.8U Taq DNA polymerase)

(Qiagen*, Hilden, Germany), 2 pi of each forward and reverse primer (5pmol/pl) and 2 pi

DNA (about 10 ng). The forward primer was labelled with the fluorescent dyes 6-FAM

or HEX. The PCR profile for CCMP2 and CCMP10 was 15 min. initial denaturation at

95 °C, followed by 35 cycles of 1 min. denaturation at 94 °C, 1 min. annealing at 50 °C

and 1 min. extension at 72 °C, with a final extension of 10 min. at 72 “’C. The PCR profile

for CCMP6 differed in the annealing temperature (52.5 °C). Aliquots o f the amplification

products were diluted prior to clcctrophoretic separation on the ABI 3100 Genetic Ana­

lyser (Applied BiosystemsR) depending on the intensity of the bands observed after aga­

rose gel electrophoresis. Two pi diluted (multiplexed in most cases) PCR product were

denaturated for 2 minutes at 90°C with 12 pi HiDi formamide (Applied Biosystems®)

containing -0.02 pi internal size standard (GS ROX 500, Applied Biosystems®) before

loading on the ABI Genetic Analyser 3100 (Applied Biosystems8) for separation.

37

Paper I: Colonization history and phylogeography

Sequencing

Comparative sequencing of 18 fragments from the three chloroplast loci was performed

to confirm the amplified regions and to determine the molecular basis for size variation.

The amplification products were purified using the QIAquick Gel Extraction kit

(Qiagen®, Germany) following the manufacturer’s specifications. We employed direct

sequencing for a locus having relatively larger fragment sizes, CCMP2 (224-235 bp).

Cloning was performed for the two loci with smaller fragment sizes, CCMP6 (140-142

bp) and CCMP10 (96-97 bp), using the pBSKS vector and X Bluel competitive cells with

the TA cloning method (Invitrogen*). Sequencing followed the dideoxy-chain termina­

tion method (Sanger et al., 1977) Sequencing reaction of 10 pi total volume containing 1

pi Big Dye (BD vers. 3.1), 1.5 pi sequencing buffer (SB 3.1), 4.8 pi HPLC H20 , 0.7 pi

forward or reverse primer (5pmol/pl), 2 pi purified DNA (about 10 ng) was used. Since

no sequences o f CCMP2 from other species of the family Rosaceae were available in ex­

isting databases, three out-group species from the Rosaceae family that were available in

the Botanic Garden of the Georg-August University Goettingen, Germany, were also se­

quenced for comparison. The sequence data have been stored in the EMBL Nucleotide

Sequence Database (http://www.ebi.ac.uk/embl/) with the accession numbers FM174367-

75 and FM 174387 for locus CCMP2 (10 sequences), FM174376-80 for locus CCMP6

(5 sequences), FM174381-83 for locus CCMP10 (3 sequences), and FM1743784-86 for

the locus ccmp2 of the out-group species (3 sequences).

38

Paper I: Colonization history and phylogeography

Table I Site characteristics of 22 natural and 3 planted populations of Hagenia sampled from Ethiopia. The planted populations are labelled as plantation.

Popula tion Code Latitude L ongitude altitude (m asl)

ARF(m l)

M in T M ax T M axHt(m )

M ax n DBH(cm)

D ebark-M ariam DKm r 37 °5 7 ' 3013 1270 8.8 19.7 15 144 11

D ebark- D KP 13°12' 38°01 ' 3005 1270 8.8 19.7 na na 11PlantationK im ir-D ingay KDP 1 1°48' 3 8°14 ' 1350 9.2 21.9 na na 11

p lantation W oldiya S e’at W D 1 1°55' 39°24 ' 3112 908 na na 15 125 11M ichael K osso B er K.B 10°59' 36°54 ' 2702 2381 12.9 27.4 17 45 11

D enkoro DR 10°52' 3 8°47 ' 3061 896 10.9 2 1 .8 2 0 196 11

W onbera W B 10°34' 35°42 ' 2428 1622 na na 18 112.5 11

W o f w asha W W 09 °4 5 ' 3 9 0 4 4 - 3159 941 6.1 19.9 15 122 11

C hilim o CM 09 °0 5 ' 38°10 ' 2805 1114 11.5 25.8 35 118 12

D indin DN 0 8 °3 6 ’ 40°14 ' 2410 989 12.7 28,0 26 156 11

Z equa la A bo ZQ 08°32 ' 38 °5 0 ’ 2856 1215 na na 23 234 10

B oterbecho BB 08°24 ' 3 7°15 ' 2772 1666 5.7 23.6 28 126 9

C hila lo CL 07 °5 6 ' 3 9 ° i r 2815 796 9.8 23,0 15 140 11

Sigm o p lantation SM P 07 °5 5 ' 36°10 ' 2300 1837 11.4 2 1 .6 na na 11

Sigm o SM 07 °4 6 ' 36°05 ' 2651 1837 11.4 2 1 .6 25 152 11

M unesa M S 0 7 °2 5 ’ 38°53 ' 2459 1028 10.1 24.3 20 84.5 11

B onga BG 07°17 ' 36°22 ' 2238 2217 11.9 26.6 18 93 11

Kofele K.L 0 7 ° i r 3 8°52 ' 2757 1305 7.7 20.1 26 214 11

D insho DO 07 °0 5 ' 3 9 0 4 7 - 3117 1213 3.4 2 0 .8 19 153 11

D oddola-Serofta DS 06 °5 2 ' 3 9°02 ' 2700 1074 6.7 24.3 23 242 11

D oddola- DD 06 °5 2 ' 39°14 ' 3039 1074 6.7 24.3 25 2 1 0 11D achosaRira RR 06 °4 5 ' 39 °4 3 ’ 2725 736 na na 23 150 11

Bore BR 06 °1 7 ' 3 3 0 3 9 - 2631 1526 8.3 18.8 24 107 12

U raga UR 06°08 ' 38°33 ' 2508 1228 8.3 18.8 19 96 11

H agereM ariam HM 0 5 °5 1 ' 38°17 ' 2443 1228 12.3 23,0 18 114 10

m asl= m eters above sea level; A R F = M ean A nnual R ainfall; m l = m illilitres; M in T = M ean M inim um tem perature; M ax T = M ean M axim um tem perature; M ax H t (m ) = M axim um height in m eters; M ax D B H (cm ) = M axim um d iam e­ter at b reast height in centim eters; n = no. o f sam ples; na = not availab le. Source o f clim atic data; N ational M eteo ro log i­cal A gency S erv ice (E thiopia)

39

Paper I: Colonization history and phylogeography

Data analysis

Amplification products were aligned with the internal size standard using GENESCAN

3.7, and fragments were scored with GENOTYPER 3.7 (Applied Biosystems®). Poly­

morphisms in fragment size were identified as different length variants that were com­

bined to define haplotypes. Genetic diversity (hs, hT. vs, vT) and differentiation among

populations ( G s t , N st ) was computed by PermutcpSSR (available at

http://www.pierroton.inra.fr/genetics/labo/Software/PermutCpSSR/index.htmn as de­

scribed by Pons and Petit (1995; 1996). Distribution of genetic diversity within and

among populations was estimated by an analysis of molecular variance (AMOVA) using

ARLEQUIN Version 3.0 (Excoffier et al. 2005; available at

http: //cmpg. unibe. ch/software/arlequin3).

Sequences were analysed with the sequence analysing software 3.7 (Applied Biosys­

tems®), edited by the program BIOEDIT (Hall 1999) and aligned with Clustal W applica­

tion (Thompson, et al. 1994; available at http://www.ebi.ac.uk/clustalw/).

A statistical parsimony network o f haplotypes was constructed with the help o f a program

TCS Version 1.21 (Clement et al. 2000) from DNA sequence data. Large gaps in a se­

quence due to an indel (insertion/deletion) are coded as a single mutation to avoid theo­

retical intermediate haplotypes that are created by the program, which interprets each gap

as independent mutation event. The sequence data also confirmed that the larger indel

was the result o f a single mutation event. The TCS program was also used to compute the

out-group weights of haplotypes. A nested clade phylogeographic analysis (NCPA) of the

spatial distribution o f the genetic variation was performed by the program GEODIS (Po­

sada et al. 2000). Nested clades were plotted manually on the haplotype network based on

the algorithms defined by Templeton et al. (1987). The interpretation of statistically sig­

nificant patterns o f distribution was made following the inference key described in Tem­

pleton (2004).

40

Paper I: Colonization history and phylogeography

Results

Genetic diversity and differentiation

We found 3 alleles in locus CCMP2, 3 alleles in locus CCMP6 and 2 alleles in locus

CCMP10 (Tables 2 and 3). The analyses o f within population diversity (hs), total diver­

sity (ht) and differentiation ( G s t ) yielded 0.079, 0.787 and 0.899, respectively, under the

assumption of unordered haplotypes (Pons and Petit 1996). The corresponding values for

within population diversity (vs), total diversity (vT) and differentiation ( N s t ) with ordered

haplotypes (Pons and Petit 1996), taking genetic distances among haplotypes into ac­

count, were 0.058, 0.787 and 0.926, respectively. An analysis of molecular variance

(AMOVA) showed that 92.3% of the total genetic diversity is represented among popula­

tions. A test of spatial genetic structure in the four polymorphic natural populations did

not show any family or spatial genetic structure, indicating effective seed dispersal by

wind at the local level. This is not unexpected for species with very light wind-dispersed

seeds. The additional 144 individuals analysed for spatial genetic structure showed simi­

lar haplotype composition and frequencies, as the sample that was analysed to study ge­

netic diversity (Table 4). No additional haplotypes were found due to increased sample

size.

Table 2 Description of chloroplast microsatellites in Hagenia

Repeat m otif Fragment size (bp)

Genelocus

Forward and reverse primer sequences (5' - 3')* Hagenia

otherplants*

other Hagenia plants*

location in genome*

source of variation

CCMP2

CCMP6

GATCCCGGAGGTAATCCTGATCGTACCGAGGGTTCGAAT

CGATGCAT ATGT AGAAAGCC CATTACGTGCGACTATCTCC

(A)9

(T)v

(A),,

(T)5C(T)17

224,234, 158-234 235

140,141,142 93- 103

5' to trnS

ORF 77- ORF 82, intergenic

Indel,micro­satellite

micro­satellite

CCMP10TTTTTTTTTAGTGAACGTGTCATTCGTCGDCGTAGTAAATAG (A),2 (T),4

91->30096, 97

rpl2-rpsl9,intergenic

micro­satellite

*Weising and Gardner, 1999, indel = Insertion/deletion (in the flanking region)

41

Paper I: Colonization history and phylogeography

Table 3 Description o f Hagenia haplotypes detected by fragment analysis in three chlo­roplast DNA loci

Haplotype CCMP2 CCMP6 CCMP10 Relativefrequency

np nfp

Hi 224 140 97 0.34 10 7H2 224 141 97 0.25 8 5H3 224 142 97 0.05 3 0H4 234 140 97 0.21 6 5H5 234 140 96 0.04 1 1H6 235 140 97 0.11 3 2

np= No. of populations possessing the haplotypes: nfp = No. of populations fixed on one type

Table 4 Number of observations per haplotype from different sample sizes of polymor­phic populations

Populations Chilimo (CM) Kofele (KL) Bore (BR) Uraga (UR)Sample size 12 47 11 46 12 47 11 50

Haplotypes HI 10 39 6 19 1 3H2 4 26 9 38 1 2H3 1 1 2 6 10 48H4 2 8

Results o f sequencing

Multiple sequence alignments o f loci CCMP2, CCMP6 and CCMP10 are shown in Fig.

1. Sequencing confirmed homology of the three loci to the respective regions of the

chloroplast genome. The observed variations were due to variable numbers o f poly (A) or

poly (T) repeats and a large indel of 10 bp at position 100 bp in the flanking region of the

locus CCMP2. In total, there were 4 variable sites (3 short indels in the microsatellites

and a large indel in the flanking region). A 10-bp segment is preceded by an identical

sequence in the flanking region of the four genotypes in locus CCMP2 (underlined in Fig.

1). The duplication can be explained by a strand slippage during cpDNA replication in a

Paper I: Colonization history andphylogeography

single mutational event (e.g., Wolfson et al., 1991). The sequences of the three out-group

species (Rubus fruticosus, Rubus idaeus and Rosa canina) also showed duplication

events of different segment in similar region (Fig. 1).

Phylogeography

Six haplotypes (H1-H6) were identified from the combination of the three loci as de­

tected by fragment analysis (Table 3). A fully resolved statistical parsimony network of

the chloroplast haplotypes of Hagenia, which is reconstructed from DNA sequences (Fig.

2), demonstrates the relationship among the different haplotypes and the minimum num­

ber of evolutionary events separating them. The third frequent haplotype, H4 (represented

in 21% of the individuals), has a larger out-group weight (0.35) than the most frequent

haplotype HI (represented in 34% of the individuals) with an out-group weight of 0.26.

Out-group weight is a relative weight of haplotypes based on mutational steps and is

strongly correlated with actual age (of a haplotype) and thus is a much better indicator of

haplotype age than is the haplotype frequency (Castelloe and Templeton 1994). All of the

haplotypes are separated by a single mutation step. HI is separated from H4 by a deletion

of 10 nucleotides in locus CCMP2.

The observed N St value is significantly higher than the G st value at p<0.01 (none of the

pennutated G st values was higher than the observed N st value), indicating geographical

clustering of related haplotypes. Three nested clades were evident from the haplotype

network (Fig. 2) and the chi-square (x2) statistic revealed a significant association

(p<0.0001) between genealogical and geographic distributions in all of the clades (Table

5). Restricted gene flow was inferred for the haplotypes nested in clade 1-1 (but with

some long distance dispersal events over intermediate areas) and in clade 1-2 (with isola­

tion by distance), while contiguous range expansion was deduced from the total clado-

gram (Table 5).

43

Paper I: Colonization history and phylogeography

Table 5 Interpretation of the results of the nested clade phylogeographic analysis (NCPA)

Clade X2 P Chain of inference* Inferred demographic events§

1-1(HI, H2, H3)

276.5762 0.0000 1 -2-3-5-6-7-8-YES restricted gene flow/dispersal but with some long distance dispersal over intermediate areas

1-2(H4, H5, H6)

136.0000 0.0000 1-2-3-4-N0 restricted gene flow with iso­lation by distance

Total cladog- ram

231.7921 0.0000 1-2-11-12-NOcontiguous range expansion

*Refers to inference key numbers (YES/NO refers to the answers to the respective last keys), §Interpreted by inference key (Templeton 2004)

Haplotype HI is widely distributed in central Ethiopia, while H2 is common in southern

regions (Fig. 3). Haplotype H4 has the longest geographic distribution in south-north di­

rection stretching from the southwest to the northern regions. The northern population

DK was established most likely by single long-distance dispersal event. A recent muta­

tion at locus CCMP10 resulted in the rarest haplotype (H5) that is restricted to only one

population (Wonbera) in the west (fixed on one type), distinguishing it from other popu­

lations. Haplotype H6 is restricted to the central-northern region, while H3 has only a rare

occurrence in the southern region, and is always in association with H2 and/or HI. The

domination of the population Uraga (UR) by haplotype H3 as contrasting to the neighbor­

ing populations (H2) in the south was caused by a single mutational event in locus

CCMP6.

The three loci exhibited different impacts on haplotypic variation in the different regions

of the country. Locus CCMP6 accounted for the variation in central and southern Ethi­

opia, while CCMP2 was responsible for the variation in southwestern and northern re­

gions. Locus CCMP10 caused the variation in west Ethiopia due to the prevalence o f a

private allele. Eighty percent of the populations are fixed on one haplotype, while the re­

maining populations share two to three haplotypes. Two populations (KL and BR) con­

tained three similar haplotypes at different frequencies while three populations (UR, CM

44

Paper I: Colonization history and phylogeography

and KDP) possessed two different haplotypes each. Two of the planted populations in­

cluded in this study (DKP and SMP) showed identical haplotypes as their respective par­

ent populations (DK and SM) based on the record obtained from the District Office of

Agriculture (unpublished data). The source population of a third plantation, (KDP) was

not confirmed, but it exhibited a combination of haplotypes from two neighboring popu­

lations (HI and H6), suggesting that seeds were obtained from the adjacent populations

or alternatively, they were procured from the national seed center.

45

DK5 2 3 4 SM7 2 3 4 WB5 2 3 4 DR7 2 3 5KB5 2 2 4 CM30 2 2 4 DN7 2 2 4 DD7 2 2 4 KB7 2 2 4 UR5 2 2 4 R u f R u i R oc

(b)

AAGAAGAAGAAGAAGAAGAAGAAGAAGAAG

30 90 1 00 11 0 12 0 130 1

TTTTTTTTATTTATTTA TTTAGTTAATTTTAGTTAATTAAAAAAAAA TATTAATAA TTTTTTTTATTTATTTA TTTAGTIAATTTTAGTTAATTAAAAAAAAA TATTAATAA TTTTTTTTATTTATTTA TTTAGTTAATTTTAGTTAATTAAAAAAAAA TATTAATAA TTTTTTTTATTTATTTA TTTAGTTAATTTTAGTTAATTAAAAAAAAAATATTAATAA TTTTTTTTATTTATTTATTTTTTTTATTTATTTATTTTTTTTATTTATTTATTTTTTTTATTTATTTATTTTTTTTATTTATTTATTTTTTTTATTTATTTA

1 50

TTTAAAGAAGTGGt t t a a a g a a g t g g

TTTAAAGAAGTGGTTTAAAGAAGTGGTTTAAAGAAGTGGTTTAAAGAAGTGGTTTAAAGAAGTGGTTTAAAGAAGTGGTTTAAAGAAGTGGTTTAAAGAAGTGG

GAGCTCTTTTTTTTATTTAATTA TTTAATTAA GAGCTTTTTTTTT ATTTAATTAA GAGCTCTTTTTT ATTATATTATTTTTATTATA

TTAGTTAATTAAAAAAAAA TATTAATAA TTAGTTAATTAAAAAAAAA TATTAATAA TTAGTTAATTAAAAAAAAA TATTAAAAA TTAGTTAATTAAAAAAAAA TATTAAAAA TTAGTTAATTAAAAAAAAA TATTAATAA TTAGTTAATTAAAAAAAAA TATTAAAAA

TAGTT AAAAATGAA TAGTTAAAGAAGTTTAAGGATGNGGTAGTT AAAAATGA ATAGTTAAAGAAGTTTAAGGATGTGTTAGTT AAAAATTATATAGTTAAAATAGTT AAAGAAGTGG

8 0

UR5 1 4 2 CTACCTTTTAGTTTTATATAATATATATAGTATTTTTTTTTCTATGGATTATGGATATAGTATTTATTAACGTATTTCTT UR16 1 4 1 CTACCTTTTAGTTTTATATAATATATATAGTATTTTTTTT CTATGGATTATGGATATAGTATTTATTAACGTATTTCTT DO5 1 4 1 CTACCTTTTAGTTTTATATAATATATATAGTATTTTTTTT c t a t g g a t t a t g g a t a t a g t a t t t a t t a a c g t a t t t c t t

KB7 1 4 0 c t a c c t t t t a g t t t t a t a t a a t a t a t a t a g t a t t t t t t t c t a t g g a t t a t g g a t a t a g t a t t t a t t a a c g t a t t t c t t

KB5 14 0 c t a c c t t t t a g t t t t a t a t a a t a t a t a t a g t a t t t t t t t c t a t g g a t t a t g g a t a t a g t a t t t a t t a a c g t a t t t c t t

20 30 40 50 60 70 80 90

WB4 96 g t a g t a a a t a g g c g a g a a a a t a g a a t t t g t t t c t t c c t c t t a a a a a a a a a a a t a g g a g t a a t t a a t t g t g a c a c g t t c a

WB6 9 6 g t a g t a a a t a g g c g a g a a a a t a g a a t t t g t t t c t t c c t c t t a a a a a a a a a a a t a g g a g t a a t t a a t t g t g a c a c g t t c a

KB 5 9 7 g t a g t a a a t a g g c g a g a a a a t a g a a t t t g t t t c t t c c t c t t a a a a a a a a a a a a t a g g a g t a a t t a a t t g t g a c a c g t t c a

Fig. 1 Sections o f sequences o f three Hagenia chloroplast microsatellite loci (a= CCMP2 aligned with Rubus fruticosus, Rubus idaeus and Rosa canina, b= CCMP6, c= CCMP10). Duplications in locus CCMP2 are underlined. Microsatellite repeats are shown in bold. Gaps indicate deletions o f nucleotides, g = genotype; f = fragment size.

Paper I: Colonization

history and

phylogeography

Paper I: Colonization history and phylogeography

Fig. 2 Statistical parsimony network showing nested clades and relatedness among haplotypes (H1-H6) o f Hagenia

abyssinica at three chloroplast loci. Sizes o f circles are proportional to their respective out-group weights. Thick

bar indicates indel o f 10 bp in a single mutation event; thin bar indicates indel o f 1 bp.

47

Paper I; Colonization history and phylogeography

Discussion

Genetic diversity and differentiation

A very low genetic and haplotype diversity within populations (hs = 0.079, vs = 0.058, respec­

tively) and a very high population differentiation ( G St = 0. 899, N St = 0. 926) proved a marked

genetic separation of the populations. This result supports our first prediction that there is a

strong differentiation among populations, but low variation within populations due to limited

seed dispersal and possibly rare long-distance seed dispersal events. The population differentia­

tion is much higher in the chloroplast genome than in the nuclear genome of Hagenia abyssinica,

as revealed by ISSR ( G st = 0.25; Tileye et al. 2007) and AFLP markers ( G s t = 0.15, Taye et al.

submitted).

Likewise, Rendell and Ennos (2002) found a population differentiation that was 10-fold higher in

the chloroplast genome o f Calluna vulgaris (L.) Hull (Ericaceae), than in the nuclear genome. In

general, maternally inherited genomes experienced considerably more subdivision (mean Gst

value o f -0.64) than biparentally inherited genomes (mean G s t value o f -0.18) of angiosperm

species (reviewed by Petit et al. 2005). The coefficient of population differentiation ( G st ) in Ha­

genia is higher than or comparable to G st values recorded for other species with heterogeneous

mode o f seed dispersal, including wind dispersal, investigated by chloroplast markers (Newton et

al. 1999, Petit et al. 2003).

The high level of genetic variation among populations of Hagenia suggested a restricted migra­

tion of seeds among regions, which is also reflected in the observed geographic structuring of

haplotypes. The demographic history of the species and/or existence of natural barriers (moun­

tains, valleys and long distances) to seed dispersal might account for the strong phylogeographic

pattern. Young and Boyle (2000) reported that for wind-pollinated and dispersed species, the pat­

tern of gene flow and genetic structure is a function o f interfragment distance.

48

Paper I: Colonization history and phylogeography

Fig. 3 Geographic distribution o f Hagenia chloroplast haplotypes in Ethiopia. Dotted enclosure shows li­neage I; dashed enclosure shows lineage II. Grey dashed lines indicate approximate position o f the Great Rift Valley. The inset pie chart shows the relative frequency distribution o f the haplotypes. Two letters de­signate populations as in Table 1; H1-H6 indicates haplotypes as in table 3. The arrows indicate the putative colonization route o f the species. Source map: Assefa G (unpublished).

Though Hagenia is a montane species, its migration is not necessarily along the mountains as

evidenced by haplotype HI that is distributed at both sides of the Great Rift Valley (see Fig 3),

most likely due to long-distance seed dispersal as intermediate populations are missing.

49

Paper I: Colonization history and phylogeography

Phylogeographical andpalynological interpretation

The geographic distribution o f haplotypes (Fig. 3) and their genealogical relationships (Fig. 2)

observed in Hagenia demonstrated a marked phylogeographical structure as a result of highly

restricted gene flow via seeds. Such patterns arise when scattering is reduced because the novel

mutations remain localized within the geographical context of their origins (e.g. Butaud et al.

2005). Both the Gst-N st test and the NCPA detected a very strong association between genea­

logical and geographic distributions. The NCPA inferred that restricted gene flow associated

with contiguous range expansion shaped the genetic structure of Hagenia. This result allows us

to accept the second prediction that populations show geographic structuring primarily induced

by isolation by distance, coupled with local mutation events. Two distinct lineages that were

separated by an indel o f 10 nucleotides in locus CCMP2 are evident from the cladogram (see

Fig. 2). The first lineage constitutes haplotype H4 and its derived haplotypes H5 and H6 that are

distributed in the south-western and northern regions (referred hereafter as lineage I), while the

second lineage embodies HI and its derived haplotypes H2 and H3 in central and southern re­

gions (lineage II). Such a non-random distribution of haplotypes asserts our prediction on the

existence of phylogeographic pattern in Hagenia.

In light of the palynological records discussed at the end of this section, there are two possible

scenarios for the immigration of Hagenia into Ethiopia. The first scenario suggests that the line­

age I of Hagenia colonized Ethiopia first through the southwest mountains (population Bonga,

BG) that is situated to the west o f the Great Rift Valley whereas the second scenario suggests

that lineage II of Hagenia colonized Ethiopia first through the south mountains (population

Hagere Mariam, HM) situated east o f the Great Rift Valley. However, our data supports the first

scenario. The cladogram demonstrated that haplotype H4 is the most probable ancient haplotype

that served as a root for the rest o f the haplotypes because o f its higher out-group weight. Castel-

loe and Templeton (1994) argued that the most ancient haplotype should be located at the center

o f the gene tree and be geographically widespread, whereas the most recent haplotypes should be

at the tips of the gene tree and be localized geographically. This ascertains the postulation that

haplotype H4 is the most ancient haplotype (followed by HI), whereas H2, H3, H5 and H6 are

located at the tips o f the gene tree and are highly localized geographically. This observation sug-

50

Paper I: Colonization history and phylogeography

gests that Hagenia was first introduced most likely to the Mountains of the southwest Ethiopia

(population Bonga, BG) from southern African regions and expanded and diversified in the cen­

tral, southern and northern regions of the country. Our results demonstrated that lineage I most

likely gave rise to lineage II due to a deletion of 10 nucleotides in a single mutational event. This

mutational event was quite recent assuming the recent colonization of Ethiopia by Hagenia. All

the southern haplotypes were most likely derived from a single seed parent with haplotype H4

and expanded to the central regions and diversified into the southern regions. In general, our re­

sults confirm that colonization took place only from the south. The inferred colonization routes

and putative long-distance dispersal event are shown in Fig. 3.

The long gap observed between the northern and southern populations with the haplotype H4 led

to three postulations: 1) the populations that are situated between these two regions diversified to

other haplotypes due to mutation (e.g., population WB diversified to H5 and population DR di­

versified to H6, both based on a single mutation event), 2) some populations containing the same

haplotype might be lost due to anthropogenic activities, 3) natural or human mediated coloniza­

tion events in terms of long-distance seed dispersal or purposeful seed transfer account for this

disjunct haplotype distribution. The postulations, however, are not exclusive. Haplotype HI is

also widely distributed, and such a widespread distribution of individual haplotypes indicates

rapid range expansion (Schaal et al. 1998) and the significant role o f rare events, particularly

long-distance seed dispersal and mutation, in shaping the genetic diversity in Hagenia. Further­

more, the patchy structure of the haplotypes o f Hagenia, in general, is a result of rare long­

distance dispersal o f seeds during colonization, each patch resulting from a founding event

beyond the colonizing front.

Though complete coverage is unavailable from Africa, the palynological data obtained from fos­

sil pollen stratigraphy often sites in Africa (Table 5) suggested that the post-glacial colonization

of Hagenia followed a northward route with the oldest available record from Burundi (ca. 34,000

l4C yrs BP). Major expansion of Hagenia took place around 1 1,500 14C yrs BP in Burundi (Bon-

nefille et al. 1995), whereas its major expansion in Bale Mountains (southern Ethiopia) was after

2500 cal yr BP (Mohammed et al. 2004; Mohammed and Bonnefille 1998). Bonnefille and Mo­

hammed (1994) also reported that Hagenia expanded after 590 yr BP in Arsi Mountains (central

Ethiopia). In general, the signal of Hagenia in the pollen records in Ethiopia was quite high in

51

Paper I: Colonization history and phylogeography

the late Holocene epoch and the palynological evidences in general suggested a northward mi­

gration route also within Ethiopia. The fossil pollen records support our third prediction that

Hagenia immigrated into Ethiopia northward from southern African regions. The examination of

the same pollen diagrams that are described above also indicated a northward colonization of

some other tree species such as Podocarpus falcatus, Juniperus procera and Olea species in Af­

rica. The palynological data also showed that the fossil pollen accumulation of Hagenia abys­

sinica has been alarmingly declining through time in the African countries other than Ethiopia,

suggesting a sequential reduction in the size of the populations.

Table 5 Late Pleistocene to late Holocene ice ages fossil pollen records of Hagenia from ten sites in Africa

Site, Country, ReferencesAltitude Approximate age o f core at first appearance (m.a.s.l.)

Maximum record o f pollen (%)

Rusaka, Burundi’ 2070 34,000 l4C yrs BP 20Mount Kenya4 2350 >33,350 14C yrs BP 40Lake Albert, U ganda1 619 12,000 14C yrs BP <2.5Lake Turkana, Kenya2 375 2,200 14C yrs BP <1Garba Guracha (Bale Mountains, Ethiopia)5 3950 17,000 cal yrs BP 10Tamsaa (Bale Mountains, Ethiopia)2,6 3000 15,470 cal yrs BP: 45Lake Tilo (Southern Rift Valley, E thiopia)7' 8 1545 8000 l4C yrs BP <2.5Dega Sala (Arsi mountain, E thiopia)9 3600 1850 l4C yrs BP ca.7Lake Langeno, Ethiopia10 1583 2370 l4C yrs BP <5Lake Hardibo (Wello, Ethiopia)11 2150 2500 14C yrs BP <2.5

The sites are arranged from south to north, generally showing a decreasing trend in ages o f fossil pollen. Low pollen grain percentages in some sites may suggest that pollen was transported from other forests. Sources: ‘Beuning et al. (1997), ^Mohammed et al. (1996), Bonnefille et al. (1995), 401ago et al. (1999). 5Umer et al. (in press), 6M ohammed and Bonnefille (1998), 7Lamb (2001), 8Lamb et al. (2004), ’Bonnefille and Mohammed (1994), 10 M o­hammed and Bonnefille (1991), "D arbyshire et al. (2003).

It remains uncertain from the pollen data whether there was a forest refugium during the gla­

cial/late glacial period at lower altitudes (2000-2500m) in southern Ethiopia. There is a lack of

information from such sites for the early Holocene.

Conclusions

The joint interpretation of genealogical relationships among the chloroplast haplotypes and the

fossil pollen evidences allowed us to accept the hypothesis predicting immigration o f Hagenia

52

Paper I: Colonization history and phylogeography

into Ethiopia from the south. Based on the cpDNA data, the migration of Hagenia into Ethiopia

occurred only once, but the exact dating was not possible. There was no indication of past frag­

mentation of Hagenia populations from our results, pointing to the effect of random long­

distance seed dispersal. It is most likely that populations were established from few parent seed

trees. Given the mountainous topography of the country that is intermittently dissected by wide

valleys, Hagenia did not have a continuous distribution. The cpDNA assay detected sufficient

variation for a phylogeographic study of Hagenia abyssinica in Ethiopia. A remarkable subdivi­

sion o f cpDNA diversity in the species was found, as indicated by a high level o f genetic differ­

entiation. The chloroplast haplotypes of Hagenia abyssinica demonstrated a pattern of isolation-

by- distance. Unlike most of the wind-dispersed tree species, the chloroplast haplotypes found in

Hagenia showed a clear pattern of congruence between their geographical distribution and ge­

nealogical relationships, allowing us to accept the prediction on geographic structuring. Analysis

of cpDNA types and palynological inventories, including all countries where the species is

known to grow, would fully resolve the genealogical relationships and help to identify the glacial

refugia of Hagenia in Africa. The analysis of pollen records from different sites and altitudes in

Ethiopia where Hagenia is growing would help to fully understand the colonization route of the

species within the country.

Acknowledgements

This work is supported by the German Federal Ministry of Economic Cooperation and Devel­

opment (BMZ) through the German Technical Cooperation (gtz) as a component of a project

“Support to the Forest Genetic Resources Conservation Project” of the Ethiopian Institute of

Biodiversity Conservation (IBC). The German Academic Exchange Service (DAAD) executed

the grant as a PhD project of the first author. The National Meteorological Service Agency of

Ethiopia provided climatic data free of charge. We are indebted to Oleksandra Dolynska and

Thomas Seliger for technical assistance in the laboratory.

53

Paper I: Colonization history and phylogeography

References

Avise JC (2004) Molecular Markers, Natural History and Evolution. 2nd edn, Sinauer Associates Inc, Sunderland, USA

Azene BT, Bimie A, Tegnas Bo (1993) Useful Trees and Shrubs for Ethiopia: Identification, Propagation and Management for Agricultural and Pastoral Communities. Technical Hand­book No. 5, Regional Conservation Unit, Swedish International Development Authority (SI- DA)

Bawa KS, Krugman SL (1990) Reproductive biology and genetics o f tropical trees in relation to conservation and management. In: Rain Forest Regeneration and Management (eds Gomez- Pampa A, Whitmore TC, Hadley M), pp. 119-136. The Parthenon Publishing Group

Berhanu M Abegaz, Ngadjui BT, Merhatibeb Bezabih, Mdee LK (1999) Novel natural products from marketed plants of eastern and southern Africa. Pure Appl Chem 71: 919-926

Beuning KRM, Talbot MR, Kelts K (1997) A revised 30,000-year paleoclimatic and paleohydro- logic history of Lake Albert, East Africa. Palaeogeogr palaeocl 136: 259-279

Birky CW Jr (1995) Uniparental inheritance of mitochondria and chloroplast genes: mechanisms and evolution. Proc Natl Acad Sci USA 92: 11331-11338Bonnefille R, Mohammed MU (1994) Pollen-inferred climatic fluctuations in Ethiopia during the

last 3000 years. Palaeogeogr palaeocl 109: 331-343 Bonnefille R, Riollet G, Buchet G, Icole M, Lafont R, Arnold M, Jolly D (1995) Gla­

cial/interglacial record from intertropical Africa, high resolution pollen and carbon data at Ru- saka, Burundi. Quaternary Sci Rev 14: 917-936

Butaud J-F, Rives F, Verhaegen D, Bouver J-M (2005) Phylogeography o f Eastern Polynesian sandalwood (Santalum insulare), an endangered tree species from the pacific: a study based on chloroplast microsatellites. J Biogeogr 32: 1763-1774

Cain ML, Milligan BG, Strand AE (2000) Long-distance seed dispersal in Plant Populations. Am JB ot 87: 1217-1227

Castelloe J, Templeton AR (1994) Root probabilities for intraspecific gene trees under neutral coalescent theory. Mol Phylogenet Evol 3: 102-113

Clement M, Posada D, Grandall KA (2000) TCS: A computer program to estimate gene geneal­ogies. Mol Ecol 9: 1657-1659

Cavers S, Navarro C, Lowe AJ (2003) Chloroplast DNA phylogeography reveals colonization history o f a Neotropical tree, Cedrela odorata L., in Mesoamerica. Mol Ecol 12: 1451-1460

Cruzan MB, Templeton AR (2000) Paleoecology and coalescence: phylogeographic analysis of hypotheses from the fossil record. Trends Ecol Evol 15: 491-496

Darbyshire I, Lamb H, Mohammed Umer (2003) Forest clearance and regrowth in northernEthiopia during the last 3000 years. Holocene 13: 537-546

Dawit A, Ahadu A (1993) Medicinal Plants and Enigmatic Health Practices of Northern Ethi­opia. Addis Ababa

Excoffier L, Laval G, Schneider S (2005) Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol Bioinform 1: 47-50

Finkeldey R, Hattemer HH (2007) Tropical Forest Genetics. Springer-Verlag, Berlin Hall TA (1999) BIOEDIT: a user-friendly biological sequence alignment editor and analysis

program for windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98

54

Paper I: Colonization history and phylogeography

Harris SA, Ingram R (1991) Chloroplast DNA and biosystematics: The effects o f intraspecific diversity and plastid transmission. Taxon 40: 393-412

Hedeberg, O (1989) Rosaceae. In: Inga Hedeberg and Sue Edwards, eds. Flora o f Ethiopia, Vol.3, Pittosporaceae to Arralaceae. Addis Abeba and Asmara, Ethiopia; Uppsala, Sweden

Heuertz M, Fineschi S, Anzidei MA et al. (2004) Chloroplast DNA variation and postglacial recolonization of common ash (Fraxinus excelsior L.) in Europe. Mol Ecol 13: 3437-3452

Jansen PCM (1981) Spices, condiments and medicinal plants in Ethiopia, their taxonomy and agricultural significance. Wageningen

King RA, Ferris C (1998) Chloroplast DNA phylogeography of Alnus glutinosa (L.) Gaertn. Mol E co l7,1151-1163

Kumilign A (2005) Estimation of sex-related genetic diversity of Hagenia abyssinica (Bruce) J.F. Gmel. M.Sc. thesis, Addis Ababa University

Lamb HF (2001) Multi-proxy records of Holocene climate and vegetation change from Ethiopian Crater lakes. Proy Irish Acad B 101: 35-46

Lamb AL, Leng MJ, Mohammed UM, Lamb HF (2004) Holocene climate and vegetation change in the main Ethiopian Rift Valley, inferred from the composition (C/N and Si3C) of lacustrine organic matter. Quaternary Sci Rev 23: 881-891

Le Corre V, Machon N, Petit RJ, Kremer A (1997) Colonization with long-distance seed disper­sal and genetic structure of maternally inherited genes in forest trees: a simulation study. Genet Res 69: 117-125

Legesse N (1995) Indigenous trees of Ethiopia: Biology, uses and propagation techniques. SLU, Reprocentralen, Umea

Meister J, Hubaishan MA, Killian N, Oberprieler C (2005) Chloroplast DNA variation in the shrub Justicia areysiana (Acanthaceae) endemic to the monsoon affected coastal mountains of the southern Arabian Peninsula. Bot J Linn Soc 148: 437-444

Mohammed MU, Bonnefille R (1991). The recent history of vegetation and climate around lake Langano (Ethiopia). Paleoecol Afr22: 275-286

Mohammed MU, Bonnefille R (1998) A Late Glacial to Late Holocene pollen record from a high land peat at Tamasaa, Bale mountains, South Ethiopia. Global Planet change 16-17: 121-129

Mohammed MU, Bonnefille R, Johnson T (1996) Pollen and isotopic records of Late Holocene sedim ents from Lake Turkana, N. Kenya. Palaeogeogr palaeocl 1 19: 371-383

Mohammed U, Dagnachew Legesse, Gasse F, Bonnefille R, Lamb HF, Leng MJ (2004) Late quaternary climate changes in the Horn of Africa. In: Past climate variability through Europe and Africa (eds Battarbee RW, Gasse F, Stickly CE), pp. 159-177. Kluwer Academic Publish­ers, Dordrecht, the Netherlands

Newton AC, Allnutt TR, Gillies ACM, Lowe AJ and Ennos RA (1999) Molecular phylogeogra­phy, intraspecific variation and the conservation of tree species. Trends Ecol Evol 14: 140-145

Ouborg NJ, Piquot Y, Van Groenendael JM (1999) Population genetics, molecular markers and the study of dispersal in plants. J Ecol 87: 551-568

Olago DO, Street-Perrott FA, Perrott RA, Ivanovich M, Harkness DD (1999) Late quaternary glacial-interglacial cycle of climatic and environmental change on Mount Kenya. J Afr Earth Sci 29:593-618

Parducci L,- Szmidt AE,- Madaghiele A, Anzidei M, Vendramin GG (2001) Genetic variation at chloroplast microsatellites (cpSSRs) in Abies nebrodensis (Lojac.) Mattei and three neighbor­ing Abies species. Theor Appl Genet 102: 733-740

Petit RJ, Aguinagalde I, de Beaulieu J-L, et al. (2003) Glacial refugia: hotspots but not melting pots o f genetic diversity. Science 300: 1563-1565

55

Paper I: Colonization history and phylogeography

Petit RJ, Brewer S, Bordacs S, et al. (2002) Identification of refugia and post-glacial colonization routes of European white oaks based on chloroplast DNA and fossil pollen evidence. Forest Ecol Manag 156: 49-74

Petit RJ, Duminil J, Fineschi S, Hampe A, Salvini D, Vendramin GG (2005) Comparative or­ganization o f chloroplast, mitochondrial and nuclear diversity in plant populations. Mol Ecol 14: 689-701

Pons O, Petit RJ (1995) Estimation, variance and optimal sampling o f gene diversity. 1. Haploid locus. Theor Appl Genet 90: 462-470

Pons O, Petit RJ (1996) Measuring and testing genetic differentiation with ordered versus unor­dered alleles. Genetics 144: 1237-1245

Posada D, Crandall KA, Templeton AR (2000) GeoDis: a program for the cladistic nested analy­sis o f the geographical distribution o f genetic haplotypes. Mol Ecol 9: 487^488

Rendell S, Ennos RA (2002) Chloroplast DNA diversity in Calluna vulgaris (heather) popula­tions in Europe. Mol Ecol 11: 69-78

Ryder AO (1986) Species conservation and systematics, the dilemma of subspecies. Trends Ecol Evol 1: 9-10

Schaal BA, Hayworth DA, Olsen KM, Rauscher JT, Smith WA (1998) Phylogeographic studies in plants: problems and prospects. Mol Ecol 7: 465-474

Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors.Proc Natl Acad Sci USA 74: 5463-5467

Templeton AR (2004) Statistical phylogeography: methods of evaluating and minimizing infe­rence errors. Mol Ecol 13: 789-809

Templeton AR, Boerwinkle E, Sing CF (1987) A cladistic analysis o f phenotypic associations with haplotypes inferred from restriction endonuclease mapping. I. Basic theory and an analy­sis of Alcohol Dehydrogenase activity in Drosophila. Genetics 117: 343-351

Tileye F, Nybom H, Bartish IV, Welander M (2007) Analysis of genetic diversity in the endan­gered tropical tree species Hagenia abyssinica using ISSR markers. Genet Resour Crop Evol 54: 947-958

Thompson JD, Higgins DG, Gibson TG (1994) CLUSTAL W: improving the sensitivity of pro­gressive multiple sequence alignment through sequence weighting, position specific gap penal­ties and weight matrix choice. Nucleic Acids Res 22: 4673-4680

Umer M, Lamb HF, Bonnefille R, Lezine A-M, Tiercelin J-J, Gibert E, Gazet J-P, Watrin J (2007). Late Pleistocene and Holocene vegetation history of the Bale Mountains, Ethiopia. Qu­aternary Sci Rev 26: 2229-2246

Weising K, Gardner RC (1999) A set of conserved PCR primers for the analysis of simple se­quence repeat polymorphisms in chloroplast genomes of dicotyledonous angiosperms. Genome 42: 9-19

Wolfson R, Higgins KG, Sears BB (1991) Evidence for Replication Slippage in the Evolution of Oenotheru Chloroplast DNA. Mol Biol Evol 8: 709-721

Young, Andrew G and Boyle, Timothy J 2000. Forest Fragmentation. In: Young, A, Boshier, D and Boyle, T (ed.) 2000. Forest conservation genetics: principles and practice. CABI Publish­ing

56

II. Spatial distribution of genetic diversity in Hagenia abyssinica (Bruce) J.F. Gmei from Ethiopia, assessed by AFLP molecular markers

Taye Bekele Ayele*, Oliver Gailing, and Reiner Finkeldey

Forest Genetics and Forest Tree Breeding, Georg-August University of Goettingen,

Buesgenweg 2, 37077 Goettingen, Germany

Abstract

The intraspecific genetic variation of 596 individuals from 25 populations of Hagenia abyssinica

sampled from the montane forests of Ethiopia was investigated at AFLP markers. Hagenia is a

wind-pollinated and wind-dispersed dioecious tree species belonging to a monotypic genus in the

Rosaceae family. We obtained 106 unequivocally scorable AFLP markers out of which 91.5%

were polymorphic. Despite the relatively recent immigration of Hagenia abyssinica into Ethio­

pia. populations showed moderate to high gene diversities (He = 0.139-0.362), and moderate but

significant genetic differentiation (Fst = 0.077), reflecting high levels of post-colonization gene

flow among populations. No trend of decreasing genetic diversity was detected during coloniza­

tion, confirming effective gene flow among populations. The observed variation at putatively

neutral AFLPs does not reflect clinal variation patterns. As expected, the coefficient of popula­

tion differentiation was found to be much lower in the nuclear genome of Hagenia abyssinica

than in the chloroplast genome. Despite the dispersal o f seed and pollen o f Hagenia by wind, a

significant non-random fine-scale spatial genetic structure (SGS) is observed up to 80 m in some

populations. Due to significant genetic differentiation observed among populations, as many

populations as possible should be considered for conservation and tree improvement programs.

Key words: AFLP, Hagenia, gene diversity, kinship coefficient, population differentia­tion, spatial genetic structure

*Correspondence: Taye B. Ayele; Fax: +49 551 398367; e-mail: tavele@gwdg.de Permanent address: Institute of Biodiversity Conservation, Fax: +251-11-6613722; P.O.Box: 30726, Addis Abeba, Ethiopia; e-mail: tavele@ibc-et.org

57

Paper II: Genetic diversity at AFLPs

Introduction

The level of genetic diversity in a population is affected by various genetic, life history and eco­

logical characteristics that collectively define the population’s genetic structure (Yeh 2000). Tree

species are generally characterized by high levels o f genetic diversity within populations and rel­

atively low levels o f differentiation among populations (Loveless & Hamrick 1984; Finkeldey &

Hattemer 2007; White et al. 2007). The geographic variation in genetic diversity has important

implications for the ecological and evolutionary potential o f populations (for example, Hoffmann

& Blows 1994).

The spatial distribution o f genetic diversity in plant populations is mainly determined by life his­

tory traits that influence mating patterns and gene dispersal (Hamrick 1989; Hamrick & Loveless

1989; Ouborg et al. 1999) and by the historical patterns o f relationship (e.g., Schaal et al. 1998).

Genetic diversity is rarely distributed homogeneously within populations and genetic similarity

is higher among neighbouring than among distant individuals (Vekemans & Hardy 2004; Jump

& Penuelas 2007). Such fine-scale genetic structure is affected by the mating system (higher in

selfing species), life form (higher in herbs than trees), population density (higher under low den­

sity) and population size o f the target species (Vekemans & Hardy 2004, Cavers et al. 2005,

Jump & Penuelas 2007, Hardy et al. 2006).

Some studies on colonization history detected a decreasing genetic diversity with increasing dis­

tance from refugial sources based on contemporary patterns of genetic diversity (Rivera-Ocasio

et al. 2002, Coart et al. 2005, Mulugeta, et al. 2007). Such patterns reflect the impact of genetic

drift associated with sequential founder effects (Wright 1969, Nei 1987, Rivera-Ocasio et al.

2002). Contrarily, others reported increasing pattern of gene diversity away from source popula­

tions due to gene flow and population admixture effects (e.g., Comps et al. 2001, Petit et al.

2003).

In this study, the AFLP technique was employed to investigate patterns o f genetic diversity,

population differentiation and fine-scale spatial genetic structure o f Hagenia abyssinica from

Ethiopia. AFLP is preferred to other techniques because of its short start-up time and cost-

effective generation of data from a large number o f loci distributed randomly across the whole

58

Paper II: Genetic diversity at AFLPs

genome and the ease to generate anonymous multilocus DNA profiles in most species regardless

of origin or complexity without prior sequence knowledge of the target species (Vos et al. 1995;

Bensch & Akesson 2005, Mueller & Wolfenbarger 1999). Although it has not been possible to

separate heterozygotes (1/0) from homozygotes (1/1), the presence and absence data can be con­

verted to expected heterozygosity by assuming Hardy-Weinberg equilibrium, to generate esti­

mates directly comparable to codominant markers (Bensch & Akesson 2005). Also, genetic dif­

ferentiation ( F s t ) values generated from dominant markers (AFLPs and RAPDs) were in general

similar to estimates obtained from microsatellites and allozymes (reviewed by Nybom 2004).

Hagenia abyssinica is a wind-pollinated and wind-dispersed broad-leaved dioecious tree species

belonging to a monotypic genus in the Rosaceae family (Hedeberg 1989; Legesse 1995). The

bright colourful and appealing appearance of the flowers of Hagenia is not typical for wind-

pollinated species, which are usually dull in colour (Legesse 1995), suggesting that other polli­

nating vectors such as insects (particularly bees) or birds might be involved. It was also reported

that honeybees collect pollen from the male flowers and nectar from the female flowers (Fichtl &

Admasu 1994). The species is found in 12 countries in Africa stretching from Ethiopia in the

North to Zimbabwe in the South and inland to Congo (Hedeberg 1989;

http://www.worldagroforestry.org/Sites/TreeDBS/aft.asp). Hagenia is a multipurpose tree spe­

cies bestowed with considerable economic and ecological values; but due to over-exploitation,

the species is gravely endangered in its natural range and especially in Ethiopia (Legesse 1995)

with only about 7000 individuals left.

According to fossil pollen records (Beuning et al. 1997; Bonnefille et al. 1995; Olago et al.

1999; Umer et al. 2007), Hagenia immigrated into Ethiopia in the late Pleistocene (since 16,700

years before present) from southern African countries (Taye et al. submitted (a). A recent phy-

logeographic investigation using maternally inherited chloroplast markers supported this coloni­

zation history and suggested a single entry point into Ethiopia. Due to the recent colonization of

Ethiopia, it was possible to reconstruct the colonization route of the species and to identify rare

mutation and long distance seed disperal events. For example, six specific haplotypes were iden­

tified that were grouped in two lineages, lineage II originated most likely from a single muta­

tional event from lineage I (Taye et al. submitted (a)).

59

The genetic diversity of few populations of H. abyssinica was investigated by using anonymous

RAPD (Kumilign 2005) and ISSR (Tileye 2007) markers. Both studies covered a small spatial

scale contrasting to the widespread distribution of the species in Ethiopia and were also limited

to a comparatively small number of individuals per population. An investigation on the genetic

diversity at the nuclear level covering the natural distribution range would enhance further un­

derstanding on the phylogeography and the forces shaping genetic variation patterns in Hagenia.

We expect that large-scale and fine-scale genetic variation patterns are affected by the aforemen­

tioned historical processes and by the species' life history traits.

Three hypotheses were tested: 1) there is high variation within-populations due to effective gene

flow from different pollen and seed sources and very low differentiation among-populations due

to long-distance pollen and seed dispersal. 2) The species does not lose genetic diversity during

colonization due to effective gene flow that counteracts effects of genetic drift. Likewise, we ex­

pect that the populations representing the two chloroplast lineages show similar levels of genetic

diversity, even though the derived one originated by a single mutational event (from a single

seed). 3) Given the wind-dispersed and wind-pollinated nature of Hagenia abyssinica, there is no

fine-scale spatial genetic structure.

Materials and methods

Sampling and DNA isolation

Twenty two natural and three planted populations were surveyed from all regions where Hagenia

is known to grow in Ethiopia. The natural populations are represented in 12 closed forests, 8

woodlands and 2 farmlands. The geographic distribution o f the sampled populations is illustrated

in Fig. 1 and the characteristics of the populations are presented in Table 1. The sizes o f the sam­

pled trees range from 3m to 35m in height and from 2.5cm to 245cm in DBH. The distances be­

tween trees within the same population range from 0.1m to 730m. The natural populations have

densities ranging from 0.7 to 75.7 individuals/ha (Table 5). Young leaves were collected and par­

tially desiccated in paper bags before drying with silica gel and stored at room temperature until

DNA isolation. The sampling o f individuals was nearly exhaustive in most cases due to the small

Paper II: Genetic diversity at AFLPs

60

Paper II: Genetic diversity at AFLPs

number of trees available in the forests, keeping a minimum distance when large numbers of

trees were available. Trees were sampled from one spot in larger populations. The locations of

each tree were mapped. Sexes of trees were identified only for 12 populations that had flowers at

the time of the survey. Genomic DNA was isolated following the DNeasy 96 kit protocol of

Qiagen® (Hilden, Germany). Different leaf sizes were tested for DNA extraction. Finally, a size

of lctrr (ca. 20 mg) gave the best results and was used for DNA isolation.

DNA restriction, PCR amplification and genotyping

The laboratory protocol followed Vos et al. (1995) with some modifications. Genomic DNA was

digested with two different restriction enzymes, a rare-cutter CEcoRI; 5’-G |A ATTC-3’) and a

frequent-cutter (MseI; 5‘-Tj.TAA-3’), and short DNA fragments (adapters) were ligated to cohe­

sive ends o f the restriction fragments. Four pi genomic DNA (about 10 ng) was added to 6 f.il

restriction-ligation reaction containing 1 pi T4-Ligase buffer (lOx), 1 pi NaCl (0.5M), 0.5 pi

BSA (1 mg/ml), 3 pi M± Adapter (5 pmol/pl), 0.6 E± Adapter (5 pmol/pl) and to 2 pi restriction-

ligation mix containing 0.2 pi T4-Ligase buffer (lOx), 0.2 pi NaCl (0.5M), 0.1 pi BSA

(1 mg/ml), 0.08 pi M sel (lOU/pl), 0.6 pi EcoRI (lOU/pl) & 0.82 pi T4-Ligase (4U/pl). The resul­

tant solution was incubated at room temperature over-night. A pre-amplification PCR was run in

a Peltier Thermal Cycler PTC-200 (MJ Research®), with a total volume of 15 pi containing 7.8

pi HPLC H20 (high performance liquid chromatography water), 1.7 pi PCR buffer (lOx), 1 pi

dNTPs (2.5mM), 0.25 pi of the pre-selective primer M 03 (5 pmol/pl), 0,20 pi of EOl (5

pmol/pl), 0.06 pi Taq polymerase (Qiagen®) (5U/pl) and 4 pi of the restriction-ligation reaction

(diluted ~1:4). The pre-amplification PCR profile was 15 min. at 72 °C, followed by 20 cycles of

10 sec. denaturation at 94 °C, 30 sec. annealing at 56 °C and 2 min. extension at 72 °C, with a

final extension step o f 30 min. at 60 °C. A selective amplification was run with a total volume of

15 pi containing 8.11 pi HPLC H20 , 1.6 pi PCR buffer (lOx), 0.4 pi dNTPs (2.5mM), 0.6 pi M-

Primer (5 pmol/pl ), 0.25 pi E-Primer (5 pmol/pl ), 1.0 pi MgCl2 (25mM), 0.06 pi Taq poly­

merase (Qiagen®) (5U/pl), and 3 pi pre-amplification product (diluted 1:10). The selective PCR

profile was 15 min. initial denaturation at 94 °C, followed by 9 cycles of 30 sec. denaturation at

94 °C, 30 sec. annealing at 65 °C (but reduced by 1 °C per cycle) and 2 min. extension at 72 °C,

followed 24 cycles o f 30 sec. denaturation at 94 °C, 30 sec. annealing at 56 °C and 2 min. exten­

sion at 72 °C, with a final extension of 10 min at 72 °C. Aliquots of the selective amplification

61

Paper II: Genetic diversity at AFLPs

products were diluted (1:5) before electrophoretic separation. Two pi diluted selective PCR

product was added to 12 pi HiDi formamide dye containing -0.02 pi internal size standard (GS

ROX 500, Applied Biosystems®), denaturated for 2 minutes at 90°C, quickly cooled on ice, and

separated on a capillary sequencer ABI 3100 Genetic Analyser (Applied Biosystems®).

Eighteen primer combinations (4 E & 6 M primers) were tested in different sets (nomenclature

according to Keygene N.V.®). The primer combination E41-M67 (5’-FAM-GAC TGC GTA

CCA ATT CAG G-3’and 5-GAT GAG TCC TGA GTA AGC A -3’, respectively) showed a

well-resolved banding pattern and a high degree o f polymorphism. A total o f 596 individuals

(23-24 per population) were genotyped with this combination. Reproducibility tests were con­

ducted on 15 samples randomly selected from each run. Only 100% reproducible loci were

Fig. 1. Distribution of Hagenia populations sampled from Ethiopia, represented by solid circles. Codes o f popula­tions follow Table 1. Broken lines with arrows indicate the putative colonization route o f Hagenia starting from the most likely source population BG as deduced from cpDNA analysis (Taye et al. submitted (a)). Source map: Assefa G (unpublished)

Paper II: Genetic diversity at AFLPs

considered in the final analysis, resulting in 106 putative loci. Furthermore, three standard lanes,

two containing the same individuals and one holding a negative control were run on each plate to

compare the data from different runs and to check for the mobility of fragments.

Table 1 Description of Hagenia populations sampled from the mountains of Ethiopia

Popula tions Code L atitude L ongitude

altitude

(m asl) A R F

M in

T M ax T H n N

D ensity

(ind/ha)

*Sex

index

D ebark-M ariam DK 1 3 ° i r 37 °5 7 ' 3013 1270 8 .8 19.7 4 24 26 16 1

D ebark-P lan ta tion DKP 13°12' 38°01 ' 3005 1270 8 .8 19.7 4 24 - na

K im ir-D ingay

plantation

KDP 11°48' 3 8 °1 4 ’ - 1350 9.2 21.9 1 , 6 24 - na

W oldiya S e ’at

M ichael

W D 11°55" 3 9 °2 4 ’ 3112 908 na na 6 24 120 na

K osso-ber KB 10°59' 36°54 ' 2702 2381 12.9 27.4 1 24 60 52 na

D enkoro DR 10°52’ 38°47 ' 3061 896 10.9 2 1 .8 6 24 60 12.5 0.7

W onbera W B 10°34- 3 5 °4 1 ' 2428 1622 na na 5 24 60 75.7 na

W of-w asha w w 09 °4 5 ' 3 9 0 4 4 - 3159 941 6.1 19.9 1 24 45 5.4 na

C hilim o CM 0 9 °0 5 ' 38°10 ' 2805 1114 11.5 25.8 1 ,4 24 65 17.8 na

D indin DN 0 8 °3 6 ’ 40° 14 ’ 2410 989 12.7 28,0 1 24 55 13.9 na

Z equala A bo ZQ 08 °3 2 ' 38°50 ' 2856 1215 na na 1 23 60 0.7 0.3

B oter-becho BB 08 °2 4 ' 3 7°15 ' 2772 1666 5.7 23.6 1 24 60 27.8 1.2

C hilalo CL 0 7 °5 6 ' 3 9 °1 1 ’ 2815 796 9.8 23,0 1 24 70 7.1 1.8

Sigm o p lan tation SM P 0 7 °5 5 ' 36°10 ' 2300 1837 11.4 2 1 .6 4 24 na

Sigm o SM 0 7 °4 6 ' 3 6 °0 5 ’ 2651 1837 11.4 2 1 .6 4 23 60 23.8 na

M unesa M S 07 °2 5 ' 38°53" 2459 1028 10.1 24.3 1 24 80 10 na

B onga BG 07 °1 7 ' 3 6°22 ' 2238 2217 11.9 26.6 4 24 80 5 0.9

K ofele KL 07 o l l ' 3 8°52 ' 2757 1305 7.7 20.1 1,2,3 24 110 12.5 1.8

D insho DO 07 °0 5 ' 3 9 0 4 7 - 3117 1213 3.4 2 0 .8 2 24 260 16.7 3

D oddola-Serofta DS 0 6 °5 2 ’ 39°02 ' 2700 1074 6.7 24.3 2 23 75 10 2.9

D oddola-D achosa DD 06 °5 2 ' 3 9 0 , 4 - 3039 1074 6.7 24.3 2 24 5000 30.9 na

R ira RR 06 °4 5 ' 3 9 °4 3 ’ 2725 736 11a na 2 23 170 10.5 na

Bore BR 0 6 °1 7 ’ 38°39 ' 2631 1526 8.3 18.8 1,2,3 24 100 9.1 1.1

U raga UR 0 6 °0 8 ' 38°33 ' 2508 1228 8.3 18.8 2,3 24 70 13.9 0.7

H agereM ariam

Total

HM 0 5 ° 5 r 38°17 ' 2443 1228 12.3 23,0 2 24

110

9

55

6741

4.8 0.9

M asl= meters above sea level; ARF = Mean Annual Rainfall; ml = millilitres; Min T = Mean minimum tempera­ture; Max T = Mean maximum temperature; H = chloroplast haplotype (Taye et al. submitted (a)); n= no. o f sam­ples analysed ; N= population size; *sex index is determined from the relative numbers o f male to female individu­als for 26-50 individuals from each population; na = not available. Source o f climatic data: National Meteorological Agency Service (Ethiopia)

63

Paper II: Genetic diversity at AFLPs

Data analysis

Data were aligned with the internal size standard using GENESCAN 3.7 and fragments were

scored with GENOTYPER 3.7 (Applied Biosystems®). Fragments with sizes ranging from 50-

500 nucleotides (bp) were scored as present (1) or absent (0) and transformed to a 1/0 matrix.

Each fragment was controlled and edited manually.

Overall and gender-segregated genetic diversity (estimated as total diversity (Ht), within-

population diversity (He) and among-population diversity (//b)), percentage of polymorphic loci

(PPL) at the 5% level, and coefficient of differentiation among-populations (.F s t ) were computed

using AFLP-SURV (Vekemans et al. 2002, available at http://www.ulb.ac.be/sciences/lagevA

following a Bayesian method with non-uniform prior distribution of allele frequencies (Zhivo-

tovsky 1999). The null hypothesis for the Fst test (that there is no genetic differentiation among

the populations) is rejected at p<0.001 if the observed FSt is higher than the value o f FSt lying at

the 1% rightmost part of the distribution (Table 3). This observation leads us to conclude that the

actual populations are genetically more differentiated than random assemblages of individuals.

Gene flow (Nm) was estimated using the formula: Nm = (1-Fst)/4Fst (Slatkin & Barton 1989).

Loci that were found to be monomorphic in all populations were excluded from the final compu­

tation in order to obtain Nei's unbiased gene diversity that is comparable to expected heterozy­

gosity (e.g., Nybom 2004). As Hagenia is a diocious and hence completely out-crossing species,

Hardy Weinberg equilibrium was assumed in all computations. Partition of genetic diversity and

the significance of the differences within and among-populations and different groups were esti­

mated by the analysis of molecular variance (AMOVA) using ARLEQUIN Version 3.0 based on

AFLP phenotypes (Excoffier et al. 2005; http://cmpg.unibe.ch/software/arlequin3). The different

groups o f the sampled populations that are used to examine the partitioning o f genetic diversity

are provided in Supplementary Table 1. The fine-scale spatial autocorrelation analysis for 21

natural populations was performed with SPAGeDi 1.2 (Hardy & Vekemans, 2002) using pair­

wise kinship coefficients (Fy) between individuals (Hardy 2003). The inbreeding coefficient is

assumed to be 0 (as for diocious species) following Hardy et al. (2006) and Tero et al. (2005).

The significance of the spatial genetic structure (SGS) was tested by upper and lower bounds of

the 95% confidence interval o f Fy defined after 10 000 random permutations o f individuals

among geographic locations. Eight distance classes were determined for all populations with one

64

Paper II: Genetic diversity at AFLPs

exception (DK) after series of tests in order to obtain a minimum of 30 pairs of individuals that

lie within a given distance interval. The distance classes were set to 4 for population DK. The

program NTSYS-pc 2.0 (Rohlf 1998) was used to draw a phylogenetic tree using the UPGMA

(Unweighted Pair Group Method with Arithmetic mean) clustering method and to examine the

correlation between geographic and genetic distances (Mantel test).

R esu lts

Within population genetic diversity

The AFLP analysis o f 596 samples from 25 populations of H. abyssinica resulted in a total of

106 unambiguously scorable putative markers in the range from 52 to 496 bps of which 97

(91.5%) were polymorphic. The percentage of polymorphic loci (PPL) within-populations ranges

from 29.9% at Dodola Serofta (farmland/homestead population with a size of N = 75) and Uraga

(located in a very small forest, N = 70) to 90.7% at Dinsho (located in a well-protected Park For­

est, N = 260). Moderate to high gene diversities were observed at AFLP loci ranging from 0.139

at Dodola-Serofta to 0.362 at Dinsho (Table 2) with a mean genetic diversity of He = 0.195. The

largest remaining population DD (N = 5000) showed only a moderate genetic diversity (Hc =

0.173, PPL = 36.1%). On the other hand, population DK with only 26 remaining individuals

showed comparatively high levels of genetic diversity (He = 0.217, PPL = 45.4%). Even though

there are marked differences in genetic diversity for some populations, mean genetic diversities

for the two sexes are nearly the same ( //e = 0.207 ± 0.013 for male, / / e = 0.201 ± 0.019 for fe­

male). The two chloroplast lineages (see introduction) show only minor non-significant differ­

ences in mean and in total genetic diversity (Lineage 1: / / e = 0.193 / 0.206, Lineage II: mean He =

0.197/0.214; Table 2).

Based on chloroplast DNA analyses, the putative entry point of Hagenia into Ethiopia was the

southwest mountains of Ethiopia (Taye et al. submitted (a)). The colonization routes o f the spe­

cies were reconstructed from southwest to the north, to the east and to the south (Fig. 1). There

was no significant association between migration distance and genetic diversity (//e, PPL) of

65

Paper II: Genetic diversity at AFLPs

populations (Spearman's nonparametric correlation r = -0.205, p= 0.186) and thus no indication

of loss of genetic diversity during colonization.

Partitioning o f genetic diversity among populations

The measures of gene diversity in subdivided populations (Nei 1987) show high mean within-

population variation (Hc = 0.195) and moderate population differentiation (Fsj = 0.077, p<

0.001). The differentiation between populations within the two chloroplast lineages of different

age was similar (Fst = 0.063 p< 0.001, F st =0.083, p < 0.001) (Table 3). The estimate o f gene

flow computed for all populations based on F s ia s the number o f migrants per generation was 3.

Analyses of molecular variance (AMOVA) based on AFLP phenotypes was performed for all

populations and for different groups (ecosystems, geographic regions, types of forest stands, tree

seed zones, chloroplast lineages and sexes, Table 4). The detailed description of the grouping is

provided in Supplementary Table 1. The AMOVA performed for all populations revealed that

10.4% of the total variation was attributed to the differences among populations. Very low pro­

portions of the total variation were distributed among groups representing different ecosystems,

geographic regions, forest stands, tree seed zones and the two sexes (Table 4). Only differentia­

tion among chloroplast lineages was significant (PV = 0.78%, p < 0.05). Within each category,

the level o f genetic differentiation among-populations is similar ranging from 7.5% to 10.6%

(Table 4). No private fragment or fragment fixed in one population was detected.

66

Paper II: Genetic diversity at AFLPs

Table 2 Summary of wilhin-populations genetic diversity of Hagenia abyssinica for 25 popula­tions. The populations are sorted north to south.

Populations Forest typenAll

PPLAll

HeAll

DK woodland 24 45.4 0.217DKP plantation 24 47.4 0.226KDP plantation 24 39.2 0.183WD woodland 24 43.3 0.194KB Closed forest 24 45.4 0.206DR Closed forest 24 39.2 0.189WB Closed forest 24 43.3 0.211WW woodland 24 41.2 0.189CM Closed forest 24 37.1 0.192DN Closed forest 24 48.5 0.212ZQ Closed forest 23 45.4 0.205BB Closed forest 24 44.3 0.213CL woodland 24 37.1 0.177SMP plantation 24 33.0 0.146SM Closed forest 23 38.1 0.170MS Closed forest 24 49.5 0.200BG Closed forest 24 46.4 0.198KL Wooded grassland 24 42.3 0.195DO Closed forest 24 90.7 0.362DS Farmland 23 29.9 0.139DD Closed forest 24 36.1 0.173RR woodland 23 36.1 0.169BR Wooded grassland 24 38.1 0.187UR Closed forest 24 29.9 0.160HM Farmland 24 35.1 0.168Total/mean 596 100* 0.195

n = sam ple size; PPL = p ercen t o f p o lym orph ic loci; H c= N ei's gene d iversity ; fo r popu la tions code, see T able 1. *The to tal P PL is 100 because the m onom orph ic loci w ere excluded.

67

Paper II: Genetic diversity at AFLPs

Table 3 Summary of the mean gene diversity and population differentiation in subdivided popu­lations o f Hagenia abyssinica for all populations and for the two chlorotype lineages

H, Hw Hb Fst

All LI LII All LI LII All LI LII All LI LII

Mean

Upper 99%

P

0.212

limit

0.206 0.214 0.195 0.193 0.197 0.016 0.013 0.018 0.077

0.013

0.000

0.063

0.013

0.000

0.083

0.018

0.000

H, = total diversity; Hw = within-population diversity; Hb = among-population diversity . F St = population differen­tiation; lineage I (LI): DK, DKP, KDP, WD, DR, WB, SM. SMP & BG populations; lineage II (LII): BB, BR, CL, CM, DD, DN, DO, DS, HM, KB, KL, MS, RR, UR, WW & ZQ populations; for population codes, see Table 1. Up­per 99% limit = value o f FSt lying at the 1% rightmost part o f the distribution under the null hypothesis, p = the probability o f rejecting the null hypothesis

Relationships among populations

The UPGMA dendrogram (Fig. 2) was calculated from Nei’s genetic distances (Nei 1978). The

pair-wise Nei’s genetic distance matrix (Supplementary Table 2) among 25 populations exhibits

genetic differences of less than 7% for each pairs of population. In general, the UPGMA dendro­

gram does not reflect the geographic origin of the populations. While populations BR, DD, KL &

HM from the southern region are assembled in the same cluster together with one population

from the northern region, populations DS, MS, RR, UR and DO from the same region are dis­

tributed in different parts of the UPGMA tree. Dinsho population is an outlier being the most

dissimilar population with the highest gene diversity (0.362). The planted populations DKP and

SMP were not clustered with their putative parent populations DK and SM, respectively (Fig. 2).

A test of association between geographic and genetic distances (Mantel test) showed a very low

and non-significant correlation (r = 0.14607, p = 0.9024). For example, the highest genetic dis­

tance was observed between population RR and DO (0.0669) that are geographically close (37.5

km air distance) but separated by a big mountain embracing the second highest peak in the coun­

try. On the other hand, the three pairs o f populations with the lowest genetic distances (from 0 to

0.0005) between them (WD & WW, WD & BB and KL & BR) are widely separated (240 km,

452 km and 103 km, respectively), with some small mountains between them.

68

Paper II: Genetic diversity at AFLPs

Table 4 Partitioning of AFLP variation among Hagenia abyssinica individuals in Ethiopia com­puted by analysis o f molecular variance (AMOVA).

Source of variation df SS vc pv IsAmong-populations 24 557.42 0.71554 10.4 ***Within-populations 571 3521.63 6.16748 89.6 ***Among ecosystem groups 4 89.92 -0.00874 -0.13 nsAmong-populations 20 467.50 0.72178 10.49 ***Within-populations 571 3521.630 6.16748 89.64 ***Among geographic groups 3 105.427 0.09441 1.4 nsAmong-populations 21 451.993 0.64411 9.3 ***Within-populations 571 3521.63 6.16748 89.3 ***Among stand groups 3 64.062 -0.01630 -0.24 nsAmong-populations 21 493.358 0.72650 10.56 * * *

Within-populations 571 3521.63 6.16748 89.67 ***Among tree seed zones groups 12 311.133 0.18654 2.7 nsAmong-populations 9 168.756 0.52310 7.5 ***Within-populations 502 3132.63 6.24030 89.8 ***Among chloroplast lineage groups 1 37.525 0.05421 0.78 *Among-populations 23 519.895 0.68950 9.98 ***Within-populations 571 3521.630 6.16748 89.24 ***Among sex groups 1 3.702 -0.08835 -1.34 nsAmong-populations 22 270.164 0.70368 10.64 ***Within-populations 193 1157.245 5.99609 90.69 ***

df = degree of freedom, SS = sum of squares, vc = variance components, pv= percent variation, Is = level of significance, *** = highly significant at p<0.001, * = significant at p<0.5, ns = not significant

Fine-scale spatial genetic structure

In general, most populations from farmlands, wooded grasslands and woodlands (6 out of 8)

showed significant spatial genetic structure up to longer distances (36-80 m) whereas only 4 out

o f 13 closed forest populations showed family structure at shorter distance classes (15 - 44 m)

(Table 5, Supplementary Fig. 1). No SGS was observed in the largest remaining Hagenia popu­

lation (DD) in Ethiopia (~ 5000 individuals) while significant SGS was observed in the second

largest population DO (N= 260), harboring the highest genetic diversity. In most (7 out of 10) of

the small populations (N = 55-80) of the closed forst type, no SGS was observed (Table 5). Den­

sity, population size and distance from the nearest population were not associated with the kin-

69

Paper II: Genetic diversity at AFLPs

ship coefficient averaged over distance classes F(d) o f 21 natural populations (for example,

Spearman's nonparametric correlation coefficient (r) for density = -0.065, p = 0.391).

cuB)i_rWD(A)r

WW(B) —

MS(D)— I

SMPfC) — '

D S ( D ) | _

ITODt

SM(C)-----

KDP(A)-----

RR(D)-----

ZQ(B)-----

BG(C),

CH(B)

DN(B)

DR(A)

B R D )

KUD)DD(D)

WB(A)

HMD)DK(A)

K » A )

DKP(A)

DO(D)

l)T_n -

0.00

Q

0A3N « s genetic

Fig. 2 UPGMA tree drawn from Nei’s (1978) genetic distances computed from AFLPs. Popula­tion codes follow Table 1. Letters in parenthesis designate geographic regions: A= northern re­gion, B= central region, C= southwestern region, D= southern region.

70

Table 5 Spatial genetic structure in Hagenia populations

Population

C ode

T ype o f fo rest S tand type S am ple

size

Pop

size

D ensity

Ind./ha

M a

X.

F(d)

M ax

distance

D istance

classes*

Sex

dex

D istance

in- (km ) from

nearest

popu la tion

KB C losed forest H agen ia-dom inated m ixed stand 24 60 52 0.06 15 1-2 na 141.2 (W B)DR C losed forest M ixed, sparse H agenia 24 60 12.5 ns ns 0.7 131.7

(W D )W B C losed forest H agen ia-dom inated m ixed stand 24 60 75.7 ns ns na 141.2 (K B )CM C losed forest M ixed, sparse H agenia 24 65 17.8 0.09 31.6 1-3 na 98.8 (ZQ )DN C losed forest M ixed, sparse H agenia 24 55 13.9 ns ns na 136.3 (CL)ZQ C losed forest M ixed, sparse H agenia 23 60 0.7 ns ns 0.3 78.3 (CL)BB C losed forest M ixed, sparse H agenia 24 60 27.8 0.07 18 1 1.2 122.2 (CM )SM C losed forest M ixed, sparse H agenia 23 60 23.8 ns ns na 69.3 (BG )M S C losed forest M ixed, sparse H agenia 24 80 10 ns ns na 28.5 (K L)BG C losed forest H agenia-dom inated m ixed stand 24 80 5 ns ns 0.9 69.3 (SM )DO C losed forest H agenia-dom inated m ixed stand 24 260 16.7 0.21 44 1 3 37.5 (RR)DD C losed forest H agenia-dom inated m ixed stand 24 5000 30.9 ns ns na 22.3 (D S)U R C losed forest M ixed, sparse H agenia 24 70 13.9 ns ns 0.7 20.6 (BR)DS Farm land Pure H agenia stand 23 75 10 0.12 64 1-2 2.9 22.3 (D D )HM Farm land H agenia-dom inated m ixed stand 24 55 4.8 0.09 58 1 0.9 41.0 (U R)KL W ooded grassland H agen ia-dom inated m ixed stand 24 110 12.5 0.2 56 1 1.8 28.5 (M S)BR W ooded grassland H agenia-dom inated m ixed stand 24 100 9.1 ns ns 1.1 20.6 (U R)DK w oodland Pure H agenia stand 24 26 16 0.19 36 I 1 215.0

(W D )W W w oodland H agenia-dom inated m ixed stand 24 45 5.4 ns ns na 141.7 (D N )CL w oodland H agenia-dom inated m ixed stand 24 70 7.1 0.08 80 1-2 1.8 61.4 (M S)RR w oodland H agenia-dom inated m ixed stand 23 170 10.5 0.06 52 1-2 na 37.5 (D O )* Distance classes for only populations that showed family structures are indicated.

Paper II: Genetic

diversity at A

FLP

s

Paper II: Genetic diversity at AFLPs

Discussion

Genetic diversity and population differentiation

The moderate to high genetic diversity in Hagenia reflects effective gene flow from dif­

ferent pollen and seed sources, resulting in low population differentiation, which in turn

reflects effective long-distance pollen and/or seed dispersal among-populations. This ob­

servation confirms the first hypothesis that predicted high variation within populations

and low differentiation among populations. The absence of association between genetic

and geographic distances might be explained by a random and long-distance dispersal of

pollen. Accordingly, planted populations were not clustered with their putative parent

populations unlike for chloroplast markers, where plantations showed the same haplo­

types as their parent populations (Taye et al. submitted (a)).

Phylogeographic analyses of the same 25 populations at cpDNA revealed two chloroplast

lineages (Taye et al. submitted (a)). Most likely, lineage I originated from Lineage II by a

deletion in a specific chloroplast region. Thus all plants o f lineage I originated from a

single seed during colonization o f Ethiopia. Assuming restricted gene flow by pollen we

would expect a much lower genetic diversity in populations with the derived chloroplast

haplotypes o f lineage I. However, the two chloroplast lineages demonstrated comparable

mean genetic diversities with lineage II exhibiting slightly higher values. Also genetic

differentiation (Fst) between populations of chloroplast lineage II and the derived lineage

I were similar, showing the harmonizing effect o f gene flow.

No trend of decreasing genetic diversity during colonization was detected, reflecting ef­

fective gene flow. This observation allows us to accept the hypothesis “Hagenia does not

lose genetic diversity during colonization due to effective gene flow that counteracts ef­

fects of genetic drift” . A general trend o f increasing genetic diversity away from refugia

was observed in European beech based on isozymes (Comps et al. 2001), suggesting a

gain in gene diversity during recolonization due to gene flow, population admixture ef­

fects and selection. Petit et al. (2003) also reported that the mixing of colonization routes

and increased levels o f seed flow resulted in increased intrapopulation diversity away

Paper II: Genetic diversity at AFLPs

from refugia in some European woody species. In contrast, Lobelia giberroa, which en­

tered Ethiopia also from the south (Mulugeta, et al. 2007), Carpinus betulus (Betulaceae)

in Europe (Coart et al. 2005) and Ptercarpus officinalis (Fabaceae) in the Caribbean

(Rivera-Ocasio et al 2002) demonstrated decreasing diversity during recolonization (all

based on AFLP analyses). The level of genetic diversity in a population is affected by an

array of genetic, life history and ecological characteristics that collectively define the

population’s genetic structure (Yeh 2000). Lobelia giberroa has a giant-rosette growth

form, reaching 9m when in flower (Mulugeta, et al. 2007) and it grows in altitudes higher

than Hagenia. As Hagenia is a canopy tree, pollen and seeds can disperse over long dis­

tances contributing to the maintenance of comparatively high levels of gene diversity.

In general, closed forest populations harbored more gene diversity (mean He = 0.207)

than woodland (mean He = 0.190) and farmland (mean He = 0.172) populations. The

maximum genetic diversity was recorded for the population Dinsho (DO) that is situated

in a well-protected Park Forest whereas the lowest genetic diversity was recorded for the

farmland populations Doddola Serofta (DS) and Hagere Mariam (HM), suggesting a

negative effect of human-induced selection.

Comparison o f genetic diversity with other species

Most genetic diversity studies of trees were done with isozymes (e.g., Hamrick & Godt

(1996)) and hence the results are not directly comparable with AFLP based diversity es­

timates. In a review of the estimation of intraspecific genetic diversity in plant species by

using nuclear DNA markers, Nybom (2004) reported a slightly higher mean within-

population diversity (Hpop) o f 0.22 (RAPD), 0.23 (AFLP) and 0.22 (ISSR) based on the

outcome of 60, 13 & 4 studies, respectively. The overall mean gene diversity of Hagenia

at AFLPs (He = 0.195) is comparable to some other plant species such as the insect-

pollinated Hibiscus tiliaceus (Malvaceae, He = 0.198, Tang et al., 2003) and the wind-

pollinated Acanthopanax sessiliflorus (Araliaceae, He = 0.187, Huh et al., 2005) but

lower than the insect-pollinated Malus sylvestris (Rosaceae, He = 0.225, Coart et al.,

2003). Studies based on AFLP markers are limited to a few tropical tree species and in­

73

Paper II: Genetic diversity at AFLPs

formation on the method of estimating He is missing in most of the cases, making com­

parisons difficult. Here, we report a comparative analysis from the available literature

applying the same method for the estimation o f allele frequencies. The insect-pollinated

tropical species Dipterocarpus cf. condorensis (Dipterocarpaceae, He = 0.215, Luu 2005)

also showed a slightly higher mean gene diversity than Hagenia at AFLP markers. H.

abyssinica exhibited higher mean gene diversity than some other tropical and subtropical

tree species such as the bird-pollinated Lobelia giberroa (Apocynaceae, He = 0.066, Mu-

lugeta, et al. 2007) the insect-pollinated Shorea leprosula (Dipterocarpaceae, He =

0.161, Cao et al. 2006), the insect-pollinated Shorea parvifolia (Dipterocarpaceae, He =

0.138, Cao et al. 2006), the insect and wind-pollinated Acer skutchii (Sapindaceae, He =

0.15, Lara-Gomez et al., 2005) and the bird-pollinated Pelliciera rhizophorae (Pellici-

eraceae, He = 0.117, Castillo-Cardenas et al. 2005) at AFLP loci. Tileye et al. (2007) re­

ported higher mean gene diversity (0.30) in 12 populations of Hagenia from central and

southern regions of Ethiopia at 84 polymorphic ISSR markers. But Qian et al. (2001) and

Nybom (2004) argued that ISSR markers generally over-estimate gene diversity as com­

pared to other markers. Hagenia also showed lower mean gene diversity at AFLPs than

some other tree species growing in Ethiopia, notably, the insect-pollinated Cordia afri­

cana (Boraginaceae, He = 0.287, Abayneh 2007) and the wind-pollinated Juniperus pro-

cera (Cupressaceae He = 0.269, Demissew 2007). The wider distribution o f both species

and the effective dispersal o f seeds of Cordia by animals explain the higher diversity than

Hagenia. The habitat of Juniperus is closer to Hagenia than Cordia that grows in lower

altitudes and warmer climate.

In the present study, the maximum gene diversity is recorded for population Dinsho (DO)

in the Bale region, conforming to the highest gene diversity found in wild coffee (Coffea

arabica, Rubiaceae; Aga et al. 2005) and Lobelia giberroa (Mulugeta et al. 2007) re­

ported from the same region at ISSR and AFLP markers, respectively. But the neighbour­

ing population Rira (RR), which is closer to the aforementioned populations o f Coffea

arabica and Lobelia giberroa, showed much lower He than Dinsho. In contrast Tileye et

al. (2007), Abayneh (2007) and Demissew (2007) reported lower gene diversity in

Hagenia abyssinica (ISSR), Cordia africana (AFLP) and Juniperus procera (AFLP), re­

74

Paper II: Genetic diversity at AFLPs

spectively from the Bale region as compared to other regions. The disagreement between

the result of Tileye et al. (2007) and that of the present study on the same population

(DO) of H. abyssinica is most likely due to small number of trees sampled by the former.

In accordance with the wind-pollinated and out-crossing mating system of Hagenia, a

moderate population differentiation ( F s t ) was observed, suggesting high levels of gene

flow particularly via pollen. Hamrick and Godt (1996) reported an average Fst value of

0.092 for out-crossing perennials at isozyme loci. High levels of gene flow are not unex­

pected for out-crossing tree species (Hamrick & Godt 1989) and it is reinforced in

Hagenia by a recent divergence of populations as confirmed by cpDNA and palynologi­

cal evidences (Taye et al. submitted (a)). Tileye et al. (2007) found a higher coefficient of

differentiation (Gst = 0.25) among 12 populations of Hagenia using ISSR markers. They

sampled fewer individuals (10 trees) per population and also included different popula­

tions that are smaller in size. This might explain the differences between the two studies.

Comparable levels of population differentiation were found at AFLPs in Cordia africana

( ® st = 0.072, Abayneh 2007), Acer skutchii ( F st = 0.075, Lara-Gomez et al. 2005),

Acanthopanax sessilifloms (Gst = 0.069, Huh et al., 2005) and in two species from the

Betulaceae family that have a similar breeding system as Hagenia - Carpinus betulus

(Fst = 0.074) and C. orientalis (Fst = 0.0863) (Coart et al. 2005). Higher coefficients of

population differentiation were also reported for insect-pollinated Shorea species ( F St =

0.25-0.31, Cao, 2006) and Hibiscus tiliaceus ( F st = 0.152, Tang et al., 2003), and bird-

pollinated Pelliciera rhizophorae ( F st = 0.265, Castillo-Cardenas et al. 2005) based on

AFLP markers. On the other hand, Fst values lower than that of Hagenia were reported

for wild Malus sylvestris (Rosacea, F s t= 0.0464, Coart et al. 2003).

Fine-scale spatial genetic structure

Despite the dispersal o f seed and pollen by wind, significant spatial genetic structure was

observed within nearly half o f the populations of Hagenia abyssinica, reflecting restricted

geneflow within populations and mating of related trees. Positive values of F;j were found

at short distances, indicating higher genetic relatedness among neighbor individuals than

random pairs of individuals, whereas negative values o f Fy occurred at larger distances,

75

Paper II: Genetic diversity at AFLPs

showing isolation-by-distance within a population (Tero et al. 2005). Significant spatial

genetic structure in Hagenia extends up to 80 m from individual trees. This result allows

us to reject the hypothesis that predicts absence o f fine-scale genetic spatial patterning in

Hagenia. While there was no association between tree density, population size or dis­

tance from the nearest population and the occurrence o f wide-ranging SGS, significant

SGS was observed more frequently in farmlands and woodlands as compared to closed

forests. The extent o f SGS in the present study is possibly underestimated due to low

sample size and lower number of AFLP loci as compared to other studies. For example,

Jump and Penuelas (2007) observed SGS upto about 30m at 6 SSR loci, while significant

SGS upto 110m was observed at 250 AFLP markers in wind-pollinated Fagits svlvatica.

Conclusions and recommendations

The intrapopulation genetic diversity and interpopulation genetic differentiation o f Hage­

nia abyssinica is consistent with earlier predictions based on breeding system, life cycle,

population size, density and geographic range. Despite the relatively recent colonization

of Ethiopia by Hagenia abyssinica that has been suggested by fossil pollen data (Taye et

al. submitted (a)) and the small population sizes, the AFLP analysis detected moderate to

high gene diversities within populations with considerable differences in He between

populations, and moderate but significant genetic differentiation among populations.

Since even little effective pollen per generation is sufficient to counteract loss of genetic

diversity (Wright 1931, Finkeldey & Hattemer 2007), the effect of recent colonization

and the small population sizes is not reflected in the levels of gene diversity. The ob­

served variation at putatively neutral markers does not reflect clinal variation patems.

Consequently, 1) a seed zone approach is questionable to conserve genetic diversity, 2) it

is difficult to capture optimal variation for conservation and tree improvement based on

approaches to sample ecological and/or geographic zones, 3) Due to significant genetic

differentiation observed among populations, it is necessary to collect seeds from as many

populations as possible for gene bank storage, and for the establishment of provenance

trials and ex situ plantations. The very high gene diversity in some populations calls for

the need to conserve the observed variability. The moderate to high intraspecific variation

76

Paper II: Genetic diversity at AFLPs

and a wide vertical distribution o f the populations (2200 to 3200 m asl) may suggest that

Hagenia might have occupied wider areas in the past than at present. The extant popula­

tions, on the other hand, harbor quite high levele of gene diversity despite of their small

sizes. Nonetheless, our data suggests that human impact in the form of selective removal

of trees conversely affects gene diversity, as observed in the two farmland populations. A

significant fine-scale spatial genetic structure was observed in some populations despite

the dispersal of seed and pollen o f Hagenia by wind.

Further work on the intraspecific genetic variation and palynological investigations in

other African countries where Hagenia is known to grow is suggested to fully understand

the colonization history and to identify the refugia of the species. Paternity analyses to

estimate effective pollen-flow distances are also recommended.

Acknowledgements

This project is a component of the “Support to the Forest Genetic Resources Conserva­

tion Project” of the Ethiopian Institute of Biodiversity Conservation (1BC) supported by

the German Federal Ministry of Economic Cooperation and Development (BMZ) through

the German Technical Cooperation (gtz). The German Academic Exchange Service

(DAAD) executed the grant. The National Meteorological Service Agency of Ethiopia

provided climatic data. We thank Oleksandra Dolynska, Thomas Seliger and Olga Artes

for kindly assisting in the laboratory.

77

Paper II: Genetic diversity at AFLPs

References

Abayneh, D. 2007. Genetic variation in Cordia africana Lam. In Ethiopia. PhD thesis, Georg-August University of Gottingen.

Aalbaek A (1993) Tree seed zones for Ethiopia. National Tree Seed Project, Addis AbabaAga, E., Bekele, E. and Bryngelsson T. 2005. Inter-simple sequence repeat (ISSR) varia­

tion in forest coffee tree (Coffea arabica L.) populations from Ethiopia. Genetica, 124:213-221.

Azene, B.T., Bimi,e A. and Tegnas, B 1993. Useful trees and shrubs for Ethiopia: identi­fication, propagation and management for agricultural and pastoral communities. Technical handbook No. 5, Regional Conservation Unit, Swedish International De­velopment Authority (SIDA).

Berhanu, M.A., Ngadjui, B.T., Merhatibeb, B. and Mdee, L.K. 1999. Novel natural prod­ucts from marketed plants o f eastern and southern Africa. Pure Appl. Chem. 71: 919- 926.

Bensch, S. and Akesson, M. 2005. Ten years o f AFLP in ecology and evolution: why so few animals? Mol. Ecol. 14: 2899-2914.

Beuning, KRM, Talbot, M.R., Kelts, K. 1997. A revised 30,000-year paleoclimatic and paleohydrologic history o f Lake Albert, East Africa. Palaeogeogr. Palaeocl. 136: 259- 279.

Bonnefille, R., Riollet, G., Buchet, G., Icole, M., Lafont, R., Arnold, M., Jolly, D. 1995. Glacial/interglacial record from intertropical Africa, high resolution pollen and carbo data at Rusaka, Burundi. Quaternary Sci. Rev. 14: 917-936.

Cao, C-P., Finkeldey, R., Siregar, I.Z., Siregar, U.J., Gailing, O. 2006. Genetic diversity within and among-populations o f Shorea leprosula Miq. and Shorea parvifolia Dyer (Dipterocarpaceae) in Indonesia detected by AFLPs. Tree Genet Genomes, 2: 225-239.

Castillo-Cardenas, M.F., Toro-Perea, N., and Cardenas-Henao, H. 2005. Population ge­netic structure of neotropical Mangrove species on the Colombian Pacific Coast: Pel- liciera rhizophorae (Pellicieraceae). Biotropica, 37: 266-273.

Cavers S., Degen B., Caron H., Lemes, M.R., Margis, R., Salgueiro, F., and Lowe, A.J. 2005. Optimal sampling strategy for estimation of spatial genetic structure in tree populations. Heredity, 95: 281-289.

Cavers, S., Navarro, C., Lowe, A.J. 2003. Chloroplast DNA phylogeography reveals colonization history of a neotropical tree, Cedrela odorata L., in Mesoamerica. Mol. Ecol. 12: 1451-1460.

Coart, E., Van Glabeke, S., Petit, R.J., Van Bockstaele, E. and Roldan-Ruiz, I. 2005. Range wide versus local patterns of genetic diversity in hornbeam (Carpinus betulus L.). Conserv Genet. 6: 259-273.

Coart, E., Vekemans, X., Smulders, M..JM., Wagner, I., Huylenbroeck. J.V., Bockstaele, E.V. and Roldan-Ruiz, I. 2003. Genetic variation in the endangered wild apple (Ma- lus sylvestris (L.) Mill.) in Belgium as revealed by amplified fragment length poly­morphism and microsatellite markers. Mol. Ecol. 12: 845-857.

78

Paper II: Genetic diversity at AFLPs

Comps, B., Gomory. D., Letouzey, J., Thiebaut, B. and Petit. R.J. 2001. Diverging trends between heterozygosity and allelic richness during post glacial colonization in the European beech. Genetics, 157: 389-397.

Dawit, A. and Ahadu A. 1993. Medicinal Plants and Enigmatic Health Practices of Northern Ethiopia. Addis Ababa.

Degen, B., Petit, R. and Kremer, A. 2001. SGS - Spatial Genetic Software: a computer program for analysis of spatial genetic and phenotypic structures of individuals and populations. J. Hered. 92: 447-448.

Demissew, S.D. 2007. Genetic variation of Juniperus procera Hochst. Ex Endl. popula­tions in Ethiopia assessed by using microsatellite (SSR) and AFLP markers. MSc. Thesis. Georg-August University of Gottingen.

Excoffier, L., Laval, G., Schneider, S. 2005. Arlequin (version 3.0): An integrated soft­ware package for population genetics data analysis. Evol Bioinformatics Online, 1: 47-50.

Faris, H. 1998. Seedling biomass, seed germination responses and cytology of Hagenia abyssinica (Bruce) J.F.Gmel. MSc. Thesis, Addis Ababa University.

Fichtl R, Admasu A 1994. Honeybee flora o f Ethiopia. DED - Margraf Verlag, Weikers- heim.

Finkeldey, R., and Hattemer, H.H. 2007. Tropical Forest Genetics. Springer-Verlag, Ber­lin.

Hamrick, J.L. 1989. Isozymes and the analysis of genetic structure in plant populations. In Isozymes in Plant Biology. Edited by D.E. Soltis, and P.S. Soltis. Dioscorides Press, Portland, pp. 87-105.

Hamrick, J.L., and Loveless, M.D. 1989. The genetic structure of tropical trees popula­tions: associations with reproductive biology. In Evolutionary Ecology of Plants. Edited by J.H. Bockand, and Y.B. Lindhart. Westview Press, Boulder, pp. 129-146.

Hamrick, J. L., and Godt, M. J. 1989. Allozyme diversity in plant species. In Plant popu­lation genetics, breeding and germplasm resources. Edited by A.H.D Brown, M.T. Clegg, A.L. Kahler, and B.S. Weir. Sinauer, Sunderland, Mass.

Hamrick, J.L., and Godt, M.J.W. 1996. Effects of life history traits on genetic diversity in plant species. Philos. Trans. R. Soc. Lond. B. 351: 1291-1298.

Hardy, O.J. Maggia, L., Bandou, E., Breyne, P., Caron, H., Chevallier, M-H., Doligez, A., Dutech, C., Kremer, A., Latouche-Halle, C., Troispoux, V., Veron, V. and De­gen, B. 2006. Fine-scale genetic structure and gene dispersal inferences in 10 Neo­tropical tree species. Mol. Ecol. 15: 559-571.

Hardy, O.J. 2003. Estimation of pairwise relatedness between individuals and characteri­zation o f isolation-by-distance processes using dom inant genetic m arkers. Mol. Ecol. 12: 1577-1588.

Hardy, O. J., and Vekemans X. 2002. SPAGeDi: a versatile computer program to analyse spatial genetic structure at the individual or population levels. Mol. Ecol. Notes, 2: 618-620.

Hedeberg, O. 1989. Rosaceae. In Flora o f Ethiopia, Vol. 3, Pittosporaceae to Arralaceae. Edited by I. Hedeberg, and S. Edwards. Addis Abeba and Asmara, Ethiopia; Uppsala, Sweden.

Hoffmann, A.A. and Blows, M.W. 1994. Species borders: ecological and evolutionary perspectives. Trends Ecol. Evol. 9: 223-227.

79

Paper II: Genetic diversity at AFLPs

Huh, M.K, Huh, H.W. and Back, K. 2005. Genetic diversity and population structure of Acanthopanax sessiliflorus (Araliaceae) using AFLP. Korean J Genetics, 27: 71-79.

Jansen, P.C.M. 1981. Spices, condiments and medicinal plants in Ethiopia, their taxono­my and agricultural significance. Wageningen.

Jump A.S., and Penuelas J. 2007. Extensive spatial genetic structure revealed by AFLP but not SSR molecular markers in the wind-pollinated tree, Fagus sylvatica. Mol. Ecol. 16: 925-936.

Lara-Gomez, G., Gailing O., and Finkeldey R. 2005. Genetic variation in isolated Mex­ican

populations of the endemic maple Acer skutchii Rehd. Allg. Forst- u J-Ztg. 176: 97- 103.

Legesse, N. 1995. Indigenous trees o f Ethiopia: biology, uses and propagation tech­niques. SLU, Reprocentralen, Umea.

Loh, J.P., Kiew, R., Hay, A., Kee, A., Gan, L.H. and Gan, Y.-Y. 2000. Intergeneric and interspecific relationships in Araceae tribe Caladieae and developmol/pl ent of mo­lecular markers using amplified fragment length polymorphism (AFLP). Ann. Bot. 85: 371-378.

Loveless, M.D., and Hamrick, J.L. 1984. Ecological determinants o f genetic structure in plant populations. Annu. Rev. Ecol. Syst. 15: 65-95.

Luu, H.T. 2005. Genetic variation and the reproductive system o f Dipterocarpus cf. condorensis Pierre in Vietnam. PhD Thesis, Georg-August University of Gottingen.

Mueller, U.G. and Wolfenbarger, L. L. 1999. AFLP genotyping and fingerprinting. Trends Ecol. Evol. 14(10): 389-394.

Mulugeta, K., Ehrich D., Taberlet P., Sileshi N. and Brochmann, C. 2007. Phylogeogra­phy and conservation genetics o f a giant lobelia (Lobelia giberroa) in Ethiopian and Tropical East African mountains. Mol. Ecol. 16: 1233-1243.

Nei, M. 1987. Molecular evolutionary genetics. Columbia University Press. Pp 512.Nei, M. 1978. Estimation o f average heterozygosity and genetic distance from a small

number o f individuals. Genetics, 89: 583-590.Nybom, H. 2004. Comparison of different nuclear DNA markers for estimating intras-

pecific genetic diversity in plants. Mol. Ecol. 13: 1143-1155.Olago, D.O., Street-Perrott F.A., Perrott R.A., Ivanovich M., Harkness D.D. 1999. Late

quaternary glacial-interglacial cycle of climatic and environmental change on Mount Kenya. J Afir Earth Sci. 29: 593-618.

Ouborg, N.J., Piquot, Y., Van Groenendael, M. 1999. Population genetics, molecular markers and the study of dispersal in plants. J. Ecol. 87: 551-568.

Pankhurst, R. 1969. The Traditional Taenicides o f Ethiopia. J. Hist. Med. All. Sci. (XXIV): 323-334.

Petit, R.J., Aguinagalde, I., de Beaulieu J-L., et al. (2003) Glacial refugia: hotspots but not melting pots o f genetic diversity. Science, 300, 1563-1565.

Qian, J., Luscombe, N.M., and Gerstein, M. 2001. Protein family and fold occurrence in genomes: power-law behaviour and evolutionary model. J. Mol. Biol. 313: 673-681.

Rivera-Ocasio, E., Aide, T.M. and McMillan, W.O. 2002. Patterns of genetic diversity and biogeographical history o f the tropical wetland tree, Pterocarpus officinalis (Jacq.), in the Caribbean basin. Mol. Ecol. 11: 675-683.

80

Paper II: Genetic diversity at AFLPs

Rohlf, F.J. 1998. NTSYS-pc: Numerical taxonomy and multivariate analysis system (Version 2.0). State University of New York, USA.

Schaal, B.A., Hayworth, D.A., Olsen, K.M., Rauscher, J.T., Smith, W.A. 1998. Phylo- geographic studies in plants: problems and prospects. Mol. Ecol. 7: 465-474.

Slatkin, M. and Barton, N.H. 1989. A comparison of three indirect methods for estimat­ing average levels o f gene flow. Evolution, 43: 1349-1368.

Tang, T., Zhong, Y., Jian, S.G. and Shi, S.H. 2003. Genetic diversity of Hibiscus tilia- ceus (Malvaceae) in China assessed using AFLP markers. Ann. Bot. 92: 409-414.

Tero, N., Aspi, J., Siikamaki, P., and Jakalaniemi. A. 2005. Local genetic population structure in an endangered plant species, Silene tatarica (Caryophyllaceae). Heredity, 94: 478—487.

Tileye, F. Nybom, H., Bartish I.V. and Welander M. 2007. Analysis of genetic diversity in the endangered tropical tree species Hagenia abyssinica using ISSR markers. Genet. Resour Crop Ev. 54: 947-958.

Umer, M., Lamb, H.F., Bonnefille, R., Lezine, A-M., Tiercelin, J-J., Gibert, E., Gazet, J- P., Watrin, J. 2007. Late Pleistocene and Holocene vegetation history of the Bale Mountains, Ethiopia. Quaternary Sci. Rev. 26: 2229-2246.

Vekemans, X., Beauwens, T., Lemaire, M. and Roldan-Ruiz, I. 2002. Data from ampli­fied fragment length polymorphism (AFLP) markers show indication of size homo- plasy and a relationship between degree of homoplasy and fragment size. Mol. Ecol. 11: 139-151.

Vekemans, X., Hardy. O.J. 2004. New insights from fine-scale spatial genetic structure analyses in plant populations. Mol. Ecol. 13: 921-935.

Vos, P., Hogers, R., Bleeker, M., Reijans, M., Lee, Th. van der, Homes, M., Frijters, A., Pot, J., Peleman. J., Kuiper, M. and Zabeau, M. 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23(21): 4407-4414.

White, T.L., Adams, W.T., and Neale, D.B. 2007. Forest Genetics. CABI Publishing, Wallingford and Cambridge.

Wright, S. 1969. The theory of gene frequencies. In Evolution and the Genetics of Popu­lations, Vol. 2. University o f Chicago Press, Chicago. Pp 511.

Yeh, F.C. 2000. Population Genetics. In Forest conservation genetics: principles and practice. Edited by A.Young, D. Boshier, and T.Boyle. CABI Publishing. Pp 352.

Zhivotovsky, L.A. 1999. Estimating population structure in diploids with multilocus do­minant DNA markers. Mol. Ecol. 8: 907-913.

81

Paper II: Genetic diversity at AFLPs

Supplementary materials to Paper II

Supplementary Table 1 The grouping of the sampled Hagenia populations that are used to exam­ine the partitioning of genetic diversity at AFLP loci.

No. of List of populations1populations

Micro-ecosystem types of sampled populationsClosed forest 12 DO, Z0 , BB, MS, SM, UR, KB, DN, DR, BG,

CM, DDOpen forest/woodland 6 WW, CL, WD, RR, DK, WBFarm land/ Homestead 2 DS, HMWooded grassland 2 BR, KLPlantation 3 DKP, SMP, KDP

Types of Hagenia forest standsMixed stand, sparse Hagenia 8 ZQ, BB, MS, SM, UR, DN, DR, CM,//agew'a-dominated mixed 12 DO, KB. BG, DD, WW, CL, WD, RR, WB,stand HM, BR, KLPure Hagenia stand 2 DS, DKPlantation 3 D K P , S M P, K D P

Geographic regionsNorthern 7 DK, DKP, DR, KB, WB, WD, KDPCentral 5 WW, CL, DN, CM, ZQSouth-western 4 BB, BG, SM, SMPSouthern 9 BR, KL, DS, HM, DO, MS, UR, DD, RR

Chloroplast lineragesLineage I 9 DK, DKP, KDP, WD, DR, WB, SM, SMP, BGLineage II 16 BB, BR, CL, CM, DD, DN, DO, DS, HM, KB,

KL, MS, RR, UR, WW, ZQ

Tree seed zones215.3 1 WD17 4 CM, DO, DD, DS19 2 DK, KDP20.1 2 KB, WB20.2 2 WW, DR20.3 1 ZQ20.4 1 CM21.1 1 MS21.2 1 DN23.2 1 SM23.3 2 BG, BB24.1 4 KL, BR, UR, HM24.2In , .•___ , „

1 RRPopulation codes follow table 1; “Ffr details on tree seed zone descriptions, see Aalbaek (1993)

Supplenentary Table 2 Pairwise matrix showing Nei’s genetic distance among 25 populations of H. abyssinica from Ethiopia assessed by AFLP

82

Supplementary Table 2 Pairwise matrix showing Nei’s genetic distance among 25 populations of H. abyssinica from Ethiopia, assessed by AFLP

BB 0.000BG 0.012 0.000BR 0.007 0.0010.000CL 0.002 0.017 0.006 0.000CM 0.016 0.000 0.003 0.020 0.000DD 0.014 0.015 0.001 0.009 0.013 0.000DK 0.027 0.015 0.016 0.034 0.009 0.027 0.000DKP 0.014 0.023 0.019 0.020 0.018 0.027 0.018 0.000DN 0.023 0.002 0.006 0.030 0.005 0.020 0.011 0.031 0.000DO 0.040 0.036 0.035 0.045 0.036 0.037 0.043 0.053 0.036 0.000DR 0.018 0.007 0.007 0.017 0.002 0.014 0.009 0.017 0.010 0.039 0.000DS 0.017 0.036 0.022 0.007 0.037 0.021 0.058 0.038 0.056 0.057 0.037 0.000HM 0.015 0.016 0.007 0.012 0.020 0.005 0.039 0.034 0.025 0.041 0.019 0.018 0.000KB 0.015 0.014 0.016 0.025 0.009 0.025 0.011 0.021 0.021 0.042 0.018 0.048 0.031 0.000KDP 0.011 0.027 0.014 0.004 0.022 0.012 0.037 0.021 0.043 0.043 0.020 0.007 0.008 0.027 0.000KL 0.011 0.0100.001 0.010 0.009 0.001 0.023 0.025 0.015 0.031 0.014 0.020 0.005 0.017 0.011 0.000MS 0.005 0.009 0.008 0.005 0.013 0.015 0.023 0.021 0.021 0.036 0.011 0.018 0.014 0.026 0.013 0.018 0.000RR 0.021 0.044 0.029 0.015 0.044 0.032 0.070 0.041 0.062 0.067 0.042 0.007 0.023 0.056 0.010 0.032 0.024 0.000SM 0.006 0.017 0.012 0.003 0.019 0.021 0.036 0.020 0.033 0.046 0.022 0.004 0.017 0.029 0.008 0.015 0.009 0.0) 1 0.000SMP 0.010 0.012 0.008 0.009 0.015 0.015 0.028 0.021 0.024 0.044 0.009 0.021 0.019 0.030 0.020 0.017 0.001 0.027 0.010 0.000UR 0.012 0.032 0.018 0.004 0.034 0.020 0.054 0.031 0.052 0.055 0.033 0.000 0.016 0.045 0.004 0.018 0.013 0.005 0.002 0.018 0.000WB 0.013 0.013 0.006 0.017 0.008 0.007 0.009 0.016 0.018 0.033 0.013 0.030 0.011 0.013 0.009 0.003 0.014 0.036 0.022 0.022 0.025 0.000WD 0.000 0.012 0.004 0.000 0.011 0.011 0.016 0.015 0.022 0.038 0.009 0.011 0.016 0.014 0.009 0.007 0.001 0.021 0.003 0.001 0.008 0.010 0.000W W 0.003 0.016 0.009 0.002 0.014 0.014 0.028 0.024 0.032 0.038 0.018 0.012 0.017 0.017 0.006 0.012 0.006 0.014 0.004 0.009 0.008 0.016 0.000 0.000ZQ 0.017 0.040 0.027 0.016 0.041 0.028 0.060 0.035 0.055 0.058 0.038 0.015 0.019 0.054 0.013 0.028 0.019 0.009 0.018 0.0260.008 0.029 0.016 0.019 0.000

BB BG BR CL CM DD DK DKP DN DO DR DS HM KB KDP KL MS RR SM SMP UR WB WD WW ZQ

00LO

Paper II: Genetic diversity at AFLPs

Supplementary Fig. 1. Correlograms showing kinship coefficient (F(d)) averaged over distance classes and plotted against the maximum distances of 8 distance classes from AFLPs of 21 natural populations of Hagenia abyssinica. Descriptions of plots: solid line with diamond marks = observed values, broken line with triangle marks = upper bound of 95% confidence interval, broken line with square marks = lower bound of 95% confidence interval. For population codes refer to Table 1.

00Lr,

Paper II: G

enetic diversity

at AFLPs

III. Conservation genetics of African redwood (Hagenia abyssini­ca (Bruce) J.F. Gmel): a remarkable but gravely endangered tropical tree species

Taye Bekele Ayele, Oliver Gailing, Reiner FinkeldeyForest Genetics and Forest Tree Breeding, Georg-August University o f Goettingen, Buesgenweg 2, 37077 Goettingen, Germany

Abstract

A major challenge for the conservation o f a given taxon in nature is a well-defined incorpora­

tion o f genetic, demographic, and political criteria into decision-making processes. This paper

describes genetic and demographic factors that are instrumental in planning conservation, tree

improvement and domestication programs. A study is presented on a tropical tree species,

Hagenia abyssinica, which is prone to extinction using morphological, chloroplast microsatel­

lite and AFLP markers. The analysis o f variance (ANOVA) revealed a significant differentia­

tion among 22 natural populations o f Hagenia abyssinica in all quantitative morphological

traits at p<0.001. Multivariate and univariate taxonomic distances o f leaf traits between popu­

lations are not correlated with the corresponding genetic distances (r= -0.03484, p = 0.3926),

showing that the genetic differentiation at anonymous and presumably neutral AFLPs is not

associated with the morphological differences among populations. The chloroplast microsatel­

lite data allowed us to identify lineages and to reconstruct population history by analyzing

seed dispersal, while the AFLP data enabled us to identify populations o f high genetic diversi­

ty. A weighted-score population prioritization matrix (WPPM) that combines genetic, mor­

phological and demographic criteria was developed and used for the first time to prioritize

populations for conservation and domestication. Action is needed to launch conservation and

massive plantation programs o f the African redwood to ensure the long-term survival o f the

species and to boost its economic and ecological uses.

Key words: AFLP, chloroplast microsatellite, conservation genetics, genetic diversity, haplotypes, prioritization criteria, quantitative traits

‘Correspondence: Taye B. Ayele; e-mail: tavele@,ibc-et.org

Permanent address: Institute o f Biodiversity Conservation, Fax: 251-11-6613722

P.O.Box: 30726, Addis Ababa, Ethiopia;

86

Paper III: Converstion genetics

Introduction

Conservation o f forest ecosystems in general and o f critically endangered tree species in par­

ticular is a challenging task in the face o f high pressure from local communities on forest land.

To develop appropriate conservation strategies that {inter alia) preserve maximum genetic

diversity, it is imperative to know the extent and distribution o f genetic variation within a spe­

cies (Bawa & Krugman 1990; Loveless and Hamrick 1984). Investigation o f intraspecific ge­

netic variation may help to assess extinction risks and evolutionary potential (fitness) in a

changing world (Bawa & Krugman 1990; Hedrick 2001) and is instrumental to identify ap­

propriate units for conservation o f rare and threatened species (Newton et al. 1999). The pre­

servation o f germplasm in genebanks and the establishment of in situ and ex situ conservation

stands requires sound knowledge o f the genetic structure o f a given species in order to capture

the optimum genetic and demographic variations. Whereas genetic variation estimates have

been used to formulate some general rules o f thumb about viable population size (Franklin

1980; Lande 1995; Lynch at al. 1995), demographic analyses o f individual species are more

often used to assess short-term population health and to suggest management alternatives

(Menges 1990; McCarthy et al. 1995). The ecological processes o f migration and colonization

are crucial to species survival and can have a profound impact on the spatial organization of

genetic structure within and among natural populations (Husband & Barrett 1996).

Higher genetic diversity enhances a population's survival probability over ecological or evolu­

tionary time (Avise 2004). Small population sizes tend to reduce genetic variation, and might

therefore lead to a decreased ability o f such populations to adapt to ecological challenges

(DeSalle & Amato 2004; Amos & Balmford 2001). When populations are few in number and

small in size, the possibility o f species extinction through stochastic demographic fluctuations

can be o f paramount immediate concern (Gilpin and Soule 1986; Hanski and Gilpin 1997).

Reduced fitness may be a direct consequence o f reduction in the number o f heterozygous loci

(Amos & Balmford 2001). On the other hand, in some endangered species (such as the north­

ern elephant seal), low genetic variation has not seriously inhibited population recovery from

dangerously low levels (Avise 2004). Genetic inventories can provide conservationists with

unprecedented precision and can add greatly to their understanding o f the genetic parameters,

on the basis o f which many decisions are made.

87

Paper III: Conversion genetics

A ssessm en t o f m orpho log ical traits is particu larly usefu l to enhance tree im provem ent and

domestication programs by identifying appropriate characters and superior traits. It also as­

sists in conservation decisions through the identification of population structures based on di­

ameter/age classes o f trees. This paper describes morphological and molecular genetic varia­

tions in the African redwood (Hagenia abyssinica) and proposes various conservation and

domestication measures. Hagenia abyssinica is a monotypic tree species o f the Rosaceae fam­

ily that is native to Africa (Hedeberg 1989; Legesse 1995). It is an anemogamous and anemo-

chorous broad-leaved dioecious tree species with distinctly coloured male and female flowers.

Fossil pollen records suggested that Hagenia immigrated into Ethiopia from the south during

the late Pleistocene (since 16,700 years Before Present (BP)) and became abundant in the

southern regions o f Ethiopia about 2500 years BP (Beuning et al. 1997; Bonnefille et al. 1995;

Olago et al. 1999; Umer et al. 2007). The tree provided enormous timber and non-timber

products and various ecological values. Hagenia has been logged heavily and selectively due

to its superior timber and it is one o f the endangered tree species in Ethiopia (Legesse 1995).

According to the present inventory, about 7000 individuals are left in Ethiopia and only two

populations out o f 22 natural populations recruited young trees. Furthermore, planting efforts

were very limited and were not successful in most o f the cases. This is a seriously alarming

situation for the genetic resources o f the species, eventually leading to extinction. We present

information on the amount and distribution of diversity at morphological and molecular ge­

netic markers with the objective to (1) identify conservation units for in situ conservation, (2)

identify populations for collection o f germplasm for ex situ conservation. (3) enhance domes­

tication and tree improvement programs.

Materials and Methods

Sampling

Twenty two natural populations were sampled from diverse ecologies including closed forests

(12 populations), open forests/woodlands (6 populations), wooded grasslands (2 populations),

and farmlands/ homesteads (2 populations), representing most o f the extant distribution o f the

species in Ethiopia. In addition, three plantations were also sampled. The distribution o f the

sampled populations in the country is illustrated in Fig. 1. Table 1 presents the characteristics

o f the populations investigated in this study. The distance between populations ranges from 21

to 806 km within an altitudinal range of 2200 masl at Bonga to 3200 masl at Wofwasha.

Temperatures range from an absolute minimum o f -1°C at Dinsho to a maximum of 33.5 °C at

Kosso Ber. Higher rainfall and lower temperatures are expected than those shown in the table

Paper III: Converstion genetics

as the nearest meteorological stations are situated at altitudes lower than the actual popula­

tions in most o f the cases.

Morphological and ecological assessment

The following dimensional, counted and visually observed variables were assessed from 1109

individuals (26-50 trees per population, see Table 1): total height, bole height, diameter at

breast height (DBH), length o f petiole, width o f serrated tooth o f leaf, number o f leaflets,

number o f stipules, number o f pairs o f leaflets having stipules at the back of their bases, num­

ber o f stipules between two pairs o f leaflets, arrangement of leaflets, bole form/timber quality,

shape o f tree and sex. Twigs were harvested at random from each tree and the largest leaf was

chosen for leaf measurements. In addition, distance between trees, compass bearing to next

tree, total number o f individuals, longitude and altitude were assessed at the population level.

Distances between populations were computed from the GPS data.

Molecular inventories

Chloroplast microsatellite

Three polymorphic consensus chloroplast microsatellite primers (CCMP2, CCMP6 &

CCMP10) were used to screen 273 samples (9-12 individuals from each population) from

twenty two natural and three planted populations o f Hagenia. Details o f the methods are de­

scribed in Taye et al. submitted (a).

AFLP

A total o f 596 individuals (23-24 trees/population) from twenty two natural and three planted

populations o f Hagenia were analysed by using the selective primer combination E41-M67

(nomenclature according to Keygene N.V. ®). Details of the methods are described in Taye

et al. submitted (b).

Data analysis

The program SPSS 16.0 (SPSS Inc®) was used to perform analyses o f variance (ANOVA) o f

morphological traits and to compute taxonomic distances (as described by Sneath & Sokal

1973) from morphological data by using the Euclidean distance option. The program NTSYS-

pc 2.0 (Rohlf 1998) was used to draw dendrograms and to perform Mantel tests (Mantel

1967). Mantel tests were performed between univariate or multivariate taxonomic distances of

Paper III: Converstion genetics

morphological traits and N ei’s genetic distances among populations. Similarly, the association

between average taxonomic distances o f morphological traits between populations and

Euclidean distances o f climatic variables between populations was tested. Molecular genetic

data analysis softwares PermutcpSSR (available at

http://www.pierroton.inra.fr/genetics/labo/Software/PennutCpSSR/index.html. accessed on 3

February 2008) and ARLEQUIN Version 3.0 (Excoffier et al. 2005; available at

http://cmpg.unibe.ch/software/arlequin3. accessed on 10 February 2008) were used to analyze

the cpSSR data, while ARLEQUIN Version 3.0, AFLP-SURV (Vekemans et al. 2002, avail­

able at http://www.ulb.ac.be/sciences/lagev/. accessed on 2 March 2008) and NTSYS-pc 2.0

(Rohlf 1998) were used to analyze the AFLP data. A weighted-score population prioritization

matrix (WPPM) that combines genetic, morphological and demographic criteria was devel­

oped and used for the first time to prioritize populations for conservation and domestication.

Fig. 1 The distribution o f populations o f Hagenia abyssinica showing the two chloroplast lineages observed in Ethiopia (Taye et al. submitted (a)). Square-dotted enclosure shows lineage I; long-dashed enclosure shows li­neage II. Small filled-circles indicate the locations o f the populations; population codes are provided in Table 1. Base map: A ssefa Guchi (unpublished).

oi£bK P

90

Paper III: Converstion genetics

Table 1 Description o f Hagenia populations sampled from the mountains o f Ethiopia showing

some measures o f genetic diversity

Populations Code Lat. Long. M asl ARF Min T Max T n N H He

Debark-Mariam DK 1 3 ° ir 37°57' 3013 1270 8.8 19.7 26 26 4 0.217

Debark-

Plantation

DKP 13°12' 38o01' 3005 1270 8.8 19.7 50 - 4 0.226

Kimir-Dingay

plantation

KDP 11°48' 38°14' - 1350 9.2 21.9 30 1,6 0.183

Woldiya Se’at

Michael

WD 11°55' 39°24’ 3112 908 na na 50 120 6 0.194

Kosso Ber KB 10°59' 36°54' 2702 2381 12.9 27.4 50 60 1 0.206

Denkoro DR 10°52' 38°47’ 3061 896 10.9 21.8 50 60 6 0.189

Wonbera WB 10°34' 35°41' 2428 1622 na na 50 60 5 0.211

Wof washa ww 09°45’ 39°44' 3159 941 6.1 19.9 30 45 1 0.189

Chilimo CM 09°05’ 38°10' 2805 1114 11.5 25.8 50 65 1,4 0.192

Dindin DN 08°36' 40°14' 2410 989 12.7 28,0 30 55 1 0.212

Zequala Abo ZQ 08°32' 38°50' 2856 1215 na na 33 60 1 0.205

Boterbecho BB 08°24' 37°15' 2772 1666 5.7 23.6 50 60 1 0.213

Chilalo CL 07°56' 39°11’ 2815 796 9.8 23,0 50 70 1 0.177

Sigmo plantation SMP 07°55' 36°10' 2300 1837 11.4 21.6 30 - 4 0.146

Sigmo SM 07°46' 36°05' 2651 1837 11.4 21.6 30 60 4 0.170

Munesa MS 07°25' 38°53' 2459 1028 10.1 24.3 50 80 1 0 .200

Bonga BG 07°17' 36°22' 2238 2217 11.9 26.6 50 80 4 0.198

Kofele KL 07°11' 38°52’ 2757 1305 7.7 20.1 50 110 1,2,3 0.195

Dinsho DO 07°05' 39047- 3117 1213 3.4 20.8 50 260 2 0.362

Doddola-Serofta DS 06°52' 39°02’ 2700 1074 6.7 24.3 50 75 2 0.139

Doddola-

Dachosa

DD 06°52' 39°14' 3039 1074 6.7 24.3 50 5000 2 0.173

Rira RR 06°45' 39043- 2725 736 11a na 50 170 2 0.169

Bore BR 06°17' 38°39' 2631 1526 8.3 18.8 50 100 1,2,3 0.187

Uraga UR 06°08' 38°33' 2508 1228 8.3 18.8 50 70 2,3 0.160

HagereMariam

Total/mean

HM 05°51' 38°17' 2443 1228 12.3 23,0 50

1109

55

6741

2 0.168

0.195

M asl= m eters above sea level; ARF = M ean annual rainfall in milliliters; M in T = M ean minim um temperature (C°); Max T = M ean maximum temperature; n= no. o f samples assessed for morphological characters; N= Popu­lation size (estimation o f total no. o f individuals), H = chloroplast haplotypes (Taye et al. submitted (a)); He = gene diversity (Taye et al. submitted (b)). Population codes w ill be used throughout the paper.

91

Paper III: Conversion genetics

Results and discussions

Morphological diversity

The morphological traits observed in Hagenia abyssinica were highly variable among popula­

tions. Supplementary Table 1 summarizes the mean values o f morphological traits observed

within populations. The DBH-based population structure (Supplementary Fig. 1) indicated

that m ost o f the populations (59% ) fall under a J-shaped distribution pattern, indicating no/bad

reproduction and no/poor recruitment. Populations Munesa (MS) and Wonbera (WB) show

nearly complete coverage o f diameter classes that was close to normal distribution. Population

Chilimo (CM) also shows a nearly complete representation o f diameter classes but deviated

from a normal distribution. Population Zequala (ZQ) demonstrated an example o f a U-shaped

distribution that is an indication o f a selective removal o f middle diameter class trees. In gen­

eral, Hagenia exhibited unsatisfactory population structure as several diameter classes were

missing from the majority o f the populations. Natural regeneration was observed in only two

populations - Bonga (BG) (112 wildings) and Boterbecho (BB) (5 saplings). A one-way

analysis o f variance (ANOVA) revealed a significant differentiation among the 22 natural

populations o f Hagenia abyssinica in all morphological traits at p<0.001 (Table 2). Large

proportion o f variation (>65%) is allocated within populations for all traits. The highest per­

centage of variation among populations was observed for DBH (34.1%) while the lowest was

observed for the number o f leaflets (9% ).

The cluster analysis based on the average taxonomic distances matrix o f all leaf traits grouped

the populations into two main clusters and separated four outlier populations (Fig. 2). In gen­

eral, no clear association between geographic regions and taxonomic distances could be ob­

served. Both main clusters are composed o f populations from the main distribution areas of

the species. The average multivariate taxonomic distances o f all morphological traits in our

dataset did not show any correlation with the average Euclidean distances o f climatic vari­

ables (r = 0.17062, p = 0.9281), suggesting that the observed morphological traits are not in­

volved in the adaptation to different climatic conditions. Similarly, separate tests o f associa­

tion o f taxonomic distances o f individual morphological traits with the Euclidean distances of

climatic variables did not show any correlation (not shown). The pronounced divergence o f

quantitative morphological traits is likely to be due to different age structures, stand histories

and edaphic factors, which were, however, not assessed. It may also reflect different physio­

logical responses to changes in the environment.

92

Paper III: Conversion genetics

Table 2 Analysis o f variance (ANOVA) of morphological traits among 22 natural populations

o f Hagenia abyssinica.

Source o f variation SS df MS F % varia­tion

Is

Tree height between populations 6601.2 21 314.3 17.5 28.5Within populations 16536.5 919 18.0 71.5Bole height between populations 1617.2 21 77.0 11.2 20.3Within populations 6342.8 919 6.9 79.7DBH between populations 414377.9 21 19732.3 22.7 34.1Within populations 799144.1 919 869.6 65.9Petiole length between populations 1175.1 21 56.0 10.7 19.7Within populations 4780.6 918 5.2 80.3No. leaflets between populations 198.2 21 9.4 4.3 9.0Within populations 2011.5 918 2.2 91.0No. o f stipules between populations 10351.1 21 492.9 16.2 27.0Within populations 27977.3 918 30.5 73.0No. o f back stipules between pops 133.9 21 6.4 10.2 24.2Within populations 420.3 673 0.6 75.8Tooth width between populations 49.6 21 2.4 7.5 16.7Within populations 247.6 786 0.3 83.3d f = degrees of freedom, SS = sum o f squares, MS= mean sum o f squares, F = computed F value, Is = level o f significance, **** = highly significant at pO.OOOl.

Molecular genetic diversity

Chloroplast microsatellites

Six haplotypes that were phylogenetically grouped into two lineages were identified from the

combination o f 8 variants from the three loci (Table 1, Fig. 1). The observed haplotypes

showed a strong geographic pattern as a result o f highly restricted gene flow via seeds and a

rare occurrence o f long-distance seed dispersal. The two lineages were separated by an indel

(insertion/deletion) o f 10 nucleotides in locus CCMP2. The first lineage contains haplotypes

H4, H5 & H6, which are distributed in the south-western and northern regions, while the sec­

ond lineage contains haplotypes H 1, H2 & H3 in central and southern regions. A remarkable

subdivision o f cpDNA diversity in the species was found, as indicated by a high level o f ge­

netic differentiation ( G st = 0. 899, N st = 0. 926). Also, the non-hierarchical analysis o f mole­

cular variance (AMOVA) showed that 92.3% of the total genetic diversity is represented

among populations (Taye et al. submitted (a))

93

Paper III: C onversion genetics

}

Ed -

BB(C)DK(A)

WB(A)DR(A)CL(B)KB(A)BR(D)DD(D)MS(D)BG(C)- K L(D )- DN(B) -

WW(B) - DO(D) - WD(A)- UR(D) ■D S(D )- H M (D)- ZQ (B)- SM (C)- CM(B)-

R R (D )--- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 'i--------------------------- 1-1-------------- 1-------------- 1-------------- 1-1-------------- 1-------------- 1-------------- 1-------------- 1-i-------------- 1-------------- 1-------------- 1-------------- 1-1-------------- 1-------------- 1-------------- 1-------------- 1

065 249 433 8.18 8MEuclidean distance (leaf characters)

Fig. 2 UPGMA cluster diagram drawn based on average taxonomic distances computed from five leaf characters o f 22 natural populations o f Hagenia abyssinica from Ethiopia. Population codes follow Table 1. Letters in parenthesis indicate geographic regions: A= northern region, B= central region, C= southwestern region, D= southern region.

AFLP

Moderate to high gene diversities were observed at AFLP loci ranging from 0.139 at Dodola-

Serofta (DS) to 0.362 at Dinsho (DO) (Table 1). Interestingly, the lowest gene diversities

were recorded for the two farmland populations (DS & UR) while the maximum gene diver­

sity was recorded for a well-protected Park Forest (DO), pointing to negative human impact

on genetic diversity. The second largest population (DO) demonstrate remarkably high gene

diversity (36.2%), reflecting strong divergence from the rest o f the populations. The mean

gene diversity in subdivided populations o f Hagenia abyssinica showed high within-

population variation (0.195) and moderate but significant population differentiation (F St =

0.077) (Taye et al. submitted (b)). The largest remaining population (DD) does not show the

highest genetic diversity whereas much smaller populations show higher diversity (Table 1).

Ten out o f 21 natural populations (KB, CM, BB, DO, DS, HM, KL, DK, CL and RR) showed

significant spatial genetic structure (SGS) (Taye et al. submitted (b)).

The non-hierarchical analysis o f molecular variance (AMOVA) performed for all populations

at AFLP markers revealed that 10.4% of the total variation is represented among populations.

Paper III: Conversion genetics

The phylogenetic tree drawn from N ei’s (1978) genetic distances using the Unweighted Pair

Group Method with Arithmetic mean (UPGMA) clustering method congregated the 22 natural

populations into two major clusters (Fig. 3). The dendrogram reflects a weak spatial distribu­

tion pattern o f the populations. Likewise, a test o f association (Mantel test) between the mul­

tivariate taxonomic distances o f combined leaf traits and genetic distances did not show any

correlation (r = -0.03484, p = 0.3926). Similarly, separate tests for association o f the taxo­

nomic distances o f individual morphological traits (including growth traits) with the genetic

distances did not show any correlation (not shown). This result suggests that the genetic dif­

ferentiation at anonymous AFLP markers is not associated with the morphological differences

among populations.

Despite the recent immigration into Ethiopia and small population sizes, Hagenia exhibited

moderate to high gene diversity within populations. Since even little effective pollen per gen­

eration is sufficient to counteract loss o f genetic diversity (Wright 1931, Finkeldey & Hatte-

mer 2007), the effect o f recent colonization and o f the small population sizes is not reflected

in the levels o f gene diversity. Likewise, studies on many rare and endangered animal species

such as the spring-dwelling fish (Gambusia nobilis), przewalski’s horse (Equus przewalskii),

manatee ( Trichechus manatus) and Stephens's kangaroo rat (Dipodomys stephensi) revealed

more or less average levels o f genetic variation due to effective mating (reviewed by Avise

2004).

Conservation priorities

We have estimated the total number o f the extant individual Hagenia trees throughout the

country as not exceeding 7,000 (including the estimation o f scattered trees that were not in­

cluded in the present study), the majority o f which are old and dying without recruiting young

generations. The three plantations included in the present study are small in size amounting to

about 450 individuals in total. There are no records on the existence o f large plantations of

Hagenia in Ethiopia. Given the present open-access to most o f the populations and lack of

natural regeneration, Hagenia will unquestionably face extinction in the following decades.

Bonga is the only viable population that recruited new generation in southwest o f Ethiopia,

but with only 80 mature individuals left at the time of this survey. The largest remaining pop­

ulation (DD) does not have natural regeneration. The fossil pollen stratigraphy from African

countries other than Ethiopia also showed that the fossil pollen accumulation o f Hagenia

95

Paper III: Conversion genetics

abyssinica has declined alarmingly through time (Beuning et al. 1997; Bonnefdle et al. 1995;

Olago et al. 1999), suggesting a dramatic reduction in the size o f the populations and probable

local extinction in some locations (Taye et al. submitted (a)). Surprisingly, despite the evident

severe threat on its survival, Hagenia is not included in the red list o f the International Union

for Conservation o f Nature (IUCN) whereas Juniperus procera, which is in a comparatively

better conservation status than Hagenia in terms o f geographic range, population size and re­

cruitment o f young trees (field observation during the preset survey), was red-listed

(http://www.iucnredlist.org/, accessed on 26 May 2008).

Fig. 3 Phylogenetic tree drawn based on Nei’s (1978) genetic distances computed by UPGMA clustering from AFLPs o f 22 natural populations o f Hagenia abyssinica from Ethiopia. Popu­lation codes follow Table 1. Letters in parenthesis designate geographic regions: A= northern region, B= central region, C= southwestern region, D= southern region.

A number o f organizations foster the conservation o f biodiversity in general and that o f

threatened species in particular at the global level. The major objectives o f the Convention on

Biological Diversity (CBD) are the conservation o f biological diversity, the sustainable use o f

its components, and the fair and equitable sharing o f the benefits arising out o f the utilization

of genetic resources (http://www.cbd.int/convention/. accessed on 2 June 2008). The IUCN's

Red List Criteria are based on available evidence concerning the numbers, trend and distribu­

tion o f a given species based on changes over periods o f time (IUCN, 2001). Such compre­

hensive time-bound information is lacking in Ethiopia. The Convention on International Trade

in Endangered Species (CITES) regulate the complex wildlife trade by controlling species-

96

Paper III: Conversion genetics

specific trade levels on the basis o f biological criteria (http://www.cites.org/. accessed on 3

June 2008). CITES classified species as prohibited (Appendix I), restricted (Appendix II) and

optional (Appendix III) for trade, but Hagenia is not included in any o f them. There is a lose

end, though, in the convention o f CITES, which provides exceptional cases that allow utiliza­

tion of endangered species categorized even under Appendix I. The Endangered Species Act

o f the United States o f America defined a species as endangered if it is at risk o f extinction

throughout all or a significant portion o f its range, and to be threatened if it is likely to be­

come endangered in the foreseeable future (http://www.nmfs.noaa.gov/pr/pdfs/laws/esa.pdf.

accessed on 2 June 2008).

Given the scanty financial resources the country has and the complex nature o f conservation,

it is indispensable to prioritize populations o f Hagenia for conservation. The need to integrate

demographic and genetic criteria in plant conservation has been recognised during the last two

decades (e.g., Lande 1988; Ostermeijer et al. 2003; DeSalle and Amato 2004; Delgado et al.

2008; Hoebee et al. 2008). Delgado et al. (2008) standardized phylogenetic, demographic and

genetic values to obtain conservation indices for populations o f Mexican rare pines. We pro­

pose a “weighted-score population prioritization matrix” (WPPM), a method that integrates

genetic, morphological and demographic criteria to prioritize populations o f a single species

for conservation and domestication purposes. Our method is similar in approach but different

in criteria and scoring from that o f Delgado and co-workers (2008) in several ways. Our me­

thod 1) uses actual values instead of standardized values as our target is a single species, 2)

uses morphological and additional demographic criteria, 3) prioritizes populations for differ­

ent conservation measures and domestication, 4) accords different weights to demographic

and genetic criteria for each o f the measures, 5) uses only one distance measure, i,e., average

genetic distance (computed from N ei’s genetic distances) as suggested by O ’Meally and Col-

gan (2005) instead of branch-node lengths o f a phylogenetic tree, 6) uses information on chlo­

roplast lineages as a complementary criterion. The values from all criteria will be summed up

and the population with the highest value will be accorded the top priority and so forth. It is a

simple and straight-forward tool that can easily be understood and applied by forestry experts

and decision makers to prioritize populations o f a given taxon for in situ conservation, ex situ

conservation, and tree improvement and domestication programs. The genetic criteria em­

ployed are the amount o f genetic diversity (He) and average genetic distance (AGD) from the

AFLP data (Taye et al. submitted (b)) while the demographic criteria included status o f natu­

ral regeneration, DBH-based population structure, present conservation status, total popula­

97

Paper III: Converstion genetics

tion size, and timber quality measured as mean bole height. More details are provided in Sup­

plementary Table 2. The weight attributed to genetic, morphological and demographic criteria

differs according to the aim o f the prioritization (Supplementary Table 2). Presence o f natural

regeneration and other demographic factors are comparatively more important to conservation

in situ than the genetic criteria whereas the reverse applies for conservation ex situ. Similarily,

morphological criteria (particularly timber quality) deserve more weight than the genetic crite­

ria to select superior trees for domestication and tree improvement programs. Accordingly, the

weights o f genetic criteria for in situ conservation, ex situ conservation, and for tree improve­

ment and domestication programs are set in the order o f 40%, 80% and 40%, respectively.

The remaining proportions in each program are accorded to the demographic/morphological

criteria. The information from the chloroplast microsatellite data (Taye et al. submitted (a)) is

considered after the outcome o f the prioritization in order to represent populations in different

chloroplast haplotypes/lineages.

Outcome o f prioritization

The supplementary Table 3 (a-c) summarizes the results o f the prioritization of the extant

populations o f Hagenia for in situ conservation, ex situ conservation, and for tree improve­

ment and domestication purposes. The top two priority populations selected for in situ conser­

vation are Bonga (with the largest natural regeneration and high genetic diversity) and Dinsho

followed by Boterbecho at the third position. Populations Kosso Ber and Zequala equally fol­

lowed in the fourth position. Since only Bonga represented chloroplast lineage I in the top

priority list, population Wonbera from the same lineage, which stood sixth in the rank, should

be given at least the fourth priority for in situ conservation. The top candidate population for

ex situ conservation is Dinsho (with the highest genetic diversity but no natural regeneration)

followed by Kosso Ber, Dindin and Zequala equally at the second position, and Debark at the

third position. Wonbera and Boterbecho shared the fourth rank. This top priority list is domi­

nated by populations from chloroplast lineage II. Therefore, population Wonbera from lineage

I should also be considered for ex situ conservation. The top three candidate populations se­

lected for tree improvement and domestication programs are Kosso Ber, Dinsho and Bore fol­

lowed by Wonbera, Dindin, Zequala and Boter Becho. This priority list should be maintained

because timber quality matters most (at least at present) than the other criteria for tree im­

provement and domestication programs. Regardless o f the differences in the types and/or

weights o f the criteria, the populations Kosso Ber, Zequala, Dinsho and Boterbecho appeared

in the top four ranks o f all the three objectives while populations Wonbera and Dindin are se­

98

Paper III: Converstion genetics

lected for both ex situ conservation, and tree improvement and domestication programs. Spe­

cial consideration should be given to populations that are chosen for multiple objectives. A

multiple population breeding strategy that combines breeding goals and conservation (Nam-

koong 1984) is particularly useful in this regard. Some purposefully weighted criteria played

influential roles to select populations for different objectives. For example, the presence of

natural regeneration influenced the selection o f populations for in situ conservation (Bonga

and Boterbecho) while the amount o f gene diversity was crucial to choose populations for ex

situ conservation (Dinsho). Similarly, the criterion bole height was vital to choose populations

for tree improvement and domestication. The largest remaining population (DD) does not ap­

pear in the top priority lists for in situ and ex situ conservation because it does not have natu­

ral regeneration and has lower genetic diversity than others. Also, it is located in a protected

area. But it appeared in the 6th priority for tree improvement and domestication because it har­

bors good quality timber. The production and recruitment o f young trees is often overlooked

as a key criterion; but it is essential for the success o f gene conservation in situ.

Conclusions and recommendations

Distinctive quantitative traits were observed in Hagenia. The chloroplast microsatellite data

allowed us to identify lineages and to reconstruct population history by analyzing seed disper­

sal while the AFLP data allowed us to identify populations o f higher genetic diversity. The

morphological data enabled us to identify populations o f desirable quantitative traits that can

be used in conservation and domestication o f the species. The sizes o f the extant populations

were reduced to very small patches due to human impact, probably affecting the genetic struc­

ture and increasing the risk o f extinction. The absence o f natural regeneration in most o f the

populations, the small sizes o f all but one (Doddola-Dachosa) populations and the current

high demand and pressure from the people for Hagenia lumber are main reasons to regard the

species as prone to extinction at least in Ethiopia in the following decades. Action is needed to

launch conservation and massive plantation programs o f this remarkably valuable but gravely

endangered tree species. The work presented here might serve as a starting point to select ge­

netic resources and superior individuals o f Hagenia. The priority rank should be considered

taking into account the availability o f resources for conservation, tree improvement and do­

mestication programs. The populations that lack natural regeneration but selected for conser­

vation in situ should be enriched by planting seedlings raised from the same stand. Conserva­

Paper III: Conversion genetics

tion decisions depend on a number o f factors that go beyond scientific information. A major

challenge for the conservation o f the genetic resources o f Hagenia abyssinica will be the well-

defined incorporation o f social, cultural and political criteria into the decision-making

processes. Seed collection for ex situ conservation and tree improvement programs should

consider the information on spatial distribution o f genetic structure (SGS) described in Taye

et al. (submitted (b)) to minimize collection o f seeds from related individuals. In conclusion,

the present work allowed us to establish priorities for the conservation and domestication o f

the African redwood based on genetic, morphological and demographic information. This in­

formation can serve as a benchmark for monitoring its conservation status in the future. In­

vestigation into the possible impediments to natural regeneration including, inter alia, the eco­

logical (moisture, soil, animal browsing) and physiological characteristics (seed quality cha­

racters and viability) o f the relict populations o f Hagenia abyssinica is crucial to ensure the

long-term survival o f the species. Common garden experiments and the establishment of

comprehensive provenance trials may help to reexamine the association between morphologi­

cal and molecular genetic traits by separating the genetic differences from non-genetic envi­

ronmental effects at important adaptive and economic traits. Similar work is recommended in

other African countries where Hagenia is known to grow. International organizations such as

IUCN and CITES should consider Hagenia in their appropriate databases/programs as it is at

high risk o f extinction.

Acknowledgements

This project is a component o f the “Support to the Forest Genetic Resources Conservation

Project” o f the Ethiopian Institute o f Biodiversity Conservation (IBC) supported by the Ger­

man Federal Ministry o f Economic Cooperation and Development (BMZ) through the Ger­

man Technical Cooperation (gtz). The German Academic Exchange Service (DAAD) ex­

ecuted the grant as a PhD project o f the first author. The National Meteorological Service

Agency o f Ethiopia provided climatic data. We thank Oleksandra Dolynska, Thomas Seliger

and Olga Artes for kindly assisting in the laboratory and Daniel Bekele for helping during the

fieldwork.

100

Paper III: Conversion genetics

References

Aalbsek A (1993) Tree seed zones for Ethiopia. National Tree Seed Project, Addis Ababa Amos M, Balmford A (2001) When does conservation genetics matter? Heredity 87: 257-265 Avise JC (2004) Molecular Markers, Natural History and Evolution, 2nd edn. Sinauer Associ­

ates Inc, Sunderland, MA Bawa KS, Krugman SL (1990) Reproductive biology and genetics o f tropical trees in relation

to conservation and management. In: Rain Forest Regeneration and Management (eds Gomez-Pampa A, Whitmore TC, Hadley M), The Parthenon Publishing Group, pp. 119- 136

Beuning KRM, Talbot MR, Kelts K (1997) A revised 30000-year paleoclimatic and paleohy- drologic history o f Lake Albert, East Africa. Palaeogeogr Palaeocl 136: 259-279

Bonnefille R, Riollet G, Buchet G, Icole M, Lafont R, Arnold M, Jolly D (1995) Gla­cial/interglacial record from intertropical Africa, high resolution pollen and carbo data at Rusaka, Burundi. Quaternary Sci Rev 14: 917-936

Delgado P, Eguiarte LE, Molina-Freaner F, Alvarez-Buylla ER, Pinero D (2008) Using phy­logenetic, genetic and demographic evidence for setting conservation priorities for Mex­ican rare pines. Biodivers Conserv 17: 121-137

DeSalle R, Amato G (2004) The expansion o f conservation genetics. Nat Rev Genet 5: 702- 712

Excoffier L, Laval G, Schneider S (2005) Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1: 47- 50

Finkeldey, R., and Hattemer, H.H. 2007. Tropical Forest Genetics. Springer-Verlag, Berlin. Franklin IR (1980) Evolutionary change in small populations. In Soule MA & Wilcox BA

(eds) Conservation biology: an evolutionary-ecological perspective. Sinauer Associates, Sunderland, MA, pp 135-149

Hedeberg O (1989) Rosaceae. In: Inga Hedeberg and Sue Edwards, eds. Flora o f Ethiopia, Vol. 3, Pittosporaceae to Arralaceae. Addis Abeba and Asmara, Ethiopia; Uppsala, Swe­den

Hedrick PW (2001) Conservation genetics: where are we now? Trends Ecol Evol 16: 629-636 Hoebee SE, Thrall PH, Young AG (2008) Integrating population demography, genetics and

self-incompatibility in a viability assessment o f the Wee Jasper Grevillea (Grevillea iaspi- cula McGill., Proteaceae). Conserv Genet 9: 515-529

Husband BC, Barrett SCH (1996) A metapopulation perspective in plant population biology. J Ecol 84: 461-469

IUCN (2001) IUCN Red List Categories and Criteria: Version 3.1. IUCN Species Survival Commission, Gland, Switzerland and Cambridge, UK

Gilpin MA, Soule ME (1986) Minimum viable populations: Processes o f species extinction. In Soule ME (ed) Conservation biology: The Science of scarcity and diversity. Sinauer Associates Inc, Sunderland, MA

Hanski IA, Gilpin MA (eds) (1997) Metapopulation biology: Ecology, genetics and evolution.Academic press, New York

Lande R (1988) Genetics and demography in biological conservation. Science 241: 1455- 1460

Lande R (1995) Mutation and conservation. Conservation biology 9: 782-791Legesse N (1995) Indigenous trees of Ethiopia: Biology, uses and propagation techniques.

SLU, Reprocentralen, Umea Loveless MD and Hamrick JL (1984) Ecological determinants o f genetic structure in plant

populations. Ann Rev Ecol Syst 15: 65-95

101

Paper III: Converstion genetics

Lynch M (1996) A quantitative genetic perspective on conservation issues. In: Avise JC, Ha­mrick JL (eds) Conservation genetics: case histories from nature. Chapman & Hall, USA, pp 471-501

Lynch M, Convey J and Burger R (1995) Mutation accumulation and the extinction o f small populations. Am Nat 146: 489-518

Mantel NA (1967) The detection o f disease clustering and a generalized regression approach.Cancer Res 27: 209-220

Menges ES (1990) Population viability analysis for an endangered plant. Conser Biol 4: 52-64 McCarthy MA, Burgman MA and Ferson S (1995) Sensitivity analysis o f models population

viability. Biol Conserv 73: 93-100 Namkoong G (1984) A control concept o f gene conservation. Silvae Genet 33: 160-163 Nei M (1978) Estimation o f average heterozygosity and genetic distance from a small number

o f individuals. Genetics 89: 583-590 Newton AC, Allnutt TR, Gillies ACM, Lowe AJ and Ennos RA (1999) Molecular phy­

logeography, intraspecific variation and the conservation o f tree species. Trends Ecol Evol 14: 140-145

Olago DO, Street-Perrott FA, Perrott RA, Ivanovich M, Harkness DD (1999) Late quaternary glacial-interglacial cycle o f climatic and environmental change on Mount Kenya. J Afr Earth Sci 29: 593-618

O ’Meally D, Colgan DJ (2005) Genetic ranking for biological conservation using information from multiple species. Biol Conser 122: 395-407

Oostermeijer JGB, Luijten SH, den Nijs JCM (2003) Integrating demographic and genetic approaches in plant conservation. . Biol Conser 113: 389-398

Rohlf FJ (1998). NTSYS-pc: Numerical taxonomy and multivariate analysis system (Version 2.0). State University o f New York, USA

Sneath PHA and Sokal RR (1973) Numerical taxonomy: the principles and practice o f numer­ical classification. WH Freeman and Company, San Fransisco

Umer M, Lamb HF, Bonnefille R, Lezine A-M, Tiercelin J-J, Gibert E, Gazet J-P, Watrin J (2007) Late Pleistocene and Holocene vegetation history o f the Bale Mountains, Ethiopia. Quaternary Sci Rev 26: 2229-2246

Vekemans X, Beauwens T, Lemaire M and Roldan-Ruiz I (2002) Data from amplified frag­ment length polymorphism (AFLP) markers show indication o f size homoplasy and a rela­tionship between degree o f homoplasy and fragment size. Mol Ecol 11: 139-151

Wright S (1931) Evolution in Mendelian populations. Genetics 16: 97-159.

102

Supplementary Table 1. Mean values (with standard deviations) for morphological traits observed within the populations o f Hagenia in Ethiopia.

Populations D (m ) SI TH (m) B H (m ) DBH (cm) LP (cm) NL NS NLBS WT (mm)Debark M ariam 31.0 1 9.6±2.6 2.1±1.4 67.9±31.7 12.4±2.2 14.2±1.2 16.6±4.5 1.4±0.7 1.9±0.6Debark Plantati­ naon na na Na na 7.5±1.6 13.0±1.6 22.5±5.7 1.2 ±0.8 2 .2±0.6Kimir Dengay naPlantation na na Na na 10.8±2.4 12 .8± 1.8 15.7±5.7 0 .6 ±0.8 2 .2±0 .6Woldiya Se’at naMichael na 13.5±2.1 3.5±0.7 114.5±14.8 14.0±2.1 13.8±1.4 18.7±4.6 1.7±0.6 1.8±0.7Kosso Bcr 9.3 na 1 1.0±2.9 6.4±2.3 24.2±9.7 14.7±3.2 14.8±1.7 17.4±5.2 1.1 ±0.9 2.3±0.6Denkoro 21.1 0.7 12.9±2.5 4.1±2.2 82.3±31.3 12.7±2.4 13.9±1.7 16.8±4.9 0.6±0.7 2.0±0.7W onbera 13.2 na 12.3±2.8 4.7±2.4 34.6±15.7 12.3±1.8 14.8±0.9 17.1±4.8 1,4±0.6 1.9±0.5W ofwasha 27.3 na 7.8±2.7 2.7±1.7 54.5±36.2 14.4±2.4 14.5±1.4 21.7±5.5 1.6 ±0.6 2.7±0.7Chilmo 28.0 na 17.0±9.2 5.2±4.0 43.1±25.5 1 1.8±2.5 13.6±2.1 9.6±2.2 1.3±0.9 2.4±1.1Didndin 29.3 na 15.4±5.8 5.9±2.6 64.7±47.2 14.2±2.9 14.9±2.3 20.5±7.3 1.3±0.9 2.2±0.5Zequala Abo 18.7 0.3 13.1±6.4 4.5±3.2 52.7±57.4 9.0±2.3 11.0± 1.8 18.0±6.1 1.0±0.9 2 .0± 0.6Boter-Becho 15.0 1.2 12 .6 ±6.2 5.8±2.8 32.5±25.3 11.9±2.3 14.0±1.4 16.9±6.2 1.2± 0.8 1.9±0.5Chilalo 31.1 1.8 10.4±2.7 3.5±1 .6 54.5±30.0 13.5±2.2 14.9±1.1 17.7±5.8 1,8±0.5 1.8±0.6Sigmo Plantation na na na na na 12 .1± 1.8 14.8±1.6 22.3±5.6 1.3±-0.9 2 .2± 0.6Sigmo 22.7 1 17.0±5.3 5.5±2.8 80.2±33.7 13.3±2.6 13.7±1.8 24.8±7.3 1.5±0.9 2.5±0.8M unesa 18.3 na 11.5±2.9 4.7±2.8 40.5±19.5 14.6±2.4 14.4±1.4 15.2±5.9 1,8±0.5 2.2±0.7Bonga 22.6 0.9 13.4±2.6 5.3±2.2 44.3±13.8 1 1.8± 2.2 14.0±1.8 21.3±6.8 1. 1±0.8 2.4±0.6Kofele 22.5 1.8 14.6±3.7 5.8±3.3 99.2±32.8 10.4±1.7 14.0±1.1 20.4±4.5 1.4±0.8 1.8±0.5Dinsho 22.7 3 16.1 ±2.4 3.3±2.3 85.2±24.7 14.4±2.0 14.2±1.1 19.0±4.3 1.6±0.6 2.4±0.8D odola-Serofta 21.9 2.9 19.5±2.9 6.7±2.4 88.6±38.5 12.4±1.8 14.7±0.8 19.2±4.6 1.7±0.6 3.0±0.6D odola-Dachosa 18.3 na 15.7±4.8 5.0±3.3 84.2±40.3 13.7±2.6 14.4±1.4 16.0±4.8 1.8±0.5 2.5±0.6Rira 19.3 na 15.2±4.7 4.2±2.8 66.5±31.3 13.3±2.4 14.0±1.2 12.9±4.9 1.3±0.7 2.5±0.7Bore 24.5 1.1 17.3±3.4 7.2±2.5 64.4±16.1 13.2± 1.7 14.6±1.1 15.9±5.2 2.1±0.7 1.6± 0.6Uraga 171.3 0.7 14.4±2.0 7.1±2.3 49.7±16.1 13.2±2.2 13.5±1.7 19.4±6.7 l.ldb0.8 1.9±0.5H agereM ariam 28.7 0.9 12.7±3.2 7.0±2.5 54.3±24.6 12 .8± 2.1 15.0±1.3 19.8±6.8 1.9±0.9 1.7±0.6Average 13.8±2.80 5.0±1.44 62.8±23.16 12.6±1.74 14.0±0.86 18.2±3.24 1.4±0.37 2.2±0.34D= distance between trees, SI= sex index (relative number of male to female), TH= total height, BH= Bole height, DBH= diameter at breast height, LP= maxi-

— mum length of petiole, NL= no. of leaflets, NS= No. of stipules, NLBS= No. of pairs of leaflets with stipules at the back of their bases, WT= width of serrated uj edges of leaf tooth.

Paper III: C

onverstion genetics

Paper III: Conversion genetics

Supplementary Table 2. Weighted-score population prioritization matrix (WPPM)

a) for in situ conservationCritera Weight

(out of 10)Score3 Product

(weight x score)

0 1 2 3 4 5

1 G enetic criteria 4

1.1 Within-population gene diversi­ty (He)

3

1.2 Average genetic distance (AGD)

1

2 Demographic criteria 62.1 Status of natural regeneration 32.2 DBH-based population structure 1

2.3 Present conservation status 1

2.4 Population size 1sum

b) for ex situ conservation (seed bank & ex situ conservation stands)Critera Weight

(out of 10)Score3 Product

(weight x score)

0 1 2 3 4

1 Genetic criteria 8

1.1 Within-population gene diversity(He)

5

1.2 Average genetic distance (AGD) 32 Demographic criteria 22.1 Population size 2

sum

c) for tree improvement and domestication programs

CriteraWeight (out o f 10)

Score3 Product (weight x score)

0 1 2 3 4

1 Genetic criteria 4

1.1 Within-population gene diver­sity (He)

3

1.2 Average genetic distance AGD)

1

2 Demographic criteria 6

104

Paper III: Conversion genetics

2.1 Boleform/height 52.2 Population size 1

sumaA box under the appropriate score is crossed based on the evaluation of the population based on the predetermined weights and scores of each criterion.

Description of scoring

1. Amount of genetic diversity (AFLP)

1.1 Within-population gene diversity

Scores1 = Mean population gene diversity values (He) less than the overall mean minus 15% of

the overall mean2 = He greater than or equal to the mean minus 15% of the mean, less than mean minus

5% of the mean3 = He greater than or equal to the mean minus 5%, less than the mean plus 5% of the

mean4 = He greater than or equal to the mean plus 5% of the mean, less than the mean plus

15% of the mean5 = He greater than the mean plus 15% of the mean

1.2 Average genetic distances (AGD)

1 = 0 .010-0 .0192 = 0 .020-0 .0293 = 0 .030-0 .0394 = 0 .040-0 .049

2. Status of natural regeneration (total count around the sample trees)

0 = No regeneration1 = low (1-10) wildings

2 = fair (10-25) wildings3 = good (25-50) wildings4 = high (>50) wildings

3. DBH-based population structure

1= > 6 DBH classes missing2 = 5-6 DBH classes missing3 = 3-4 DBH classes missing

105

Paper III: Converstion genetics

4 = 1-2 DBH class missing5 = complete distribution

4. Present conservation status (refers to the pressure from the surrounding community and the current level of protection)

0= well-protected - not threatened at the moment1 = fair protection - but vulnerable 2= open access -endangered3 = open access - gravely endangered

5. Population size (y)

1= y < 502 = 50 < y >1503 = 150< y > 2504 = 250< y > 3505 = y > 350

6. Bole quality measured as mean bole height (z)

1 = z < 4 m2 = 4< z < 6 m3 = z > 6 m

106

Supplementary Table 3 Summary of the results of the prioritization o f the extant populations of Hagenia for in situ conservation, ex situ conserva­tion, and for tree improvement and production purposes.

a) Prioritization of Hagenia populations for in situ conservation

Criteria DK WD KB DR WB WW CM DN ZQ BB CL SM MS BG KL DO DS DD RR BR UR HMAmount o f He gene diver­

12 9 12 9 12 9 9 12 12 12 6 6 9 9 9 15 3 6 6 9 3 6

sity AGD 2 1 2 1 1 1 1 2 2 1 1 1 1 1 1 4 2 1 3 1 2 1

Status o f natural re­generation

0 0 0 0 0 0 0 0 0 3 0 0 0 12 0 0 0 0 0 0 0 0

DBH-based populati­on structure

1 1 5 1 3 3 4 3 3 4 4 2 5 3 1 1 1 2 3 1 3 4

Present conservation status

1 1 1 1 2 1 1 2 3 1 3 2 1 2 2 0 1 0 1 3 2 3

Population size 1 2 2 2 2 1 2 2 2 2 2 2 2 2 2 4 2 5 3 2 2 2sum 17 14 22 14 20 15 17 21 22 23 16 13 18 29 15 24 9 14 16 16 12 16Rank 8 11 4 I 1 6 10 8 5 4 3 9 12 7 1 10 2 14 11 9 9 13 9

b) Prioritization of Hagenia populations for ex situ conservation

Criteria_________________ DK WD KB DR WB WW CM DN ZQ BB CL SM MS BG KL DO DS DD RR BR UR HMAmount o f ge­ He 20 15 20 15 20 15 15 20 20 20 10 10 15 15 15 25 5 10 10 15 5 10ne diversity

AGD 6 3 6 3 3 3 3 6 6 3 3 3 3 3 3 12 6 3 9 3 6 3

Population size 2 4 4 4 4 2 4 4 4 4 4 4 4 4 4 8 4 10 6 4 4 4sum 28 22 30 22 27 20 22 30 30 27 17 17 22 22 22 45 15 23 25 22 15 17Rank 3 7 2 7 4 8 7 2 2 4 9 9 7 7 7 1 10 6 5 7 10 9

c) Prioritization of Hagenia populations for tree improvement and domestication purposes

Criteria DK WD KB DR WB WW CM DN ZQ BB CL SM MS BG KL DO DS DD RR BR UR HMAmount of Hc 12 9 12 9 12 9 9 12 12 12 6 6 9 9 9 15 3 6 6 9 3 6gene diversity

AGD 2 1 2 1 1 1 1 2 2 1 1 1 1 1 1 4 2 1 3 1 2 1

Bole height 5 5 15 10 10 5 10 10 10 10 5 10 10 10 10 5 15 10 10 15 15 15Population size 1 2 2 2 2 1 2 2 2 2 2 2 2 2 2 4 2 5 3 2 2 2sum 20 17 31 22 25 16 22 26 26 25 14 19 22 22 22 28 22 22 22 27 22 24Rank 7 9 1 6 4 10 6 4 4 4 11 8 6 6 6 2 6 6 6 3 6 5

Population codes follow Table 1; Hc= gene d iv e rsity , AGD = average genetic distance between one population and the rest

Paper III: Converstion

genetics

Paper III: Converstion genetics

9 a « s z t s

109

Supplementary Fig. 1. DBH-based population structure of 21 natural populations of Hagenia abyssinica from Ethiopa. Population codes as in Table 1.

10 Appendices

Appendix l. Description of Tree Seed Zones (TSZ) of Ethiopia in which H. abyssinica is

growing

TSZ no. Name of Tree Seed Zones_______________________________________________15.3 Welo Dry Juniperus Forest (Welo in Amhara and South extreme of Tigray)17 Southeastern High Altitude Juniperus Forest (Chilalo, Kaka & Batu mountains

- Western Arsi and North western Sidamo)18 Upper Wabe Juniperus Forest (Southwestern extreme of Arsi and Northwes­

tern extreme of Sidamo)19 Western Highlands Moist Juniperus Forest (Northeastern Gonder, Including

Wegera Mts.)20.1 Gojam Undifferentiated Afromontane Forest (Gojam and southeastern Gonder)20.2 Northeastern Drier Undifferentiated Afromontane Forest (northeastern Shewa

& southwestern Wello)20.3 Southeastern Shewa Undifferentiated Afromontane Forest (Highlands east and

south of Addis Abeba and Gurage Mt.)20.4 Western Humid Undifferentiated Afromontane Forest (western Welega and

western Shewa)21.1 Arsi Western Escarpment Undifferentiated Afromontane Forest (western Arsi)21.2 Gelemso Central Undifferentiated Afromontane Forest (western Arsi & north

central Hararghe)23.2 Central Wet Broad-leaved Afromontane Rainforest (northwestern Illubabor,

eastern Illubabor & central northeastern Kaffa)23.3 Eastern Higher Broad-leaved Afromontane Rainforest (northeastern half of

Gamo Gofa, southwestern extreme of Shewa & southeastern Keffa)24.1 Southeastern Upper Wet Broad-leaved Afromontane Rainforest (southern

slopes of Batu mountains in areas above 2000 masl, north of Hagere Mariam)24.2 Southeastern Lower Broad-leaved Afromontane Rainforest (southern slopes of_________ Batu mountain in areas below 2000 masl, south of Hagere Mariam)___________Source: Aalbaek 1993

Appendices

Appendix 2. Ranges o f absolute morphological and some ecological values observed among populations of Hagenia in Ethiopia.

Variables Minimumrecord

Maximumrecord

Variables Min.record

Max.record

altitude 2221 3193 width of serrated tooth (mm) 1 8sex ratio 1:0.3 1:30 no. of pairs o f leaflets having 0 4(M:F) stipules at the back of their

basestree height 3.0 35 no. of stipules between two 0 10(m) pairs of leafletsbole height 0.0 20 diameter at breast height (cm) 2.5* 242(m)length of 5.5 20.5 distance between trees (m) 0.1 730petiole (cm)no. o f leaf­ 7 19 distance between populations 20.6 806.4lets (km)

no. o f stipu­ 2 41les* Plants having diameter at breast height (DBH) values less than 2.5 cm are recorded as either saplings or seedlings

112

Appendix 3. Pairwise matrix showing geographic distances between 22 natural populations of Hagenia abyssinica from Ethiopia (see Table 1 of papers I & II for population codes)

KB 0BG 415.70HM 585.8 263.0 0BR 555.8 280.2 62.6 0BB 292.8 157.4 301.9 281.0 0UR 567.4 273.1 41.0 20.60 286.2 0CL 424.7 317.5 250.4 190.3 208.3 209.8 0CM 259.9 276.6 356.0 314.3 122.2 330.5 170.5 0DR 214.1 475.1 555.6 505.2 317.7 520.8 325.8 207.9 0KL 480.1 277.6 160.1 103.0 222.7 124.7 87.4 224.5 705.5 0DN 461.0 450.8 367.9 308.6 327.8 327.8 136.3 239.5 298.5 215.6 0DO 543.0 378.7 208.3 153.1 314.0 173.8 116.2 286.5 430.1 101.2 175.2 0DD 528.4 321.4 153.9 92.7 276.0 110.9 116.0 273.1 442.7 51.9 220.8 65.9 0DS 516.5 301.5 137.2 78.1 257.1 98.3 116.7 263.0 439.8 39.1 230.0 84.6 22.3 0WB 141.2 369.6 595.9 575.7 295.4 584.4 476.6 314.2 340.6 511.9 544.1 591.5 564.9 549.1 0DK 264.5 671.2 806.4 763.5 530.5 777.8 593.5 451.5 267.7 664.7 562.5 700.2 708.6 704.7 376.5 0MS 455.1 277.7 191.0 131.5 210.0 151.1 61.4 200.5 378.1 28.50 197.4 107.7 73.8 65.6 492.9 641.8 0RR 567.1 376.0 185.2 126.6 326.9 143.6 145.0 311.1 466.8 101.8 210.6 37.5 57.2 77.3 611.5 730.0 121.9 0WD 294.3 609.3 679.6 627.0 452.2 643.6 439.4 388.2 131.7 524.2 375.3 533.2 556.0 555.0 428.7 215.0 500.0 570.0 0SM 371.1 69.3 331.6 338.9 155.4 337.3 352.8 276.2 456.6 327.2 476.3 427.0 371.8 353.4 311.4 632.0 324.8 427.8 589.1 0WW 348.4 463.7 464.2 407.2 312.9 424.4 213.7 191.2 160.6 303.9 141.7 296.7 326.1 329.5 451.3 420.3 276.0 336.3 239.7 470.0 0ZQ 350.4 304.9 301.5 247.8 175.2 266.4 78.3 98.8 257.1 148.4 151.4 189.4 187.8 182.4 409.7 521.1 120.0 212.0 377.6 323.3 167.3 0

KB BG HM BR BB UR CL CM DR KL DN DO DD DS WB DK MS RR WD SM WW ZQ

J

Appendices

TAYE BEKELE AYELEtayele@ibc-et.org

Curriculum Vitae

Date o f birth:Sex:Nationality: Marital status:

23 July 1965MaleEthiopianMarried, two daughters

Education

2005 - 2008 PhD study, Department of Forest Genetics and Forest Tree Breed­ing, Georg-August University Goettingen, Germany Master of Science, Farm Forestry, Swedish University of Agricul­tural Sciences (SLU), Uppsala & Wondo Genet. Ethiopia Bachelor of Science, Forestry Management, Swedish University of Agricultural Sciences (SLU), Uppsala & Wondo Genet, Ethiopia Diploma, Wondo Genet Forestry Resources Institute, Ethiopia,

1994-1996

1988-1990

1983-1985

Professional experience

06, 2000 - 01, 2005 Head, Department o f Forest and Aquatic Plants, Ethiopian Institute o f Biodiversity Conservation (IBC) and Counterpart to Forest Ge­netic Resources Conservation Project

• Chief Editor, Biodiversity Newsletter (2000-2004)• Forestry Team Leader, National Biodiversity Strategy and Action Plan (BSAP)

0 2 ,1 9 9 9 -0 6 ,2 0 0 0 Forestry Expert, GTZ- Forest Genetic Resources ConservationProject, Ethiopia

07 1996 - 02, 1999 Programming Senior Expert/Assistant Farm Forestry Program Co­ordinator, Ethiopian Orthodox Church Development and Inter- Church Aid Commission (EOC-DICAC), Ethiopia

06, 1990 -08, 1994 Junior Research Officer, Bako Agricultural Research Centre, Insti­tute of Agricultural Research, Ethiopia

07, 198 5 -0 8 , 1988 Technical Assistant, Forestry Research Centre (based in Jimma),Ministry o f Agriculture, Ethiopia

Publications

Tave BA. Gailing O, Mohammed U, Finkeldey R. Colonization history and phylogeo­graphy of Hagenia abyssinica (Bruce) J.F. Gmel in Ethiopia inferred from chloroplast microsatellite markers. Submitted

Tave BA. Gailing O, Finkeldey R. Spatial distribution o f genetic diversity in Hagenia abyssinica from Ethiopia assessed by AFLP molecular markers. Submitted

116

Taye BA. Gailing O, Finkeldey R. Conservation genetics of African redwood (Hagenia abyssinica) (Bruce) J.F. Gmel: a remarkable but gravely endangered tropical tree spe­cies. Submitted

Getachew Berhan and Taye Bekele (2006) Population structure and spatial distribution of four woody medicinal plant species in Bonga forest, Ethiopia. Ethiop. J. Nat. Sci. 8: 19-38

Kumlachew Yeshitela and Taye Bekele (2003) The Woody Species Composition and Structure of Masha-Anderacha Forest, Southwestern Ethiopia. Ethiop. J. Biol. Sci. 2(1): 31-48

Taye Bekele. Getachew Berhan, Matheos Ersado and Elias Taye (2003) Regeneration Status o f Moist Montane Forests o f Ethiopia: Part II: Godere, Sigmo, Setema and Ti- ro-Boterbecho Forests. Walia 23: 19-32

Taye Bekele (2003) The benefits of Forest Certification to Ethiopia. In Proceedings of the National Stakeholders Workshop on Forest Certification. 25 - 26 August 2003, Addis Abeba, Ethiopia

Taye Bekele (2003) The Potential of Bonga Forest for Certification. In Proceedings of the National Stakeholders Workshop on Forest Certification. 25 - 26 August 2003, Addis Abeba, Ethiopia

Simon Shibru, Taye Bekele and Girma Balcha (2003) Preliminary Survey of the Effect of Drought on the Forest Resources. Biodiversity Newsletter, Vol. 2, No. 1

Taye Bekele. Getachew Berhan, Elias Taye, Matheos Ersado and Kumlachew Yeshitela (2001) Regeneration Status of Moist Montane Forests of Ethiopia: Consideration for Conservation (Part I). Walia 22: 45-62

Franzel S, Ndufa, JK, Obonyo OC, Taye Bekele and Coe R (2002) Farmer-designed agroforestry trials: farm ers' experiences in Western Kenya. In Franzel S and Scherr SJ (eds). Trees on the Farm: Assessing the Adoption Potential o f Agroforestry Prac­tices in Africa. CABI Publishing, New York

Taye Bekele. Kumlachew Yeshitela, Getachew Berhan and Sisay Zerfu (2002) Forest Biodiversity Conservation: Perspectives of the Ethiopian Orthodox Church. In Ishii K, Masumori M & Suzuki K Proceedings of BIO-REFOR Tokyo Workshop. 7-11 October 2001, Tokyo

Taye Bekele (2002) Indigenous Knowledge of Medicinal Plants: Perspectives of the Ethiopian Orthodox Church. In Mersha Alehegne, Taye Bekele & Netsanet Tesfaye (eds.). Proceedings of the Workshop on the Ethiopian Church: Yesterday, Today and Tomorrow. 18-19 April 2002, Addis Abeba, Ethiopia

Edwards S, Abebe Demissie, Taye Bekele & Haase G (eds.) (1999) Forest genetic re­sources conservation: principles, strategies and actions: proceedings of the national forest genetic resources conservation strategy development workshop, June 21-22, 1999, Addis Abeba, Ethiopia

Taye Bekele. Haase G & Teshome Soromessa (1999). Forest genetic resources of Ethi­opia: status and proposed actions. In Edwards, et al., Forest genetic resources conser­vation: principles, strategies and actions: proceedings of the national forest genetic re­sources conservation strategy development workshop, June 21-22, 1999, Addis Ab­eba, Ethiopia

Taye Bekele. 1993. Direct sowing Pigeon pea: A successful low cost establishment tech­nique. IAR Newsletter. Vol. 8 No. 4

117

_____________________

The m onotypic tropical tree species Hagenio abyssinica (Rosaceaej is an anemogamous and

anemochorous broad-leaved dioecious tree species native to Africa. Fossil pollen evidences sug­

gest that it immigrated in to Ethiopia from the south during the late Pleistocene. The chloroplast

haplotypes identified in Hagenia are grouped into two lineages and demonstrated a strong pat­

tern of congruence between their geographical d istribution and genealogical relationships. Re­

stricted gene flow through seeds, contiguous range expansion, mutation and rare long-distance

dispersal shaped the genetic structure in the chloroplast genome of Hagenia.

Populations showed moderate to high gene diversities and moderate but significant genetic d if­

ferentiation at AFLP markers, reflecting high levels of post-colonization gene flow. Despite the

dispersal of seed and pollen by wind, a significant fine-scale spatial genetic structure (SGS) was

observed in some populations. A weighted-score population prioritization matrix(WS-PPM) that

combines genetic, morphological and demographic criteria was developed and used for the first

time to prioritize populations for conservation and domestication. Conservation and massive

plantation programs should be launched to ensure the survival of the gravely endangered Kosso

and to boost its economic and ecological values.

ISBN 13:978-3-941274-07-5

9" 783941 11 274075 02850