WORK PERFORMED AT - Universidade Nova de Lisboa Tania Serra.pdfstrong negative effect on rice production. High salinity severely affects rice growth and reduces grain yield, as it

WORK PERFORMED AT:

GENOMICS OF PLANT STRESS LABORATORY

Instituto de Tecnologia Química e Biológica

Universidade Nova de Lisboa

Av. da República

2780-157 Oeiras

Portugal

SUPERVISORS:

Dr. Nelson José Madeira Saibo

Auxiliary Investigator at GPlantS laboratory (ITQB-UNL)

Prof. M. Margarida Oliveira

Head of GPlantS laboratory (ITQB-UNL)

Associated Professor with Aggregation at UNL

Aos meus pais,

por me amarem e ajudarem

incondicionalmente.

Science and art have that in common that

everyday things seem to them new and attractive.

Friedrich Nietzsche

(15th October 1844 - 25th August 1900)

vii

ACKNOWLEDGMENTS

To Nelson Saibo for being my PhD supervisor, for the help and

guidance during all this years, for all the brilliant ideas you gave

me and for always “pushing” me to give my best in everything I

do. Above all, thank you for allowing me to enter in the science

world and to believe in me and in my work.

To Prof. Margarida Oliveira for helping me to be a “scientist”

(almost). Thank you for accepting me in your lab when I was just

another student and for helping me grow up not only

“scientifically” but also personally. Moreover, thank you for always

find time to guide my work and to give me new ideas for all the

problems I encounter.

To Ana Paula Santos for the help with the microscope “world”,

especially with the confocal “monster”. Thank you for all the

advices and for always be available to help.

To Lisete Fernandes from IGC for all the help with the “EMSA saga”.

If it weren’t for your wonderful advices, for sure it would be even

more difficult to finish that part of the work.

To Laszlo Bogre from Royal Holloway (University of London) for

accepting me in his lab and teaching new techniques that helped

me finish my PhD.

To Tiago Lourenço for all the fruitful talks during my PhD and for the

several ideas that you gave me to overcome the million problems

I had during these years. Also thank you for noticing when

something was wrong and helping me to find a way out.

To Duarte Figueiredo for the “peace” you gave me during these

years and for helping me to unstress when everything seemed to

fall apart. Also, thank you for giving me the positive side of the

“bad” results and for giving me strength to carry on.

viii

To Pedro Barros for the companionship and the nice insights you

gave me. Thank you for always be willing to help. Also, I am really

thankful that you have worked with almond all this years, because

when we talked about our work problems, I always realized that

rice is a fairly easy plant to work with and all my problems may not

be that complicated.

To André Cordeiro for joining the lab when you did and for always be

ready to help whenever needed. If it weren’t for your help I would

probably had to work 24h a day to finish this thesis, so thank you

for working so hard and for doing all the work the best way

possible.

To Isabel Abreu for always be available to talk about everything and

for helping me realize that my work is actually not that bad. Thank

you for making difficult questions that “force” me to think outside

the box.

To Safina Khan for all the help during my staying in Royal Holloway,

not only for guiding me in the lab but also for making me feel

welcome and for the nice company and friendship. I’m saving a

nice bottle of wine for us to celebrate.

To Mafalda Rodrigues for helping me in a million things. From

proteins to plants, you always have some great idea. Also, thank

you for the companionship during the several long nights that we

spent in the lab.

To Sónia Negrão for all the “pet-talks” that truly helped me gain more

confident in my work. Also for helping me to have a more positive

thinking and to keep in mind that one day all the hard work will be

worth it.

To Diego Almeida for always having a nice topic to talk about that is

not related to work. Thank you for helping me “disconnect” from

work and for the nice ideas about travelling.

ix

To Helena Sapeta for the nice talks while we see if it rains outside

and for always be interested about how everything is going.

To all the members of the GPlantS lab, Cecília, Nuno, Alicja,

Paulinha, Liliana, “Joões”, Margarida and Filipa for making the lab

a really nice place to work at.

To Regina Menezes, Catarina Pimentel and Catarina Amaral for

always giving me good advices and for always being willing to

help.

To Ana Barbas for the useful advices during the first steps of the

“EMSA saga”. Thank you for the strength you gave me, it really

helped me carry on.

To Claudia Santos for introducing me to the difficulties of the

ubiquitin world.

To Forest Biotech group for always having everything that we miss in

the lab. Also thank you for the helpful advices and the nice

companionship during these years.

To Zé and Sandra for the help with the “EMSA saga”. Thank you for

introducing me to the “giraffe” and the nice things we can do with

it.

To Miguel Costa for teaching me about plant physiology and one of

the techniques that always intrigued me.

To Marta Alves for always asking how is everything going and for

caring about me and my work. Thank you for making me feel that

“yes, I can”.

To Inês and Mara for helping me let go work and realize that life

cannot be only dependent on work. Also thank you for the late

afternoons with the nice beer, good snacks and wonderful

company.

À minha Priminha, por teres sempre as palavras certas, no momento

certo para me arrancares dos “buracos” que vão aparecendo.

x

Obrigado por me fazeres sentir especial e por estares sempre

comigo nas coisas boas e menos boas. Obrigado por seres como

és.

Aos meus irmãos, pela força e apoio que me têm dado ao longo

destes anos. Obrigado por me contarem muitas “Estoínhas” em

pequenina que de certeza me inspiraram! Ao meu maninho e

padrinho, por estares sempre ao nosso lado, por fazeres tudo

para nos ajudar a alcançar os nosso sonhos e por puxares por

mim para alargar os meus horizontes e querer ser sempre

melhor. Se não fosse a tua ajuda ao longo destes anos, teria sido

muito mais difícil de atingir este patamar. À minha maninha Lena

por estares sempre pronta a ajudar, por te preocupares comigo e

por me fazeres sentir que posso contar contigo para tudo. À

minha maninha Célia pela boa disposição e por me fazeres rir

naqueles tempos difíceis. Obrigado por seres um exemplo para

mim de como é possível ser independente, chegar longe e ser

feliz.

Aos meus pais, por me acompanharem e ajudarem durante toda a

vida. Obrigado por acreditarem em mim e me darem força para

ser sempre melhor e para tentar ir sempre mais longe. Obrigado

por tirarem as pedras do caminho, mesmo antes de aparecerem.

Amo-vos muito.

Ao André, por tanta coisa... Por estares sempre ao meu lado, por me

dares animo para continuar, por compreenderes que por vezes

seja workaholic, por estares comigo nos mellhores momentos,

por me apoiares naqueles dias mais dificeis, enfim, por me

fazeres feliz. ILY

xi

The author of this thesis, Tânia Sofia Lobato Paulo Serra, hereby

declares to have had active participation in the following research

papers:

Ana Paula Santos, Tânia S. Serra, Duarte Figueiredo, Pedro Barros,

Tiago Lourenço, Subhash Chander, M. Margarida Oliveira and

Nelson J. M. Saibo. (2011) Transcription regulation of abiotic stress

responses in rice: a combined action of transcription factors and

epigenetic mechanisms. OMICS A Journal of Integrative Biology, 15

(12):839-57

Tânia S. Serra performed part of the review work and manuscript writing.

This manuscript includes part of the work described in Chapter I.

Duarte Figueiredo, Pedro Barros, André Cordeiro, Tânia S. Serra,

Tiago Lourenço, M. Margarida Oliveira and Nelson J. M. Saibo.

(2012) Seven Zinc Finger transcription factors are novel regulators of

the rice gene OsDREB1B. Journal Experimental Botany, Published

Online (doi: 10.1093/jxb/ers035)

Tânia Serra participated in the experimental work and manuscript writing.

Tânia S. Serra, Duarte Figueiredo, André Cordeiro, Tiago Lourenço,

Isabel A. Abreu, Alvaro Sebastián, Lisete Fernandes, Bruno

Contreras-Moreira, M. Margarida Oliveira and Nelson J. M. Saibo.

OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may

regulate its gene expression under salt stress. (In preparation).

Tânia S. Serra participated in the experimental design, the laboratory work

and manuscript writing. This manuscript includes the work described in

Chapter II and III.

xii

Tânia S. Serra, André Cordeiro, Laszlo Bögre, M. Margarida Oliveira

and Nelson J. M. Saibo. OsEREBP1 encodes an AP2/ERF

transcription factor involved in high salinity, drought and ABA

responses. (In preparation)



Chapter IV.

Tânia S. Serra, M. Margarida Oliveira and Nelson J. M. Saibo.

OsEREBP2 is a multifunctional AP2/ERF transcription factor

mediating abiotic stress and hormone signaling pathways. (In

preparation)



Chapter V.

xiii

LIST OF ABBREVIATIONS

3-AT 3-amino-1,2,4-triazole

aa amino acid

ABA Abscisic Acid

AP2/ERF APETALA2/Ethylene Response Factor

ATP Adenosine Triphosphate

bp base pair

BLAST Basic Local Alignment Search Tool

CAMV35S Cauliflower Mosaic Virus 35S promoter

cDNA complementary DNA

ºC degree Celsius

dNTPs Deoxynucleotide Triphosphates

DNA Deoxyribonucleic Acid

dS DeciSiemens

DUF26 Domain of Unknown Function 26

EC Saturated Paste Extract

EDTA Ethylene Diamine Tetraacetic Acid

ERE Ethylene-Responsive Element

FAO Food Agriculture Organization

g relative centrifugal force

GFP Green Fuorescence Protein

GST Glutathione S-Transferase

GUS β-Glucuronidase

HA Hemagglutinin

h hour

kDa kiloDalton

kg kilogram

LUC Luciferase

Mb Mega base pair

xiv

MAPK Mitogen-Activated Kinase

µCi microCurie

µg microgram

µL microlitre

µm micrometer

µM micromolar

mL millilitre

mM millimolar

m35S minimal 35S promoter

min minute

M Molar

m meter

nm nanometer

Os Oryza sativa

PCR Polymerase Chain Reaction

PEG Polyethylene Glycol

RT-PCR Reverse Transcription – PCR

RLK Receptor Like-Kinase

RNA Ribonucleic Acid

RAM Root Apical Meristem

PTMs Post-Translational Modifications

s second

SAM Shoot Apical Meristem

SDS-PAGE Sodium Dodecyl Sulfate – Polyacrylamide

Gel Electrophoresis

SD Standard Deviation

TF Transcription Factor

T-DNA Transfer-DNA

wt wild-type

Y1H Yeast One-Hybrid

xv

SUMMARY

Rice (Oryza sativa L.) is cultivated worldwide and is the staple

food for more than one-half of the world population. Abiotic stress

conditions, such as high salinity, drought and low temperature have a

strong negative effect on rice production. High salinity severely

affects rice growth and reduces grain yield, as it induces late

flowering and lowers pollen viability. To cope with saline

environments, plants rely on the perception and transduction of

stress signals through specific response pathways, which activate

several adaptation mechanisms. Salt stress adaptation involves Na+

intracellular compartmentalization, synthesis of osmoprotectants and

restriction of Na+ accumulation in the shoots. Transcription factors

(TFs) play an important role in the modulation of stress responses. A

single TF regulates the expression of several stress-responsive

genes, allowing a fast and efficient response to stress conditions.

Therefore, a study of the transcriptional network regulating plant

stress responses may not only elucidate the mechanisms involved in

plant adaptation to stress, but also allow the identification of

candidate genes for the generation of stress tolerant crops.

The main goal of our study was to identify and characterize TFs in

rice involved in the stress-induced responses to high salinity. Initially,

we selected five genes reported in the literature as responsive to salt

stress and analyzed in detail their gene expression in rice seedlings

subjected to salt stress. Among the genes analyzed, we have

selected Oryza sativa Root Meander Curling (OsRMC), which

showed a high responsiveness to salt stress and is putatively

involved in the recognition of abiotic stress signals. Using the yeast

one-hybrid system to screen a salt-induced rice cDNA expression

library, two TFs were found to bind to the OsRMC promoter. These

xvi

TFs, OsEREBP1 and OsEREBP2, belong to the ERF subfamily and

were shown to interact with a GCC-like motif in the OsRMC gene

promoter. In addition, trans-activation assays showed that both TFs

negatively regulate OsRMC gene expression.

When we analyzed OsEREBP1 and OsEREBP2 gene expression

in rice seedlings that were subjected to high salinity, drought, ABA

and low temperature treatments, we observed that OsEREBP1

transcript level was not significantly affected by most stresses

applied. Therefore, we propose that under the conditions tested, this

TF is mainly regulated by post-translational modifications (PTMs). In

addition, under salt stress conditions, we observed an increased

OsEREBP1 protein level associated with higher protein stability,

which is in agreement with our hypothesis. The OsEREBP2

transcript level was differentially expressed in response to all the

treatments applied, suggesting that this TF is a multifunctional

protein with a role in several abiotic stress responses. Sub-cellular

localization studies in onion epidermal cells revealed that

OsEREBP1 is located exclusively in the nucleus, whereas

OsEREBP2 is dispersed throughout the cell.

OsEREBP1 and OsEREBP2 function in abiotic stress responses

were further analyzed in transgenic Arabidopsis plants over-

expressing the rice TFs. OsEREBP1-OX seeds displayed enhanced

sensitivity to high salinity during germination, but the root phenotype

and survival rate was affected similarly to wild-type by this treatment.

These data further supports the hypothesis that, under salt stress,

OsEREBP1 is mainly regulated by PTMs. This TF seems to be also

involved in ABA (Abscisic Acid) responses. OsEREBP1-OX seed

germination was more affected by ABA than wild-type and the roots

of transgenic plants were more sensitive to ABA inhibition. The

increased tolerance of the transgenic roots to PEG-induced water

xvii

deficit conditions indicated that OsEREBP1 plays also a role in

drought stress responses. On the other hand, OsEREBP2-OX plants

displayed a phenotype resembling abnormal responses to auxins

and/or cytokinins. The expression of auxin- and cytokinin-responsive

genes was altered in the transgenic plants, as well as the expression

of genes involved in the maintenance and function of the shoot

apical meristem (SAM). Therefore, we suggest that OsEREBP2

plays a role in developmental processes.

Complementation studies with Arabidopsis mutants for orthologs

of OsEREBP1 and OsEREBP2, rap2.2 and abr1, respectively,

revealed that OsEREBP1 and RAP2.2 may have different functions

in high salinity and drought stress responses. When rap2.2 seedlings

over-expressing OsEREBP1 were subjected to these stress

treatments, no root phenotype complementation was observed. In

contrast, OsEREBP2 heterologous expression rescued the abr1

germination phenotype under high salinity and ABA treatments,

suggesting that OsEREBP2 may have a similar function to ABR1.

This work allowed the identification of two novel transcription

factors with a role in rice abiotic stress responses. Their functional

characterization contributed to a better understanding of the

transcriptional networks activated in response to high salinity. In

addition, it provided new insights regarding TF involvement in the

integration of external signals in plant developmental programs.

xviii

xix

SUMÁRIO

O arroz (Oryza sativa L.) é cultivado em todo o mundo, sendo a

base da alimentação para mais de metade da população mundial. O

stress abiótico, como por exemplo a elevada salinidade, secura e

baixa temperatura exercem efeitos negativos na produção de arroz.

A elevada salinidade afeta severamente o crescimento do arroz e

reduz a produção de grão, pois provoca atrasos na floração

reduzindo ainda a viabilidade do pólen. A sobrevivência em solos

com elevada salinidade depende da perceção e transdução dos

sinais de stress, os quais, através das vias de sinalização

específicas, ativam vários mecanismos de adaptação. Estes

mecanismos incluem a compartimentação intracelular de Na+,

síntese de osmoprotectores e diminuição da acumulação de Na+ na

parte aérea da planta. Os fatores de transcrição (FTs)

desempenham um papel importante na modulação da resposta ao

stress, pois um único FT tem a capacidade de regular a expressão

de vários genes de resposta ao stress, permitindo uma resposta

rápida e eficiente. Assim, o estudo da regulação transcricional

envolvida na resposta ao stress, não só elucida os mecanismos de

adaptação das plantas ao stress, como pode também permitir a

identificação de genes candidatos para a produção de plantas mais

tolerantes.

O principal objetivo deste estudo foi identificar e caracterizar FTs

envolvidos na resposta do arroz ao stress provocado por elevada

salinidade. Inicialmente, foram selecionados cinco genes descritos

na literatura como sendo regulados pelo stress salino e a sua

expressão foi analisada em plantas sujeitas a tratamentos de

elevada salinidade. Entre os genes analisados, selecionámos o

Oryza sativa Root Meander Curling (OsRMC) para análise em maior

xx

detalhe, por apresentar uma elevada resposta ao stress salino e por

poder estar envolvido na perceção dos sinais de stress. Utilizando o

sistema de yeast one-hybrid, para fazer o rastreio de uma biblioteca

de expressão de cDNA enriquecida em genes de resposta ao stress

salino, foi-nos possível identificar dois FTs que se ligam ao promotor

do gene OsRMC. Provámos que estes dois FTs, OsEREBP1 e

OsEREBP2, pertencentes à subfamília ERF, se ligam

especificamente a um motivo GCC-like identificado no promotor do

gene OsRMC. Por outro lado, através de ensaios de transactivação

verificámos que os FTs regulam negativamente a expressão do

gene OsRMC.

A análise da expressão dos genes OsEREBP1 e OsEREBP2, em

plantas de arroz submetidas a tratamentos de elevada salinidade,

secura, ABA e baixa temperatura, revelou que o nível do transcrito

OsEREBP1 não é significativamente afetado pela maioria dos

tratamentos aplicadas. Assim, propomos que, sob as condições

analisadas, este FT deverá ser regulado principalmente por

modificações pós-traducionais (MPTs). De acordo com esta

hipótese, observámos que em condições de stress por elevada

salinidade ocorre uma maior acumulação da proteína OsEREBP1

devido ao aumento da sua estabilidade. Quanto ao gene

OsEREBP2, este revelou-se diferencialmente expresso em resposta

a todos os tratamentos realizados, o que sugere que a proteína

OsEREBP2 é multifuncional, estando envolvida na resposta a

diversas condições de stress abiótico. Através de estudos de

localização sub-celular, demonstrou-se que, em condições controlo,

a proteína OsEREBP1 está localizada exclusivamente no núcleo,

enquanto a proteína OsEREBP2 se encontra dispersa na célula.

A função do OsEREBP1 e do OsEREBP2 na resposta ao stress

abiótico foi também analisada em plantas de Arabidopsis a sobre-

xxi

expressar estes FTs de arroz (OsEREBP1-OX e OsEREBP2-

OX). As sementes das plantas OsEREBP1-OX apresentaram maior

sensibilidade ao tratamento com elevada salinidade durante a

germinação, mas o fenótipo da raiz e a taxa de sobrevivência ao

stress salino foi semelhante ao observado em plantas

selvagens. Estes resultados reforçam a hipótese de que o FT

OsEREBP1 é regulado maioritariamente por MPTs em resposta a

este stress. Foi também demonstrado que este FT pode estar

envolvido na resposta ao ácido abscísico (ABA) . A germinação das

sementes OsEREBP1-OX foi mais afetada pelo tratamento com ABA

do que as sementes selvagens. Além disso, na presença de ABA,

as plantas transgénicas OsEREBP1-OX apresentaram uma maior

inibição do crescimento da raiz comparativamente às plantas

selvagens. O aumento da tolerância das raízes observado quando

as plantas transgénicas foram submetidas a condições de défice

hídrico induzido por PEG, sugere que o OsEREBP1 pode também

estar envolvido na resposta à seca. As plantas OsEREBP2-OX

apresentaram um fenótipo que sugere a existência de uma resposta

anormal a auxinas e/ou citocininas. Verificámos que a expressão de

genes de resposta a auxinas e citocininas, bem como a expressão

de genes envolvidos na manutenção e função do meristema apical,

está afetada nas plantas transgénicas. Assim, propomos que o

OsEREBP2 esteja envolvido nos mecanismos reguladores do

desenvolvimento da planta.

Efetuámos também estudos de complementação nos mutantes

de Arabidopsis, rap2.2 e abr1, os quais correspondem aos ortólogos

de OsEREBP1 e OsEREBP2, respetivamente. Estes estudos

revelaram que OsEREBP1 e RAP2.2. têm funções diferentes na

resposta aos stresses por elevada salinidade e secura. Quando as

plantas rap2.2 a sobre-expressar o FT OsEREBP1 foram

xxii

submetidas a estes stresses, não se observou a reversão do

fenótipo da raiz observado no mutante rap2.2. Por outro lado, a

expressão heteróloga do OsEREBP2 permitiu a reversão do fenótipo

de germinação do mutante abr1, em condições de elevada

salinidade e em tratamentos com ABA, indicando que os FTs

OsEREBP2 e ABR1 têm funções semelhantes.

Este trabalho permitiu identificar e caracterizar dois novos fatores

de transcrição envolvidos na resposta do arroz a condições de

stress abiótico. A caracterização funcional destes FTs contribuiu

para uma melhor compreensão das vias transcricionais ativadas em

resposta ao stress por elevada salinidade. Além disso, este estudo

contribuiu para um maior conhecimento relativamente ao

envolvimento destes FTs na integração de sinais internos e externos

nos programas de desenvolvimento da planta.

xxiii

TABLE OF CONTENTS

Acknowledgments........................................................................ vii

List of Abbreviations ................................................................... xiii

Summary ....................................................................................... xv

Sumário ........................................................................................ xix

Chapter I ......................................................................................... 1

General Introduction and Research Objectives

Chapter II ...................................................................................... 53

OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and

may regulate its gene expression under salt

Chapter III ..................................................................................... 85

Characterization of the OsEREBP1 and OsEREBP2 interaction

with the OsRMC promoter

Chapter IV ................................................................................... 115

OsEREBP1 encodes an AP2/ERF transcription factor involved

in high salinity, drought and ABA responses

Chapter V .................................................................................... 151

OsEREBP2 is a multifunctional AP2/ERF transcription factor

mediating abiotic stress and hormone signaling pathways

Chapter VI ................................................................................... 191

Final Discussion and Future Perspectives

xxiv

Chapter I

1


Chapter I


2

TABLE OF CONTENTS – CHAPTER I

Rice as a crop model plant ............................................................. 3

High salinity effects on plant growth and development ................... 5

High salinity effects on rice growth and development ................... 7

Perception and transduction of stress signals ................................ 8

Perception ...................................................................................10

Second messengers ....................................................................13

MAPKs ........................................................................................15

Transcription factors involved in abiotic stress responses .............19

MYB family ..................................................................................20

NAC family ..................................................................................22

bZIP family ..................................................................................24

AP2/ERF family ...........................................................................25

Plant mechanisms to cope with salt stress ....................................30

Research Objectives .....................................................................35

References ....................................................................................36

Chapter I

3

Rice as a crop model plant

Rice (Oryza sativa L.) is one of the oldest and most important

crops worldwide, being estimated that more than one-half of the

world population relies on this crop to survive (Molina et al. 2011).

The cultivated rice can be divided in two main subspecies, indica and

japonica, based on physiological and morphological features (Molina

et al. 2011; Ronald et al. 2008). Indica rice is mainly cultivated in

Asia, whereas japonica rice production occurs in Asia and also in

Africa, North America and Europe (Ronald et al. 2008). In Europe,

rice is mainly produced in Italy, Spain and Greece, which together

account for approximately 60% of total European rice production

(FAOSTAT data, 2010). In contrast, Portugal produces less than 4%

of the European production (170200 tones in 2010). However,

Portugal is the major consumer of milled rice in the European Union

(EU), with a consumption of 14.84 kg/person/year in 2007, followed

by Belgium and Spain with only 8.12 and 7.21 kg/person/year,

respectively (FAOSTAT data, 2007).

Rice consumption is expected to increase over the next decades

along with the world population growth. However, rice production is

becoming insufficient to fulfill the world demand for this cereal (Roy

et al. 2011). In addition to the increased world population, water

shortage, reduction of arable land and climate changes are affecting

rice production worldwide (Gujja and Thiyagarajan 2010). Therefore,

it is highly important to develop crops with higher yields and better

adapted to adverse environmental conditions. To achieve this goal

we need to increase the knowledge regarding the mechanisms

involved in plant growth and development and also in plant

responses to stress conditions. The study of model plants like

Arabidopsis and rice provides new valuable information that can be


4

used to improve several crops. Arabidopsis is considered the

standard model organism for the study of plant biology, mainly due to

its small genome size, short generation time and simple

transformation methods (Buell and Last 2010; Koornneef and Meinke

2010). Additionally, the availability of its genome sequence, large

genomic resources and mutant collections, make this dicotyledon the

most studied plant species (Spannagl et al. 2011). Many basic

mechanisms involved in plant development and tolerance to biotic

and abiotic stresses are common to all plants. In most of the cases,

the genes identified in Arabidopsis can be directly used in

heterologous systems or as candidate genes to identify orthologs in

crops (Feuillet et al. 2011). However, the identified orthologs may

have alternative functions and, even when the basic mechanisms are

similar, the underlying pathways may diverge (Movahedi et al. 2011;

Rensink and Buell 2004). Therefore, the study of a crop model

organism may overcome these limitations. Rice belongs to the

Poaceae family which includes other agronomically important crops,

such as maize, wheat, barley and rye (Rensink and Buell 2004). The

high degree of conservation of phenotypic features and the

conserved synteny among the cereal genomes, promotes the study

of rice as a model crop. Additionally, rice has a small genome size

(390 Mb) compared to other cereals such as maize (2300 Mb),

barley (5100 Mb) and wheat (17000 Mb) (IRGSP 2005; Mayer et al.

2011; Santos et al. 2011).The availability of its complete genome

sequence and the development of very efficient transformation

protocols further prompt the adoption of rice as a model system. To

functionally characterize the sequenced genes, several tools are

being developed, including full-length cDNA collections, gene

expression profiling platforms and T-DNA insertional mutant libraries

(Rensink and Buell 2004; Ronald et al. 2008).

Chapter I

5

High salinity effects on plant growth and development

High salinity negatively affects crop productivity and quality

worldwide. The soil is considered to contain high salt concentration

when the electrical conductivity of the saturated paste extract (ECe)

is above 4 dS/m (≈ 40 mM NaCl) (Chinnusamy et al. 2005). Most

crops are glycophytes and thus sensitive to high salinity; however if

plants are gradually exposed to increasing salt concentration

(acclimation) they may acquire some degree of stress tolerance

(Negrao et al. 2011).

Plant responses to high salinity can be divided in two phases: the

initial rapid osmotic response and the slower ion-specific response

(Munns and Tester 2008). The osmotic response caused by salt

stress is mainly related to the effect of the salt that surrounds the

roots and is very similar to the drought stress response. Osmotic

stress decreases the rate of leaf growth through reduction of cell

elongation and cell division (Munns and Tester 2008). The rate of

leaf and root elongation decreases rapidly and is followed by a partial

recover to a reduced steady rate after a few hours of osmotic stress

(Munns 2002). Along the stress period, leaf production decreases

and the new leaves are smaller and thicker. Root growth is however

less affected than leaf growth. Increased stress severity can cause

leaf growth arrest; whereas roots can recover faster and maintain a

lower but steady growth rate (Hsiao and Xu 2000). Osmotic stress

induces stomatal closure to avoid water loss via transpiration. In this

process, the plant hormone abscisic acid (ABA) plays an important

role in the regulation of stomatal movement (Finkelstein et al. 2002).

Several stress conditions induce synthesis of ABA, which promotes

stomatal closure and inhibits its opening (Hubbard et al. 2010). ABA

induces depolarization of the guard cells plasma membrane, thus


6

promoting the efflux of K+ and anions and removal of organic solutes

from the cell, which leads to reduced cellular turgor and rapid

stomatal closing (Hubbard et al. 2010; Kim et al. 2010). The stomatal

closure caused by osmotic stress results in reduced photosynthesis

rate, mainly due to lower CO2 assimilation. In addition, severe

osmotic stress results in decreased activity of several enzymes

involved in the photosynthetic metabolism (Saibo et al. 2009). The

decrease in photosynthesis rate leads to a higher formation of

reactive oxygen species (ROS) causing oxidative stress (Munns and

Tester 2008). ROS induce oxidative damage of lipids, proteins and

nucleic acids (Türkan and Demiral 2009). The osmotic stress effects

on photosynthesis depends on the intensity and duration of the

stress, leaf age and plant species (Chaves et al. 2009).

The continued exposure to high salinity leads to the ion-specific

phase of salt stress, characterized by the increase in the rate of

senescence of older leaves (Munns and Tester 2008). Sodium ions

enter plant roots by the apoplastic pathway and the symplastic

pathway through channels and transporters, and then enter in the

transpirational stream (Gao et al. 2007). Na+ and other ions are

transported from the roots to the shoots and accumulate in older

leaves, which have been transpiring the longest, leading to injuries

like tissue necrosis and eventually to their death (Munns 2002). The

ions accumulate in the vacuole and afterwards either in the cytosol or

in the cell wall, leading to inhibition of enzyme activity or cell

dehydration, respectively. In addition, high concentrations of Na+ in

the cell cause osmotic imbalance and membrane disorganization

(Mahajan and Tuteja 2005). The toxic effects of Na+ are also related

to the disruption of K+ homeostasis. This ion is essential for

maintenance of cellular turgor and stomatal movement and is a co-

factor for several enzymes, implying that cells need to maintain high

Chapter I

7

cytosol K+/Na+ ratios (Gao et al. 2007; Mahajan and Tuteja 2005).

Increased Na+ concentration in the soil decreases root K+ uptake

(Gao et al. 2007). Moreover, Na+ competes with K+ for intracellular

influx by nonselective transporters and may also compete for K+

binding sites (Bartels and Sunkar 2005; Mahajan and Tuteja 2005).

The severity of salt-induced injuries depends not only on the salinity

level but also on other environmental conditions like temperature and

on the genetic variations regarding the efficiency of stress tolerance

mechanisms (Munns 2002). The rate at which older leaves die and

new leaves are produced may determine plant survival. Increased

tissue necrosis will reduce the plant photosynthetic capacity and

therefore the carbohydrate levels required to develop younger

leaves, leading to a further reduction in growth rate (Munns and

Tester 2008). In addition, the photosynthetic processes are thought

to be affected by the accumulation of toxic ions in the leaf tissues

(Chaves et al. 2009). Continued exposure to stress for weeks or

months leads to lateral shoot inhibition, altered flowering time and

reduced seed production (Munns 2002).

High salinity effects on rice growth and development

Rice production is highly affected by abiotic stress conditions,

such as low temperature, drought and high salinity. In Portugal, rice

productivity is affected by low temperature mainly in the North region

(Mondego river bed) and by high salinity in the Center (Tejo and

Sorraia) and South regions (Sado). Rice yield decreases by 12% per

dS/m in soils with EC above 3 dS/m (Chinnusamy et al. 2005).

Among other cereals, rice is the most sensitive to salt stress,

whereas wheat is moderately tolerant and barley is the most tolerant

cereal (Munns and Tester 2008). Rice is differently affected by high

salinity depending on the growth stage: it displays some level of


8

tolerance during germination and vegetative growth, and high

sensitivity at seedling and reproductive stage (Negrao et al. 2011).

The osmotic effect of salt stress was proposed to last only a few

hours or days due to leakage from rice roots, which allows higher

Na+ influx (Gao et al. 2007; Munns and Tester 2008). As described

for other plant species, rice growth is also affected under high

salinity. Reduced leaf growth has been reported for plants exposed

to prolonged salt stress conditions (see Negrão et al. (2011) and

references therein). Rice yield greatly decreases due to lower pollen

viability, reduced panicle length and delayed panicle emergence and

flowering (Moradi and Ismail 2007; Negrao et al. 2011). Plants

exposed to moderate stress (NaCl < 50 mM) display delayed

flowering and reduced seed yield, whether exposure to severe stress

(NaCl > 100 mM) may lead to plant death before maturity is reached.

Perception and transduction of stress signals

Plant response to adverse environmental conditions relies on the

perception of stress signals, generation of second messengers and

signal transduction through phosphorylation cascades (Hirayama

and Shinozaki 2010). These cascades will activate proteins involved

in the direct cell protection or in the regulation of the stress response,

ultimately leading to the physiological and biochemical modifications

necessary for plant survival (Xiong et al. 2002). Figure 1 illustrates

the generic signal transduction pathway of plant response to abiotic

stress conditions.

Chapter I

9

Figure 1. Regulatory network of stress responses to abiotic stress

conditions. Stress signals are initially perceived by sensors, such as

receptor-like kinases (RLKs). These proteins trigger the generation of

second messengers, which include calcium ions (Ca2+

) and reactive oxygen

species (ROS), to transduce the perceived stress signals. Variations in the

content and/or nature of second messengers in the cell lead to the

activation of signal transducers, such as mitogen-activated protein kinases

(MAPKs) and Ca2+

protein sensors like calcineurin B-like proteins (CBLs).

The targets of signal transducers include transcription factors (TFs) from

several families (e.g. bZIP and AP2/ERF), which will regulate the

expression of stress-responsive genes. The products of these genes

function in the direct cell protection (Functional proteins) or in the regulation

of the response processes (Regulatory proteins). The regulatory proteins

include TFs and signal transducers that are proposed to form positive and

negative feedback loops to strictly regulate stress responses. Figure

adapted from Hirayama et al (2010).


10

Perception

The apoplast, which consists of the cell wall and the intercellular

spaces, is considered the bridge from the environment to the

protoplast (Pignocchi and Foyer 2003). It perceives environmental

changes and stress signals and then transfers them into the

protoplast to trigger a response. The apoplast matrix contains solutes

(e.g. amino acids, ions and sugars), proteins (e.g. extensins and

peroxidases) and cell-wall constituents (e.g. celluloses and

glycoproteins) (Pignocchi and Foyer 2003). Several reports indicate

that upon stress conditions the apoplast protein composition is

altered in both abundance and protein type (Bhushan et al. 2007;

Dani et al. 2005; Pandey et al. 2010). Proteins with signaling function

were shown to be differentially expressed in response to dehydration

(Bhushan et al. 2007), high salinity (Zhang et al. 2009b) and

pathogen elicitor (Casasoli et al. 2008). Some of the identified

proteins belong to the receptor-like kinase (RLK) group and were

implicated in plant development and defence processes, such as

meristem maintenance, plant morphology, hormone signaling, and

biotic and abiotic stress responses (Chen 2001; Gish and Clark

2011). RLKs are located in the plasma membrane and usually

contain an extracellular receptor domain, a transmembrane domain

and a cytosolic protein kinase domain. Several RLK classes were

discriminated based on similarity of domain structure and include the

wall-associated kinase (WAK), leucine-rich repeat (LRR)-RLK, S-

domain RLK (SRK) and the cysteine-rich RLK (CRK) class. The wall-

associated kinases (WAKs) contain an extracellular domain tightly

bound to the cell wall (Seifert and Blaukopf 2010). These RLKs are

thought to function as a signaling component between the cell wall

and the cytosol and are implicated in turgor maintenance, tolerance

Chapter I

11

to metals, pathogen resistance and probably in abiotic stress

responses (Morillo and Tax 2006; Seifert and Blaukopf 2010; Yan et

al. 2006). The LRR-RLKs and cysteine-rich RLKs are not bound to

the cell wall, however the proximity of the plasma membrane to the

apoplast due to turgor pressure suggests that any perturbation in the

apoplast is perceived by the plasma membrane (Monshausen and

Gilroy 2009; Seifert and Blaukopf 2010). The LRR-RLKs are the

largest RLK class comprising at least 200 and 309 members in

Arabidopsis and rice, respectively (Gish and Clark 2011; Sun and

Wang 2011). The best characterized LRR-RLKs were shown to be

involved in meristem regulation (CLAVATA (CLV) pathway) and

hormone signaling (brassinosteroid-insensitive-1 (BRI1) pathway)

(Gish and Clark 2011). Some members of this class were also

reported to be involved in abiotic stress responses. An LRR-RLK

from Medicago truncatula, Srlk, was reported to regulate the root

response to high salinity (de Lorenzo et al. 2009). Several LRR-RLKs

putatively involved in abiotic stress responses were identified through

a reverse genetic approach in Arabidopsis, but their function is still

unknown (ten Hove et al. 2011).

RLKs containing a cysteine-rich domain in their extracellular

regions include the S-domain (SRK) and the DUF26 (Domain of

Unknown Function 26)-domain (CRKs) proteins. These domains are

enriched in cysteines but are structurally distinct (Chen 2001). The S-

domain was initially identified in the Brassica S-receptor kinase

(SRK), which is involved in pollen recognition in the self-

incompatibility response (Gish and Clark 2011). Other S-domain

containing proteins were identified in Arabidopsis, ARK1 and ARK3,

and reported to have a putative role in biotic stress responses

(Haffani et al. 2004). The DUF26 domain is characterized by the

presence of four highly conserved cysteine residues that may


12

mediate protein-protein interactions (Chen 2001). CRKs specific

function is unknown for most of the class members, but some

evidences suggest that they may have a role in biotic and abiotic

stress responses. Gene expression studies have indicated that

several CRKs are induced by pathogen infection and oxidative stress

(Gish and Clark 2011; Haffani et al. 2004; Wrzaczek et al. 2010).

Atypical forms of RLKs, named receptor-like proteins (RLPs) were

identified for several RLK classes (Chen 2001; Gish and Clark 2011).

These protein forms contain the same extracellular domain as RLKs,

but lack the transmembrane and the intracellular kinase domain

(secreted proteins) or only lack the intracellular kinase domain. Some

RLPs were reported to function independently of RLKs whereas

others act in combination with the RLK counterpart. The CLAVATA

system relies on the interaction between the LRR-RLP CLAVATA2

and the LRR-RLK CLAVATA1 to form a complex that will become

active after binding to the specific ligand CLAVATA3 (Rojo et al.

2002). The rice Root Meander Curling (OsRMC) gene encodes a

RLP from the CRK class involved in biotic and abiotic stress

responses. This RLP contains two DUF26-domains in the

extracellular region but lack the transmembrane and intracellular

kinase domains, suggesting that it is secreted (Jiang et al. 2007;

Zhang et al. 2009b). Protein localization studies indicated that

OsRMC is located in the apoplast and/or the plasma membrane

(Jiang et al. 2007; Zhang et al. 2009b). The presence of a signal

peptide with transmembrane character may explain the plasma

membrane location (Jiang et al. 2007). The OsRMC protein was

shown to accumulate in response to high salinity, pathogen

inoculation, jasmonic acid (JA) and wound stimuli (Kim et al. 2003;

Kim et al. 2004; Shen et al. 2003; Zhang et al. 2009b), while rice

knockdown lines displayed enhanced tolerance to high salinity

Chapter I

13

treatments at germination and adult stage (Zhang et al. 2009b). In

addition, salt-stress responsive genes were up-regulated in the

transgenic lines, suggesting that OsRMC negatively regulates the

response to high salinity through deregulation of gene expression.

These transgenic lines also displayed enhanced sensitivity to JA and

increased root coiling, indicating that OsRMC negatively regulates

root development and coiling processes mediated by JA (Jiang et al.

2007).

Second messengers

Signal perception leads to the generation of second messengers

like calcium (Ca2+) and reactive oxygen species (ROS), which

transduce the stress signal (Figure 1). A wide range of biotic and

abiotic stress signals cause transient elevation of cytosolic calcium

levels [Ca2+]cyt (Kim et al. 2009). However, each stress signal induces

a specific perturbation in the calcium levels, termed “Ca2+ signature”

that can vary in kinetics, magnitude and sub-cellular location (Tuteja

and Mahajan 2007). Elevation of [Ca2+]cyt can be due to influx from

the apoplast and/or from intracellular organelles, such as the vacuole

and the endoplasmic reticulum (ER). Calcium increase in the cytosol

is perceived by protein sensors such as the calmodulin (CaM), Ca2+-

dependent protein kinases (CPKs/CDPKs) and calcineurin B-like

proteins (CBLs) (DeFalco et al. 2010). CaMs bind to Ca2+ through

EF-hands and change conformation to directly interact with several

target proteins and modulate their activity/function. Several CaM

targets were identified and reported to be involved in various

processes, such as salt tolerance, hormone signaling and

transcriptional regulation (Reddy and Reddy 2004). CPKs also bind

to Ca2+ via EF-hands but contain a catalytic kinase domain and

regulate the target proteins through phosphorylation. A role in biotic


14

and/or abiotic stress responses has been proposed for CPKs

identified in Arabidopsis, tobacco and rice (DeFalco et al. 2010).

OsCPK13 gene expression is induced by drought and high salinity

conditions and its over-expression in rice enhanced plant tolerance

to these stresses. Arabidopsis AtCPK23 was reported to be involved

in stomatal opening and its over-expression increased drought and

salt stress sensitivity. The CBLs have Ca2+-binding properties similar

to CaMs and are regulatory subunits for serine/threonine protein

kinases, named CBL-interacting protein kinases (CIPKs) (DeFalco et

al. 2010). The best characterized CBL-CIPK interaction is involved in

the salt-overly-sensitive (SOS) signaling pathway (Luan 2009). The

Arabidopsis calcium sensor SOS3 (CBL4) was shown to interact with

SOS2 (CIPK24) upon [Ca2+]cyt perturbations regulating its kinase

activity and targeting it to the plasma membrane (Luan 2009). The

SOS3-SOS2 complex regulates SOS1, a Na+/K+ exchanger located

in the plasma membrane, enhancing Na+ efflux and contributing to

Na+ ion homeostasis. CIPK24 was also reported to be targeted to the

vacuole membrane upon binding to CBL10 (Luan 2009). The precise

function of the CBL10-CIPK24 complex is unknown, however some

speculate that it may regulate a tonoplast Na+/H+ exchanger, NHX1,

involved in high salinity tolerance (DeFalco et al. 2010).

Biotic and abiotic stress conditions promote an increase in ROS

like hydrogen peroxide (H2O2) and superoxide (O2-), which induce

damages in cellular components and can lead to tissue necrosis

(Apel and Hirt 2004). To minimize the effect of ROS generation, cells

produce antioxidants (e.g. ascorbate and glutathione) and ROS-

scavenging enzymes (e.g. superoxide dismutase and ascorbate

peroxidase). Several reports suggest that apart from their toxic

effect, ROS are involved in specific signal transduction mechanisms

that regulate ROS homeostasis (Moller and Sweetlove 2010). The

Chapter I

15

identification of genes whose expression is regulated by specific

oxidative stress signals originated in different subcellular locations,

suggested that ROS have a signaling function (Moller and Sweetlove

2010). The specific mechanism of ROS signaling is still unknown but

several hypothesis have been proposed (Mittler et al. 2011; Moller

and Sweetlove 2010). Some authors argue that the ROS signal by

itself functions as a second messenger and the amplitude, frequency

and/or localization of the signal can trigger specific gene expression

patterns. Others suggest that peptides derived from oxidized proteins

may act as second messengers that trigger specific stress

responses. ROS accumulation caused by biotic and abiotic stress

conditions was shown to modulate the response to stress signals.

The increase in apoplastic ROS levels under water stress conditions

was shown to promote cell wall loosening in maize, allowing cell

elongation and ultimately stress adaptation (Zhu et al. 2007). In

addition, ROS accumulation was reported to activate cascades of

mitogen-activated protein kinases (MAPKs) (described below)

involved in biotic and abiotic stress responses (Mittler et al. 2011).

The Arabidopsis MEKK1-MKK1/2-MPK4/6 signaling cascade was

shown to participate in cold and salt stress responses and some

members are activated by ROS (Jaspers and Kangasjarvi 2010;

Mittler et al. 2011).

MAPKs

The mitogen-activated protein kinases (MAPK) function in signal

transduction cascades that amplify and integrate external stimuli into

the cell metabolic and transcriptional response mechanisms (Figure

1) (Rodriguez et al. 2010; Sinha et al. 2011). The basic MAPK

cascade involves the stimuli-mediated activation of a MAP kinase

kinase kinase (MEKK/MAP3K) which phosphorylates a MAP kinase


16

kinase (MKK/MAP2K) that in turn activates a MAP kinase

(MPK/MAPK). MAPKs can phosphorylate several cytosolic and

nuclear targets, including other kinases, enzymes and TFs. MAP

kinase kinase kinase kinases (MAP4K) were also reported to be

involved in these cascades but function as adaptors between

upstream signals and the MAPK cascade itself. Based on the amino

acid sequences of the kinase domain, MEKKs can be divided into

two main groups: MEKK-like and RAF-like kinases that are similar to

mammalian MEKK and RAF1 proteins, respectively (Ichimura et al.

2002; Rodriguez et al. 2010). MEKK proteins from both groups were

reported to be involved in stress responses. AtMEKK1 gene

expression is induced by wound, high salinity, cold and drought

stress conditions and its activity is promoted by H2O2 (Pitzschke et

al. 2009). This MEKK was shown to be an upstream activator of the

MKK2-MPK4/6 cascade involved in Arabidopsis high salinity and

cold stress responses (Teige et al. 2004). In addition, AtMEKK1

interacts with MKK1, which is activated by H2O2 and phosphorylates

MPK4, suggesting a role of AtMEKK1 in ROS homeostasis

(Pitzschke et al. 2009). The rice putative RAF-like kinase DSM1 was

proposed to mediate ROS and drought stress signaling responses

(Ning et al. 2010). DSM1 over-expression increased rice tolerance to

drought stress, whereas dsm1 mutants displayed enhanced

sensitivity to this abiotic stress. In addition, the rice mutants were

more sensitive to oxidative stress suggesting a putative role in ROS

scavenging.

Arabidopsis and rice MKK proteins are classified into four groups

(A-D) according to their sequences and structures (Hamel et al.

2006). Only a few MKKs were characterized but all groups include

kinases involved in biotic and/or abiotic stress responses.

Arabidopsis MKK2 belongs to group A of MKKs and is activated by

Chapter I

17

cold and salt stress treatments (Teige et al. 2004). MKK2 over-

expression increased the transcript level of several stress-responsive

genes and enhanced plant tolerance to high salinity and freezing

conditions. MKK2 was reported to phosphorylate MPK4 and MPK6,

which are activated by several stresses, including pathogen infection,

and osmotic, cold and oxidative stress (Teige et al. 2004).

Arabidopsis MKKs from groups B (MKK3) and C (MKK4 and MKK5)

were reported to be mainly involved in biotic stress responses (Doczi

et al. 2007; Sinha et al. 2011). In rice, OsMKK4 from group C was

shown to mediate the response to arsenic stress (Sinha et al. 2011).

Arabidopsis MKK9 belongs to group D and was proposed to mediate

ABA and salt stress responses (Alzwiy and Morris 2007).

Plant MAPKs are classified in 4 groups (A-D) and contain either

TEY (group A-C) or TDY (group D) phosphorylation motifs in their

activation domain (Ichimura et al. 2002; Liu and Xue 2007). A

conserved C-terminal common docking (CD) domain was detected in

group A and B proteins and proposed to function as a docking site

for MKKs and protein substrates (Ichimura et al. 2002). Group C

proteins also display a CD domain but with modified residues.

MAPKs from group D lack a CD domain and contain an extended C-

terminal region compared to proteins from the other groups (Ichimura

et al. 2002). Several MAPKs were reported to have a role in biotic

and abiotic stress responses. Arabidopsis MPK4 (group B) and

MPK6 (group A) are activated by cold, salt, drought and wounding

(Teige et al. 2004). In rice, OsMAPK5 (group A) activity was shown

to be induced by pathogen infection and ABA, drought, high salinity

and cold stress treatments (Xiong and Yang 2003). In addition,

studies with rice plants over-expressing and silencing OsMAPK5

revealed that it positively regulates drought, salt and cold tolerance

and negatively modulates disease resistance. A role in pathogen


18

signaling responses was assigned to the group C MAPK MPK7

(Doczi et al. 2007). This protein was shown to be activated and

stabilized by MKK3 which blocks its degradation. The MKK3-MPK7

module was proposed to regulate the expression of pathogenesis-

related (PR) genes upon activation by ROS.

The rice blast- and wounding-activated MAP kinase (OsBWMK1)

belongs to the group D of MAPKs and is encoded by three

alternative splice variants: OsBWMK1L, OsBWMK1M and

OsBWMK1S (Koo et al. 2007). The protein isoforms were shown to

have different gene expression profiles in response to biotic and

abiotic stress conditions. OsBWMK1M and OsBWMK1S gene

expression was shown to be up-regulated by H2O2, JA, salicylic acid

(SA), NaCl and fungal elicitors, whereas OsBWMK1L transcript level

was not altered by any of these treatments (Koo et al. 2007).

OsBWMK1S transcript level was also shown to be induced by other

biotic and abiotic stress conditions, such as wounding, ABA and

drought stress (Agrawal et al. 2003; He et al. 1999). The kinase

activity of this isoform was also reported to be induced by pathogen

signals and ROS (Cheong et al. 2003). According to Koo et al.

(2007) the three isoforms display different subcellular locations.

OsBWMK1S was mainly detected within the nucleus, whereas

OsBWMK1L and OsBWMK1M were predominantly located in the

cytosol. Upon treatment with H2O2 and SA, the OsBWMK1L isoform

was shown to be translocated into the nucleus. The OsBWMK1S

isoform role in biotic stress responses was further analyzed through

over-expression in tobacco plants (Cheong et al. 2003). The

transgenic plants displayed enhanced resistance to bacterial and

fungal pathogens and increased accumulation of PR transcripts. In

addition, OsBWMK1S was shown to phosphorylate the AP2/ERF TF

OsEREBP1, enhancing its DNA-binding activity to GCC box

Chapter I

19

elements. OsBWMK1L and OsBWMK1M isoforms were also

reported to phosphorylate OsEREBP1 in vitro (Koo et al. 2007).

Several putative MAPK targets have been identified in

Arabidopsis through protein microarrays (Feilner et al. 2005;

Popescu et al. 2009). These studies predicted that the same MAPK

can phosphorylate several targets, but some targets are modified by

a single MAPK. Thus, MAPKs with similar sequences display some

specificity towards its targets. The majority of the identified targets

are TFs putatively involved in development and stress responses

(Popescu et al. 2009). Several members from the MYB, bZIP,

AP2/ERF and WRKY TF families were predicted to be

phosphorylayed by MAPKs (Popescu et al. 2009).

Transcription factors involved in abiotic stress responses

Stress signals perceived by the cell are transduced and amplified

through phosphorylation cascades that target proteins directly

involved in cell protection or in the regulation of gene expression

(e.g. transcription factors) (Xiong et al. 2002). The products of these

genes can also promote the synthesis of hormones like abscisic acid

(ABA) that initiate a second round of signaling. Transcription factors

(TFs) are master regulatory proteins that can modulate the

expression of several target genes through interaction with the cis-

elements present in the gene promoters (Nakashima et al. 2009).

TFs involved in abiotic stress responses include members of the

MYB, NAC, bZIP and AP2/ERF families, which can function in both

ABA-dependent and ABA-independent signaling pathways (Agarwal

and Jha 2010; Shao et al. 2007). Members of other TF families are

also involved in abiotic stress responses, but they are much less

represented. Figure 2 illustrates the most relevant members of the

transcriptional network associated with abiotic stress responses.


20

Figure 2. Transcriptional network of abiotic stress responses. Transcription

factors and post-translational modifying enzymes are represented in ovals

and circles, respectively. The triangles indicate post-translational

modifications. The green boxes indicate cis-elements or putative motifs

(question marks) identified in stress-responsive genes. The black dot

corresponds to SUMOylation modification of ICE1 by SIZ1. The dashed

black line represents competition between SIZ1 and HOS1 for binding to

ICE1. Figure adapted from Saibo et al. (2009) and Yamaguchi-Shinozaki

and Shinozaki (2006).

MYB family

Transcription factor proteins from the MYB family contain MYB

repeats (R) involved in DNA-binding and protein-protein interactions

(Feller et al. 2011). The number of tandem MYB repeats groups

these TFs in three subfamilies: R-MYB, R2R3-MYB and R1R2R3-

MYB that contain one, two, or three repeats, respectively. Several

MYB proteins have been implicated in abiotic stress responses (see

Chapter I

21

Feller et al. (2011) and references therein). In rice, several MYB

proteins were reported to be involved in cold stress responses.

MYBS3 transcript level is regulated by cold, high salinity and ABA,

and its over-expression in rice was shown to enhance plant tolerance

to cold (Su et al. 2010). OsMYB3R-2 was shown to play an important

role in cell-cycle regulation, but it is also involved in abiotic stress

responses (Ma et al. 2009). Its gene expression is induced under

cold, drought and high salinity, and OsMYB3R-2 over-expression in

rice enhanced plant cold tolerance (Ma et al. 2009). On the other

hand, when over-expressed in Arabidopsis, this TF improved

tolerance to drought and high salinity (Dai et al. 2007). OsMYB4 was

shown to be involved in both biotic and abiotic stress responses

(Vannini et al. 2006). The TF over-expression in heterologous

systems conferred tolerance to different stress conditions depending

on the plant host (Agarwal and Jha 2010; Park et al. 2010). The

increased stress tolerance was proposed to be related to the

OsMYB4 putative function in osmotic adjustment (Park et al. 2010).

Studies with rice plants over-expressing OsMYB4 revealed that the

increased cold tolerance can be related to reduce oxidative injuries

due to enhanced antioxidant capacity (Park et al. 2010). The

transcriptional activity of some MYB proteins was shown to be

dependent on the interaction with basic Helix-Loop-Helix (bHLH)

proteins from the MYC subgroup (Feller et al. 2011). AtMYC2 and

AtMYB2 were shown to interact with the MYCRS and MYBRS cis-

elements present in the promoter of the drought- and ABA-inducible

gene rd22 (Figure 2) (Abe et al. 2003). TF co-expression in

Arabidopsis protoplasts strongly activated rd22 transcription. In

addition, over-expression of both TFs increased ABA sensitivity and

the transcript level of several ABA-responsive genes. Arabidopsis

low temperature responses were also reported to depend on the


22

cooperative interaction between MYB15 and ICE1 (Inducer of CBF

Expression 1) (Figure 2) (Agarwal et al. 2006a). ICE1 encodes a

MYC-type bHLH TF, which positively regulates CBF/DREB1 genes

expression and has an essential role in cold acclimation

(Chinnusamy et al. 2003). This TF was shown to down regulate the

gene expression of MYB15, which represses the transcription of

CBF/DREB1 genes (Mazzucotelli et al. 2008). Under cold stress

conditions, ICE1 TF is activated through phosphorylation and

SUMOylation by the SUMO E3 ligase SIZ1 (SAP and MIZ domain

protein) (Chinnusamy et al. 2007). ICE1 SUMOylation blocks its

proteosomal degradation mediated by the E3 Ubiquitin ligase HOS1

(High expression of Osmotically responsive gene 1) (Miura et al.

2007). The ICE1 active form increases the expression of

CBF/DREB1 genes and, thus, enhances plant tolerance to low

temperatures.

NAC family

NAC [NAM (No Apical Meristem), ATAF (Arabidopsis

Transcription Activation Factor), and CUC2 (Cup-shaped Cotyledon)]

proteins are characterized by a highly conserved N-terminal NAC

domain that binds to target DNA and a divergent region in the C-

terminal domain that regulates its transcriptional activity (Olsen et al.

2005). These proteins have been implicated in the regulation of

several processes, including developmental mechanisms and stress

responses (Olsen et al. 2005). Arabidopsis ATAF1 was reported to

be involved in both biotic and abiotic stress responses (Wu et al.

2009). Its gene transcripts accumulate in response to drought, high

salinity, ABA, JA, wounding and pathogen infection. Additionally,

ATAF1 over-expression enhanced tolerance to drought stress and

increased plant sensitivity to high salt, ABA, oxidative stress and

Chapter I

23

pathogen infection. Several NAC proteins were shown to regulate the

transcription of stress-responsive genes cooperatively with other

TFs. ANAC019, ANAC055 and ANAC072 interact with the zinc-finger

homeodomain (ZF-HD) protein ZFHD1 to regulate the drought-

dependent expression of ERD1 (Early Responsive to Drought 1)

(Figure 2) (Tran et al. 2007). Arabidopsis plants over-expressing both

NAC and ZFHD1 TFs displayed improved drought tolerance. In rice,

OsNAC5 was demonstrated to form homo- and heterodimers with

the NAC domains of OsNAC5, OsNAC6 and SNAC1 (Takasaki et al.

2010). Additionally, OsNAC5 and OsNAC6 transcriptionally activate

OsLEA3 (Late Embryogenesis Abundant group 3 protein), a stress-

inducible gene whose over-expression enhances rice drought

tolerance. Rice plants over-expressing OsNAC6 displayed improved

tolerance to drought, high salinity and blast disease, suggesting that

the TF is involved in both biotic and abiotic stress responses

(Nakashima et al. 2007). OsNAC10 function in abiotic stress

responses was revealed through its over-expression driven by a

constitutive and a root-specific promoter in rice (Jeong et al. 2010).

The transgenic plants displayed enhanced tolerance to drought, high

salinity and cold stress at the vegetative stage. In addition, OsNAC10

root-specific over-expression resulted in increased rice grain yield

under field drought conditions. ONAC045 was also shown to have an

important role in rice response to drought and high salinity (Zheng et

al. 2009). Its over-expression resulted in rice plants with enhanced

tolerance to this abiotic stress conditions. In both OsNAC10 and

ONAC045 transgenic plants the enhanced tolerance was associated

with the induction of stress-responsive genes (Jeong et al. 2010;

Zheng et al. 2009)


24

bZIP family

The basic-region leucine zipper (bZIP) TFs contain a basic region

that interacts with the DNA and a leucine zipper involved in protein

homo- and heterodimerization (Jakoby et al. 2002). Several bZIP

proteins have been implicated in ABA-dependent abiotic stress

responses and are thus referred to as ABRE-binding (AREB)

proteins or ABRE-Binding Factors (ABFs). These proteins modulate

the expression of ABA-responsive genes through binding to the ABA

Responsive Element (ABRE; ACGT-core), a cis-element present in

their promoter region (Umezawa et al. 2010; Zhang et al. 2005).

However, the presence of one ABRE was shown to be insufficient to

activate ABA-dependent gene expression and an additional element

termed coupling element (CE) was shown to be required (Gomez-

Porras et al. 2007; Zhang et al. 2005). Two CEs (CE1 and CE3)

were identified in wheat and shown to form an ABA-responsive

complex. Additionally, ABREs themselves and the dehydration-

responsive element (DRE) were reported to function as CEs. bZIP

proteins were shown to interact with DNA as homo- or heterodimers

and the affinity to specific DNA sequences may be dependent on the

dimer formed (Siberil et al. 2001). Additionally, phosphorylation was

proposed to determine the DNA binding affinity and the formation of

specific dimers (Schutze et al. 2008). Rice bZIPs TRAB1 and OsVP1

were shown to directly interact and to putatively regulate the

expression of ABA-responsive genes (Hobo et al. 1999). TRAB1

directly binds to ABRE motifs and this interaction was enhanced

upon ABA-dependent phosphorylation (Kagaya et al. 2002).

Additionally, TRAB1 phosphorylation was shown to be triggered by

high salinity treatments (Kobayashi et al. 2005). Rice OSBZ8 activity

was also proposed to be regulated by phosphorylation, which may

Chapter I

25

promote the bZIP interaction with the promoter of several LEA genes

(RoyChoudhury et al. 2008). OSBZ8 transcripts were shown to

rapidly accumulate in response to ABA and to be present at higher

levels in salt-tolerant rice cultivars as compared to salt-sensitive ones

(Mukherjee et al. 2006). OsABF1 and OsABF2 also play a role in

abiotic stress responses. Their transcript levels are up regulated

under different stress conditions, including cold, drought and high

salinity, and the respective mutants showed enhanced sensitivity to

high salinity and drought stress (Hossain et al. 2010a; Hossain et al.

2010b). In Arabidopsis, AREB1 transcriptional activity was reported

to be dependent on ABA-mediated multisite phosphorylation

(Furihata et al. 2006). Over-expression of a constitutive active form

of AREB1 resulted in the expression of downstream genes involved

in drought stress tolerance, such as the LEA genes RD29B and

RAB18 (Fujita et al. 2005). The transgenic plants displayed ABA

hypersensitivity and enhanced drought tolerance.

AP2/ERF family

AP2/ERF (APETALA2/Ethylene Response Factor) TFs are

characterized by the highly conserved AP2 domain involved in TF

binding to DNA (Dietz et al. 2010; Santos et al. 2011). The origin of

these proteins in plants is proposed to result from horizontal transfer

of an HNN-AP2 endonuclease from bacteria or viruses (Magnani et

al. 2004). The plant AP2/ERF family is divided in five subfamilies,

AP2, RAV, ERF, DREB and ‘others’, according to the similarity of

their DNA binding domains (Sakuma et al. 2002). The AP2

(APETALA2) proteins contain two AP2 domains and are mainly

involved in plant development. The RAV (Related to ABI3/VP1)

proteins have a B3 domain apart from one AP2 domain, and can

interact with bipartite DNA motifs through both DNA-binding domains


26

(Dietz et al. 2010; Swaminathan et al. 2008). Arabidopsis and pepper

RAV proteins have been implicated in stress responses. RAV1 and

RAV2 transcripts accumulated in Arabidopsis plants subjected to

several abiotic stress conditions (Woo et al. 2010). Over-expression

of CARAV1 from pepper in Arabidopsis greatly enhanced plant

resistance to pathogen infection and tolerance to osmotic stress

(Sohn et al. 2006). Members from the DREB (Dehydration-

Responsive Element Binding protein) and ERF (Ethylene

Responsive Factor) subfamilies are implicated in biotic and abiotic

stress responses. These proteins contain only one AP2 domain but

have different DNA binding specificity due to the amino acids in

position 14 and 19 (Sakuma et al. 2002). The 14th alanine and the

19th aspartic acid are conserved in the ERF proteins, whereas valine

and glutamic acid are conserved within DREB proteins. Although

both ERF and DREB TFs recognize the core sequence CCGNC,

their DNA-binding specificity is determined by the sequences that

surround this core motif. DREB proteins usually recognize the

dehydration responsive element (DRE; A/GCCGAC), whereas ERF

TFs preferentially interact with ERE (Ethylene-Responsive Element),

which contains a core sequence designated GCC box (AGCCGCC)

(Mizoi et al. 2012). Although ERE and DRE are considered the

optimal target sites for ERF and DREB proteins, respectively, several

studies indicate that members of these subfamilies can bind to either

cis-elements with different affinity levels and to sequences containing

variations of both core motifs (Fujimoto et al. 2000; Kizis et al. 2001).

Proteins from the DREB subfamily were reported to recognize cis-

elements similar to DRE, such as the C-repeat (CRT) and the Low-

Temperature-Responsive Element (LTRE) (Yamaguchi-Shinozaki

and Shinozaki 2005). TFs that bind to the CRT element were named

Chapter I

27

CRT-binding factors/DRE-binding proteins (CBF/DREB) (Baker et al.

1994; Jiang et al. 1996; Stockinger et al. 1997).

Proteins from the ERF subfamily were initially characterized as

regulators of ethylene signal transduction pathways, but their role in

biotic and abiotic stress responses has been shown in several plant

species (Xu et al. 2011). The identification of ERE cis-elements in

the promoter region of several pathogenesis-related (PR) genes,

suggested that ERF had a role in biotic stress responses (Dietz et al.

2010; Gutterson and Reuber 2004). Additionally, studies in

Arabidopsis, tobacco and tomato revealed that ERF over-expression

enhanced plant resistance to fungal and bacterial pathogens (Xu et

al. 2011). The involvement of ERF TFs in abiotic stress responses

was confirmed in several plant species (Xu et al. 2011). Tomato

JERF1 was shown to be regulated at transcriptional level by

ethylene, jasmonic acid, ABA and high salinity (Wu et al. 2007).

When over-expressed in tobacco JERF1 enhanced plant tolerance to

high salinity and cold stress through the transcriptional activation of

stress-responsive genes. JERF1 was also reported to interact with

multiple cis-acting elements, such as GCC box, DRE and CE1 and,

therefore, proposed to function in both ABA-dependent and ABA-

independent stress signaling pathways. GmERF3 from soybean was

shown to function in biotic and abiotic stress responses (Zhang et al.

2009a). When over-expressed in tobacco, it increased tolerance to

high salinity and drought stress. Additionally, the transgenic plants

displayed enhanced resistance to bacterial, fungal and viral

pathogens, suggesting that GmERF3 is also involved in biotic stress

responses. In rice, OsBIERF2, OsBIERF3 and SUB1A were reported

to be involved in abiotic stress responses. OsBIERF2 (also named

AP37 or OsERF3) gene expression was induced by high salinity and

drought stress, and its over-expression enhanced rice tolerance to


28

both stress conditions and to low temperature at vegetative stage

(Oh et al. 2009). In addition, these transgenic plants showed

enhanced drought tolerance during the reproductive stage, leading to

an increased grain yield as compared to wild-type plants. OsBIERF3

(also named AP59) has a role in rice biotic and abiotic stress

responses. Tobacco plants over-expressing this TF showed

enhanced disease resistance against infection by virus and bacteria,

and increased drought and high salinity tolerance (Cao et al. 2005).

The SUB1A-1 allele was identified only in rice indica cultivars and

reported to contribute to the higher submergence tolerance observed

in these cultivars as compared to the japonica ones. Introgression of

SUB1A-1 in japonica cultivars enhanced rice tolerance to

submergence and drought stress (Fukao et al. 2011).

DREB proteins are mainly implicated in plant responses to abiotic

stress conditions. This subfamily was divided in two subclasses,

CBF/DREB1 and DREB2, due to their differential gene expression

pattern in Arabidopsis plants subjected to abiotic stress conditions

(Agarwal et al. 2006b). The fact that some genes are identified as

CBF and others as DREB, results from the fact that at the same time

two independent teams have characterized the same genes in

Arabidopsis (Liu et al. 1998; Stockinger et al. 1997). The

CBF/DREB1 subclass includes the CBF3/DREB1A, CBF1/DREB1B

and CBF2/DREB1C genes, which were up-regulated by low

temperatures but not by drought or high salt stress. Contrary, the

DREB2 genes, DREB2A and DREB2B, were only induced by

drought and high salt stress. Other members from the CBF/DREB1

subclass, such as the DREB1D and DREB1F, were identified and

reported to respond to drought and salt stress at transcriptional level,

suggesting cross-talk between the CBF/DREB1 and DREB2

pathways in response to these stress conditions (Nakashima et al.

Chapter I

29

2009). In Arabidopsis, the CBF/DREB1 regulon was proposed to be

regulated by the zinc-finger TF ZAT12 which reduces the expression

of CBF/DREB genes (Vogel et al. 2005). ZAT12 putative homologs

were identified in rice and barley, but their function in still unknown

(Skinner et al. 2006). The CBF/DREB1 regulon has an important role

in low temperature responses. Over-expression of CBF/DREB1

genes in Arabidopsis and other plant species, such as rice and

wheat, resulted in improved plant tolerance to low temperature but

also to salt and drought stress conditions (Nakashima et al. 2009; Xu

et al. 2011). In rice, OsDREB1A, OsDREB1B and OsDREB1F are

induced by drought, high salinity and cold stress (Dubouzet et al.

2003; Fukao et al. 2011; Gutha and Reddy 2008; Wang et al. 2008),

and their over-expression in Arabidopsis and rice improved tolerance

to those stresses in both species (Ito et al. 2006). OsDREB1A-OX

plants displayed increased content of osmoprotectants and activation

of several stress-responsive genes (Ito et al. 2006). Studies in

tobacco revealed that OsDREB1B is also involved in biotic stress

responses and radical scavenging processes (Gutha and Reddy

2008). Some rice DREB genes were shown to have a putative role in

ABA-dependent responses. OsDREB1F was induced by an ABA

treatment (Wang et al. 2008) and Arabidopsis plants over-expressing

OsDREB1D showed decreased sensitivity to ABA (Zhang et al.

2009c). DREB2 proteins have been identified in Arabidopsis and

several crop species, such as rice, wheat, barley and maize

(Matsukura et al. 2010). Under control conditions, Arabidopsis

DREB2A was shown to be regulated at post-translational level

through ubiquitination by DRIP1 and DRIP2 RING E3 ligases (Qin et

al. 2008). Over-expression of the DREB2A constitutively active form

resulted in enhanced tolerance to drought stress (Sakuma et al.

2006). DREB2 proteins from rice, barley, wheat and maize were also


30

shown to be regulated by alternative splicing (Mizoi et al. 2012).

Under control conditions there is an accumulation of inactive

transcripts, whereas increased induction of active transcripts occurs

under stress. Over-expression of the OsDREB2B active form

improved Arabidopsis tolerance to drought and heat-shock stress

(Matsukura et al. 2010).

The coordinated action of TFs promotes the regulation of several

tolerance mechanisms that will allow plant adaptation to

environmental changes and ultimately its survival. The identification

and functional characterization of TFs from several plant species

contributes to a better understanding of the complexity of plant

responses to abiotic stress conditions.

Plant mechanisms to cope with salt stress

Plants have evolved sophisticated mechanisms to adapt their

growth and development to changes in the environment. The

response to high salinity involves mechanisms that occur at cellular

level, including intracellular compartmentation and damage repair,

and at whole plant level, mainly to control Na+ uptake and distribution

(Tester and Davenport 2003).

High salinity causes osmotic stress, which reduces cellular turgor

and leads to water loss. To cope with this adverse effect, plants have

developed several osmotic adjustment mechanisms (Chinnusamy et

al. 2005). One of these mechanisms, is the ion compartmentation in

the vacuole, which contributes to low Na+ concentrations in the

cytosol, promoting ion homeostasis and maintenance of cellular

turgor (Gao et al. 2008). AtNHX1 is a tonoplast Na+/H+ transporter,

which was shown to have an important function in salt stress

tolerance. Over-expression in Arabidopsis, tomato and Brassica

napus greatly enhanced plant tolerance to this abiotic stress (Tester

Chapter I

31

and Davenport 2003). Similarly, rice and maize plants over-

expressing the Na+/H+ antiporter OsNHX1 displayed improved salt

tolerance (Chen et al. 2007; Fukuda et al. 2004; Liu et al. 2010). In

addition, Na+/H+ antiporters were reported to display increased

activity in barley roots subjected to salt stress (Tester and Davenport

2003).

The accumulation of Na+ ions in the vacuole is accompanied by

increased amounts of K+ ions and organic solutes in the cytosol to

facilitate osmotic adjustment (Munns and Tester 2008; Tester and

Davenport 2003). Accumulation of organic solutes in the cytosol is

also required to prevent cell water loss due to high Na+

concentrations outside the cell (Negrao et al. 2011). The most

common include proline, trehalose and glycine betaine (Chinnusamy

et al. 2005). Besides their role in the osmotic adjustment, these

compounds have protective functions and therefore are usually

termed osmoprotectants (Tester and Davenport 2003). Proline

accumulation greatly increases in rice plants subjected to salt stress

and this accumulation is enhanced in tolerant rice genotypes

(Negrao et al. 2011). This metabolite is thought to contribute to

osmotic adjustment but also to function in ROS scavenging (Tester

and Davenport 2003; Türkan and Demiral 2009). Glycine betaine

was proposed to function as a chaperone, stabilizing quaternary

structures of proteins and therefore protecting important enzymes

like RUBISCO (Tester and Davenport 2003; Türkan and Demiral

2009). In addition, this osmoprotectant was reported to have a

putative function in the protection of mitochondrial electron transport

reactions under high salinity, extreme temperature or pH (Tester and

Davenport 2003; Türkan and Demiral 2009). Trehalose was also

proposed to stabilize protein and membrane structures. The

important role of glycine betaine in salt stress responses was shown


32

through studies with Arabidopsis, rice, wheat and Brassica plants

over-producing this compound (Chinnusamy et al. 2005). Similarly,

rice plants over-producing trehalose displayed enhanced tolerance to

high salinity. This feature was proposed to be related to the

protective function of these compounds and not to their role in

osmotic adjustment (Chinnusamy et al. 2005).

High salinity causes damages in cellular structures and

components. Thereby, to reduce the salt-related deleterious effects,

cells synthesize several proteins with protective functions. LEA

proteins and heat-shock proteins (HSPs) are induced and

accumulate in response to drought, high salinity and extreme

temperature stress (Hussain et al. 2011). LEAs have the ability to

protect proteins from inactivation and aggregation and may also have

a function in membrane stabilization (Hand et al. 2011). The

dehydrins belong to the LEA protein family and were shown to be

involved in ROS scavenging. Over-expression of genes encoding

LEA proteins were reported to enhance plant stress tolerance, further

confirming their role in stress responses (Hussain et al. 2011).

Transgenic rice plants expressing the barley gene HVA1, which

encodes a LEA protein, displayed enhanced tolerance to drought

and high salinity. However, it is not clear if the transgenic plants have

increased tolerance to the osmotic or the ion-specific effect of salt

stress (Tester and Davenport 2003). HSPs function as molecular

chaperones, being responsible for protein folding, assembly,

translocation and degradation (Wang et al. 2004). Small HSPs

(sHSPs) are also involved in enzyme stabilization and in the

reactivation of inactive enzymes (Hussain et al. 2011). Studies in

Arabidopsis, tobacco and rice revealed that over-expression of

genes encoding HSPs or sHSPs greatly enhanced plant tolerance to

drought stress (see Hussain et al. (2011) and references therein).

Chapter I

33

The accumulation of ROS and the induced oxidative stress is a

consequence of high salinity and other abiotic stress conditions. To

minimize ROS effects, cells have efficient detoxification mechanisms,

including antioxidant or ROS-scavenging enzymes and non-

enzymatic antioxidants (Gao et al. 2008; Türkan and Demiral 2009).

The superoxide dismutase (SOD) and ascorbate peroxidase (APX)

are examples of ROS-scavenging enzymes. SOD catalyses the

dismutation of O2- to H2O2, whereas APX catalyses the conversion of

H2O2 to H2O (Apel and Hirt 2004). Non-enzymatic antioxidants

include ascorbic acid and glutathione, which also function in ROS

scavenging processes. Several studies suggest a correlation

between the efficiency of ROS detoxification and plant salt stress

tolerance (Türkan and Demiral 2009). High salinity was reported to

increase the activity or accumulation of antioxidant enzymes and

non-enzymatic antioxidants, respectively, but high variability was

found among different plant species and even between cultivars

(Ashraf 2009). Rice salt-tolerant cultivars were shown to display

higher accumulation of reduced ascorbic acid and enhanced activity

of antioxidant enzymes, as compared to a salt-sensitive cultivar

(Moradi and Ismail 2007). In addition, over-expression of genes

encoding antioxidant enzymes was shown to enhance plant salt

stress tolerance. Arabidopsis plants over-expressing a manganese-

SOD (Mn-SOD) displayed increased salt tolerance and increased

activity of other antioxidant enzymes (Gill and Tuteja 2010). Similarly,

enhanced salt tolerance was observed in Arabidopsis plants over-

expressing HvAPX1 or OsAPXa from barley and rice, respectively

(Gill and Tuteja 2010).

Salt stress response mechanisms that occur at whole plant level

are mainly related to the control of Na+ uptake and its distribution

within the plant (Tester and Davenport 2003). To restrict Na+


34

accumulation in the shoot, plants can enhance the ion efflux to the

soil solution, reduce its initial entry in the plant, minimize ion entry

into the xylem stream, maximize its retrieval before reaching the

shoots and secrete it onto the surface of the leaf (Tester and

Davenport 2003). Exclusion of Na+ across the plasma membrane to

the soil solution was proposed to involve Na+/H+ antiporters (Hauser

and Horie 2010; Plett and Moller 2010). The SOS1 was suggested to

participate in this process at the epidermis of Arabidopsis root tips.

The initial entry of Na+ in the plant is mediated by Ca2+-sensitive and

insensitive processes (Plett and Moller 2010). Cyclic nucleotide-

gated channels (CNGCs) and glutamate-activated channels (GLRs)

are examples of non-selective cation channels (NSCCs) putatively

involved in Ca2+-sensitive Na+ influx. The OsCNGC1 gene was

shown to be differentially expressed in rice salt-sensitive and salt-

tolerant cultivars (Plett and Moller 2010). Tolerant cultivars displayed

decreased OsCNGC1 gene expression which was proposed to

explain the restricted Na+ influx detected in this cultivar. Enhanced

sensitivity to ionic stress caused by Na+ and K+ was detected in

Arabidopsis plants over-expressing AtGLR3;2, suggesting that this

transporter is involved in Na+ influx. Ca2+-insensitive Na+ influx was

proposed to occur through NSCCs and to involve members of the

high-affinity K+ (HKT) family, but their exact function is unknown

(Hauser and Horie 2010). The mechanisms involved in Na+ loading

into the xylem are also largely unknown. In Arabidopsis the SOS

pathway was proposed to be involved in the active efflux of Na+ to

the xylem under moderate Na+ concentrations (Tester and Davenport

2003). Removal of Na+ from the xylem before it reaches the shoots is

a common mechanism of salt tolerance among Arabidopsis and crop

species like rice and wheat (Hauser and Horie 2010). Members of

the HKT family were proposed to be involved in this process.

Chapter I

35

Arabidopsis AtHKT1;1 was shown to exclude Na+ from the xylem and

indirectly stimulate K+ loading, to maintain a high K+/Na+ ratio in

shoots (Hauser and Horie 2010). The AtHKT1;1 ortholog OsHKT1;5

from rice was reported to function in Na+ retrieval from xylem but its

role in K+ homeostasis was not confirmed (Hauser and Horie 2010).

Another mechanism to reduce Na+ concentration in the shoots is

through ion excretion by salt glands (modified trichomes) or bladders

(modified epidermal cells) (Munns and Tester 2008). However, this

specialized cell types are mainly present in halophytes (Munns

2002).

A better understanding of the molecular mechanisms underlying

tolerance to abiotic stress conditions may support the design of

improved strategies to apply in breeding programs not only for rice

but also for other crops.

Research Objectives

Many genes have been shown to play important roles in abiotic

stress responses in different plants. However, little is known about

their upstream regulation. In order to contribute to narrow this gap,

the main goal of this study was to identify and characterize

transcription factors (TFs) regulating a target gene selected for its

high response to salt stress. Therefore, this thesis started by

analyzing in detail different genes described in the literature as

responsive to high salinity. Their putative biological function as well

as expression profile under high salinity, were main criteria for

selection of the best candidate for follow up.

To identify the TFs binding to the target gene, we aimed to use an

yeast one-hybrid (Y1H) screening, using a salt-induced cDNA

expression library, also to be prepared during this study.

Electrophoretic mobility shift assays and transient expression assays


36

in Arabidopsis protoplasts were planned to confirm the protein-DNA

interaction and to characterize the TFs transcriptional activity,

respectively.

For functional analysis of the novel TFs, transcription expression

patterns under abiotic stress conditions (e.g. high salinity, drought,

ABA and low temperature treatments) were designed. TF subcellular

localization was assessed by transient expression of the TF proteins

fused to GFP in onion epidermal cells and/or Arabidopsis

protoplasts. The biological function of the TFs was investigated

through over-expression in Arabidopsis plants, and further

characterized regarding seed germination rate, root growth and

survival rate under abiotic stress. In addition, Arabidopsis mutants for

genes homologous to the rice TFs have been complemented through

heterologous expression.

References

Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003)

Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as

transcriptional activators in abscisic acid signaling. Plant Cell 15: 63-78

Agarwal M, Hao Y, Kapoor A, Dong CH, Fujii H, Zheng X, Zhu JK (2006a) A

R2R3 type MYB transcription factor is involved in the cold regulation of

CBF genes and in acquired freezing tolerance. J Biol Chem 281: 37636-

37645

Agarwal PK, Agarwal P, Reddy MK, Sopory SK (2006b) Role of DREB

transcription factors in abiotic and biotic stress tolerance in plants. Plant

Cell Rep 25: 1263-1274

Agarwal PK, Jha B (2010) Transcription factors in plants and ABA

dependent and independent abiotic stress signalling. Biol Plantarum 54:

201-212

Agrawal GK, Tamogami S, Iwahashi H, Agrawal VP, Rakwal R (2003)

Transient regulation of jasmonic acid-inducible rice MAP kinase gene

Chapter I

37

(OsBWMK1) by diverse biotic and abiotic stresses. Plant Physiol

Biochem 41 355-361

Alzwiy IA, Morris PC (2007) A mutation in the Arabidopsis MAP kinase

kinase 9 gene results in enhanced seedling stress tolerance. Plant Sci

173: 302-308

Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidative

stress, and signal transduction. Annu Rev Plant Biol 55: 373-399

Ashraf M (2009) Biotechnological approach of improving plant salt tolerance

using antioxidants as markers. Biotechnol Adv 27: 84-93

Baker SS, Wilhelm KS, Thomashow MF (1994) The 5'-region of Arabidopsis

thaliana cor15a has cis-acting elements that confer cold-, drought- and

ABA-regulated gene expression. Plant Mol Biol 24: 701-713

Bartels D, Sunkar R (2005) Drought and salt tolerance in plants. Crit Rev

Plant Sci 24: 23-58

Bhushan D, Pandey A, Choudhary MK, Datta A, Chakraborty S,

Chakraborty N (2007) Comparative proteomics analysis of differentially

expressed proteins in chickpea extracellular matrix during dehydration

stress. Mol Cell Proteomics 6: 1868-1884

Buell CR, Last RL (2010) Twenty-first century plant biology: impacts of the

Arabidopsis genome on plant biology and agriculture. Plant Physiol 154:

497-500

Cao YF, Wu YF, Zheng Z, Song FM (2005) Overexpression of the rice

EREBP-like gene OsBIERF3 enhances disease resistance and salt

tolerance in transgenic tobacco. Physiol Mol Plant Pathol 67: 202-211

Casasoli M, Spadoni S, Lilley KS, Cervone F, De Lorenzo G, Mattei B

(2008) Identification by 2-D DIGE of apoplastic proteins regulated by

oligogalacturonides in Arabidopsis thaliana. Proteomics 8: 1042-1054

Chaves MM, Flexas J, Pinheiro C (2009) Photosynthesis under drought and

salt stress: regulation mechanisms from whole plant to cell. Ann Bot 103:

551-560

Chen M, Chen Q-J, Niu X-G, Zhang R, Lin H-Q, Xu C-Y, Wang X-C, Wang

G-Y, Chen J (2007) Expression of OsNHX1 gene in maize confers salt


38

tolerance and promotes plant growth in the field. Plant Soil Environ 53:

490-498

Chen Z (2001) A superfamily of proteins with novel cysteine-rich repeats.

Plant Physiol 126: 473-476

Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH, Park CY, Kim JC,

Park BO, Koo SC, Yoon HW, Chung WS, Lim CO, Lee SY, Cho MJ

(2003) BWMK1, a rice mitogen-activated protein kinase, locates in the

nucleus and mediates pathogenesis-related gene expression by

activation of a transcription factor. Plant Physiol 132: 1961-1972

Chinnusamy V, Jagendorf A, Zhu J-K (2005) Understanding and improving

salt tolerance in plants. Crop Science 45: 437-448

Chinnusamy V, Ohta M, Kanrar S, Lee BH, Hong X, Agarwal M, Zhu JK

(2003) ICE1: a regulator of cold-induced transcriptome and freezing

tolerance in Arabidopsis. Genes Dev 17: 1043-1054

Chinnusamy V, Zhu J, Zhu JK (2007) Cold stress regulation of gene

expression in plants. Trends Plant Sci 12: 444-451

Dai X, Xu Y, Ma Q, Xu W, Wang T, Xue Y, Chong K (2007) Overexpression

of an R1R2R3 MYB gene, OsMYB3R-2, increases tolerance to freezing,

drought, and salt stress in transgenic Arabidopsis. Plant Physiol 143:

1739-1751

Dani V, Simon WJ, Duranti M, Croy RR (2005) Changes in the tobacco leaf

apoplast proteome in response to salt stress. Proteomics 5: 737-745

de Lorenzo L, Merchan F, Laporte P, Thompson R, Clarke J, Sousa C,

Crespi M (2009) A novel plant leucine-rich repeat receptor kinase

regulates the response of Medicago truncatula roots to salt stress. Plant

Cell 21: 668-680

DeFalco TA, Bender KW, Snedden WA (2010) Breaking the code: Ca2+

sensors in plant signalling. Biochem J 425: 27-40

Dietz KJ, Vogel MO, Viehhauser A (2010) AP2/EREBP transcription factors

are part of gene regulatory networks and integrate metabolic, hormonal

and environmental signals in stress acclimation and retrograde

signalling. Protoplasma 245: 3-14

Chapter I

39

Doczi R, Brader G, Pettko-Szandtner A, Rajh I, Djamei A, Pitzschke A,

Teige M, Hirt H (2007) The Arabidopsis mitogen-activated protein kinase

kinase MKK3 is upstream of group C mitogen-activated protein kinases

and participates in pathogen signaling. Plant Cell 19: 3266-3279

Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura S, Seki M,

Shinozaki K, Yamaguchi-Shinozaki K (2003) OsDREB genes in rice,

Oryza sativa L., encode transcription activators that function in drought-,

high-salt- and cold-responsive gene expression. Plant J 33: 751-763

Feilner T, Hultschig C, Lee J, Meyer S, Immink RG, Koenig A, Possling A,

Seitz H, Beveridge A, Scheel D, Cahill DJ, Lehrach H, Kreutzberger J,

Kersten B (2005) High throughput identification of potential Arabidopsis

mitogen-activated protein kinases substrates. Mol Cell Proteomics 4:

1558-1568

Feller A, Machemer K, Braun EL, Grotewold E (2011) Evolutionary and

comparative analysis of MYB and bHLH plant transcription factors. Plant

J 66: 94-116

Feuillet C, Leach JE, Rogers J, Schnable PS, Eversole K (2011) Crop

genome sequencing: lessons and rationales. Trends Plant Sci 16: 77-88

Finkelstein RR, Gampala SS, Rock CD (2002) Abscisic acid signaling in

seeds and seedlings. Plant Cell 14 Suppl: S15-45

Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000)

Arabidopsis ethylene-responsive element binding factors act as

transcriptional activators or repressors of GCC box-mediated gene

expression. Plant Cell 12: 393-404

Fujita Y, Fujita M, Satoh R, Maruyama K, Parvez MM, Seki M, Hiratsu K,

Ohme-Takagi M, Shinozaki K, Yamaguchi-Shinozaki K (2005) AREB1 is

a transcription activator of novel ABRE-dependent ABA signaling that

enhances drought stress tolerance in Arabidopsis. Plant Cell 17: 3470-

3488

Fukao T, Yeung E, Bailey-Serres J (2011) The submergence tolerance

regulator SUB1A mediates crosstalk between submergence and drought

tolerance in rice. Plant Cell 23: 412-427


40

Fukuda A, Nakamura A, Tagiri A, Tanaka H, Miyao A, Hirochika H, Tanaka

Y (2004) Function, intracellular localization and the importance in salt

tolerance of a vacuolar Na(+)/H(+) antiporter from rice. Plant Cell Physiol

45: 146-159

Furihata T, Maruyama K, Fujita Y, Umezawa T, Yoshida R, Shinozaki K,

Yamaguchi-Shinozaki K (2006) Abscisic acid-dependent multisite

phosphorylation regulates the activity of a transcription activator AREB1.

Proc Natl Acad Sci USA 103: 1988-1993

Gao JP, Chao DY, Lin HX (2007) Understanding abiotic stress tolerance

mechanisms: recent studies on stress response in rice. J Integr Plant

Biol 49: 742-750

Gao JP, Chao DY, Lin HX (2008) Toward understanding molecular

mechanisms of abiotic stress responses in rice. Rice 1: 36-51

Gill SS, Tuteja N (2010) Reactive oxygen species and antioxidant

machinery in abiotic stress tolerance in crop plants. Plant Physiol

Biochem 48: 909-930

Gish LA, Clark SE (2011) The RLK/Pelle family of kinases. Plant J 66: 117-

127

Gomez-Porras JL, Riano-Pachon DM, Dreyer I, Mayer JE, Mueller-Roeber

B (2007) Genome-wide analysis of ABA-responsive elements ABRE and

CE3 reveals divergent patterns in Arabidopsis and rice. BMC Genomics

8: 260

Gujja B, Thiyagarajan TM (2010) Producing more with less: exploring farm-

based approaches to improve productivity and providing options to

farmers in adapting to climate change. International Rice Research

Institute (IRRI) Limited Proceedings Series: 1-7

Gutha LR, Reddy AR (2008) Rice DREB1B promoter shows distinct stress-

specific responses, and the overexpression of cDNA in tobacco confers

improved abiotic and biotic stress tolerance. Plant Mol Biol 68: 533-555

Gutterson N, Reuber TL (2004) Regulation of disease resistance pathways

by AP2/ERF transcription factors. Curr Opin Plant Biol 7: 465-471

Haffani Y, Silva N, Goring D (2004) Receptor kinase signaling in plants. Can

J Bot 82: 1-15

Chapter I

41

Hamel LP, Nicole MC, Sritubtim S, Morency MJ, Ellis M, Ehlting J, Beaudoin

N, Barbazuk B, Klessig D, Lee J, Martin G, Mundy J, Ohashi Y, Scheel

D, Sheen J, Xing T, Zhang S, Seguin A, Ellis BE (2006) Ancient signals:

comparative genomics of plant MAPK and MAPKK gene families. Trends

Plant Sci 11: 192-198

Hand SC, Menze MA, Toner M, Boswell L, Moore D (2011) LEA Proteins

During Water Stress: Not Just for Plants Anymore. Annu Rev Physiol 73:

115-134

Hauser F, Horie T (2010) A conserved primary salt tolerance mechanism

mediated by HKT transporters: a mechanism for sodium exclusion and

maintenance of high K(+)/Na(+) ratio in leaves during salinity stress.

Plant Cell Environ 33: 552-565

He C, Fong SH, Yang D, Wang GL (1999) BWMK1, a novel MAP kinase

induced by fungal infection and mechanical wounding in rice. Mol Plant

Microbe Interact 12: 1064-1073

Hirayama T, Shinozaki K (2010) Research on plant abiotic stress responses

in the post-genome era: past, present and future. Plant J 61: 1041-1052

Hobo T, Kowyama Y, Hattori T (1999) A bZIP factor, TRAB1, interacts with

VP1 and mediates abscisic acid-induced transcription. Proc Natl Acad

Sci USA 96: 15348-15353

Hossain MA, Cho JI, Han M, Ahn CH, Jeon JS, An G, Park PB (2010a) The

ABRE-binding bZIP transcription factor OsABF2 is a positive regulator of

abiotic stress and ABA signaling in rice. J Plant Physiol 167: 1512-1520

Hossain MA, Lee Y, Cho JI, Ahn CH, Lee SK, Jeon JS, Kang H, Lee CH, An

G, Park PB (2010b) The bZIP transcription factor OsABF1 is an ABA

responsive element binding factor that enhances abiotic stress signaling

in rice. Plant Mol Biol 72: 557-566

Hsiao TC, Xu LK (2000) Sensitivity of growth of roots versus leaves to water

stress: biophysical analysis and relation to water transport. J Exp Bot 51:

1595-1616

Hubbard KE, Nishimura N, Hitomi K, Getzoff ED, Schroeder JI (2010) Early

abscisic acid signal transduction mechanisms: newly discovered

components and newly emerging questions. Genes Dev 24: 1695-1708


42

Hussain SS, Iqbal MT, Arif MA, Amjad M (2011) Beyond osmolytes and

transcription factors: drought tolerance in plants via protective proteins

and aquaporins. Biol Plantarum 55: 401-413

Ichimura K, Shinozaki K, Tena G, Sheen J, Henry Y, Champion A, Kreis M,

Zhang SQ, Hirt H, Wilson C, Heberle-Bors E, Ellis BE, Morris PC, Innes

RW, Jr E, Scheel D, Klessig DF, Machida Y, Mundy J, Ohashi Y, Walker

JC, Grp M (2002) Mitogen-activated protein kinase cascades in plants: a

new nomenclature. Trends Plant Sci 7: 301-308

IRGSP IRGSP (2005) The map-based sequence of the rice genome. Nature

436: 793-800

Ito Y, Katsura K, Maruyama K, Taji T, Kobayashi M, Seki M, Shinozaki K,

Yamaguchi-Shinozaki K (2006) Functional analysis of rice DREB1/CBF-

type transcription factors involved in cold-responsive gene expression in

transgenic rice. Plant Cell Physiol 47: 141-153

Jakoby M, Weisshaar B, Droge-Laser W, Vicente-Carbajosa J, Tiedemann

J, Kroj T, Parcy F (2002) bZIP transcription factors in Arabidopsis.

Trends Plant Sci 7: 106-111

Jaspers P, Kangasjarvi J (2010) Reactive oxygen species in abiotic stress

signaling. Physiol Plant 138: 405-413

Jeong JS, Kim YS, Baek KH, Jung H, Ha SH, Do Choi Y, Kim M, Reuzeau

C, Kim JK (2010) Root-specific expression of OsNAC10 improves

drought tolerance and grain yield in rice under field drought conditions.


Jiang C, Iu B, Singh J (1996) Requirement of a CCGAC cis-acting element

for cold induction of the BN115 gene from winter Brassica napus. Plant

Mol Biol 30: 679-684

Jiang J, Li J, Xu Y, Han Y, Bai Y, Zhou G, Lou Y, Xu Z, Chong K (2007)

RNAi knockdown of Oryza sativa root meander curling gene led to

altered root development and coiling which were mediated by jasmonic

acid signalling in rice. Plant Cell Environ 30: 690-699

Kagaya Y, Hobo T, Murata M, Ban A, Hattori T (2002) Abscisic acid-induced

transcription is mediated by phosphorylation of an abscisic acid

response element binding factor, TRAB1. Plant Cell 14: 3177-3189

Chapter I

43

Kim MC, Chung WS, Yun DJ, Cho MJ (2009) Calcium and calmodulin-

mediated regulation of gene expression in plants. Mol Plant 2: 13-21

Kim ST, Cho KS, Yu S, Kim SG, Hong JC, Han CD, Bae DW, Nam MH,

Kang KY (2003) Proteomic analysis of differentially expressed proteins

induced by rice blast fungus and elicitor in suspension-cultured rice cells.

Proteomics 3: 2368-2378

Kim ST, Kim SG, Hwang DH, Kang SY, Kim HJ, Lee BH, Lee JJ, Kang KY

(2004) Proteomic analysis of pathogen-responsive proteins from rice

leaves induced by rice blast fungus, Magnaporthe grisea. Proteomics 4:

3569-3578

Kim TH, Bohmer M, Hu H, Nishimura N, Schroeder JI (2010) Guard cell

signal transduction network: advances in understanding abscisic acid,

CO2, and Ca2+

signaling. Annu Rev Plant Biol 61: 561-591

Kizis D, Lumbreras V, Pages M (2001) Role of AP2/EREBP transcription

factors in gene regulation during abiotic stress. FEBS Lett 498: 187-189

Kobayashi Y, Murata M, Minami H, Yamamoto S, Kagaya Y, Hobo T,

Yamamoto A, Hattori T (2005) Abscisic acid-activated SNRK2 protein

kinases function in the gene-regulation pathway of ABA signal

transduction by phosphorylating ABA response element-binding factors.

Plant J 44: 939-949

Koo SC, Yoon HW, Kim CY, Moon BC, Cheong YH, Han HJ, Lee SM, Kang

KY, Kim MC, Lee SY, Chung WS, Cho MJ (2007) Alternative splicing of

the OsBWMK1 gene generates three transcript variants showing

differential subcellular localizations. Biochem Bioph Res Co 360: 188-

193

Koornneef M, Meinke D (2010) The development of Arabidopsis as a model

plant. Plant J 61: 909-921

Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K,

Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with

an EREBP/AP2 DNA binding domain separate two cellular signal

transduction pathways in drought- and low-temperature-responsive gene

expression, respectively, in Arabidopsis. Plant Cell 10: 1391-1406


44

Liu Q, Xue Q (2007) Computational identification and phylogenetic analysis

of the MAPK gene family in Oryza sativa. Plant Physiol Biochem 45: 6-

14

Liu S, Zheng L, Xue Y, Zhang Q, Wang L, Shou H (2010) Overexpression of

OsVP1 and OsNHX1 increases tolerance to drought and salinity in rice.

J Plant Biol 53: 444-452

Luan S (2009) The CBL-CIPK network in plant calcium signaling. Trends

Plant Sci 14: 37-42

Ma Q, Dai X, Xu Y, Guo J, Liu Y, Chen N, Xiao J, Zhang D, Xu Z, Zhang X,

Chong K (2009) Enhanced tolerance to chilling stress in OsMYB3R-2

transgenic rice is mediated by alteration in cell cycle and ectopic

expression of stress genes. Plant Physiol 150: 244-256

Magnani E, Sjolander K, Hake S (2004) From endonucleases to

transcription factors: evolution of the AP2 DNA binding domain in plants.

Plant Cell 16: 2265-2277

Mahajan S, Tuteja N (2005) Cold, salinity and drought stresses: an

overview. Arch Biochem Biophys 444: 139-158

Matsukura S, Mizoi J, Yoshida T, Todaka D, Ito Y, Maruyama K, Shinozaki

K, Yamaguchi-Shinozaki K (2010) Comprehensive analysis of rice

DREB2-type genes that encode transcription factors involved in the

expression of abiotic stress-responsive genes. Mol Genet Genomics

283: 185-196

Mayer KF, Martis M, Hedley PE, Simkova H, Liu H, Morris JA, Steuernagel

B, Taudien S, Roessner S, Gundlach H, Kubalakova M, Suchankova P,

Murat F, Felder M, Nussbaumer T, Graner A, Salse J, Endo T, Sakai H,

Tanaka T, Itoh T, Sato K, Platzer M, Matsumoto T, Scholz U, Dolezel J,

Waugh R, Stein N (2011) Unlocking the barley genome by chromosomal

and comparative genomics. Plant Cell 23: 1249-1263

Mazzucotelli E, Mastrangelo AM, Crosatti C, Guerra D, Stanca AM,

Cattivelli L (2008) Abiotic stress response in plants: when post-

transcriptional and post-translational regulations control transcription.

Plant Sci 174: 420-431

Chapter I

45

Mittler R, Vanderauwera S, Suzuki N, Miller G, Tognetti VB, Vandepoele K,

Gollery M, Shulaev V, Van Breusegem F (2011) ROS signaling: the new

wave? Trends Plant Sci 16: 300-309

Miura K, Jin JB, Hasegawa PM (2007) Sumoylation, a post-translational

regulatory process in plants. Curr Opin Plant Biol 10: 495-502

Mizoi J, Shinozaki K, Yamaguchi-Shinozaki K (2012) AP2/ERF family

transcription factors in plant abiotic stress responses. Biochim Biophys

Acta 1819: 86-96

Molina J, Sikora M, Garud N, Flowers JM, Rubinstein S, Reynolds A, Huang

P, Jackson S, Schaal BA, Bustamante CD, Boyko AR, Purugganan MD

(2011) Molecular evidence for a single evolutionary origin of

domesticated rice. Proc Natl Acad Sci USA 108: 8351-8356

Moller IM, Sweetlove LJ (2010) ROS signalling-specificity is required.


Monshausen GB, Gilroy S (2009) Feeling green: mechanosensing in plants.

Trends Cell Biol 19: 228-235

Moradi F, Ismail AM (2007) Responses of photosynthesis, chlorophyll

fluorescence and ROS-scavenging systems to salt stress during

seedling and reproductive stages in rice. Ann Bot (Lond) 99: 1161-1173

Morillo SA, Tax FE (2006) Functional analysis of receptor-like kinases in

monocots and dicots. Curr Opin Plant Biol 9: 460-469

Movahedi S, Van de Peer Y, Vandepoele K (2011) Comparative network

analysis reveals that tissue specificity and gene function are important

factors influencing the mode of expression evolution in Arabidopsis and

rice. Plant Physiol 156: 1316-1330

Mukherjee K, Choudhury AR, Gupta B, Gupta S, Sengupta DN (2006) An

ABRE-binding factor, OSBZ8, is highly expressed in salt tolerant

cultivars than in salt sensitive cultivars of indica rice. BMC Plant Biol 6:

18

Munns R (2002) Comparative physiology of salt and water stress. Plant Cell

Environ 25: 239-250

Munns R, Tester M (2008) Mechanisms of salinity tolerance. Annu Rev

Plant Biol 59: 651-681


46

Nakashima K, Ito Y, Yamaguchi-Shinozaki K (2009) Transcriptional

regulatory networks in response to abiotic stresses in Arabidopsis and

grasses. Plant Physiol 149: 88-95

Nakashima K, Tran LS, Van Nguyen D, Fujita M, Maruyama K, Todaka D,

Ito Y, Hayashi N, Shinozaki K, Yamaguchi-Shinozaki K (2007)

Functional analysis of a NAC-type transcription factor OsNAC6 involved

in abiotic and biotic stress-responsive gene expression in rice. Plant J

51: 617-630

Negrao S, Courtois B, Ahmadi N, Abreu I, Saibo N, Oliveira MM (2011)

Recent Updates on Salinity Stress in Rice: From Physiological to

Molecular Responses. Critical Reviews in Plant Sciences 30: 329-377

Ning J, Li X, Hicks LM, Xiong L (2010) A Raf-like MAPKKK gene DSM1

mediates drought resistance through reactive oxygen species

scavenging in rice. Plant Physiol 152: 876-890

Oh SJ, Kim YS, Kwon CW, Park HK, Jeong JS, Kim JK (2009)

Overexpression of the transcription factor AP37 in rice improves grain

yield under drought conditions. Plant Physiol 150: 1368-1379

Olsen AN, Ernst HA, Leggio LL, Skriver K (2005) NAC transcription factors:

structurally distinct, functionally diverse. Trends Plant Sci 10: 79-87

Pandey A, Rajamani U, Verma J, Subba P, Chakraborty N, Datta A,

Chakraborty S (2010) Identification of extracellular matrix proteins of rice

(Oryza sativa L.) involved in dehydration-responsive network: a

proteomic approach. J Proteome Res 9: 3443-3464

Park MR, Yun KY, Mohanty B, Herath V, Xu F, Wijaya E, Bajic VB, Yun SJ,

De Los Reyes BG (2010) Supra-optimal expression of the cold-regulated

OsMyb4 transcription factor in transgenic rice changes the complexity of

transcriptional network with major effects on stress tolerance and panicle

development. Plant Cell Environ 33: 2209-2230

Pignocchi C, Foyer CH (2003) Apoplastic ascorbate metabolism and its role

in the regulation of cell signalling. Curr Opin Plant Biol 6: 379-389

Pitzschke A, Djamei A, Bitton F, Hirt H (2009) A major role of the MEKK1-

MKK1/2-MPK4 pathway in ROS signalling. Mol Plant 2: 120-137

Chapter I

47

Plett DC, Moller IS (2010) Na(+) transport in glycophytic plants: what we

know and would like to know. Plant Cell Environ 33: 612-626

Popescu SC, Popescu GV, Bachan S, Zhang Z, Gerstein M, Snyder M,

Dinesh-Kumar SP (2009) MAPK target networks in Arabidopsis thaliana

revealed using functional protein microarrays. Genes Dev 23: 80-92

Qin F, Sakuma Y, Tran LS, Maruyama K, Kidokoro S, Fujita Y, Fujita M,

Umezawa T, Sawano Y, Miyazono K, Tanokura M, Shinozaki K,

Yamaguchi-Shinozaki K (2008) Arabidopsis DREB2A-interacting

proteins function as RING E3 ligases and negatively regulate plant

drought stress-responsive gene expression. Plant Cell 20: 1693-1707

Reddy VS, Reddy AS (2004) Proteomics of calcium-signaling components

in plants. Phytochemistry 65: 1745-1776

Rensink WA, Buell CR (2004) Arabidopsis to rice. Applying knowledge from

a weed to enhance our understanding of a crop species. Plant Physiol

135: 622-629

Rodriguez MC, Petersen M, Mundy J (2010) Mitogen-activated protein

kinase signaling in plants. Annu Rev Plant Biol 61: 621-649

Rojo E, Sharma VK, Kovaleva V, Raikhel NV, Fletcher JC (2002) CLV3 is

localized to the extracellular space, where it activates the Arabidopsis

CLAVATA stem cell signaling pathway. Plant Cell 14: 969-977

Ronald PC, Jung KH, An GH (2008) Towards a better bowl of rice:

assigning function to tens of thousands of rice genes. Nat Rev Genet 9:

91-101

Roy P, Orikasa T, Okadome H, Nakamura N, Shiina T (2011) Processing

conditions, rice properties, health and environment. Int J Environ Res

Public Health 8: 1957-1976

RoyChoudhury A, Gupta B, Sengupta DN (2008) Trans-acting factor

designated OSBZ8 interacts with both typical abscisic acid responsive

elements as well as abscisic acid responsive element-like sequences in

the vegetative tissues of indica rice cultivars. Plant Cell Rep 27: 779-794

Saibo NJ, Lourenco T, Oliveira MM (2009) Transcription factors and

regulation of photosynthetic and related metabolism under

environmental stresses. Ann Bot 103: 609-623


48

Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki

K (2002) DNA-binding specificity of the ERF/AP2 domain of Arabidopsis

DREBs, transcription factors involved in dehydration- and cold-inducible

gene expression. Biochem Biophys Res Commun 290: 998-1009

Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki K,

Yamaguchi-Shinozaki K (2006) Functional analysis of an Arabidopsis

transcription factor, DREB2A, involved in drought-responsive gene


Santos AP, Serra T, Figueiredo DD, Barros P, Lourenco T, Chander S,

Oliveira MM, Saibo NJ (2011) Transcription regulation of abiotic stress


epigenetic mechanisms. OMICS 15: 839-857

Schutze K, Harter K, Chaban C (2008) Post-translational regulation of plant

bZIP factors. Trends Plant Sci 13: 247-255

Seifert GJ, Blaukopf C (2010) Irritable walls: the plant extracellular matrix

and signaling. Plant Physiol 153: 467-478

Shao HB, Guo QJ, Chu LY, Zhao XN, Su ZL, Hu YC, Cheng JF (2007)

Understanding molecular mechanism of higher plant plasticity under

abiotic stress. Colloids Surf B Biointerfaces 54: 37-45

Shen S, Jing Y, Kuang T (2003) Proteomics approach to identify wound-

response related proteins from rice leaf sheath. Proteomics 3: 527-535

Siberil Y, Doireau P, Gantet P (2001) Plant bZIP G-box binding factors.

Modular structure and activation mechanisms. Eur J Biochem 268: 5655-

5666

Sinha AK, Jaggi M, Raghuram B, Tuteja N (2011) Mitogen-activated protein

kinase signaling in plants under abiotic stress. Plant Signal Behav 6:

196-203

Skinner J, Szucs P, von Zitzewitz J, Marquez-Cedillo L, Filichkin T,

Stockinger EJ, Thomashow MF, Chen THH, Hayes PM (2006) Mapping

of barley homologs to genes that regulate low temperature tolerance in

Arabidopsis. Theor Appl Genet 112: 832-842

Sohn KH, Lee SC, Jung HW, Hong JK, Hwang BK (2006) Expression and

functional roles of the pepper pathogen-induced transcription factor

Chapter I

49

RAV1 in bacterial disease resistance, and drought and salt stress

tolerance. Plant Mol Biol 61: 897-915

Spannagl M, Mayer K, Durner J, Haberer G, Frohlich A (2011) Exploring the

genomes: from Arabidopsis to crops. J Plant Physiol 168: 3-8

Stockinger EJ, Gilmour SJ, Thomashow MF (1997) Arabidopsis thaliana

CBF1 encodes an AP2 domain-containing transcriptional activator that

binds to the C-repeat/DRE, a cis-acting DNA regulatory element that

stimulates transcription in response to low temperature and water deficit.

Proc Natl Acad Sci USA 94: 1035-1040

Su CF, Wang YC, Hsieh TH, Lu CA, Tseng TH, Yu SM (2010) A novel

MYBS3-dependent pathway confers cold tolerance in rice. Plant Physiol

153: 145-158

Sun X, Wang GL (2011) Genome-wide identification, characterization and

phylogenetic analysis of the rice LRR-kinases. PLoS ONE 6: e16079

Swaminathan K, Peterson K, Jack T (2008) The plant B3 superfamily.


Takasaki H, Maruyama K, Kidokoro S, Ito Y, Fujita Y, Shinozaki K,

Yamaguchi-Shinozaki K, Nakashima K (2010) The abiotic stress-

responsive NAC-type transcription factor OsNAC5 regulates stress-

inducible genes and stress tolerance in rice. Mol Genet Genomics 284:

173-183

Teige M, Scheikl E, Eulgem T, Doczi R, Ichimura K, Shinozaki K, Dangl JL,

Hirt H (2004) The MKK2 pathway mediates cold and salt stress signaling

in Arabidopsis. Mol Cell 15: 141-152

ten Hove CA, Bochdanovits Z, Jansweijer VM, Koning FG, Berke L,

Sanchez-Perez GF, Scheres B, Heidstra R (2011) Probing the roles of

LRR RLK genes in Arabidopsis thaliana roots using a custom T-DNA

insertion set. Plant Mol Biol 76: 69-83

Tester M, Davenport R (2003) Na+ tolerance and Na

+ transport in higher

plants. Ann Bot 91: 503-527

Tran LS, Nakashima K, Sakuma Y, Osakabe Y, Qin F, Simpson SD,

Maruyama K, Fujita Y, Shinozaki K, Yamaguchi-Shinozaki K (2007) Co-

expression of the stress-inducible zinc finger homeodomain ZFHD1 and


50

NAC transcription factors enhances expression of the ERD1 gene in

Arabidopsis. Plant J 49: 46-63

Türkan I, Demiral T (2009) Recent developments in understanding salinity

tolerance. Env Exp Bot 67: 2–9

Tuteja N, Mahajan S (2007) Calcium signaling network in plants: an

overview. Plant Signal Behav 2: 79-85

Umezawa T, Nakashima K, Miyakawa T, Kuromori T, Tanokura M,

Shinozaki K, Yamaguchi-Shinozaki K (2010) Molecular basis of the core

regulatory network in ABA responses: sensing, signaling and transport.

Plant Cell Physiol 51: 1821-1839

Vannini C, Iriti M, Bracale M, Locatelli F, Faoro F, Croce P, Pirona R, Di

Maro A, Coraggio I, Genga A (2006) The ectopic expression of the rice

Osmyb4 gene in Arabidopsis increases tolerance to abiotic,

environmental and biotic stresses. Physiol Mol Plant Pathol 69: 26-42

Vogel JT, Zarka DG, Van Buskirk HA, Fowler SG, Thomashow MF (2005)

Roles of the CBF2 and ZAT12 transcription factors in configuring the low

temperature transcriptome of Arabidopsis. Plant J 41: 195-211

Wang Q, Guan Y, Wu Y, Chen H, Chen F, Chu C (2008) Overexpression of

a rice OsDREB1F gene increases salt, drought, and low temperature

tolerance in both Arabidopsis and rice. Plant Mol Biol 67: 589-602

Wang W, Vinocur B, Shoseyov O, Altman A (2004) Role of plant heat-shock

proteins and molecular chaperones in the abiotic stress response.


Woo HR, Kim JH, Kim J, Lee U, Song IJ, Lee HY, Nam HG, Lim PO (2010)

The RAV1 transcription factor positively regulates leaf senescence in

Arabidopsis. J Exp Bot 61: 3947-3957

Wrzaczek M, Brosche M, Salojarvi J, Kangasjarvi S, Idanheimo N,

Mersmann S, Robatzek S, Karpinski S, Karpinska B, Kangasjarvi J

(2010) Transcriptional regulation of the CRK/DUF26 group of receptor-

like protein kinases by ozone and plant hormones in Arabidopsis. BMC

Plant Biol 10: 95

Wu L, Chen X, Ren H, Zhang Z, Zhang H, Wang J, Wang XC, Huang R

(2007) ERF protein JERF1 that transcriptionally modulates the

Chapter I

51

expression of abscisic acid biosynthesis-related gene enhances the

tolerance under salinity and cold in tobacco. Planta 226: 815-825

Wu Y, Deng Z, Lai J, Zhang Y, Yang C, Yin B, Zhao Q, Zhang L, Li Y, Xie Q

(2009) Dual function of Arabidopsis ATAF1 in abiotic and biotic stress

responses. Cell Res 19: 1279-1290

Xiong L, Schumaker KS, Zhu JK (2002) Cell signaling during cold, drought,

and salt stress. Plant Cell 14 Suppl: S165-183

Xiong L, Yang Y (2003) Disease resistance and abiotic stress tolerance in

rice are inversely modulated by an abscisic acid-inducible mitogen-

activated protein kinase. Plant Cell 15: 745-759

Xu ZS, Chen M, Li LC, Ma YZ (2011) Functions and application of the

AP2/ERF transcription factor family in crop improvement. J Integr Plant

Biol 53: 570-585

Yamaguchi-Shinozaki K, Shinozaki K (2005) Organization of cis-acting

regulatory elements in osmotic- and cold-stress-responsive promoters.


Yamaguchi-Shinozaki K, Shinozaki K (2006) Transcriptional regulatory

networks in cellular responses and tolerance to dehydration and cold

stresses. Annu Rev Plant Biol 57: 781-803

Yan SP, Zhang QY, Tang ZC, Su WA, Sun WN (2006) Comparative

proteomic analysis provides new insights into chilling stress responses in

rice. Mol Cell Proteomics 5: 484-496

Zhang G, Chen M, Li L, Xu Z, Chen X, Guo J, Ma Y (2009a)

Overexpression of the soybean GmERF3 gene, an AP2/ERF type

transcription factor for increased tolerances to salt, drought, and

diseases in transgenic tobacco. J Exp Bot 60: 3781-3796

Zhang L, Tian LH, Zhao JF, Song Y, Zhang CJ, Guo Y (2009b) Identification

of an apoplastic protein involved in the initial phase of salt stress

response in rice root by two-dimensional electrophoresis. Plant Physiol

149: 916-928

Zhang W, Ruan J, Ho TH, You Y, Yu T, Quatrano RS (2005) Cis-regulatory

element based targeted gene finding: genome-wide identification of


52

abscisic acid- and abiotic stress-responsive genes in Arabidopsis

thaliana. Bioinformatics 21: 3074-3081

Zhang Y, Chen C, Jin XF, Xiong AS, Peng RH, Hong YH, Yao QH, Chen

JM (2009c) Expression of a rice DREB1 gene, OsDREB1D, enhances

cold and high-salt tolerance in transgenic Arabidopsis. Bmb Rep 42:

486-492

Zheng X, Chen B, Lu G, Han B (2009) Overexpression of a NAC

transcription factor enhances rice drought and salt tolerance. Biochem

Biophys Res Commun 379: 985-989

Zhu J, Alvarez S, Marsh EL, Lenoble ME, Cho IJ, Sivaguru M, Chen S,

Nguyen HT, Wu Y, Schachtman DP, Sharp RE (2007) Cell wall

proteome in the maize primary root elongation zone. II. Region-specific

changes in water soluble and lightly ionically bound proteins under water

deficit. Plant Physiol 145: 1533-1548

Chapter II

53

OsEREBP1 and OsEREBP2 bind to the OsRMC promoter

and may regulate its gene expression under salt

Chapter II

OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt

54

TABLE OF CONTENTS – CHAPTER II

Abstract .........................................................................................55

Introduction ...................................................................................56

Material and Methods ...................................................................59

Plant material and stress treatments .............................................59

Semi-quantitative reverse transcription-PCR (RT-PCR) analysis .........................................................................................60

cDNA expression library construction ............................................61

Generation of yeast bait strains .....................................................61

Yeast one-hybrid screening and validation ....................................62

Results ...........................................................................................63

Expression analysis of salt stress responsive genes .....................63

Identification of transcription factors binding to the OsRMC gene promoter ...............................................................................64

Protein and phylogenetic analysis of OsEREBP1 and OsEREBP2 ...................................................................................66

OsEREBP1 and OsEREBP2 gene expression under different abiotic stresses .............................................................................69

Discussion .....................................................................................71

Acknowledgments ........................................................................77

References ....................................................................................77

Chapter II

55

ABSTRACT

High salinity causes remarkable losses in rice productivity

worldwide mainly because it inhibits growth and reduces grain yield.

To cope with environmental changes, plants evolved several

adaptive mechanisms, which involve the regulation of many stress-

responsive genes. Among these, we have chosen OSBZ8, OsNAC6,

OsNHX1 and OsRMC to study their gene expression in rice

seedlings subjected to high salinity. The OsNAC6, OSBZ8 and

OsNHX1 gene expression increased, reaching a maximum after 2

hours of treatment. The OsRMC transcript, which was not detected in

control conditions, was highly induced by salt treatment and showed

a stress-dose-dependent pattern. OsRMC encodes a receptor-like

kinase described as a negative regulator of salt stress responses in

rice. To investigate how OsRMC is regulated in response to high

salinity, a salt-induced rice cDNA expression library was constructed

and subsequently screened using the OsRMC promoter as bait.

Thereby, two transcription factors, OsEREBP1 and OsEREBP2,

belonging to the AP2/ERF family were identified as binding to the

OsRMC promoter. The identified TFs were characterized regarding

their gene expression under different abiotic stress conditions. This

study revealed that OsEREBP1 transcript level is not significantly

affected by salt, ABA or severe cold (5ºC) and is only slightly

regulated by drought and moderate cold, suggesting that its

regulation by abiotic stress involves mainly post-translational

modifications. On the other hand, the OsEREBP2 transcript level

increased after cold, drought and high salinity treatments, indicating

that OsEREBP2 may play a central role mediating the response to

different abiotic stresses.


56

INTRODUCTION

Plants undergo several types of abiotic stress conditions, such as

drought, cold and high salinity, throughout their life cycle. Soil salinity

causes high losses in crop productivity worldwide mainly because it

inhibits growth and grain yield (Hasegawa et al. 2000; Pardo 2010;

Wankhade et al. 2010). To minimize the deleterious effects of salt

stress, plants need to coordinate several adaptation mechanisms

that occur at the cellular and molecular levels (Munns and Tester

2008). Cellular adaptations include the vacuolar compartmentation of

Na+ through vacuolar Na+/H+ transporters (Tester and Davenport

2003). The exclusion of excessive Na+ from the cytosol allows the

maintenance of ion homeostasis, preventing Na+-specific damage in

plant tissues leading to, among others, photosynthesis inhibition

(Hauser and Horie 2010). Na+ transport to the vacuole is

accompanied by adaptive changes at the molecular level, such as

the synthesis and accumulation of osmoprotectants in the cytosol

(Hasegawa et al. 2000; Tester and Davenport 2003; Xiong et al.

2002). Osmoprotectans, such as proline and trehalose, are involved

in the maintenance of the cell osmotic balance but also in the

scavenging of reactive oxygen species and protection of cellular

structures (Sahi et al. 2006; Tester and Davenport 2003).

Adaptation mechanisms rely on the perception and transduction

of stress signals from the environment. Stress signals can be initially

perceived by apoplast molecules, such as peptides and enzymes,

which will lead to the activation of specific signaling pathways in the

cell (Sattelmacher 2001; Zhang et al. 2009a). The rice Root Meander

Curling (OsRMC) gene was described as an apoplast protein

belonging to the DUF26 group of Receptor-Like Kinases (RLKs)

(Jiang et al. 2007; Zhang et al. 2009a). This protein was predicted to

Chapter II

57

have a receptor domain containing a Cysteine-Rich Repeat (CRR),

but no kinase or transmembrane domain, suggesting that this protein

is secreted (Chen 2001; Jiang et al. 2007). Some secreted proteins

have been described as putative ligands for receptor-like kinases in

Arabidopsis (Rojo et al. 2002), Brassicaceae (Dixit et al. 2000) and

tomato (Tang et al. 2002). The CLAVATA pathway in Arabidopsis is

one of the best characterized signaling pathways involving the

binding of a ligand (CLV3) to a receptor complex (CLV1/CLV2)

(Jeong et al. 1999; Rojo et al. 2002). The interaction between CLV3

and CLV1/CLV2 is required for the formation of the active receptor

complex involved in the regulation of meristem development. In

Brassicaceae, a cysteine-rich protein, SCR, was shown to be a

ligand for the stigma-expressed S-locus receptor kinase SRK

involved in the self-incompatibility response (Dixit et al. 2000;

Kachroo et al. 2002). Although the cysteine-rich region of SCR and

SRK is structurally distinct from the CRR domain present in OsRMC,

this apoplastic protein may be a ligand for CRR receptor-like kinases

(CRKs) regulating abiotic stress responses (Chen 2001). The role of

OsRMC in the salt stress response was previously described using

rice knockdown lines. These lines showed improved salt tolerance

associated with induction of stress-responsive genes, indicating that

OsRMC is a negative regulator of rice salt stress response (Zhang et

al. 2009a).

The regulation of abiotic stress responses relies on the ability of

transcription factors (TFs) to coordinate the expression of stress-

responsive genes (Agarwal and Jha 2010; Saibo et al. 2009). The

NAC (NAM, ATAF1,2 and CUC2), AREB (ABA Responsive Element

Binding protein) and AP2/ERF (APETALA2/Ethylene Response

Factor) families of transcription factors were shown to be highly

involved in the salt stress tolerance mechanisms (Negrão et al. 2011;


58

Roychoudhury et al. 2008; Takasaki et al. 2010; Wu et al. 2007).

NAC transcription factors regulate the expression of several genes

related to abiotic stress response, floral development, growth and

hormone signaling (Kikuchi et al. 2000; Kim et al. 2007; Ooka et al.

2003). NAC proteins with a role in abiotic stress responses include

the Arabidopsis AtNAC2 and the rice SNAC1, OsNAC5, OsNAC6

and OsNAC10 (He et al. 2005; Hu et al. 2006; Jeong et al. 2010;

Nakashima et al. 2007; Takasaki et al. 2010). Enhanced salt

tolerance was observed in Arabidopsis and rice plants over-

expressing these TFs. Several members of the AREB family regulate

the ABA-dependent stress signal transduction pathway (Agarwal and

Jha 2010). These bZIP TFs were shown to interact with the cis-

element ABRE (ABA-Responsive Element) present in the promoter

region of genes coding for various Late-Embryogenesis Abundant

(LEA) proteins (Chinnusamy et al. 2005; Yoshida et al. 2010). LEA

proteins are known to function as protection molecules, probably

acting as chaperones to prevent protein misfolding or denaturation

during stress (Bartels and Sunkar 2005; Xiong and Zhu 2002). The

AP2/ERF protein family is characterized by the presence of the AP2

DNA binding domain (Dietz et al. 2010; Okamuro et al. 1997). The

subfamily AP2 contains two AP2 domains and functions mainly in the

regulation of plant development (Okamuro et al. 1997; Zhao et al.

2006). On the other hand, the subfamilies DREB (Dehydration-

Responsive Element-Binding protein) and ERF (Ethylene-

Responsive Factor) have only a single DNA binding domain and are

involved in biotic and abiotic stress responses (Dietz et al. 2010;

Gutterson and Reuber 2004). Over-expression of genes from these

subfamilies, such as OsBIERF3 and OsDREB1D, in tobacco and

Arabidopsis, respectively, were shown to highly increase plant salt

tolerance (Cao et al. 2005; Zhang et al. 2009b).

Chapter II

59

Rice is among the most important food crops worldwide and its

productivity is highly affected by high salinity, which causes reduced

growth and grain yield. This crop shows higher sensitivity to

increases in soil salinity compared to others such as durum bread

wheat and barley (Munns and Tester 2008). Understanding the

molecular mechanisms underlying salt stress response in rice may

provide useful tools to improve its tolerance. In this work, we have

investigated the expression of the rice salt-responsive genes OSBZ8,

OsNAC6, OsNHX1 and OsRMC under salt stress conditions. Based

on this analysis, we have found OsRMC as the gene with the most

stress-dependent expression profile. The study of OsRMC

transcriptional regulation allowed us to identify and characterize two

transcription factors that bind to the OsRMC promoter and may be

associated with its salt stress response.

MATERIAL AND METHODS

Plant material and stress treatments

Rice (Oryza sativa L. cv. Nipponbare) seeds were submerged for

30 min at 50ºC in 0.1% Benlate, washed with sterile water and

disinfected with 70% ethanol for 1 min and with a solution of 2%

sodium hypochlorite containing 0.02% Tween 20 for 30 min. After

washing six times with sterile water, the seeds were germinated in

the darkness for 3 days at 28ºC in Petri dishes containing 3MM

paper pieces soaked in sterile water. Germinated seeds were

transferred to glass tubes containing Yoshida’s medium (Yoshida et

al. 1976) and grown under a 12 h photoperiod (500 μE m-2 s-1)

regime. The cDNA expression library and the expression analysis of

salt-responsive genes were performed with RNA extracted from 14

days-old rice seedlings transferred to Yoshida’s medium


60

supplemented with 100 mM or 200 mM NaCl. Samples were

collected after 0, 2, 5, 12 and 24 hours of treatment, frozen in liquid

nitrogen and kept at -80ºC until RNA extraction. The expression

pattern of the novel TF genes identified was performed using 14

days-old seedlings subjected to drought, cold (5ºC and 10ºC), salt or

ABA treatments. For the drought treatment, seedlings were left to dry

on paper towels in the flow chamber. The salt and ABA treatments

were performed using Yoshida’s medium supplemented with 200 mM

NaCl or 100 µM ABA, respectively. Shoot and root samples were

separated prior to freezing in liquid nitrogen and storage at -80ºC.

Semi-quantitative reverse transcription-PCR (RT-PCR) analysis

The gene expression analysis of the salt-responsive genes

OSBZ8 (LOC_Os01g46970), OsNAC6 (LOC_Os01g66120),

OsNHX1 (LOC_Os07g47100) and OsRMC (LOC_Os04g25650), was

performed using the total RNA purified to construct the cDNA

expression library (see below). Reverse transcription was performed

with 1 µg total RNA using an oligo-(dT)12-18 primer and the

SuperscriptII reverse transcriptase (Invitrogen, CA, USA) following

the manufacturer’s instructions. The gene expression profile of the

novel TFs identified was obtained using total RNA extracted from rice

seedlings, using the RNeasy Plant Mini kit (Qiagen, Courtaboeuf,

France). The cDNA first strand was synthesized from 1 µg total RNA

and according to the instructions from the Transcriptor High Fidelity

cDNA Synthesis Kit (Roche, Basel, Switzerland). PCR reactions

were performed using the gene specific primers described in Table 1.

The OsACT1 (LOC_Os03g50885) and OsUBC (LOC_Os02g42314)

genes were used as internal controls.

Chapter II

61

cDNA expression library construction

Total RNA was isolated from a pool of five rice seedlings

subjected to 2, 5, 12 and 24 h of treatment with 100 and 200 mM

NaCl, using the TRIzol method described by the manufacturer

(Invitrogen, CA, USA). After mRNA purification with the PolyATtract

mRNA Isolation System III (Promega, Wisconsin, USA), cDNA was

synthesized according to the HybriZAP-2.1XR cDNA synthesis kit

manual (Stratagene, CA, USA). The cDNA expression library was

constructed into the HybriZAP-2.1 vector according to the

manufacturer’s instructions. To verify the average size of the cDNA

inserts, PCR amplification was performed from 20 individual plaques

using the HybriZAP primers described in Table 1. After in vivo

excision and amplification of the excised phagemid, the cDNA library

was used to transform the yeast bait strains.

Generation of yeast bait strains

Yeast strain Y187 (Clontech, USA) was used to generate different

strains containing fragments of the OsRMC promoter as bait. The

OsRMC promoter region was defined as the 2120 bp sequence

upstream of the start codon. The promoter was divided in six

overlapping fragments with 300 to 500 bp, which were inserted in the

yeast integrative vector pINT1-HIS3 (Ouwerkerk and Meijer 2001) as

a NotI-XbaI or XbaI-SpeI fragment. The NcoI-SacI fragment of this

construct, containing the PDC6 sequences necessary for

homologous recombination, was used to transform Y187 cells. The

APT1 marker gene and the OsRMC promoter fragments are

upstream of the HIS3 reporter gene. The obtained yeast bait strains

were selected on YAPD medium containing 0.2 mM G418 (Duchefa

Biochemie B.V., Netherlands). Because some DNA promoter


62

sequences allow leaky expression of the HIS3 reporter gene, leading

to some background growth in medium lacking histidine, a 3-amino-

1,2,4-triazole (3-AT) titration was performed. 3-AT is a competitive

inhibitor of the yeast His3 enzyme and will suppress its activity

(Ouwerkerk and Meijer 2001). To assess the putative HIS3 leaky

expression, the bait strains were titrated in complete minimal medium

(CM) lacking histidine and containing up to 25 mM 3-AT. Yeast

transformations were performed by the lithium acetate polyethylene

glycol method as described by Ouwerkerk et al. (2001).

Yeast one-hybrid screening and validation

Yeast bait strains were transformed with 1 µg of cDNA library.

Transformation efficiency was assessed on CM medium without

leucine, using 100- and 1000-fold dilutions of transformation

reactions. Putative positive clones were selected on CM medium

containing 5 mM 3-AT and lacking leucine and histidine. The

identified clones were re-streaked on selective medium to confirm

growth. Direct PCR on the yeast colonies was performed to amplify

the cDNA insert, using specific primers for the library plasmid. Library

plasmid DNA was recovered from these colonies and amplified in

Escherichia coli. To validate the DNA-protein interaction in yeast, the

plasmid DNA was retransformed into the yeast bait strain. To know

whether the isolated clones encode transcription factors, the plasmid

DNA was sequenced and the results were analyzed with BLAST

programs.

Chapter II

63

Table 1. Oligonucleotide sequences used in the yeast one-hybrid and gene

expression studies.

Primer name Primer sequence 5´- 3´

OSBZ8-Fw AAAGGTAAAAGATCAAAGTTAGAAGG

OSBZ8-Rv CTCTGGTCTGGCGACTGATG

OsNAC6-Fw TTTTTAAACAGAAACAGGAAAGCTA

OsNAC6-Rv CCCCTCCTCCAGGACATC

OsNHX1-Fw GCCATGGAGGAAGATGAACA

OsNHX1-Rv GCAAACCATGCCATACCATT

OsRMC-Fw GTTCGACATCACGCTGGA

OsRMC-Rv ATAATCCGGTTACAGCTTAGATAGAT

HybriZAP-Fw CCCCACCAAACCCAAAAAAAG

HybriZAP-Rv GTTGAAGTGAACTTGCG

OsEREBP1-Fw TGCAGCTTCTTCAGCACTGT

OsEREBP1-Rv ACTTCGAGGAGTTCGAGGTG

OsEREBP2-Fw GTACCTGCGCTACCAGATGC

OsEREBP2-Rv CATCTCCGTCTCTCCGTCTC

OsACT1-Fw GTCGCACTTCATGATGGAGTTG

OsACT1-Rv CATGCTATCCCTCGTCTCGAC

OsUBC-Fw CAAAATTTTCCACCCGAATG

OsUBC-Rv ATCACATGAATCAGCCATGC

RESULTS

Expression analysis of salt stress responsive genes

The expression of the salt-responsive genes OSBZ8, OsNAC6,

OsNHX1 and OsRMC was analyzed through RT-PCR in rice

seedlings subjected to high salinity treatments: 100 mM and 200 mM

NaCl (Figure 1). The transcript level of OSBZ8, OsNAC6 and

OsNHX1 was increased after 2 h under 100 mM NaCl and it

decreased thereafter. OsRMC transcript level was not detected

under control conditions, but greatly increased under salt stress. In

the presence of 100 mM NaCl, the OsRMC transcript level was


64

detected 2 h after treatment increasing thereafter up to 24 hours.

When the seedlings were subjected to 200 mM NaCl, the transcript

accumulation, followed the same trend, but was higher (OSBZ8,

OsNHX1 and OsRMC) or maintained at high level for longer

(OsNAC6), showing a clear stress-dose-dependent response.

OsRMC was selected for further studies due to its high

responsiveness to salt stress and its putative role as a negative

regulator of rice salt stress response.

Figure 1. Expression analysis of the salt stress responsive genes OSBZ8,

OsNAC6, OsNHX1 and OsRMC in response to high salinity conditions. RT-

PCR reactions were performed with cDNA prepared from 1 µg of total RNA

isolated from 14 days-old rice seedlings subjected to high salinity (100 or

200 mM NaCl) during 0, 2, 5, 12 or 24 hours. Gene used as internal control:

OsACT1. The Image J program was used to determine the normalized gene

expression ratio.

Identification of transcription factors binding to the OsRMC gene

promoter

The yeast one-hybrid (Y1H) system was used to identify the TFs

that bind to the OsRMC promoter. Initially, it was necessary to

construct both the library and the yeast bait strains containing

fragments of the OsRMC promoter upstream the HIS3 reporter gene.

In order to have enrichment in salt stress responsive genes, the

Chapter II

65

library was prepared from rice seedlings subjected to salt stress.

After constructing this library and to assess the average length of the

cDNA inserts, PCR amplification was performed using 20 individual

phage plaques (Figure 2). The size range of the inserts was 750-

1500 bp and the average length was close to 1000 bp. The rice

cDNAs were cloned in fusion with the GAL4 activation domain, so

that all proteins expressed could function as activators. Six yeast bait

strains carrying the OsRMC promoter fragments illustrated in Figure

3 were constructed.

Figure 2. Analysis of the inserts present in the salt-induced rice cDNA

expression library. Twenty plaques were randomly picked from the cDNA

expression library and analyzed by PCR, using the HybriZAP primers

described in Table 1.

Figure 3. Schematic representation of the OsRMC promoter fragments (F1-

F6) used to prepare the yeast bait strains. The OsRMC promoter region

was defined as the 2120 bp sequence upstream the translation start codon

(ATG).

Using the Y1H system, 3-7 million clones from the salt-induced

cDNA expression library were screened for each of the six yeast bait


66

strains, resulting in a total of 115 positive clones identified. The

putative positive clones were re-streaked in selective medium, to

validate growth, and then analyzed by direct PCR. Twenty-five

clones did not grow after re-streak and from the clones with high to

moderate growth on selective medium, 42 did not amplify a cDNA

insert. Library plasmid DNA was isolated only from the yeast clones

with high growth on selective medium and from which a cDNA insert

could be amplified. After plasmid amplification in bacteria, the inserts

were sequenced and a BLAST analysis was performed to identify the

genes. Six clones were confirmed to be false positives containing, for

example, an insert encoding a ribosomal protein and an

endopeptidase. Obtaining false positives was previously described

as a limitation of the yeast one-hybrid system (Chen and Shin 2008;

Ouwerkerk and Meijer 2001). The analyses of the remaining 42

clones, led to the identification of two TFs belonging to the AP2/ERF

family and interacting with fragment 3 of the OsRMC promoter:

OsEREBP1 and OsEREBP2. OsEREBP1 gene was found in 38

clones while OsEREBP2 was only found in four. To further validate

the DNA-protein interaction, the plasmid DNA was retransformed into

the yeast bait strain. High growth on selective medium was observed

for the yeast bait strain transformed with each of the identified TFs.

Protein and phylogenetic analysis of OsEREBP1 and OsEREBP2

The nucleotide sequence analysis revealed that OsEREBP1

contained an open reading frame of 1098 bp and encoded a protein

of 365 amino acids with a predicted molecular mass of 40.1 kDa and

pI of 4.79. Analysis of deduced amino acid sequence showed that

the protein contained a single AP2 DNA-binding domain (120-175

aa) and a potential nuclear localization sequence (NLS) (Figure 4).

Chapter II

67

Figure 4. Alignment of deduced amino acid sequences of OsEREBP1,

OsEREBP2 and other proteins from the AP2/ERF family of transcription

factors using the Clustal W program and the Genedoc software. The

sequences shown are: OsEREBP1 (Q6K7E6), OsEREBP2 (Q5N965),

OsERF1 (Q0JB99), OsERF3 (Q9LRF3), AtERF2 (O80338), AtERF3

(O80339), AtERF4 (O80340), AtERF5 (O80341), AtERF6 (Q8VZ91),

AtRAP2-2 (Q9LUM4), AtRAP2-6 (Q7G1L2), ABR1 (Q9FGF8), JERF3

(Q6TXK7), NtERF2 (Q40479), NtERF5 (Q5Y836), Pti4 (B5AIC2), ZmERF1

(Q6DKU6), AtDREB1A (Q9M0L0), AtDREB1B (P93835), AtDREB1C

(Q9SYS6), AtDREB2A (O82132), AtDREB2B (O82133), OsDREB1A

(Q64MA1), OsDREB1B (Q3T5N4), OsDREB1C (Q9LWV3), OsDREB1D

(Q6J1A5), OsDREB2 (Q0JQF7), ZmDREB2A (Q1ESI9), AtAPETALA2

(P47927), OsAP2-1 (Q2MGU2). Residues in black are 100% conserved and

in grey are 80% conserved. Dashes indicate gaps in the amino acid

sequences. The line shows the conserved AP2 DNA binding domain. The

squares indicate the nuclear localization signal (NLS) predicted for

OsEREBP1 and OsEREBP2 by the PSORT program.

The OsEREBP2 gene sequence contains an open reading frame

of 1056 bp encoding a 351 amino acids long protein. The deduced

protein has a predicted molecular mass of 36.3 kDa and pI of 6.18.


68

Similarly to OsEREBP1, the amino acid sequence contained one

AP2 domain (130-185 aa) and a NLS (Figure 4).

Figure 5. Phylogenetic analysis of the deduced amino acid sequences of

OsEREBP1, OsEREBP2 and the AP2/ERF proteins described in Figure 4.

The bootstrapped tree was produced by Clustal W with 1000 repetitions.

The predicted amino acid sequences of OsEREBP1 and

OsEREBP2 were aligned with known members of the AP2/ERF

family of TFs (Figure 4). The results showed that these proteins

shared high homology in the AP2 DNA-binding domain with other

family members from rice, Arabidopsis, maize, tomato, potato and

tobacco.

Chapter II

69

To further analyze the phylogenetic relationship of OsEREBP1

and OsEREBP2 with AP2/ERF proteins, a phylogenetic tree was

constructed based on their predicted amino acid sequences (Figure

5). This analysis revealed that both TFs are grouping in the ERF

subfamily of transcription factors and are distant from the DREB

subfamily. Interestingly, OsEREBP1 and OsEREBP2 are located in

different subgroups inside the ERF family.

OsEREBP1 and OsEREBP2 gene expression under different abiotic

stresses

To investigate whether OsEREBP1 and OsEREBP2 were

regulated at transcriptional level by abiotic stress conditions, a gene

expression analysis was performed in rice seedlings subjected to

different treatments (salt, drought, cold and ABA). Figure 6 shows

that OsEREBP1 gene expression was not significantly and

reproducibly altered under control conditions in both shoots and roots

during the analyzed period. Similarly, no significant changes in the

transcript accumulation were observed in roots and shoots of

seedlings treated with salt, severe cold (5ºC) and ABA. In roots, an

accumulation of OsEREBP1 transcript was observed after 2, 5 and

10 h at 10ºC. Drought stress response was weak and opposite in

shoots and roots. In shoots, the OsEREBP1 transcript level

increased slightly and transiently, reaching a peak 40 min after

beginning of treatment, while in roots the transcript level started to

decrease 10 min after drought stress.


70

Figure 6. Analysis of OsEREBP1 and OsEREBP2 gene expression in

response to different abiotic stress conditions. RT-PCR reactions were

performed with cDNA prepared from 1 µg of total RNA extracted from

shoots and roots of 14 days-old rice seedlings (cv. Nipponbare) subjected

(or not) to salt (200 mM), drought, cold (5ºC, 10ºC) and ABA (100 µM).

OsEREBP1 was amplified with 25 cycles, except for shoot samples under

control, 5ºC and ABA treatments (20 cycles). OsEREBP2 was amplified

with 30 cycles, except for shoot samples under drought stress (25 cycles).

Internal controls: OsACT1 and OsUBC (ubiquitin-conjugase). OsACT1 was

amplified using 25 cycles or 20 cycles for the root samples under salt and

5ºC. OsUBC reactions were performed with 23, 25 or 30 cycles for root

samples under 10ºC, ABA and drought, respectively.

OsEREBP2 gene expression analysis revealed that its

transcription is significantly induced in response to salt, drought, ABA

and both cold treatments (Figure 6). In roots, the transcript

accumulation in response to salt was visible within 20 min, reaching

the maximum at 1-2 h treatment and then decreasing to the level of

the untreated plants. A similar pattern was observed in shoots.

Chapter II

71

Drought stress enhanced OsEREBP2 transcript accumulation also

after 20 min exposure to stress in both shoots and roots. This

increase in transcript abundance was observed up to 40 min

treatment and was followed by a gradual decrease in gene

expression. Under cold stress, the transcript level of OsEREBP2

increased in shoots and roots at both temperatures tested. In both

shoots and roots, the increase in OsEREBP2 expression occurred

earlier at 10ºC (within 1-2 h) than at 5ºC (only after 5 h). In addition,

at 10ºC the maximum transcript level was reached within 5 to 10 h

treatment, while at 5ºC it required at least 24 h. Under ABA

treatment, the TF transcript accumulation was visible in both shoots

and roots within 1 h, rapidly decreasing thereafter to the level of the

untreated plants.

DISCUSSION

High salinity induces changes in the expression of several genes

being estimated that the transcription level of approx. 8% of all genes

is affected by this abiotic stress (Chao et al. 2005; Rabbani et al.

2003; Tester and Davenport 2003). To assess the transcription

regulation of selected salt stress responsive genes, an initial gene

expression analysis was performed on rice seedlings subjected to

high salinity conditions. The genes under study were chosen based

on their function. The products of these genes are involved in

transcriptional regulation (OSBZ8 and OsNAC6), Na+ detoxification

(OsNHX1) and signal perception (OsRMC).

OSBZ8 transcript level increased 2 h after applying the salt

treatments and decreased thereafter. This gene codes for an ABRE-

binding factor, whose expression was described as being highly

induced upon 6 h of treatment with 200 mM NaCl (Nakagawa et al.

1996). This study was however performed in suspension-cultured


72

rice cells in which the salt effect may be stronger and less transient

than in rice seedlings. The putative involvement of OSBZ8 in salt

stress responses was also previously addressed in a study using

several cultivars. This study showed that OSBZ8 is expressed at a

higher level in salt-tolerant cultivars as compared to sensitive ones

(Mukherjee et al. 2006), thus indicating that OSBZ8 may be involved

in the plant responses leading to salt tolerance. OSBZ8 was also

described as a regulator of LEA proteins, such as Rab16A and Osem

(Mukherjee et al. 2006; Roychoudhury et al. 2008).

OsNAC6 gene expression was also induced under high salinity

conditions, as previously described (Nakashima et al. 2007; Ohnishi

et al. 2005). OsNAC6 function in abiotic stress responses was shown

through its over-expression in rice. The transgenic plants exhibit

increased tolerance to high salt and drought stress (Nakashima et al.

2007). Furthermore, OsNAC6 was shown to interact with the

CATGTG motif present in the promoter region of a late-

embryogenesis abundant protein, OsLEA3 whose over-expression

improved rice drought tolerance under field conditions (Takasaki et

al. 2010; Xiao et al. 2007).

The analysis of OsNHX1 gene expression revealed that its

transcription is enhanced by high salinity in a stress-dose dependent

manner, as previously described (Fukuda et al. 2004). OsNHX1

encodes a vacuolar Na+/H+ antiporter involved in the Na+

compartmentation in the vacuole (Fukuda et al. 2004; Fukuda et al.

1999). The important role of OsNHX1 in salt tolerance was

demonstrated by studies in rice and maize which have shown that

plants over-expressing OsNHX1 displayed reduced salt-related

deleterious effects comparing to wild type plants, suggesting an

improved salt tolerance (Chen et al. 2007; Fukuda et al. 2004; Liu et

al. 2010).

Chapter II

73

OsRMC transcript level increased in response to high salinity. At

100 mM NaCl a reduced accumulation was detected after 2 h and 5

h treatment, suggesting that OsRMC is involved in the late stage

response to high salinity. A stronger and earlier transcript

accumulation was detected under severe stress conditions,

indicating that OsRMC gene expression regulation is stress-dose-

dependent. The observed transcript accumulation is well correlated

with the described increase in the protein level in plants treated with

200 mM NaCl (Zhang et al. 2009a). In untreated plants OsRMC

transcript level was absent or not detectable by RT-PCR, which

correlates with previous studies on protein level indicating that

OsRMC is present in low amounts under non stress conditions

(Rabbani et al. 2003; Zhang et al. 2009a). OsRMC encodes an

apoplast protein described as a negative regulator of salt stress

response (Zhang et al. 2009a). In Arabidopsis, other genes induced

by high-salinity have been described as negative regulators of salt

stress response (Tran et al. 2007). For instance, AHK2, which is

induced by drought and salt stress, encodes a receptor histidine

kinase characterized as a negative regulator. ahk2 mutants showed

enhanced tolerance to drought and salt stress associated with the

accumulation of several stress-responsive genes. Stress responses

involve the induction of several genes whose products, when present

in high amounts, can have adverse effects on plant development.

Therefore, plants need to have mechanisms to finely regulate the

burst of expression occurring upon environmental changes (Kazan

2006; Mito et al. 2010; Tieman et al. 2000). OsRMC may act as a

fine tuner of salt stress responses by repressing the induction of salt-

responsive genes whose products can induce damages to cellular

components. Its high responsiveness to high salinity and the reduced

knowledge available about the function of salt stress negative


74

regulators lead us to further analyze OsRMC involvement in this

abiotic stress condition through a detailed study of its transcriptional

regulation.

The two transcription factors, OsEREBP1 and OsEREBP2,

identified as binding to the fragment 3 of OsRMC promoter contain

one AP2-DNA binding domain indicating that they belong to the

AP2/ERF family of TFs. Both TFs share high homology within the

AP2-DNA binding domain with other known members of the

AP2/ERF family and are more closely related to the ERF subfamily.

The classification of OsEREBP1 and OsEREBP2 as ERF

transcription factors was previously described from a bioinformatic

analysis (Nakano et al. 2006). OsEREBP1 was shown to belong to

the CMVII group which includes proteins involved in abiotic stress

response, like the JERF3 whose over-expression enhanced salt

stress tolerance in tomato (Wang et al. 2004). OsEREBP2 was

predicted to belong to the group Xa due to the presence of a CMX-1-

like motif in the amino acid sequence. The ABR1 protein from

Arabidopsis also belongs to the Xa group and was shown to be

involved in the ABA-dependent osmotic stress response. In

agreement with this classification, the phylogenetic analysis showed

that OsEREBP1 groups with JERF3 and OsEREBP2 is a close

relative to ABR1. Together, these data show that, although

OsEREBP1 and OsEREBP2 belong to the same ERF subfamily of

TFs, they are phylogenetically distant from each other and may have

different roles mediating OsRMC gene expression levels.

The AP2/ERF family of TFs has been shown to play a role in the

response to several abiotic stress conditions (Agarwal and Jha 2010;

Dietz et al. 2010; Nakano et al. 2006). To assess the transcriptional

regulation of OsEREBP1 and OsEREBP2 by abiotic stress

conditions, the expression of these genes was analyzed in rice

Chapter II

75

seedlings subjected to salt, drought, cold and ABA treatments.

OsEREBP1 gene expression was not significantly affected under

control, high salinity, severe cold (5ºC) and ABA. An increased

transcript accumulation was detected in roots after 2, 5 and 10 h of

cold treatment at 10ºC, whereas no significant difference was

observed in shoots. The OsEREBP1 gene expression in the japonica

cultivar CT6748-8-CA-17 was previously shown to be induced upon

cold exposure (10ºC) (Cheng et al. 2007). The response to drought

stress was weak and opposite in shoots and roots. A weak increase

in OsEREBP1 transcript was observed in shoots, while in roots a

down-regulation was detected. Only a few genes were reported to

have opposite responses to abiotic stress in roots and shoots. In

Limonium bicolor, a gene encoding a lipid transfer protein

(EH795199) was shown to be induced in roots and down-regulated in

shoots upon saline-alkali stress (Wang et al. 2008). In Setaria italica,

a putative protease inhibitor encoding gene revealed the same

expression pattern in response to drought stress treatment (Zhang et

al. 2007). These results suggest that OsEREBP1 may be regulated

at transcriptional level by drought and moderate cold temperatures.

On the contrary, the regulation of this TF under salt and severe cold

(5ºC) conditions may be mainly dependent on post-translational

modifications.

OsEREBP2 gene expression was shown to be induced in

response to salt, drought, ABA and cold stress treatments in both

shoots and roots. Curiously, OsEREBP2 response to moderate cold

(10ºC) occurred earlier than the response to severe cold (5ºC).

Previous studies suggested that rice response to moderate and

severe cold involves two different signaling pathways (Wen et al.

2002). Thus, OsEREBP2 may be involved in both pathways and its

gene expression induction may depend on the severity of the stress.


76

OsEREBP2 transcript accumulation by salt and drought was shown

to occur earlier than the induction by cold. Being rapidly induced by

these stresses, OsEREBP2 may be involved in the early responses

to osmotic stress. Moreover, given that induction of OsEREBP2 only

occurs 1 h after ABA treatment we suggest that the TF regulation by

osmotic stress is not ABA dependent. ERF proteins with a putative

role in the early responses of the osmotic stress were also identified

in tomato (Huang et al. 2004), wheat (Xu et al. 2007) and tobacco

(Park et al. 2001) and its over-expression enhanced tolerance to this

abiotic stress. In rice, OsBIERF1 and OsBIERF4 were also shown to

be rapidly induced (within 1 hour) by salt and drought treatments

(Cao et al. 2006). Our results indicate that OsEREBP2 can be

considered as a multifunctional TF putatively involved in several

stress responses in rice. Several TFs belonging to the AP2/ERF

family have been reported as such (Hu et al. 2010; Shao et al. 2007).

In tomato, JERF1 gene expression was shown to be induced in

response to salt, ABA and ethylene (Zhang et al. 2004). Over-

expression of this ERF protein in tobacco enhanced the plant

tolerance to high salinity and low temperature, indicating an

important role in both abiotic stress conditions (Wu et al. 2007).

In this work, we have shown that OsRMC gene expression is

highly induced by high salinity conditions and this regulation is

stress-dose-dependent. In addition, we identified two transcription

factors, OsEREBP1 and OsEREBP2, which bind to the OsRMC

promoter. The analysis of gene expression in response to abiotic

stress conditions revealed that OsEREBP1 may be mainly regulated

at a post-translational level. On the other hand, OsEREBP2 gene

expression may encode a multifunctional protein. Further

characterization of these TFs, namely using their mutants or

Chapter II

77

silencing lines, will provide new insights on their role in the salt stress

response in rice.

ACKNOWLEDGMENTS

Tânia Serra carried out the experimental work with the

collaboration of Duarte Figueiredo who contributed to the abiotic

stress assays. The planning of the research work and discussion of

results was performed by Tânia Serra, Nelson Saibo and M.

Margarida Oliveira. In addition, we would like to ackowledge Dr.

Pieter Ouwerkerk and Tiago Lourenço for the advices regarding the

Y1H system.

REFERENCES



201-212

Bartels D, Sunkar R (2005) Drought and salt tolerance in plants. Crit Rev

Plant Sci 24: 23-58

Cao Y, Song F, Goodman RM, Zheng Z (2006) Molecular characterization

of four rice genes encoding ethylene-responsive transcriptional factors

and their expressions in response to biotic and abiotic stress. J Plant

Physiol 163: 1167-1178

Cao YF, Wu YF, Zheng Z, Song FM (2005) Overexpression of the rice

EREBP-like gene OsBIERF3 enhances disease resistance and salt

tolerance in transgenic tobacco. Physiol Mol Plant Pathol 67: 202-211

Chao DY, Luo YH, Shi M, Luo D, Lin HX (2005) Salt-responsive genes in

rice revealed by cDNA microarray analysis. Cell Research 15: 796-810

Chen G, Shin JA (2008) AhR/Arnt:XRE interaction: turning false negatives

into true positives in the modified yeast one-hybrid assay. Anal Biochem

382: 101-106


78

Chen M, Chen Q-J, Niu X-G, Zhang R, Lin H-Q, Xu C-Y, Wang X-C, Wang

G-Y, Chen J (2007) Expression of OsNHX1 gene in maize confers salt

tolerance and promotes plant growth in the field. Plant Soil Environ 53:

490-498

Chen Z (2001) A superfamily of proteins with novel cysteine-rich repeats.


Cheng C, Yun KY, Ressom HW, Mohanty B, Bajic VB, Jia Y, Yun SJ, de los

Reyes BG (2007) An early response regulatory cluster induced by low

temperature and hydrogen peroxide in seedlings of chilling-tolerant

japonica rice. BMC Genomics 8: 175

Chinnusamy V, Jagendorf A, Zhu J-K (2005) Understanding and improving

salt tolerance in plants. Crop Science 45: 437-448





Dixit R, Nasrallah ME, Nasrallah JB (2000) Post-transcriptional maturation

of the S receptor kinase of Brassica correlates with co-expression of the

S-locus glycoprotein in the stigmas of two Brassica strains and in

transgenic tobacco plants. Plant Physiol 124: 297-311

Fukuda A, Nakamura A, Tagiri A, Tanaka H, Miyao A, Hirochika H, Tanaka

Y (2004) Function, intracellular localization and the importance in salt

tolerance of a vacuolar Na(+)/H(+) antiporter from rice. Plant Cell Physiol

45: 146-159

Fukuda A, Nakamura A, Tanaka Y (1999) Molecular cloning and expression

of the Na+/H

+ exchanger gene in Oryza sativa. Biochim Biophys Acta

1446: 149-155



Hasegawa PM, Bressan RA, Zhu JK, Bohnert HJ (2000) Plant Cellular and

Molecular Responses to High Salinity. Annu Rev Plant Physiol Plant Mol

Biol 51: 463-499

Chapter II

79

Hauser F, Horie T (2010) A conserved primary salt tolerance mechanism

mediated by HKT transporters: a mechanism for sodium exclusion and

maintenance of high K(+)/Na(+) ratio in leaves during salinity stress.

Plant Cell Environ 33: 552-565

He XJ, Mu RL, Cao WH, Zhang ZG, Zhang JS, Chen SY (2005) AtNAC2, a

transcription factor downstream of ethylene and auxin signaling

pathways, is involved in salt stress response and lateral root

development. Plant J 44: 903-916

Hu H, Dai M, Yao J, Xiao B, Li X, Zhang Q, Xiong L (2006) Overexpressing

a NAM, ATAF, and CUC (NAC) transcription factor enhances drought

resistance and salt tolerance in rice. Proc Natl Acad Sci USA 103:

12987-12992

Hu XJ, Zhang ZB, Xu P, Fu ZY, Hu SB, Song WY (2010) Multifunctional

genes: the cross-talk among the regulation networks of abiotic stress

responses. Biol Plantarum 54: 213-223

Huang Z, Zhang Z, Zhang X, Zhang H, Huang D, Huang R (2004) Tomato

TERF1 modulates ethylene response and enhances osmotic stress

tolerance by activating expression of downstream genes. FEBS Lett 573:

110-116

Jeong JS, Kim YS, Baek KH, Jung H, Ha SH, Do Choi Y, Kim M, Reuzeau

C, Kim JK (2010) Root-specific expression of OsNAC10 improves

drought tolerance and grain yield in rice under field drought conditions.


Jeong S, Trotochaud AE, Clark SE (1999) The Arabidopsis CLAVATA2

gene encodes a receptor-like protein required for the stability of the

CLAVATA1 receptor-like kinase. Plant Cell 11: 1925-1934





Kachroo A, Nasrallah ME, Nasrallah JB (2002) Self-incompatibility in the

Brassicaceae: receptor-ligand signaling and cell-to-cell communication.

Plant Cell 14 Suppl: S227-238


80

Kazan K (2006) Negative regulation of defence and stress genes by EAR-

motif-containing repressors. Trends Plant Sci 11: 109-112

Kikuchi K, Ueguchi-Tanaka M, Yoshida KT, Nagato Y, Matsusoka M, Hirano

HY (2000) Molecular analysis of the NAC gene family in rice. Mol Gen

Genet 262: 1047-1051

Kim SY, Kim SG, Kim YS, Seo PJ, Bae M, Yoon HK, Park CM (2007)

Exploring membrane-associated NAC transcription factors in

Arabidopsis: implications for membrane biology in genome regulation.

Nucleic Acids Res 35: 203-213

Liu S, Zheng L, Xue Y, Zhang Q, Wang L, Shou H (2010) Overexpression of

OsVP1 and OsNHX1 increases tolerance to drought and salinity in rice.

J Plant Biol 53: 444-452

Mito T, Seki M, Shinozaki K, Ohme-Takagi M, Matsui K (2010) Generation

of chimeric repressors that confer salt tolerance in Arabidopsis and rice.

Plant Biotechnol J

Mukherjee K, Choudhury AR, Gupta B, Gupta S, Sengupta DN (2006) An

ABRE-binding factor, OSBZ8, is highly expressed in salt tolerant

cultivars than in salt sensitive cultivars of indica rice. BMC Plant Biol 6:

18



Nakagawa H, Ohmiya K, Hattori T (1996) A rice bZIP protein, designated

OSBZ8, is rapidly induced by abscisic acid. Plant J 9: 217-227

Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of

the ERF gene family in Arabidopsis and rice. Plant Physiol 140: 411-432

Nakashima K, Tran LS, Van Nguyen D, Fujita M, Maruyama K, Todaka D,

Ito Y, Hayashi N, Shinozaki K, Yamaguchi-Shinozaki K (2007)

Functional analysis of a NAC-type transcription factor OsNAC6 involved

in abiotic and biotic stress-responsive gene expression in rice. Plant J

51: 617-630

Negrao S, Courtois B, Ahmadi N, Abreu I, Saibo N, Oliveira MM (2011)

Recent Updates on Salinity Stress in Rice: From Physiological to

Molecular Responses. Critical Reviews in Plant Sciences 30: 329-377

Chapter II

81

Ohnishi T, Sugahara S, Yamada T, Kikuchi K, Yoshiba Y, Hirano HY,

Tsutsumi N (2005) OsNAC6, a member of the NAC gene family, is

induced by various stresses in rice. Genes Genet Syst 80: 135-139

Okamuro JK, Caster B, Villarroel R, Van Montagu M, Jofuku KD (1997) The

AP2 domain of APETALA2 defines a large new family of DNA binding

proteins in Arabidopsis. Proc Natl Acad Sci USA 94: 7076-7081

Ooka H, Satoh K, Doi K, Nagata T, Otomo Y, Murakami K, Matsubara K,

Osato N, Kawai J, Carninci P, Hayashizaki Y, Suzuki K, Kojima K,

Takahara Y, Yamamoto K, Kikuchi S (2003) Comprehensive analysis of

NAC family genes in Oryza sativa and Arabidopsis thaliana. DNA Res

10: 239-247

Ouwerkerk PBF, Meijer AH (2001) Yeast One-Hybrid screening for DNA-

protein interactions. Curr Protoc Mol Biol: 12.12.11-12.12.22

Pardo JM (2010) Biotechnology of water and salinity stress tolerance. Curr

Opin Biotech 21: 185-196

Park JM, Park CJ, Lee SB, Ham BK, Shin R, Paek KH (2001)

Overexpression of the tobacco Tsi1 gene encoding an EREBP/AP2-type

transcription factor enhances resistance against pathogen attack and

osmotic stress in tobacco. Plant Cell 13: 1035-1046

Rabbani MA, Maruyama K, Abe H, Khan MA, Katsura K, Ito Y, Yoshiwara

K, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Monitoring

expression profiles of rice genes under cold, drought, and high-salinity

stresses and abscisic acid application using cDNA microarray and RNA

gel-blot analyses. Plant Physiol 133: 1755-1767

Rojo E, Sharma VK, Kovaleva V, Raikhel NV, Fletcher JC (2002) CLV3 is

localized to the extracellular space, where it activates the Arabidopsis

CLAVATA stem cell signaling pathway. Plant Cell 14: 969-977

RoyChoudhury A, Gupta B, Sengupta DN (2008) Trans-acting factor

designated OSBZ8 interacts with both typical abscisic acid responsive

elements as well as abscisic acid responsive element-like sequences in

the vegetative tissues of indica rice cultivars. Plant Cell Rep 27: 779-794


82

Sahi C, Singh A, Blumwald E, Grover A (2006) Beyond osmolytes and

transporters: novel plant salt-stress tolerance-related genes from

transcriptional profiling data. Physiol Plant 127: 1-9




Sattelmacher B (2001) The apoplast and its significance for plant mineral

nutrition. New Phytol 149: 167-192

Shao HB, Guo QJ, Chu LY, Zhao XN, Su ZL, Hu YC, Cheng JF (2007)

Understanding molecular mechanism of higher plant plasticity under

abiotic stress. Colloids Surf B Biointerfaces 54: 37-45

Takasaki H, Maruyama K, Kidokoro S, Ito Y, Fujita Y, Shinozaki K,

Yamaguchi-Shinozaki K, Nakashima K (2010) The abiotic stress-

responsive NAC-type transcription factor OsNAC5 regulates stress-

inducible genes and stress tolerance in rice. Mol Genet Genomics 284:

173-183

Tang W, Ezcurra I, Muschietti J, McCormick S (2002) A cysteine-rich

extracellular protein, LAT52, interacts with the extracellular domain of

the pollen receptor kinase LePRK2. Plant Cell 14: 2277-2287

Tester M, Davenport R (2003) Na+ tolerance and Na

+ transport in higher

plants. Ann Bot 91: 503-527

Tieman DM, Taylor MG, Ciardi JA, Klee HJ (2000) The tomato ethylene

receptors NR and LeETR4 are negative regulators of ethylene response

and exhibit functional compensation within a multigene family. Proc Natl

Acad Sci USA 97: 5663-5668

Tran LS, Urao T, Qin F, Maruyama K, Kakimoto T, Shinozaki K,

Yamaguchi-Shinozaki K (2007) Functional analysis of AHK1/ATHK1 and

cytokinin receptor histidine kinases in response to abscisic acid, drought,

and salt stress in Arabidopsis. Proc Natl Acad Sci USA 104: 20623-

20628

Wang H, Huang Z, Chen Q, Zhang Z, Zhang H, Wu Y, Huang D, Huang R

(2004) Ectopic overexpression of tomato JERF3 in tobacco activates

Chapter II

83

downstream gene expression and enhances salt tolerance. Plant Mol

Biol 55: 183-192

Wang Y, Ma H, Liu G, Zhang D, Ban Q, Zhang G, Xu C, Yang C (2008)

Generation and analysis of expressed sequence tags from a NaHCO3-

treated Limonium bicolor cDNA library. Plant Physiol Biochem 46: 977-

986

Wankhade SD, Bahaji A, Mateu-Andres I, Cornejo MJ (2010) Phenotypic

indicators of NaCl tolerance levels in rice seedlings: variations in

development and leaf anatomy. Acta Physiologiae Plantarum 32: 1161-

1169

Wen JQ, Oono K, Imai R (2002) Two novel mitogen-activated protein

signaling components, OsMEK1 and OsMAP1, are involved in a

moderate low-temperature signaling pathway in rice. Plant Physiol 129:

1880-1891

Wu L, Chen X, Ren H, Zhang Z, Zhang H, Wang J, Wang XC, Huang R

(2007) ERF protein JERF1 that transcriptionally modulates the

expression of abscisic acid biosynthesis-related gene enhances the

tolerance under salinity and cold in tobacco. Planta 226: 815-825

Xiao B, Huang Y, Tang N, Xiong L (2007) Over-expression of a LEA gene in

rice improves drought resistance under the field conditions. Theor Appl

Genet 115: 35-46

Xiong L, Lee H, Ishitani M, Zhu JK (2002) Regulation of osmotic stress-

responsive gene expression by the LOS6/ABA1 locus in Arabidopsis. J

Biol Chem 277: 8588-8596

Xiong L, Zhu JK (2002) Molecular and genetic aspects of plant responses to

osmotic stress. Plant Cell Environ 25: 131-139

Xu ZS, Xia LQ, Chen M, Cheng XG, Zhang RY, Li LC, Zhao YX, Lu Y, Ni

ZY, Liu L, Qiu ZG, Ma YZ (2007) Isolation and molecular

characterization of the Triticum aestivum L. ethylene-responsive factor 1

(TaERF1) that increases multiple stress tolerance. Plant Mol Biol 65:

719-732


84

Yoshida S, Foorno DA, Cock JH, Gomez KA (eds) (1976) Laboratory

manual for physiological studies of rice. International Rice Research

Institute, Los Banos, Philippines

Yoshida T, Fujita Y, Sayama H, Kidokoro S, Maruyama K, Mizoi J,

Shinozaki K, Yamaguchi-Shinozaki K (2010) AREB1, AREB2, and ABF3

are master transcription factors that cooperatively regulate ABRE-

dependent ABA signaling involved in drought stress tolerance and

require ABA for full activation. Plant J 61: 672-685

Zhang H, Huang Z, Xie B, Chen Q, Tian X, Zhang X, Lu X, Huang D, Huang

R (2004) The ethylene-, jasmonate-, abscisic acid- and NaCl-responsive

tomato transcription factor JERF1 modulates expression of GCC box-

containing genes and salt tolerance in tobacco. Planta 220: 262-270

Zhang J, Liu T, Fu J, Zhu Y, Jia J, Zheng J, Zhao Y, Zhang Y, Wang G

(2007) Construction and application of EST library from Setaria italica in

response to dehydration stress. Genomics 90: 121-131

Zhang L, Tian LH, Zhao JF, Song Y, Zhang CJ, Guo Y (2009a) Identification



149: 916-928

Zhang Y, Chen C, Jin XF, Xiong AS, Peng RH, Hong YH, Yao QH, Chen

JM (2009b) Expression of a rice DREB1 gene, OsDREB1D, enhances

cold and high-salt tolerance in transgenic Arabidopsis. Bmb Rep 42:

486-492

Zhao LF, Xu SB, Chai TY, Wang T (2006) OsAP2-1, an AP2-like gene from

Oryza sativa, is required for flower development and male fertility. Sex

Plant Reprod 19: 197-206

Chapter III

85

Characterization of the OsEREBP1 and OsEREBP2

interaction with the OsRMC promoter

Chapter III

Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter

86

TABLE OF CONTENTS – CHAPTER III

Abstract .........................................................................................87

Introduction ...................................................................................88

Material and Methods ...................................................................91

Identification of TF-binding sites in OsRMC gene promoter ...........91

Construction of plasmids ...............................................................92

Production of recombinant proteins ...............................................93

Measurement of OsBWMK1 phosphorylation activity ....................94

Electrophoretic mobility shift assay (EMSA) ..................................95

Transient expression assays in Arabidopsis protoplasts ................96

Results ...........................................................................................98

Identification of putative cis-elements in OsRMC gene promoter........................................................................................98

Both OsEREBPs bind to a GCC-like motif in OsRMC promoter .. 100

OsEREBP1 and OsEREBP2 act as transcriptional repressors. ... 107

Discussion ................................................................................... 107

Acknowledgments ...................................................................... 109

References .................................................................................. 110

Chapter III

87

ABSTRACT

The AP2/ERF family of transcription factors (TFs) includes

proteins involved in several plant developmental processes and also

in biotic and abiotic stress responses. The ERF subfamily is

characterized by the presence of one highly conserved AP2-DNA

binding domain that binds with high affinity to the ERE sequence

(core motif GCC box). However, several ERF proteins are known to

interact with GCC-like motifs and even to DRE sequences, usually

recognized by DREB proteins. A bioinformatic analysis of

OsEREBP1 and OsEREBP2 protein sequences indicated that the

amino acid residues involved in the DNA-binding interface are

conserved in both TFs and in other ERF proteins. This study also

allowed the identification of two GCC-like DNA-binding sites, S1 and

S2, for OsEREBP1 and OsEREBP2 in the OsRMC gene promoter.

EMSA experiments showed that both OsEREBP1 and OsEREBP2

bind to S1 and a synthetic sequence containing tandem GCC-box

motifs, but not to S2. The OsEREBP1-GCC box complex revealed a

slower migration in the gel, suggesting that homodimers bind to the

GCC box motif. The OsEREBP1-DNA interaction analysis was also

performed in the presence of the MAPK OsBWMK1, however, only a

weak difference in DNA-binding activity was observed in the tested

conditions. In agreement, we were not able to detect the OsEREBP1

phosphorylated form in the in vitro kinase experiments. Trans-

activation assays in Arabidopsis protoplasts revealed that

OsEREBP1 and OsEREBP2 act as transcriptional repressors and

may therefore function as repressors of the OsRMC gene

expression.


88

INTRODUCTION

AP2/ERF (APETALA2/Ethylene Response Factor) transcription

factors (TFs) have been identified and extensively studied in several

plant species, such as Arabidopsis, rice, maize and tobacco (Dietz et

al. 2010). Proteins from this family are characterized by the presence

of the conserved AP2 DNA-binding domain.

Regulatory proteins from the AP2/ERF family can be classified in

five subfamilies: AP2, RAV, ERF, DREB and “others”, according to

the similarity of the DNA-binding domains (Sakuma et al. 2002). AP2

proteins contain two AP2 DNA-binding domains and are key

developmental regulators in reproductive and vegetative organs

(Dietz et al. 2010). Proteins with one AP2 domain and an additional

B3 DNA-binding domain are classified in the RAV subfamily.

Members from this subfamily are implicated in several physiological

and developmental processes, but may also have a role in biotic and

abiotic stress responses (Swaminathan et al. 2008; Woo et al. 2010).

ERF and DREB family proteins contain a single AP2 domain and are

described as regulators of biotic and abiotic stress responses,

although some members also have a function in plant development

(Mizoi et al. 2011; Shukla et al. 2006).

ERF and DREB regulatory proteins can be distinguished by their

DNA binding specificity (Sakuma et al. 2002). DREB proteins interact

with DRE (Dehydration-Responsive Element) and DRE-like cis-

elements usually present in the promoter of abiotic stress-responsive

genes (Busk et al. 1997; Yamaguchi-Shinozaki and Shinozaki 2005).

The DRE-like elements include the CRT (C-Repeat) and the LTRE

(Low-Temperature-Responsive Element), which contain the DRE

core sequence, A/GCCGAC (Yamaguchi-Shinozaki and Shinozaki

2005). Other DRE-like elements contain variations of the DRE core

Chapter III

89

sequence, such as the DRE1 (ACCGAGA) identified in the promoter

sequence of the maize rab17 gene (Busk et al. 1997; Kizis et al.

2001). ERF proteins usually bind to the ERE (Ethylene-Responsive

Element), which contains a core sequence designated as GCC box

(AGCCGCC) (Mizoi et al. 2011). This sequence was identified in the

promoter of several Pathogenesis-Related (PR) genes, thereby ERF-

dependent regulation is often related to biotic stress responses

(Dietz et al. 2010; Gutterson and Reuber 2004). The GCC box was

shown to be the optimal target site for several ERFs; however some

of these have shown binding flexibility, interacting with variants of

this sequence (Fujimoto et al. 2000). Although several reports

indicate that DREB and ERF proteins interact specifically with DRE

or ERE sequences, respectively, a few proteins were described to be

able to bind to both cis-elements. TINY, which belongs to the DREB

subfamily, was shown to interact with DRE and ERE sequences with

similar affinity (Sun et al. 2008). Similarly, the tomato ERF protein

JERF1 was also reported to bind to both motifs, suggesting a

possible cross-talk between DRE- and ERE-regulated responses

(Dietz et al. 2010; Zhang et al. 2004).

The three-dimensional structure of the AP2 domain from the

AtERF1 revealed that it consists of a three-stranded anti-parallel β-

sheet and one α-helix (Allen et al. 1998). The AP2 domain was

shown to interact directly with DNA through specific residues in the

β-sheet that are conserved between DREB and ERF proteins (Allen

et al. 1998). The ability to recognize different cis-elements was

reported to be related to differences in the residues that surround the

conserved DNA interacting sequences (Sakuma et al. 2002).

Additional studies showed that the AP2 domain of DREB and ERF

proteins differs in two aa that are conserved within each group of

regulatory proteins. In DREBs the 14th and 19th positions are


90

occupied by valine (Val-14) and glutamic acid (Glu-19), respectively,

whereas alanine and aspartic acid occupy the corresponding

positions in the ERFs AP2 domain (Sakuma et al. 2002). The Val-14

and Glu-19 were reported to be essential for specific binding to DRE

sequences (Sakuma et al. 2002). The detailed mechanism of protein

binding to ERE is not fully characterized. The serine in the 15th

position was reported to be crucial for TINY interaction with the ERE

sequence, however several ERF proteins do not contain this aa

suggesting that other aa may contribute to the ERE recognition (Sun

et al. 2008). An alanine in position 37 (Ala37) was also reported to be

involved in DNA binding or in the stability of the AP2 domain (Liu et

al. 2006).

OsEREBP1 and OsEREBP2 encode ERF transcription factors

with a putative role in biotic and abiotic stress responses.

OsEREBP1 was previously reported to be phosphorylated in vitro

and in vivo by a MAPK, OsBWMK1, involved in biotic stress

responses (Cheong et al. 2003). OsBWMK1 was also shown to

enhance the TF DNA-binding activity to the GCC box motif. In

addition, its over-expression enhanced rice resistance to bacterial

infection (Seo et al. 2011). OsEREBP2 transcripts were shown to

accumulate in rice plants treated with a functional analog of salicylic

acid, benzothiadiazole (Shimono et al. 2007). Given that salicylic

acid (SA) mediates plant response against pathogens, OsEREBP2

may be involved in rice response to pathogen infection. OsEREBP1

and OsEREBP2 may also be involved in abiotic stress responses.

OsEREBP1 gene expression was regulated by moderate cold (10ºC)

(Cheng et al. 2007) and drought stress (Chapter 2). OsEREBP2

gene expression was shown to be highly induced by different abiotic

stresses (Chapter 2). In addition, both proteins bind to the promoter

of the OsRMC gene, a negative regulator of rice salt stress

Chapter III

91

responses (Zhang et al. 2009). The silencing of OsRMC, which

encodes a protein from the DUF26 group of Receptor-Like Kinases

(RLKs), was demonstrated to enhance salt tolerance and to increase

the expression of stress-responsive genes (Jiang et al. 2007; Zhang

et al. 2009). In chapter 2, it was suggested that OsEREBP1 and

OsEREBP2 are involved in the regulation of OsRMC gene

expression in response to salt stress.

In this study, we confirmed that both OsEREBP1 and OsEREBP2

bind directly and specifically to the OsRMC gene promoter.

OsEREBP1 and OsEREBP2 interact with the same GCC-like motif

and the trans-activation assays revealed that both TFs function as

transcriptional repressors.


Identification of TF-binding sites in OsRMC gene promoter

In order to identify cis-elements related to abiotic stress

responses, we have used the PlantPAN database. This analysis was

performed for the OsRMC promoter region ranging from -1260 bp to

-613 bp, which includes the fragment 3 (-1160 bp to -613 bp)

(Chapter 2). Additionally, the footprintDB and 3D-footprint databases

(http://floresta.eead.csic.es/footprintdb and http://floresta.eead.csic.

es/3dfootprint) were scanned with OsEREBP1 and OsEREBP2

protein sequences to identify DNA-binding proteins that bind to

similar DNA motifs and to define the interface amino acid residues

that putatively interact with DNA (Contreras-Moreira 2010; Steffens

et al. 2004). Two such proteins were selected, ERF-4 (At3g15210.1)

and AtERF1A (At4g17500, http://floresta.eead.csic.es/3dfootprint/

complexes/1gcc_A. html) and their corresponding position weight

matrices (PWMs), which capture their binding specificity, scanned


92

along the OsRMC promoter. The search for significant matches

within the promoter sequence was performed with the software

matrix-scan, with default parameters (Turatsinze et al. 2008). Several

putative OsEREBP1 and OsEREBP2 cis-elements were identified in

fragment 3 of OsRMC promoter.

Construction of plasmids

For the transient expression assays in Arabidopsis protoplasts,

we have used as reporter the plasmid pLUCm35GUS (Figueiredo et

al. 2012). To construct the reporter plasmid pLUCm35GUS-pRMC,

which contains the fragment 3 (Chapter 2) of the OsRMC promoter,

we have amplified fragment 3 with the primers pRMCF3-Fw and -Rv

(Table 1) and cloned it in SalI-PstI. To construct the effector plasmids

over-expressing OsEREBP1 (LOC_Os02g54160) and OsEREBP2

(LOC_Os01g64790), the respective coding sequences were PCR

amplified from cDNA, using gene specific primers containing

Gateway adapters, GW-OsEREBP1-Fw/-Rv and GW-OsEREBP2-

Fw/-Rv (Table 1) and the PhusionTM high-fidelity DNA polymerase

(Finnzymes, Vantaa, Finland). To amplify the OsEREBP2 sequence,

the reaction needed to be supplemented with 1 M betaine and 2.5%

DMSO. The coding sequences amplified were cloned into the entry

vector pDONR221 with the BP recombinase, according to the

manufacturer’s instructions (Invitrogen, CA, USA), to obtain

pENTRY-OsEREBP1 and pENTRY-OsEREBP2. The OsEREBP1

fragment was afterwards transferred to the binary vector pH7WGF2

through LR recombination. The region containing the

35S::GFP::OsEREBP1 fragment was removed from the binary vector

through XbaI-HindIII restriction and cloned into the pGREEN0029

vector to obtain the 35S::OsEREBP1 plasmid. The 35S::OsEREBP2

effector plasmid was obtained by LR recombination of the pENTRY-

Chapter III

93

OsEREBP2 with the pEarleyGate201 vector following the

manufacturer’s instructions.

For recombinant protein expression in E. coli, OsEREBP1,

OsEREBP2 and OsBWMK1 (LOC_Os06g49430.2) coding

sequences were amplified with the GX-OsEREBP1-Fw/-Rv, GX-

OsEREBP2-Fw/-Rv or PET-OsBWMK1-Fw/-Rv primers (Table 1),

respectively, and the PhusionTM high-fidelity DNA polymerase

(Finnzymes, Vantaa, Finland) according to the manufacturer’s

instructions. The OsEREBP1 and OsEREBP2 fragments were

cloned in frame with the GST tag as an EcoRI-XhoI fragment into the

pGEX-4T-1 vector. The OsBWMK1 fragment was cloned in frame

with the His tag in the pET200/D-TOPO vector according to the

manufacturer’s instructions.

Production of recombinant proteins

The E. coli Rosetta strain was transformed with the pGEX-4T-1

vector alone or pGEX-4T-1 containing the OsEREBP1 and

OsEREBP2 coding sequences. Cells were grown in TB broth until

the OD600 reached ≈ 0.5. Afterwards, isopropyl β-D-thiogalactoside

(IPTG) was added to a final concentration of 0.4 mM, and the culture

was further incubated for 1-2 h at 28ºC. Cells were harvested by

centrifugation at 3500 x g for 20 min at 4ºC and lysed by passing 2

times through a French Press at 900 psi. Cell debris was removed by

sedimentation at 16600 x g for 45 min at 4ºC. The GST-fusion

proteins were purified in a 1 ml GSTrap HP (GE Healthcare, UK) with

a flow rate of 1 ml/min according to the manufacturer’s instruction.

For OsBWMK1 over-expression, Rosetta strain was transformed

with the pET200/D-TOPO vector containing the coding sequence

and grown in TB broth. When OD600 reached ≈ 0.5, protein

production was induced with IPTG 0.4 mM and the culture was


94

grown for 2 h at 28ºC. Cells were harvested through centrifugation as

described above and lysed in 20 mM phosphate buffer pH 7.5,

containing 0.5 M NaCl, 10 mM imidazole, 50 µg/ml lysozyme, 100

mM PMSF, 5 µg/mL DNase and 10 µM MgCl2. Cell debris was

removed by centrifugation at ≈ 27000 x g for 40 min at 4ºC and the

obtained supernatant was filtrated with a 0.45 µm MillexR GV low

protein binding filter (Millipore, Billerica, USA). The filtered lysate was

loaded at 5 ml/min onto a 5 ml Ni containing HiTrap IMAC HP (GE

Healthcare, UK) column, pre-equilibrated with 20 mM phosphate

buffer pH 7.5, containing 0.5 M NaCl and 10 mM imidazole. The His-

tagged protein was eluted with the same buffer, but containing 0.25

M of imidazole. The OsBWMK1 tag protein was further purified in a

gel-filtration column (Hiprep 26/60 Sephacryl S-200 HR, GE

Healthcare, UK) with 20 mM phosphate pH 7.5, 200 mM NaCl, 5%

glycerol, 1 mM DTT, and 1 mM Na2EDTA pH 8. Protein-containing

fractions were pooled and protein was concentrated in an Amicon

ultracell 10,000 MWCO (Millipore, Billerica, USA).

For immunoblots and Coomassie Brilliant Blue staining, 3-30 µg of

purified GST-fusion proteins or 1.7 µg His-OsBWMK1 tag protein

and Rosetta total protein extract were resolved on SDS-PAGE gels

containing 10% polyacrylamide. Proteins were stained with

Coomassie Brilliant Blue or transferred to PVDF membranes. The

membranes were probed with anti-GST (abm, NBS Biologicals, UK)

or anti-HIS (GE Healthcare, UK) mouse monoclonal antibody and an

anti-mouse horseradish peroxidase-conjugated antibody according to

the manufacturer’s instructions.

Measurement of OsBWMK1 phosphorylation activity

The reactions were conducted at ≈ 22ºC for 20 min in 20 µL

reaction volume containing 20 mM Tris-HCl pH 8, 1 mM DTT, 10 mM

Chapter III

95

MgCl2, 0.1 mM ATP, 5 µCi [γ-32P]ATP and 1.7 µg or 2.5 µg of

purified OsBWMK1. To analyze OsEREBP1 phosphorylation, the

reaction was performed with approximately 3 µg of purified TF. The

reactions were terminated by boiling in SDS sample buffer and

resolved in SDS-PAGE gels containing 10% polyacrylamide. Gels

were dried on Whatman 3MM paper and exposed to X-ray film

(Amersham, GE Healthcare, UK).

Electrophoretic mobility shift assay (EMSA)

DNA probes were generated by annealing oligonucleotide pairs,

S1-Fw/-Rv, S1M-Fw/-Rv, S2-Fw/-Rv, S2M-Fw/-Rv or GCC-Fw/-Rv

(Supplementary Table 1), in a PCR machine with the advanced

protocol described in Pierce Tech Tip #45 (“Anneal complementary

pairs of oligonucleotides”, www.piercenet.com) and the annealing

temperatures 52ºC, 46ºC, 58ºC and 54ºC, respectively. The

reactions were performed in the presence of 10 mM Tris-HCl pH 8,

50 mM NaCl and 1 mM Na2EDTA pH 8. Probes were labeled with [α-

32P]ATP using the DNA polymerase I/Klenow fragment (3’->5’ exo-)

(NEB, USA) following the manufacturer’s instructions. The DNA-

binding reaction was performed in a volume of 10 µL, which

contained 50 fmol of labeled probe, 0.002 µM poly(dI/dC), binding

buffer (25 mM HEPES pH 7.5, 40 mM KCl and 0.1 mM Na2EDTA pH

8) and 3 µg of purified GST-OsEREBP1, 6 µg GST-OsEREBP2, 30

µg GST tag or 300 µg untransformed Rosetta total protein extract. In

some experiments, 1.7 µg of purified OsBWMK1 was added together

with 100 µM ATP. Competition reactions were performed with 500-

fold molar excess of unlabeled probe. The reactions were incubated

for 30 min in a water bath at ≈ 22ºC and loaded onto native 5%

polyacrylamide gel (37.5:1). Electrophoresis was run at 200 V for 2 h

with 0.5 x TBE (50 mM Tris-HCl pH 8, 50 mM boric acid, 1 mM


96

Na2EDTA pH 8) at approximately 22ºC. Gels were dried on Whatman

3MM paper and exposed to X-ray film (Amersham, GE Healthcare,

UK).

Transient expression assays in Arabidopsis protoplasts

Arabidopsis protoplasts were isolated as previously described

(Anthony et al. 2004). Briefly, 3-day-old Arabidopsis cells were

incubated with an enzyme solution containing 1% cellulase and 0.2%

macerozyme for 3-4 h. After washing, the protoplasts were isolated

by centrifugation with a sucrose solution. Approximately 3 x 105

protoplasts were transfected with 3 µg of reporter plasmid and 6 or 8

µg of effector plasmid 35S::OsEREBP1 or 35S::OsEREBP2,

respectively, to obtain a molar ratio 1:3. The transfections were

performed in triplicate and cells were incubated 48 h at 22ºC in the

darkness in medium containing 0.2 µM 2.4-Dichlorophenoxyacetic

acid (2.4-D). After harvesting, the cells were lysed through

ressuspension in 100 mM K2PO4, 1 mM Na2EDTA pH 8, 7 mM 2-

mercaptoethanol, 1% Triton X-100 and 10% glycerol, and two freeze-

thaw cycles (-20ºC, 22ºC). The cell debris was sedimented at 17000

x g for 2 min and the cleared lysate was stored at -80ºC. For the

GUS quantification assay, 20 µL of cleared lysate was incubated with

0.5 µL 50 mM MUG (4-methylumbelliferyl-β-D-glucuronide) in

triplicate at 37ºC in the darkness for 1 h. The reaction was stopped

by adding 180 µL 200 mM Na2CO3 and the fluorescence signal was

detected using a spectrofluorimeter (Fluoromax-4 with Micromax

plate reader, Horiba, Portugal) with excitation at 365 nm, emission at

455 nm and a slit of 1.5 nm.

Chapter III

97

Table 1. Oligonucleotide sequences used in the cloning procedures and

recombinant protein expression. The underlined region of the primer

corresponds to adapter sequences and the remaining region is specific to

the target DNA.


GW-OsEREBP1-Fw GGGGACAAGTTTGTACAAAAAAGCAGGCTACAAGCAATCCACCACTGCA

GW-OsEREBP1-Rv GGGGACCACTTTGTACAAGAAAGCTGGGTTGCCTCCCAATCTCCAATAG

pRMCF3-Fw ATCTGCAGCTTGACGAGCAGGCATAGGT

pRMCF3-Rv ATGTCGACTGCCTGCGTTCTATGGTCTG

GW-OsEREBP2-Fw GGGGACAAGTTTGTACAAAAAAGCAGGCTATATGACGGTGGCGGGGGCGTCGGAGCT

GW-OsEREBP2-Rv GGGGACCACTTTGTACAAGAAAGCTGGGTGGACAGAATCCGGCGGCTACTGCGTGTGC

GX-OsEREBP1-Fw ATATGAATTCATGTGCGGCGGCGCCATCATCC

GX-OsEREBP1-Rv ATATCTCGAGGAATTCCTCAATAGAAATCGCTAACGGGCAT

GX-OsEREBP2-Fw ATATGAATTCATGACGGTGGCGGGGGCGTCGGAGCT

GX-OsEREBP2-Rv ATATCTCGAGGGACAGAATCCGGCGGCTACTGCGTGTGC

PET-OsBWMK1-Fw CACCATGGGGGGAGGGGGCACGCT

PET-OsBWMK1-Rv ATCATCGTCATCGTTGTGCATTAGGAGTGC

S1-Fw GCTTGACGAGCAGGCATAGGTATATTTG

S1-Rv TCGACAAATATACCTATGCCTGCTCGTCAAGCTGCA

S1M-Fw TTCTTGACTATCATTCATAGGTATATTT

S1M-Rv TTAAATATACCTATGAATGATAGTCAAG

S2-Fw GCGCATCCAATGGCAGCACTGGTTCCTAG

S2-Rv TCGACTAGGAACCAGTGCTGCCATTGGATGCGCTGCA

S2M-Fw TTCGCATCCAATTTCATCACTGGTTCCTA

S2M-Rv TTTAGGAACCAGTGATGAAATTGGATGCG

GCC-Fw GCATAAGAGCCGCCACTAAAATAAGACCGATCAAATAAGAGCCGCCATG

GCC-Rv TCGACATGGCGGCTCTTATTTGATCGGTCTTATTTTAGTGGCGGCTCTTATGCTGCA


98

The luciferase assay was performed through addition of 150 µL of

LUC reagent (20 mM tricine pH 7.8, 5 mM MgCl2, 0.1 mM Na2EDTA

pH 8, 3.3 mM DTT and 2 mM ATP) and 75 µL of 1.5 mM luciferine to

20 µL of cleared lysate. The light intensity was measured for 10 s in

a luminometer (Berthold MicroLumatPlus LB96V, Germany).

Transcriptional activity was calculated as a GUS/LUC ratio.

RESULTS

Identification of putative cis-elements in OsRMC gene promoter

In order to determine where OsEREBP1 and OsEREBP2 bind to

the OsRMC gene promoter, we have used the PlantPAN database to

identify cis-elements related to abiotic stress responses present

within the region ranging from -1260 bp to -613 bp (Figure 1). This

promoter region is contained in the fragment 3 (-1160 bp to -613 bp),

which was used as bait for the Y1H screening (Chapter 2).

Figure 1. Putative abiotic stress-related cis-elements present in the OsRMC

gene promoter. The promoter region -1260 bp to -613 bp upstream the

translation start codon (ATG) was scanned using the PlantPAN database.

The symbol N used in the sequence corresponds to G/A/T/C.

Chapter III

99

We have identified, within the targeted promoter region, four

ABRE (ABA Responsive Element) sequences with the core motif

ACGT. These cis-elements are present in the promoter of several

ABA-responsive genes (Umezawa et al. 2010), suggesting that

OsRMC gene expression is regulated by ABA. The Dehydration-

Responsive Element (DRE) and the Low-Temperature-Responsive

Element (LTRE) also found in our sequence are usually recognized

by Dehydration-Responsive Element Binding (DREB) proteins, which

are well known regulators of abiotic stress responses (Yamaguchi-

Shinozaki and Shinozaki 2005). In addition, we found three MYB-

recognition motifs. Several MYB proteins have also been shown to

function in abiotic stress responses (Dubos et al. 2010). However,

given that no GCC box motifs (known ERF binding sites) were

predicted with the former analysis, a more detailed bioinformatics

approach was performed to identify OsEREBP1 and OsEREBP2

DNA-binding sites in the OsRMC gene promoter. Initially, the

footprintDB database was interrogated to identify similar DNA-

binding proteins that bind to known regulatory motifs and to define

the amino acid residues that shape the DNA-binding interface. This

search revealed a high homology with ERF proteins detected at the

level of the AP2 domain (Figure 2A), confirming that both proteins

belong to the ERF subfamily of TFs. It also showed that the interface

amino acid residues involved in DNA-binding interface were

conserved with other ERF proteins, suggesting that OsEREBP1 and

OsEREBP2 recognize similar DNA motifs (Figure 2A). Position

weight matrices (PWMs) of proteins ERF-4 and AtERF1A were used

to predict putative cis-elements within the OsRMC promoter. Two of

these sites were predicted by both PWMs (S1 and S2, with P-values

of 2.9e-05 and 1.5e-03, respectively) and were selected for further

analysis (Figure 2B).


100

Figure 2. Analysis of the OsEREBP1 and OsEREBP2 AP2 domain and the

GCC-like boxes in the OsRMC promoter. (A) Alignment of OsEREBP1 and

OsEREBP2 with AtERF1A (At4g17500) protein sequence, obtained after

querying the footprintDB database, to spot the amino acid residues

putatively involved in DNA binding interface. The arrows indicate the

conserved amino acid residues involved in DNA-binding interface, inferred

from the Protein Data Bank entry 1GCC (Allen et al. 1998). The numbers

represent the residues position in the protein sequence. (B) DNA

sequences used in the EMSA assays. In bold are the predicted OsEREBP1

and OsEREBP2 DNA-binding sites (S1 and S2) identified as GCC-like

boxes in fragment 3 of the OsRMC promoter. S1M and S2M are mutated

forms of site S1 and S2, respectively. Point mutations are underlined. The

sequence containing the GCC box motif in tandem was described by

Cheong et al. (2003). The numbers represent the position in the promoter

upstream the ATG start codon of the OsRMC gene.

Both OsEREBPs bind to a GCC-like motif in OsRMC promoter

Electrophoretic mobility shift assays (EMSAs) were performed to

check whether OsEREBP1 and OsEREBP2 proteins interact with the

predicted DNA-binding sites S1 and S2, and also with a synthetic

probe containing the GCC box motif (Cheong et al. 2003) (Figure

2B). Both TFs were produced as GST-fusion proteins and purified by

Chapter III

101

affinity chromatography (Figure 3). In addition to the predicted bands

for our proteins, other bands were detected and assumed to be

products of degradation of the fusion proteins or eventually

contaminant proteins from bacteria. To confirm that the DNA-binding

activity detected in the EMSA assays was not related to the

interaction of contaminant proteins with the DNA fragments, we

included a control reaction by using the total protein extract from

bacteria.

Figure 4 shows that both OsEREBP1 and OsEREBP2 interact

with the probe S1 and the TF-DNA complexes formed migrate

similarly. No DNA-binding activity was detected for the GST protein

and only unspecific binding was detected with the total protein

extract from bacteria. When the specificity of the TFs-DNA

interaction was analyzed through competition experiments, using

500-fold excess of unlabeled S1, an efficient challenge with the cold-

probe was observed for both TFs. In contrast, when the competition

was performed with the mutated probe S1M (Figure 4), the specific

binding was enhanced, probably due to higher unspecific binding to

unlabeled S1M.


102

Figure 3. Production and purification of recombinant proteins GST-

OsEREBP1, GST-OsEREBP2 and His-OsBWMK1. The recombinant

proteins were produced in Rosetta strain and purified by affinity

chromatography. Three to thirty micro grams of GST-OsEREBP1 (3 µg),

GST-OsEREBP2 (6 µg), GST tag (30 µg) and 1.7 µg of His-OsBWMK1

were separated in an SDS-PAGE gel along with 300 µg or 55 µg,

respectively, of bacteria total protein extract (cell extract). Proteins were

stained with Coomassie Brilliant Blue (A, C) or transferred to PVDF

membranes and probed with anti-GST (B) or anti-His (D) mouse

monoclonal antibody. (E) OsBWMK1 activity was measure through

incubation of 2.5 µg of purified protein with 5 µCi [γ-32

P]ATP and with or

without 3 µg of purified GST-OsEREBP1. Expected band sizes: GST-

OsEREBP1 – 67 kDa; GST-OsEREBP2 – 63 kDa; GST – 27 kDa and His-

OsBWMK1 – 70 kDa. The arrow indicates the expected band for each

assay.

Chapter III

103

The DNA-binding activity of both TFs was also assessed for the

probe S2, but no signal was detected (data not shown). To confirm

that the TFs do not bind to this probe, a competition reaction was

prepared, using the labeled probe S1 together with 500-fold excess

of unlabeled probe S2. As shown in Figure 5, TFs’ binding to S1 was

not affected by S2 presence.

Figure 4. Analysis of the DNA-binding specificity of OsEREBP1 and

OsEREBP2 to the S1 sequence present in the OsRMC gene promoter.

EMSA was carried out with 32

P-labeled S1 probe incubated with GST,

bacteria total protein extract (Cell Extract) and purified proteins GST-

OsEREBP1 and GST-OsEREBP2. Binding reactions contained no (-) or a

500-fold molar excess (+) of unlabeled S1 or S1M probe. For OsEREBP1,

OsBWMK1 and 100 µM ATP reactions were also tested. The arrow

indicates a specific band shift. The asterisk indicates non-specific signal.

Details of the EMSAs are described in Material and Methods.


104


OsEREBP2 to the site S1 of OsRMC gene promoter sequence. EMSA was

performed with 32

P-labeled S1 probe incubated with GST, bacteria total

protein extract (Cell Extract) and purified proteins GST-OsEREBP1 and

GST-OsEREBP2. Binding reactions contained no (-) or a 500-fold molar

excess (+) of unlabeled S1, S1M, S2 or GCC probe. The arrow indicates a

specific band shift. The asterisk indicates non-specific signal. Details of the

EMSAs are described in Material and Methods.

OsEREBP1 was previously reported to be phosphorylated by the

OsBWMK1 MAPK and this modification enhanced OsEREBP1 DNA-

binding activity to the GCC box motif (Cheong et al. 2003). Thereby,

OsBWMK1 was also produced and its activity was confirmed by an in

vitro kinase assay (Figure 3). No significant difference in OsEREBP1

DNA-binding activity was detected when the TF was incubated with

OsBWMK1 and the probe S1 (Figure 4). EMSAs were also

Chapter III

105

performed with a sequence containing two tandem repeats of the

GCC box motif (Cheong et al. 2003).


OsEREBP2 to the GCC probe described by Cheong et al. (2003). EMSA

was performed with 32

P-labeled GCC probe incubated with GST, bacteria

total protein extract (Cell Extract) and purified proteins GST-OsEREBP1

and GST-OsEREBP2. An assay control was performed with a 500-fold

molar excess of unlabeled GCC probe. OsBWMK1 and 100 µM ATP were

also tested for OsEREBP1. The arrow indicates a specific band shift. The

asterisks indicate non-specific signal. Details of the EMSAs are described in

Material and Methods.


106

Figure 6 shows that OsEREBP1 and OsEREBP2 bind to the

synthetic probe and the interaction specificity was confirmed through

competition with 500-fold excess of unlabeled GCC probe. However,

only a weak enhancement in OsEREBP1-DNA binding activity was

detected when the protein was incubated with OsBWMK1 and ATP.

Curiously, the migration of OsEREBP1-DNA complex seems to be

slower than that of the OsEREBP2-DNA, opposite to what was

observed when the TFs interact with the S1 probe (Figure 4).

Figure 7. Transcriptional activity of OsEREBP1 and OsEREBP2 proteins.

(A) Illustrated plasmids used for the transient expression assays. The

pLUCm35GUS-pRMC plasmid contains the GUS reporter gene driven by

the fragment 3 of the OsRMC promoter and the minimal CaMV35S

promoter. (B) GUS and LUC activities were measured in Arabidopsis

protoplasts transfected with the reporter plasmid, pLUCm35GUS-pRMC or

pLUCm35GUS and the effector plasmid, 35S::OsEREBP1 or

35S::OsEREBP2 in a molar ratio 1:3. Transcriptional activity was calculated

as a GUS/LUC ratio. Bars indicate GUS/LUC ratio ± SD after 48 h

protoplast incubation. Data are means ± SD of three replicates.

Chapter III

107

The putative phosphorylation of OsEREBP2 by OsBWMK1 was

not assessed since any MAPK phosphorylation sites were predicted

in OsEREBP2 protein sequence.

OsEREBP1 and OsEREBP2 act as transcriptional repressors.

To assess the TFs transcriptional activity, transient expression

assays were performed in Arabidopsis protoplasts. These protoplasts

were transfected with the reporter plasmid pLUCm35GUS-pRMC

alone or in combination with the effector plasmids 35S::OsEREBP1

or 35S::OsEREBP2. As shown in Figure 7, the expression of the

GUS reporter gene was repressed when each effector plasmid was

co-transfected with the reporter plasmid, thus revealing that

OsEREBP1 and OsEREBP2 negatively regulate OsRMC gene

expression.

DISCUSSION

Several ERF proteins were shown to interact with the cis-element

ERE (Ethylene-Responsive Element), which contains the core

sequence designated GCC box (AGCCGCC) (Mizoi et al. 2011). This

sequence was shown to be the target cis-element for several ERFs;

however some TF proteins display binding flexibility and are able to

interact with variants of this sequence (Fujimoto et al. 2000). To

further characterize the TFs interaction with OsRMC gene promoter,

EMSA experiments were performed with two predicted GCC-like

motifs, S1 and S2, and the synthetic sequence containing two

tandem repeats of the canonical GCC box (Cheong et al. 2003). It

was shown that both OsEREBP1 and OsEREBP2 bind to either S1

or GCC box, but none of them binds to S2. In addition, the

OsEREBP1-GCC box complex displayed a slower migration than the

OsEREBP2-GCC box complex. This difference was not detected


108

when the TFs were incubated with S1, in which the TF-DNA

complexes migrate similarly. This result suggests that two

OsEREBP1 molecules bind to the GCC box tandem repeats as a

dimer or the TF binding may induce the recruitment of other TF

molecule to adjacent sites (Garvie and Wolberger 2001). OsEREBP1

cooperative binding was not detected in the EMSAs with S1,

probably because this sequence only contains one GCC-like motif.

Cooperative binding has been described for other regulatory

proteins. The Arabidopsis XERO2 dehydrin gene expression was

shown to be regulated by ABA and cold through combinatorial TF

binding (Chung and Parish 2008). Two Dehydration-Responsive

Elements/C-Repeat elements (DRE/CRT) which are binding sites for

DREB proteins were shown to be required for XERO2 gene

expression induced by cold stress. In addition, the regulation of

PDF1.2 gene expression by jasmonate and ethylene was reported to

depend on the activity of two GCC box motifs (Zarei et al. 2011).

Transient expression assays revealed that the AP2/ERF protein

ORA59 displays enhanced transactivation activity when both GCC

box motifs are present. In tobacco the AP2/ERF protein Tsi1 recruits

and interacts with the Zn-finger protein Tsip1 to cooperatively

promote the transcriptional activation of stress-responsive genes

(Ham et al. 2006). The formation of AP2/ERF dimers was reported

for CRF proteins but their biological function is still unknown

(Cutcliffe et al. 2011).

OsEREBP1 and OsEREBP2 transcriptional activity suggests that

OsEREBP1 and OsEREBP2 negatively regulate OsRMC gene

expression. Opposite results were obtained by Cheong et al. (2003),

who reported that OsEREBP1 functions as a transcriptional activator

when it interacts with GCC box sequences. Previous studies suggest

that TF proteins can function as both activators and repressors

Chapter III

109

(Bossi et al. 2009; Mena et al. 2002). The barley BPBF gene

encodes a DOF TF that induces gene expression in developing

endosperm and has a repressor activity upon germination (Mena et

al. 2002). During germination the TF was proposed to compete with

other transcriptional activators for DNA-binding or to interact with

other TFs that regulate the same target gene. ABI4 encodes an

AP2/ERF protein with a dual function in sugar signaling (Bossi et al.

2009). The authors suggest that the TF transcriptional activity is

dependent on the sequences that surround the ABI4-binding site or

on the binding of other factors. OsEREBP1 may also display different

transcriptional activity depending on the DNA-binding motifs present

in the target gene promoter sequence. The cooperative binding effect

suggested by the EMSA results also indicates that the presence of

additional DNA-binding motifs may interfere with the TF function.

In this work, we have shown that the OsEREBP1 and OsEREBP2

TFs bind to the same GCC-like motif in the OsRMC gene promoter

and function as transcriptional repressors. In addition, we show that

both TFs interact with a synthetic probe containing the GCC box

motif. Moreover, we propose that OsEREBP1 may be involved in

cooperative binding. The TF may bind to the GCC box motif as a

dimer or two TF proteins bind to the tandem GCC box motifs.

ACKNOWLEDGMENTS

Tânia Serra carried out the experimental work with the collaboration

of André Cordeiro who contributed to the protein production and

purification and the transactivation assays and Isabel Abreu who

contributed to the protein purification. The planning of the research

work and discussion of results was performed by Tânia Serra, Lisete

Fernandes, Nelson Saibo and M. Margarida Oliveira. In addition, we


110

would like to acknowledge Álvaro Sebastian and Bruno Contreras-

Moreira who contributed to the bioinformatic analysis.

REFERENCES

Allen MD, Yamasaki K, Ohme-Takagi M, Tateno M, Suzuki M (1998) A

novel mode of DNA recognition by a beta-sheet revealed by the solution

structure of the GCC-box binding domain in complex with DNA. EMBO J

17: 5484-5496

Anthony RG, Henriques R, Helfer A, Meszaros T, Rios G, Testerink C,

Munnik T, Deak M, Koncz C, Bogre L (2004) A protein kinase target of a

PDK1 signalling pathway is involved in root hair growth in Arabidopsis.

EMBO J 23: 572-581

Bossi F, Cordoba E, Dupre P, Mendoza MS, Roman CS, Leon P (2009) The

Arabidopsis ABA-INSENSITIVE (ABI) 4 factor acts as a central

transcription activator of the expression of its own gene, and for the

induction of ABI5 and SBE2.2 genes during sugar signaling. Plant J 59:

359-374

Busk PK, Jensen AB, Pages M (1997) Regulatory elements in vivo in the

promoter of the abscisic acid responsive gene rab17 from maize. Plant J

11: 1285-1295










Chung S, Parish RW (2008) Combinatorial interactions of multiple cis-

elements regulating the induction of the Arabidopsis XERO2 dehydrin

gene by abscisic acid and cold. Plant J 54: 15-29

Chapter III

111

Contreras-Moreira B (2010) 3D-footprint: a database for the structural

analysis of protein-DNA complexes. Nucleic Acids Res 38: D91-97

Cutcliffe JW, Hellmann E, Heyl A, Rashotte AM (2011) CRFs form protein-

protein interactions with each other and with members of the cytokinin

signalling pathway in Arabidopsis via the CRF domain. J Exp Bot 62:

4995-5002





Dubos C, Stracke R, Grotewold E, Weisshaar B, Martin C, Lepiniec L

(2010) MYB transcription factors in Arabidopsis. Trends Plant Sci 15:

573-581

Figueiredo D, Barros P, Cordeiro A, Serra TS, Lourenco T, Chander S,

Oliveira MM, Saibo NJM (2012) Seven zinc-finger transcription factors

are novel regulators of the stress responsive gene OsDREB1B. J Exp

Bot: 1-14

Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000)

Arabidopsis ethylene-responsive element binding factors act as

transcriptional activators or repressors of GCC box-mediated gene


Garvie CW, Wolberger C (2001) Recognition of specific DNA sequences.

Mol Cell 8: 937-946



Ham BK, Park JM, Lee SB, Kim MJ, Lee IJ, Kim KJ, Kwon CS, Paek KH

(2006) Tobacco Tsip1, a DnaJ-type Zn finger protein, is recruited to and

potentiates Tsi1-mediated transcriptional activation. Plant Cell 18: 2005-

2020






112

Kizis D, Lumbreras V, Pages M (2001) Role of AP2/EREBP transcription

factors in gene regulation during abiotic stress. FEBS Lett 498: 187-189

Liu Y, Zhao TJ, Liu JM, Liu WQ, Liu Q, Yan YB, Zhou HM (2006) The

conserved Ala37 in the ERF/AP2 domain is essential for binding with the

DRE element and the GCC box. FEBS Lett 580: 1303-1308

Mena M, Cejudo FJ, Isabel-Lamoneda I, Carbonero P (2002) A role for the

DOF transcription factor BPBF in the regulation of gibberellin-responsive

genes in barley aleurone. Plant Physiol 130: 111-119

Mizoi J, Shinozaki K, Yamaguchi-Shinozaki K (2012) AP2/ERF family

transcription factors in plant abiotic stress responses. Biochim Biophys

Acta 1819: 86-96

Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki

K (2002) DNA-binding specificity of the ERF/AP2 domain of Arabidopsis

DREBs, transcription factors involved in dehydration- and cold-inducible

gene expression. Biochem Biophys Res Commun 290: 998-1009

Seo YS, Chern M, Bartley LE, Han M, Jung KH, Lee I, Walia H, Richter T,

Xu X, Cao P, Bai W, Ramanan R, Amonpant F, Arul L, Canlas PE, Ruan

R, Park CJ, Chen X, Hwang S, Jeon JS, Ronald PC (2011) Towards

establishment of a rice stress response interactome. PLoS Genet 7:

e1002020

Shimono M, Sugano S, Nakayama A, Jiang CJ, Ono K, Toki S, Takatsuji H

(2007) Rice WRKY45 plays a crucial role in benzothiadiazole-inducible

blast resistance. Plant Cell 19: 2064-2076

Shukla RK, Raha S, Tripathi V, Chattopadhyay D (2006) Expression of

CAP2, an APETALA2-family transcription factor from chickpea,

enhances growth and tolerance to dehydration and salt stress in

transgenic tobacco. Plant Physiol 142: 113-123

Steffens NO, Galuschka C, Schindler M, Bulow L, Hehl R (2004) AthaMap:

an online resource for in silico transcription factor binding sites in the

Arabidopsis thaliana genome. Nucleic Acids Res 32: D368-372

Sun S, Yu JP, Chen F, Zhao TJ, Fang XH, Li YQ, Sui SF (2008) TINY, a

dehydration-responsive element (DRE)-binding protein-like transcription

Chapter III

113

factor connecting the DRE- and ethylene-responsive element-mediated

signaling pathways in Arabidopsis. J Biol Chem 283: 6261-6271

Swaminathan K, Peterson K, Jack T (2008) The plant B3 superfamily.


Turatsinze JV, Thomas-Chollier M, Defrance M, van Helden J (2008) Using

RSAT to scan genome sequences for transcription factor binding sites

and cis-regulatory modules. Nat Protoc 3: 1578-1588

Umezawa T, Nakashima K, Miyakawa T, Kuromori T, Tanokura M,

Shinozaki K, Yamaguchi-Shinozaki K (2010) Molecular basis of the core

regulatory network in ABA responses: sensing, signaling and transport.

Plant Cell Physiol 51: 1821-1839

Woo HR, Kim JH, Kim J, Lee U, Song IJ, Lee HY, Nam HG, Lim PO (2010)

The RAV1 transcription factor positively regulates leaf senescence in

Arabidopsis. J Exp Bot 61: 3947-3957

Yamaguchi-Shinozaki K, Shinozaki K (2005) Organization of cis-acting

regulatory elements in osmotic- and cold-stress-responsive promoters.


Zarei A, Korbes AP, Younessi P, Montiel G, Champion A, Memelink J

(2011) Two GCC boxes and AP2/ERF-domain transcription factor

ORA59 in jasmonate/ethylene-mediated activation of the PDF1.2

promoter in Arabidopsis. Plant Mol Biol 75: 321-331

Zhang H, Huang Z, Xie B, Chen Q, Tian X, Zhang X, Lu X, Huang D, Huang

R (2004) The ethylene-, jasmonate-, abscisic acid- and NaCl-responsive

tomato transcription factor JERF1 modulates expression of GCC box-

containing genes and salt tolerance in tobacco. Planta 220: 262-270

Zhang L, Tian LH, Zhao JF, Song Y, Zhang CJ, Guo Y (2009) Identification



149: 916-928


114

Chapter IV

115

OsEREBP1 encodes an AP2/ERF transcription factor

involved in high salinity, drought and ABA responses

Chapter IV

OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses

116

TABLE OF CONTENTS – CHAPTER IV

Abstract ....................................................................................... 117

Introduction ................................................................................. 118

Material and Methods ................................................................. 120

Plant material and growth conditions ........................................... 120

Plasmid construction ................................................................... 121

OsEREBP1 subcellular localization ............................................. 122

Arabidopsis protoplast transfection and treatments ..................... 123

Protein extraction and immunoblot analysis ................................ 123

Analysis of protein kinase activity ................................................ 124

Arabidopsis plant transformation ................................................. 125

Semi-quantitative reverse transcription-PCR (RT-PCR) analysis ....................................................................................... 125

Analysis of stress tolerance in transgenic plants ......................... 125

Complementation of the rap2.2 Arabidopsis mutant .................... 126

Results ......................................................................................... 127

OsEREBP1 locates in the nucleus .............................................. 127

High salinity increases OsEREBP1 abundance through increased protein synthesis and stability ..................................... 128

High salinity does not affect the kinase activity of the OsBWMK1 protein encoded by the OsBWMK1S transcript ......... 130

OsEREBP1 functional analysis in transgenic plants .................... 131

Complementation studies in rap2.2 mutants ................................ 135

Discussion ................................................................................... 136


References .................................................................................. 143

Chapter IV

117

ABSTRACT

Drought and high salinity cause great losses in crop productivity

worldwide. In order to cope with these adverse environmental

conditions, plants have evolved several strategies, which rely on the

perception of stress stimuli, signal transduction and regulation of

stress-responsive genes. Transcription factors (TFs) can control the

expression of several genes and play a crucial role in stress

responses. OsEREBP1 encodes an AP2/ERF family TF that binds to

the OsRMC promoter and is putatively involved in biotic and abiotic

stress responses in rice. We have shown that high salinity induces

OsEREBP1 protein accumulation, through increase in both protein

synthesis and protein stability. OsEREBP1 was previously reported

to be phosphorylated by the OsBWMK1. However, our in vitro kinase

assays revealed that OsBWMK1 kinase activity is not affected by

high salinity, suggesting that the increase in the TF stability does not

involve phosphorylation by this MAPK. The analysis of Arabidopsis

plants over-expressing OsEREBP1 further supports its role in abiotic

stress responses. OsEREBP1-OX Arabidopsis seeds displayed

increased sensitivity to high salinity and ABA during germination. The

ABA hypersensitivity was also observed in root growth assays, but

the increased sensitivity to high salinity was neither observed for root

growth nor in survival studies. Root growth assays indicated that

OsEREBP1-OX seedlings are more tolerant to water deficit.

However, when OsEREBP1-OX and wt seedlings were subjected to

water deficit conditions, no significant differences in survival rate

were observed. Complementation assays with rap2.2 mutants

showed that OsEREBP1 and RAP2.2 must have different functions

in abiotic stress responses.


118

INTRODUCTION

Drought and high salinity are major adverse environmental factors

that reduce the yield of several staple food crops, such as rice.

Therefore, the continuous worldwide reduction of water resources

and the increase in soil salinization will further limit crop productivity

(Newton et al. 2011; Pardo 2010). To respond to adverse

environmental conditions plants have developed mechanisms that

promote the physiological and biochemical modifications necessary

for plant adaptation and survival. The perception of the

environmental stress stimuli promotes the activation of signal

transduction pathways that induce changes in gene expression

(Knight and Knight 2001; Mahajan and Tuteja 2005). The products of

stress-inducible genes may have a direct function in cell protection

(the case of detoxification enzymes), or in the regulation of gene

expression and signal transduction (Yamaguchi-Shinozaki and

Shinozaki 2006). Transcription factors (TFs) are master regulators of

the stress signaling network, due to their ability to control the

expression of several target genes (Nakashima et al. 2009). This

feature makes the TFs good candidates for genetic engineering

programs, since their over-expression can lead to enhanced

tolerance to multiple stress conditions (Bhatnagar-Mathur et al. 2008;

Century et al. 2008; Vij and Tyagi 2007). TFs implicated in abiotic

stress responses have been identified in several plant species and

include members of the AP2/ERF, bZIP, NAC and MYB families

(Agarwal and Jha 2010; Saibo et al. 2009; Santos et al. 2011).

The AP2/ERF (APETALA2/Ethylene Response Factor) proteins

comprise a superfamily of TFs identified in plants and

microorganisms (Magnani et al. 2004). These regulatory proteins

contain either one or two AP2-DNA binding domains and are

Chapter IV

119

involved in plant development and stress-related responses (Dietz et

al. 2010). OsEREBP1 contains one AP2-DNA binding domain and

belongs to the CMVII group of ERF proteins (Cheong et al. 2003;

Nakano et al. 2006). This ERF group includes many proteins

involved in biotic and abiotic stress responses. For instance, the

Arabidopsis RAP2.2 and rice SUB1A were shown to have a role in

submergence tolerance (Hinz et al. 2010; Jung et al. 2010) and the

CaPF1 from pepper was found to confer pathogen and freezing

tolerance when over-expressed in Arabidopsis (Yi et al. 2004).

Several studies revealed that OsEREBP1 is involved in both biotic

and abiotic stress responses. OsEREBP1 was initially identified as a

putative target of OsBWMK1 (rice Blast- and Wounding-activated

MAP Kinase), a MAPK involved in rice defense responses (Cheong

et al. 2003). OsBWMK1 alternative splicing generates three

transcript variants OsBWMK1L, OsBWMK1M and OsBWMK1S and

the encoded proteins were shown to phosphorylate OsEREBP1 (Koo

et al. 2007). The OsBWMK1S encoded protein phosphorylates the

TF and greatly increases its DNA-binding activity to the GCC box

motif usually present in the promoter of stress-responsive genes

(Cheong et al. 2003; Seo et al. 2011). OsEREBP1 function in biotic

stress responses was also analyzed in rice plants over-expressing

the TF (Seo et al. 2011). The transgenic plants displayed enhanced

resistance to infection by the bacteria Xanthomonas oryzae pv.

oryzae (Xoo).

The role of OsEREBP1 as a putative regulator of abiotic stress

responses was suggested by gene expression studies. Microarray

analysis revealed that the TF gene expression is induced under

moderate cold (10ºC) (Cheng et al. 2007). In addition, the TF

transcript level was transiently induced in shoots and down-regulated

in roots of rice plants subjected to drought stress (Chapter 2).


120

OsEREBP1 may also have a role in high salinity responses.

Although no significant changes in gene expression were reported

under salt stress, the TF was shown (Chapter 3) to modulate the

expression of OsRMC (rice Root Meander Curling), a negative

regulator of salt stress responses. The TF directly interacts with the

OsRMC promoter and negatively regulates its gene expression

(Chapters 2 and 3). OsRMC encodes a receptor-like kinase (RLK)

whose expression is induced in response to high salinity in a stress-

dose-dependent manner (Chapter 2). In addition, OsRMC

knockdown lines showed improved tolerance to salt stress conditions

and increased expression of stress-responsive genes (Zhang et al.

2009).

In this study, we further characterized the function of OsEREBP1

in biotic and abiotic stress responses. The OsEREBP1 protein level

was shown to be strictly regulated by salt stress through synthesis

and stability of the protein. Transgenic Arabidopsis plants revealed

that OsEREBP1 is also involved in drought and ABA responses.


Plant material and growth conditions

Arabidopsis thaliana (ecotype Columbia (Col-0)) and rap2.2

mutant (SALK_079603.40.60.x) plants were grown in the

greenhouse under long-day conditions (16 h/8 h light/dark cycle) to

the flowering stage for plant transformation. Seeds were surface-

sterilized in a solution of 1.5% sodium hypochlorite containing 0.1%

Tween-20 for 10 min and rinsed six times with sterile water. After

stratification at 4ºC for 3 d in darkness, the seeds were sown and

germinated in a growth chamber at 22ºC, under a 16 h photoperiod

(40 µmol m-2 s-1). Seven-day-old seedlings, similar in size, grown on

Chapter IV

121

half-strength Murashige and Skoog (MS) medium, were used in the

root growth studies. Survival assays were performed with 14-day-old

seedlings grown on half-strength MS medium.

Plasmid construction

The full-length OsEREBP1 (LOC_Os02g54160) and OsBWMK1S

(LOC_Os06g49430.2) sequences were isolated from cDNA prepared

from total RNA of 14 days-old rice seedlings as described in Chapter

2. The OsEREBP1 fragment was obtained through amplification with

the PhusionTM high-fidelity DNA polymerase (Finnzymes, Vantaa,

Finland) and the GW-OsEREBP1-Fw/-Rv primers containing

Gateway adapters (Table 1). The insert was cloned into the

pDONR221 vector with the Gateway BP recombinase (Invitrogen,

CA, USA) according to the manufacturer’s instructions. The plasmid

was confirmed by sequencing. To obtain the 35S::GFP::OsEREBP1

and the HA::OsEREBP1 plasmids, LR recombination (Invitrogen, CA,

USA) reactions were performed with the binary vectors pH7WGF2

and pEarleyGate201, respectively, following the manufacturer’s

instructions. The OsBWMK1S fragment was isolated with the

PrimeSTAR HS DNA polymerase (Takara, Shiga, Japan) and the

OsBWMK1-Fw/-Rv primers containing NcoI and NotI recognition

sequences (Table 1). The obtained PCR product was cloned into the

pGEM-T Easy Vector (Promega, Wisconsin, USA) according to the

manufacturer’s instructions and sequenced. The NcoI-NotI fragment

containing the OsBWMK1S insert was excised from the pGEM-T

Easy Vector and cloned into the pRT100 vector to obtain the

OsBWMK1::HA plasmid. The GFP::OsEREBP1 construct was

prepared to perform studies in Arabidopsis protoplasts. The region

containing the 35S::GFP::OsEREBP1 fragment was removed from

the pH7WGF2-OsEREBP1 through restriction with XbaI-HindIII and


122

cloned into the pGREEN0029 vector. The plasmids AtMAPK8::HA,

AtMAPK16::HA and AtMAPK18::HA which allow over-expression of

the MAPKs in Arabidopsis protoplasts were previously prepared by

colleagues at L. Bögre lab.

Table 1. Oligonucleotide sequences used for the cloning procedures and

gene expression studies. The underlined region of the primer corresponds

to adapter sequences and the remaining region is specific to the target

DNA.


GW-OsEREBP1-Fw GGGGACAAGTTTGTACAAAAAAGCAGGCTACAAGCAATCCACCACTGCA

GW-OsEREBP1-Rv GGGGACCACTTTGTACAAGAAAGCTGGGTTGCCTCCCAATCTCCAATAG

OsBWMK1-Fw GGCCATGGAGTTCTTCACTGAGTATGGA

OsBWMK1-Rv GGGCGGCCGCAGGAGTGCATCCTGGAGACTT

RAP2.2-Fw TCCCTCCGCGTCACTAACGA

RAP2.2-Rv GCTAAACAAGTTTGGGGGTACAAAACA

Actin-Fw GGCGATGAAGCTCAATCCAAACG

Actin-Rv GGTCACGACCAGCAAGATCAAGACG

OsEREBP1 subcellular localization

Onion epidermal cells were bombarded with 1.5 or 1.6 µg of

35S::GFP::OsEREBP1 or 35S::GFP (pH7WGF2 vector) plasmids,

respectively. Plasmid DNA was precipitated onto 1 µm gold particles

using spermidine (0.1 M) and CaCl2 (2.5 M). The tissues were

bombarded with DNA-coated particles using a particle gun device

(PDS-1000/He, Bio-Rad, CA, USA). The transformed tissues were

incubated overnight under dark on filter paper soaked in sterile

water. The tissues were stained with DAPI (17 µM) and observed

with a Nikon TE300 microscope.

Chapter IV

123

Arabidopsis protoplast transfection and treatments

Protoplast isolation from Arabidopsis suspension cells (Col-0

ecotype) and polyethylene glycol-mediated transfection were

performed as described in Chapter 3. Approximately 3 x 105

protoplasts were transfected with 2-10 µg of plasmid DNA and

incubated 24 to 48 h in medium containing 0.2 µM 2.4-

Dichlorophenoxyacetic acid (2.4-D). Before harvesting, the

transfected protoplasts were subjected to a salt treatment (280 mM

NaCl) for 10 min (Teige et al. 2004) or maintained under control

conditions. In a separate experiment, the transfected protoplasts

under control and high salt conditions were simultaneously treated

with cycloheximide (100 µM) to block protein synthesis (Magyar et al.

2005) and harvested after 0, 15, 30, 60, 120 and 240 min. The

transfected protoplasts were collected by centrifugation and stored at

-80ºC.

Protein extraction and immunoblot analysis

Total protein was extracted from transfected protoplasts as

previously described (Teige et al. 2004) with minor modifications.

Cell pellets were ressuspended in homogenization buffer (Lacus

buffer) containing 25 mM Tris-HCl pH 7.5, 10 mM MgCl2, 15 mM

EGTA, 75 mM NaCl, 1 mM NaF, 0.5 mM NaVO3, 15 mM β-

glycerolphosphate, 0.1% Tween-20, 1 mM DTT, 15 mM ρ-

nitrophenylphosphate, 0.5 mM phenylmethylsulfonyl fluoride (PMSF)

and 1x complete protease inhibitor cocktail (Roche, Basel,

Switzerland). After removal of the cell debris by centrifugation, the

total protein concentration was determined by the Bradford protein

assay (Bio-Rad, CA, USA). For immunoblots, equal amounts of total

protein extracts were resolved on SDS-PAGE gels containing 10%


124

polyacrylamide and transferred to PVDF membranes. The

membranes were probed with anti-HA or anti-GFP mouse

monoclonal antibody and an anti-mouse horseradish peroxidase-

conjugated antibody according to the manufacturer’s instructions

(Roche, Basel, Switzerland). A loading control was performed with

Coomassie Brilliant Blue staining or an anti-Actin antibody (Santa

Cruz Biotechnology, CA, USA).

Analysis of protein kinase activity

Immunoprecipitation and in vitro kinase assay were performed as

previously described with some modifications (Bogre et al. 1999). For

immunoprecipitation, 5 µL of anti-HA antibody (Roche, Basel,

Switzerland) were added to 50 µg of protein extracts. After 1 h of

constant rolling, 15 µL of protein G beads was added from a 50%

protein G-Sepharose suspension. The tubes were rotated for 3 h,

and the beads were then washed three times with 500 µL of wash

buffer (50 mM Tris-HCl pH 7.5, 250 mM NaCl, 5 mM EGTA, 5 mM

Na2EDTA pH 8, 0.1% Tween-20, 5 mM NaF, 0.1% Nonidet P-40,

and 0.5 mM PMSF) and once with kinase buffer (20 mM HEPES pH

7.5, 15 mM MgCl2, 5 mM EGTA, and 1 mM DTT). The buffer was

aspirated with a needle and the kinase reaction was performed on

the beads. The reaction was conducted at approximately 22ºC for 30

min with 15 µL kinase buffer supplemented with 0.1 mM ATP, 2 µCi

[γ-32P]-ATP, and 10 µg of myelin basic protein (MBP) as artificial

phosphorylation substrate. The reaction was terminated by boiling in

SDS sample buffer and resolved in SDS-PAGE gels containing

12.5% polyacrylamide. Gels were dried on Whatman 3MM paper and

analyzed by autoradiography. All the reactions were performed in

triplicate.

Chapter IV

125

Arabidopsis plant transformation

Arabidopsis plants (ecotype Col-0) were transformed via the

floral-dip method as previously described (Clough and Bent 1998).

An Agrobacterium (strain LBA4404) culture containing the

HA::OsEREBP1 plasmid was used for Col-0 transformation. T0

seeds were surface-sterilized, stratified and screened on MS plates

containing 1% sucrose, 2.6 mM MES buffer, 0.1 mM BASTA and 0.2

mM cefotaxime. Ten resistant OsEREBP1-OX seedlings (T1) were

transplanted to soil and grown in the greenhouse to produce seeds.

DNA was isolated from these plants through the QuickExtractTM Plant

DNA Extraction Solution (Epicentre, Madison, USA) according to the

manufacturer’s instructions. The presence of the transgene was

confirmed by PCR with the GW-OsEREBP1-Fw/-Rv primers (Table

1). Homozygous plants (T2) were selected for transgene expression

analysis by RT-PCR and OsEREBP1-OX T2 and T3 seeds were

used for the stress tolerance assays.

Semi-quantitative reverse transcription-PCR (RT-PCR) analysis

Total RNA was isolated using the RNeasy Plant Mini kit (Qiagen,

Courtaboeuf, France). cDNA was synthesized from 0.5-1 µg of total

RNA using the Transcriptor High Fidelity cDNA Synthesis kit (Roche,

Base Switzerland) according to the manufacturer’s instructions. PCR

reactions were performed using the gene specific primers described

in Table 1. Actin (At2g37620) gene was used as internal control.

Analysis of stress tolerance in transgenic plants

For germination rate analysis, approximately 40 seeds from wt

and OsEREBP1-OX lines were plated in triplicate on half-strength

MS medium supplemented or not with 100 mM NaCl or 1 µM ABA.


126

Seeds were stratified and incubated at 22ºC under long-day

conditions. Germination (emergence of the radicle) was scored daily

for 6 days. Two independent replicates were performed for each

treatment. Survival rate was evaluated through transfer of 14-day-old

seedlings to half-strength MS medium supplemented with NaCl (150

mM and 200 mM) or PEG (7.5%). Shoot photographs were taken 11

d after transfer. For root growth assays, 7-day-old seedlings were

transferred to half-strength MS medium supplemented with ABA (1

and 10 µM), NaCl (100 mM and 150 mM) or PEG (5% and 10%).

The plates were placed vertically in a rack and photographs were

taken 11 d after transfer to medium containing ABA, PEG or NaCl.

Root growth ratios were obtained by analysis of photographs with the

Image J software and determined as the length at a given time point

minus the initial length (root length after seedling transfer). Relative

root growth was calculated as the mean of the root growth in stress-

treated seedlings divided by the mean of the root growth in control

conditions obtained for wt or each transgenic line. The total number

of plants used in the root growth studies is described in Table 2.

Complementation of the rap2.2 Arabidopsis mutant

The rap2.2 T-DNA insertion mutant (SALK_079603.40.60.x) was

obtained from the Nottingham Arabidopsis Stock Centre (NASC,

Loughborough, UK). Homozygous mutant plants were isolated and

suppression of gene expression was confirmed by RT-PCR analysis.

For complementation studies, homozygous mutant plants were

transformed with Agrobacterium (strain LBA4404) carrying

HA::OsEREBP1 by the floral-dip method (Clough and Bent 1998).

Homozygous plants (T2) were obtained as previously described and

analyzed for transgene expression. rap2.2 mutant complementation

was assessed through the study of root growth under abiotic stress

Chapter IV

127

conditions. The root growth assays were performed with 7-day-old

seedlings as previously described and photographs were taken 11 or

15 days after transfer to medium containing 100 mM NaCl or 5%

PEG, respectively. The total number of plants used in the root growth

studies is described in Table 2.

Table 2. Total number of plants used to calculate root growth in seedlings

treated with NaCl, ABA and PEG. L2 and L3 are OsEREBP1-OX lines and

L4, L5 and L6 are rap2.2/OsEREBP1 complemented lines.

Control NaCl Control 1 µM ABA

Control 10 µM ABA

Control PEG

Col-0 9 24 27 32 9 25 7 15

L2 13 21 10 13 13 24 17 24

L3 11 21 8 14 11 23 17 22

Col-0 9 17 - - - - 19 36

rap2.2 13 18 - - - - 16 25

L4 4 - - - - - 14 20

L5 20 24 - - - - 17 19

L8 8 22 - - - - 17 16

RESULTS

OsEREBP1 locates in the nucleus

OsEREBP1 subcellular localization was analyzed through

transient expression of 35S::GFP::OsEREBP1 in onion epidermal

cells. The green fluorescent signal was detected exclusively in the

nucleus (Figure 1). The cells were stained with DAPI, which

confirmed the nuclear localization of the GFP-OsEREBP1 fusion

protein (Figure 1).


128

Figure 1. Analysis of OsEREBP1 cellular localization. Onion epidermal cells

were bombarded with 35S::GFP::OsEREBP1 and 35S::GFP, stained with

DAPI and photographed under different light fields. Merged images were

prepared with the Image J software. Scale bars ≈ 100 µm.

High salinity increases OsEREBP1 abundance through increased

protein synthesis and stability

To investigate whether high salinity could have an effect on

OsEREBP1 protein level, Arabidopsis protoplasts were transfected

with the GFP::OsEREBP1 plasmid and after 24 h were subjected to

a salt treatment (280 mM NaCl) for 10 min. Total protein analysis

revealed that two forms of OsEREBP1 are recognized by the anti-

GFP antibody under both control and high salt conditions (Figure

2A). Moreover, both protein forms showed a molecular mass higher

than expected. The molecular mass of GFP-OsEREBP1 fusion

protein was estimated as 72 kDa based on the predicted aa

sequence, but the detected forms were close to 78 and 85 kDa. The

Chapter IV

129

protein form with 78 kDa was considered as corresponding to the

GFP-OsEREBP1 fusion protein.

Figure 2. Effect of high salinity on OsEREBP1 protein accumulation, as

assessed by Western-blot with anti-GFP antibody, on Arabidopsis

protoplasts transfected with GFP::OsEREBP1 or 35S::GFP. (A) Protoplasts

treated with a salt solution (280 mM NaCl) for 10 min. (B) Protoplasts

treated with 100 µM cycloheximide (CHX) and subjected or not to a salt

treatment (280 mM NaCl). The protoplasts were harvested at the time

points indicated. Coomassie Brilliant Blue staining (A) or an anti-Actin

antibody (B) was used as loading control. Cells were either transfected with

GFP::OsEREBP1 (10 µg) or with 35S::GFP (2 µg in A, or 5 µg in B).

The observed increase in OsEREBP1 protein level under salt

stress conditions may be due to increased protein stability or higher

protein synthesis. To investigate these hypothesis, Arabidopsis

protoplasts over-expressing the TF under control and salt stress

conditions were treated with cycloheximide (100 µM) to block de

novo protein synthesis (Figure 2B). In cells maintained at control

conditions, GFP-OsEREBP1 levels rapidly decreased becoming

undetectable at 1 h treatment. Under high salinity, the protein level

slightly increased after 15 min treatment and afterwards it gradually

decreased. However, the fusion protein was still detected after 4 h

treatment. The slight reduction in protein level indicates that high


130

salinity promoted OsEREBP1 protein synthesis. However, the

presence of protein during all the treatment suggests that

OsEREBP1 stability was much enhanced under salt stress

conditions.

High salinity does not affect the kinase activity of the OsBWMK1

protein encoded by the OsBWMK1S transcript

OsEREBP1 was previously reported to be phosphorylated by the

protein form encoded by the OsBWMK1S transcript (Cheong et al.

2003). Moreover, the OsBWMK1S transcript was shown to

accumulate in response to high salinity (Agrawal et al. 2003b). To

assess if the kinase activity of the OsBWMK1 protein encoded by the

OsBWMK1S transcript is affected by high salinity, in vitro kinase

assays were performed in Arabidopsis protoplasts. No different

kinase activity or protein levels were detected (Figure 3). To identify

Arabidopsis MAPKs able to phosphorylate OsEREBP1, the kinase

activity of the group D MAPKs AtMAPK8, AtMAPK16 and

AtMAPK18, was also analyzed. The MAPKs whose activity is

regulated by this abiotic stress, would be silenced in Arabidopsis

protoplasts. Moreover, transactivation assays should be able to

elucidate if the interaction between OsEREBP1 and the OsRMC

promoter is regulated by phosphorylation (this assay, however, was

not yet performed due to time limitations). Only AtMAPK16 revealed

a significant increase in kinase activity under high salt treatment. The

difference in kinase activity observed in control and salt stress

conditions was confirmed through quantification of band intensity

with the Image J software.

Chapter IV

131

Figure 3. MAPKs activity under control and high salinity conditions. The

MAPKs activity was measured through in vitro kinase assays using 50 µg

total protein from Arabidopsis cells transfected with 5 µg of each MAPK

construct. Protoplasts were treated with 280 mM NaCl for 10 min or

maintained in control conditions. MAPK protein quantification was

performed on the previous samples by Western-blot with anti-HA antibody.

OsEREBP1 functional analysis in transgenic plants

OsEREBP1 was shown to be regulated by drought and salt stress

conditions at transcriptional (Chapter 2) or post-translational level,

respectively. To further characterize the TF role in these abiotic

stress responses, Arabidopsis plants over-expressing OsEREBP1

(OsEREBP1-OX) were generated. Three independent homozygous

lines (L1, L2 and L3) with high expression of the transgene (Figure

4A) were selected for the following studies. The germination rate was

measured for wt and transgenic seeds under control, high salinity

and ABA treatments (Figures 4B-4D). As shown in Figure 4B, under

control conditions, the germination rate of the three transgenic lines

was lower (80%) than the observed in wt plants (96%). However, no

significant delay in germination was observed. On the contrary, salt

treatment induced a significant delay in germination of the transgenic

seeds (Figure 4C). Approximately 90% of wt seeds germinated within

3 d, whereas the germination rate for the transgenic seeds was

between 20% and 55%. A slight delay in germination was also


132

detected in transgenic seeds subjected to ABA. The seed

germination rate of OsEREBP1-OX lines, evaluated 6 days after ABA

treatment was significantly lower than that observed for wt plants.

These results indicate that OsEREBP1-OX greatly increases seed

sensitivity to high salinity and causes a slight increase in ABA

sensitivity.

Figure 4. OsEREBP1 over-expression in Arabidopsis induces a delay in

seed germination under salt and ABA treatments. (A) RT-PCR analysis of

OsEREBP1 expression level in transgenic and wt (Col-0) plants. Total RNA

was isolated from plants with the second pair of leaves well expanded.

Internal control: Actin. (B), (C) and (D) Germination rate analysis of

transgenic and wt seeds sown on half-strength MS medium without (B) or

with 100 mM NaCl (C) or with 1 µM ABA (D). The percentage of seeds

germinated was recorded during 6 days. Data are means ± SD (n ≈ 100).

OsEREBP1 function in abiotic stress responses was also

analyzed through survival rate and root growth studies with wt and

transgenic seedlings subjected to stress treatments. Survival rate

assays were performed with 14-day-old seedlings transferred to

medium supplemented with NaCl (150 and 200 mM) and PEG

Chapter IV

133

(7.5%). No significant differences in survival rate were detected in

seedlings subjected to both stress treatments (Figure 5). The

transgenic seedlings treated with 200 mM NaCl displayed a survival

rate similar to wt and were completely dried 1 day after transfer.

Figure 5. OsEREBP1-OX (L1-L3) and wild type (Col-0) Arabidopsis

seedlings grown under high salinity and water deficit induced by PEG, as

compared to control conditions. Fourteen-day-old seedlings were

transferred to half-strength MS medium with or without 7.5% PEG, or with

150 mM NaCl. Photographs were taken 11 days after transfer.

Root growth assays were performed with 7-day-old seedlings

transferred to medium containing ABA (1 or 10 µM), NaCl (100 or

150 mM) or PEG (5 or 10%). These assays were not performed with

plants L1 due to their low seed germination. Root growth was

considered as the root length of each seedling minus the initial length

measured immediately after transfer. A high variability in root growth

was detected for all seedlings analyzed, thus the relative root growth

was calculated as the ratio between the mean root growth of stress-

treated seedlings and the mean growth of wt or each transgenic line

under control conditions (Figure 6). No significant difference in root

phenotype was detected between wt and the transgenic seedlings

under 100 mM NaCl treatment. In addition, treatment with 1 µM ABA

did not significantly affect root growth of both wt and L2 transgenic


134

seedlings, but did affect the growth of L3 roots. At higher ABA

concentration (10 µM ABA), the root growth of both wt and

transgenic seedlings (L2 and L3) was significantly affected and the

transgenic seedlings displayed enhanced sensitivity to ABA

inhibition. Water deficit induced by PEG revealed that the transgenic

plants are less affected at the root level by this abiotic stress, as

compared to wt. The root growth was also analyzed in seedlings

treated with 150 mM NaCl and 10% PEG, however all seedlings

were completely dried 1 day after transfer.

Figure 6. Analysis of root growth in OsEREBP1-OX seedlings subjected to

high salinity, ABA and water deficit induced by PEG. Seven-day-old

seedlings were transferred to half-strength MS medium with or without 100

mM NaCl, 1 or 10 µM ABA and 5% PEG. Photographs were taken 11 days

after transfer to medium containing ABA, PEG or NaCl. Error bars represent

standard error. Total number of plants is described in Table 2. Asterisks (*)

indicate significant differences (P<0.05) relative to wt (Col-0).

Chapter IV

135

Complementation studies in rap2.2 mutants

OsEREBP1 and RAP2.2 belong to the CMVII group of ERF

proteins and share high aa sequence identity (87%) within the AP2-

DNA binding domain. To determine whether OsEREBP1 is

functionally similar to the RAP2.2 gene from Arabidopsis, a rap2.2

mutant line was transformed with the HA::OsEREBP1 construct. The

suppression of rap2.2 gene expression and the transgene

expression in homozygous rap2.2/OsEREBP1 complemented lines

was confirmed by RT-PCR (Figure 7A).

Figure 7. Analysis of gene expression and root growth of

rap2.2/OsEREBP1 complemented seedlings. (A) RT-PCR analysis of

rap2.2 mutants, wt and complemented lines (L4, L5 and L8). Total RNA was

extracted from plants with the second pair of leaves well expanded. Internal

control: Actin. (B) Root growth assays with 7-day-old seedlings subjected to

100 mM NaCl and 5% PEG. Photographs were taken 11 or 15 days after

transfer to NaCl-containing medium or PEG-containing medium,

respectively. Total number of plants is described in Table 2. Asterisks (*)

indicate significant differences (P<0.05) relative to wt (Col-0).

Root growth studies were performed to assess the root phenotype

of rap2.2 mutants and rap2.2/OsEREBP1 complemented lines grown

under high salinity (100 mM NaCl) and water deficit induced by PEG


136

(5%) (Figure 7B). When the Arabidopsis seedlings were grown under

100 mM NaCl treatment, no significant difference in root growth was

detected between wt, the rap2.2 mutant and the transgenic seedlings

L5. However, a significant decrease in root growth was observed for

the seedlings L8 when compared with wt. When the seedlings were

subjected to water deficit induced by PEG, the root growth of rap2.2

was 13.5% higher than wt, indicating that rap2.2 mutant is more

tolerant to water deficit. Nevertheless, under the same stress

conditions, all rap2.2/OsEREBP1 lines also showed enhanced root

growth as compared to wt (16-32%). Therefore, we conclude that

OsEREBP1 over-expression does not rescue the mutant phenotype

under the applied stress treatments.

DISCUSSION

Proteins must be targeted to, or retained in, the correct subcellular

compartment to ensure their biological function. Transcription factors

are characterized by the presence of a nuclear localization signal

(NLS) that allows their transport into the nucleus after being

synthesized (Krause and Krupinska 2009; Liu et al. 1999).

OsEREBP1 contains a NLS (Chapter 2) and our cellular localization

studies revealed that this TF is indeed located in the nucleus.

The transcription of genes with an important role in plant salt

stress response is not always induced by high salinity treatments

(Xiong and Zhua 2002). Studies in rice have shown that the

OsEREBP1 transcript level does not change under high salinity

treatment, suggesting a regulation at post-translational level under

this abiotic stress condition (Chapter 2). In fact, OsEREBP1 protein

level increased under salt stress. Two protein forms were detected,

with 78 and 85 kDa, but only the one with 78 kDa was considered to

correspond to the GFP-OsEREBP1 fusion protein (with an estimated

Chapter IV

137

molecular mass of 72 kDa). The discrepancy from the expected

molecular weight may be due to some protein anomalous migration.

The fusion protein was predicted to have an acidic isoelectric point

(pI 5.1) and a high negative net charge (-17.5) at pH 7.0. The

anomalous migration of proteins with high acidic residue content in

SDS-PAGE gels has been previously described (Alves et al. 2004;

Stumpo et al. 1989). The slow migration in the gel may be related to

a low binding of SDS to the protein due to the acidic residues,

causing insufficient protein denaturation (Alves et al. 2004; Graceffa

et al. 1992). The 85 kDa band may represent a post-translationally

modified variant of OsEREBP1. Previous reports revealed that the

TF is phosphorylated by OsBWMK1 (Cheong et al. 2003). Moreover,

an aa sequence analysis using the NetPhos program predicted the

existence of 20 serine and threonine putative phosphorylation sites.

Therefore, the upper band detected may correspond to a highly

phosphorylated form of OsEREBP1. Although the difference in

molecular weight between the unmodified and modified protein is

relatively high (13 kDa), such difference has been reported for the

highly phosphorylated protein PsRBR1 from pea (Mori et al. 2008).

PsRBR1 was identified in axillary buds and the aa sequence analysis

predicted the existence of 16 phosphorylation sites. The protein was

found in the non-phosphorylated form (114 kDa), and in the lower-

and higher-molecular mass phosphorylated forms with 140 and 150

kDa, respectively (Mori et al. 2008). The detected upper band may

also correspond to a SUMOylated form of OsEREBP1. The

prediction programs SUMOplot and SUMOsp2.0 identified a putative

SUMOylation site (K193 position) with high score. In addition, the

difference in molecular weight between the upper and lower band (13

kDa) corresponds approximately to the molecular weight of the

Arabidopsis SUMO protein (14 kDa) (Kurepa et al. 2003). Several


138

components of the SUMOylation system have been identified in rice

and Arabidopsis, suggesting that the conjugation mechanism is

present in both plant species (Karlson and Chaikam 2010; Kurepa et

al. 2003). A proteome-wide screen in Arabidopsis allowed the

identification of several putative SUMO substrates (Elrouby and

Coupland 2010). Studies in rice and Arabidopsis also revealed that

under abiotic stress conditions there is an accumulation of SUMO

conjugates, pointing for a role of SUMOylation in plant stress

responses (Kurepa et al. 2003; Park et al. 2010).

OsEREBP1 protein accumulation under salt stress was shown to

be related to increased protein synthesis and protein stability. A

slight increase in protein level was observed at 15 min stress

treatment, suggesting that the effect of salt on the TF protein

synthesis is stronger and faster than the repression of de novo

synthesis induced by cycloheximide. Protein stability can be

promoted by post-translational modifications (PTMs), such as

phosphorylation and SUMOylation. The increase in TF stability

through these PTMs was reported in Arabidopsis (Mazzucotelli et al.

2008; Miura and Hasegawa 2010; Rodriguez et al. 2010). The

phosphorylation of bHLH TF SPEECHLESS (SPCH) by MPK6

increased its protein activity and stability (Rodriguez et al. 2010).

Similarly, the conjugation of SUMO to ABI5 promotes its stability and

protects the TF from proteasome-dependent degradation (Miura and

Hasegawa 2010). The exact mechanism responsible for the

increased OsEREBP1 protein stability under salt stress is still

unknown. Nevertheless, the obtained results suggest that two

OsEREBP1 protein forms are present in Arabidopsis cells and one of

the forms corresponds to a post-translational modified protein form.

We have shown that OsEREBP1 protein stability is putatively

regulated by PTMs in high salinity conditions. In addition, other

Chapter IV

139

researchers have previously reported that this TF is phosphorylated

by the protein forms encoded by OsBWMK1L, OsBWMK1M and

OsBWMK1S (Koo et al. 2007). A gene expression analysis indicated

that only OsBWMK1M and OsBWMK1S transcripts are regulated by

stress conditions (Agrawal et al. 2003b). According to these authors,

a strong up-regulation of OsBWMK1S transcript level was detected

under high salt treatment. However, our studies revealed that the

kinase activity of this protein form was not significantly affected by

high salinity, suggesting that OsEREBP1 post-translational regulation

by high salt does not involve this protein form. Further studies need

to be performed to investigate if the other OsBWMK1 protein forms

are involved in the TF regulation under these stress conditions.

OsBWMK1 belongs to the group D of MAPKs characterized by the

presence of an extended C-terminal region, a TDY motif in the

activation loop and the lack of a common docking (CD) domain

(Ichimura et al. 2002; Xue and Liu 2007). The Arabidopsis group D

MAPKs AtMAPK8, AtMAPK16 and AtMAPK18 were analyzed

regarding their kinase activity under salt stress and only AtMAPK16

displayed enhanced activity. A few reports describe the putative

involvement of MAPKs from group D in plant abiotic stress

responses (Agrawal et al. 2003a; Agrawal et al. 2003b; Jammes et

al. 2009; Shi et al. 2011). AtMAPK9 and AtMAPK12 were shown to

function as positive regulators of ABA signaling in guard cells

(Jammes et al. 2009). The cotton GhMPK16 gene expression was

shown to be induced by salt, mannitol and ABA, and its over-

expression reduced drought tolerance in transgenic Arabidopsis (Shi

et al. 2011).

The functional analysis of OsEREBP1-OX plants revealed a role

in high salinity, drought and ABA responses. OsEREBP1-OX over-

expressing plants displayed hypersensitivity to high salinity


140

treatments at germination level, whereas no significant differences in

plant survival and root growth were detected at the seedling stage.

This result may be related to the proposed regulation of this TF at

post-translational level under salt stress. Previous reports suggest

that over-expression of TFs regulated at post-translational level may

display a wt phenotype under abiotic stress conditions. DREB2A and

OsDREB2A from Arabidopsis and rice, respectively, were reported to

be stress-responsive genes, but their over-expression in Arabidopsis

only induced little phenotypic alterations (Dubouzet et al. 2003;

Sakuma et al. 2006). DREB2A was shown to be unstable under

normal growth conditions and to stably accumulate when a negative

regulatory domain is deleted from its gene sequence (Sakuma et al.

2006). Over-expression of the DREB2A constitutive active form

resulted in enhanced tolerance to drought stress (Sakuma et al.

2006). In addition, the protein instability under normal growth

conditions was shown to be related to its ubiquitination by DRIP1 and

DRIP2 RING E3 ligases (Qin et al. 2008). OsEREBP1 in silico

analysis predicted that the TF protein sequence contains 8 putative

ubiquitination sites (BDM-PUB program). Thus, OsEREBP1 may be

degraded under normal growth conditions through ubiquitination and

the lack of phenotypic alterations under high salinity treatments may

be due to low OsEREBP1 protein levels in the transgenic seedlings.

Conversely, the effect of salt stress on OsEREBP1-OX seed

germination may partially result from the slight increase in ABA

sensitivity. Abiotic stress conditions, such as high salinity, induce

ABA production, which increases sensitivity to salt during

germination (Xiong and Zhua 2002). OsEREBP1 gene expression

was reported not to be altered by ABA treatments (Chapter 2); but

this TF may be regulated by the hormone through PTMs. The

involvement in hormone responses of genes that are not regulated

Chapter IV

141

by ABA at transcriptional level, has been previously described (Fujita

et al. 2011). AtERF7 gene expression proved to be unaffected by

ABA, but knockdown lines displayed increased sensitivity to the

hormone during germination (Song et al. 2005). The AtERF7-

mediated regulation of ABA response was reported to involve the TF

phosphorylation by PKS3, a protein kinase described as a negative

regulator of ABA responses (Song et al. 2005).

OsEREBP1 putative involvement in ABA responses was further

analyzed through root growth analyses of ABA-treated OsEREBP1-

OX seedlings. Low ABA concentration (1 µM) was shown to affect

root growth of one transgenic line (L3), whereas a higher ABA

concentration (10 µM) affected root growth of all OsEREBP1-OX

seedlings. These results suggest that the transgenic plants are more

sensitive to the ABA inhibitory effect, which is in agreement with the

observed ABA hypersensitivity of the transgenic seeds. These

results suggest that OsEREBP1 have a role in ABA responses.

Gene expression studies revealed that OsEREBP1 is regulated

by drought stress conditions (Chapter 2). To confirm the function of

this gene in the response to water deficit, OsEREBP1-OX seedlings

were treated with PEG. Such treatments are reported to mimic the

conditions imposed by soil drying, which cause water removal from

the cell wall and the protoplast (Verslues et al. 2006). The transgenic

plants L2 and L3 displayed enhanced root growth as compared to wt,

suggesting a role of OsEREBP1 in plant tolerance to drought stress

conditions. However, plant survival was not affected by the PEG

treatment, which may indicate a developmental stage-dependent

function of OsEREBP1 in drought stress responses. Several

adaptation processes to low water availability, such as stomatal

regulation, root growth and compatible solutes accumulation are

regulated by ABA (Verslues et al. 2006). Given that OsEREBP1 may


142

play a role in ABA responses, the OsEREBP1 function in drought

stress may be ABA-dependent.

OsEREBP1 and RAP2.2 belong to the CMVII group of ERF

proteins and share high aa sequence identity (87%) within the AP2-

DNA binding domain, but little identity (38%) when considering the

full length aa sequence. The minor homology between AP2/ERF

proteins outside the conserved DNA binding domain has been

previously reported (Gutterson and Reuber 2004). RAP2.2 was

characterized as a putative ortholog of rice SUB1A, an ERF protein

known to play an important function in submergence and drought

stress tolerance (Fukao et al. 2011; Hinz et al. 2010). Despite the low

homology (38%) between SUB1A and RAP2.2, the Arabidopsis

protein was shown to also function in response to hypoxia (Hinz et al.

2010). To investigate whether RAP2.2 and OsEREBP1 have similar

functions in abiotic stress response, rap2.2 mutant lines over-

expressing OsEREBP1 were generated. Root growth assays

revealed that rap2.2 seedlings are less affected by drought stress

compared to wt, suggesting that RAP2.2 negatively regulates the

response to this abiotic stress condition. However, no phenotypic

complementation was observed when seedlings were subjected to

water deficit induced by PEG, indicating that OsEREBP1 role in

drought stress responses differs from that of RAP2.2. This was an

expected result, as, in contrast to RAP2.2, OsEREBP1 was shown

(this study) to act as a positive regulator of drought stress. No root

phenotype complementation was detected under high salinity

treatments, suggesting that RAP2.2. and OsEREBP1 have different

functions in response to salt stress.

This study demonstrated that OsEREBP1 is involved in abiotic

stress responses, namely salt and drought stress, and that its

Chapter IV

143

function is associated with ABA signaling. Given that OsEREBP1 is

known to bind to the promoter of OsRMC, a salt-induced gene, it

would be important to investigate how OsRMC is regulated by salt

stress in the absence of OsEREBP1. In addition, it would be

interesting to identify other genes regulated by OsEREBP1

ACKNOWLEDGMENTS

Tânia Serra carried out the experimental work with the

collaboration of André Cordeiro, who contributed to the studies with

the Arabidopsis transgenic plants. The planning of the research work

and discussion of results was performed by Tânia Serra, Laszlo

Bögre, Nelson Saibo and M. Margarida Oliveira. We would like to

acknowledge Laszlo Bögre lab for providing the Arabidopsis cell

culture and the MAPKs constructs.

REFERENCES



201-212

Agrawal GK, Agrawal SK, Shibato J, Iwahashi H, Rakwal R (2003a) Novel

rice MAP kinases OsMSRMK3 and OsWJUMK1 involved in

encountering diverse environmental stresses and developmental

regulation. Biochem Biophys Res Commun 300: 775-783

Agrawal GK, Tamogami S, Iwahashi H, Agrawal VP, Rakwal R (2003b)

Transient regulation of jasmonic acid-inducible rice MAP kinase gene

(OsBWMK1) by diverse biotic and abiotic stresses. Plant Physiol

Biochem 41 355-361

Alves VS, Pimenta DC, Sattlegger E, Castilho BA (2004) Biophysical

characterization of Gir2, a highly acidic protein of Saccharomyces

cerevisiae with anomalous electrophoretic behavior. Biochem Biophys

Res Commun 314: 229-234


144

Bhatnagar-Mathur P, Vadez V, Sharma KK (2008) Transgenic approaches

for abiotic stress tolerance in plants: retrospect and prospects. Plant Cell

Rep 27: 411-424

Bogre L, Calderini O, Binarova P, Mattauch M, Till S, Kiegerl S, Jonak C,

Pollaschek C, Barker P, Huskisson NS, Hirt H, Heberle-Bors E (1999) A

MAP kinase is activated late in plant mitosis and becomes localized to

the plane of cell division. Plant Cell 11: 101-113

Century K, Reuber TL, Ratcliffe OJ (2008) Regulating the regulators: the

future prospects for transcription-factor-based agricultural biotechnology

products. Plant Physiol 147: 20-29










Clough SJ, Bent AF (1998) Floral dip: a simplified method for

Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J

16: 735-743









Elrouby N, Coupland G (2010) Proteome-wide screens for small ubiquitin-

like modifier (SUMO) substrates identify Arabidopsis proteins implicated

Chapter IV

145

in diverse biological processes. Proc Natl Acad Sci USA 107: 17415-

17420

Fujita Y, Fujita M, Shinozaki K, Yamaguchi-Shinozaki K (2011) ABA-

mediated transcriptional regulation in response to osmotic stress in

plants. J Plant Res 124: 509-525

Fukao T, Yeung E, Bailey-Serres J (2011) The submergence tolerance

regulator SUB1A mediates crosstalk between submergence and drought

tolerance in rice. Plant Cell 23: 412-427

Graceffa P, Jancso A, Mabuchi K (1992) Modification of acidic residues

normalizes sodium dodecyl sulfate-polyacrylamide gel electrophoresis of

caldesmon and other proteins that migrate anomalously. Arch Biochem

Biophys 297: 46-51



Hinz M, Wilson IW, Yang J, Buerstenbinder K, Llewellyn D, Dennis ES,

Sauter M, Dolferus R (2010) Arabidopsis RAP2.2: an ethylene response

transcription factor that is important for hypoxia survival. Plant Physiol

153: 757-772

Ichimura K, Shinozaki K, Tena G, Sheen J, Henry Y, Champion A, Kreis M,

Zhang SQ, Hirt H, Wilson C, Heberle-Bors E, Ellis BE, Morris PC, Innes

RW, Jr E, Scheel D, Klessig DF, Machida Y, Mundy J, Ohashi Y, Walker

JC, Grp M (2002) Mitogen-activated protein kinase cascades in plants: a

new nomenclature. Trends Plant Sci 7: 301-308

Jammes F, Song C, Shin D, Munemasa S, Takeda K, Gu D, Cho D, Lee S,

Giordo R, Sritubtim S, Leonhardt N, Ellis BE, Murata Y, Kwak JM (2009)

MAP kinases MPK9 and MPK12 are preferentially expressed in guard

cells and positively regulate ROS-mediated ABA signaling. Proc Natl

Acad Sci USA 106: 20520-20525

Jung KH, Seo YS, Walia H, Cao P, Fukao T, Canlas PE, Amonpant F,

Bailey-Serres J, Ronald PC (2010) The submergence tolerance

regulator Sub1A mediates stress-responsive expression of AP2/ERF

transcription factors. Plant Physiol 152: 1674-1692


146

Karlson DT, Chaikam V (2010) Response and transcriptional regulation of

rice SUMOylation system during development and stress conditions.

Bmb Rep 43: 103-109

Knight H, Knight MR (2001) Abiotic stress signalling pathways: specificity

and cross-talk. Trends Plant Sci 6: 262-267

Koo SC, Yoon HW, Kim CY, Moon BC, Cheong YH, Han HJ, Lee SM, Kang

KY, Kim MC, Lee SY, Chung WS, Cho MJ (2007) Alternative splicing of

the OsBWMK1 gene generates three transcript variants showing

differential subcellular localizations. Biochem Bioph Res Co 360: 188-

193

Krause K, Krupinska K (2009) Nuclear regulators with a second home in

organelles. Trends Plant Sci 14: 194-199

Kurepa J, Walker JM, Smalle J, Gosink MM, Davis SJ, Durham TL, Sung

DY, Vierstra RD (2003) The small ubiquitin-like modifier (SUMO) protein

modification system in Arabidopsis. Accumulation of SUMO1 and -2

conjugates is increased by stress. J Biol Chem 278: 6862-6872

Liu LS, White MJ, MacRae TH (1999) Transcription factors and their genes

in higher plants - Functional domains, evolution and regulation. Eur J

Biochem 262: 247-257

Magnani E, Sjolander K, Hake S (2004) From endonucleases to

transcription factors: evolution of the AP2 DNA binding domain in plants.

Plant Cell 16: 2265-2277

Magyar Z, De Veylder L, Atanassova A, Bako L, Inze D, Bogre L (2005) The

role of the Arabidopsis E2FB transcription factor in regulating auxin-

dependent cell division. Plant Cell 17: 2527-2541



Mazzucotelli E, Mastrangelo AM, Crosatti C, Guerra D, Stanca AM,

Cattivelli L (2008) Abiotic stress response in plants: when post-

transcriptional and post-translational regulations control transcription.

Plant Sci 174: 420-431

Miura K, Hasegawa PM (2010) Sumoylation and other ubiquitin-like post-

translational modifications in plants. Trends Cell Biol 20: 223-232

Chapter IV

147

Mori H, Shimizu-Sato S, Ike Y (2008) PsRBR1 encodes a pea

retinoblastoma-related protein that is phosphorylated in axillary buds

during dormancy-to-growth transition. Plant Mol Biol 66: 125-135



Nakashima K, Ito Y, Yamaguchi-Shinozaki K (2009) Transcriptional

regulatory networks in response to abiotic stresses in Arabidopsis and

grasses. Plant Physiol 149: 88-95

Newton AC, Johnson SN, Gregory PJ (2011) Implications of climate change

for diseases, crop yields and food security. Euphytica 179: 3-18

Pardo JM (2010) Biotechnology of water and salinity stress tolerance. Curr

Opin Biotech 21: 185-196

Park HC, Kim H, Koo SC, Park HJ, Cheong MS, Hong H, Baek D, Chung

WS, Kim DH, Bressan RA, Lee SY, Bohnert HJ, Yun DJ (2010)

Functional characterization of the SIZ/PIAS-type SUMO E3 ligases,

OsSIZ1 and OsSIZ2 in rice. Plant Cell Environ 33: 1923-1934

Qin F, Sakuma Y, Tran LS, Maruyama K, Kidokoro S, Fujita Y, Fujita M,

Umezawa T, Sawano Y, Miyazono K, Tanokura M, Shinozaki K,

Yamaguchi-Shinozaki K (2008) Arabidopsis DREB2A-interacting

proteins function as RING E3 ligases and negatively regulate plant

drought stress-responsive gene expression. Plant Cell 20: 1693-1707

Rodriguez MC, Petersen M, Mundy J (2010) Mitogen-activated protein

kinase signaling in plants. Annu Rev Plant Biol 61: 621-649




Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki K,

Yamaguchi-Shinozaki K (2006) Functional analysis of an Arabidopsis

transcription factor, DREB2A, involved in drought-responsive gene


Santos AP, Serra T, Figueiredo DD, Barros P, Lourenco T, Chander S,

Oliveira MM, Saibo NJ (2011) Transcription regulation of abiotic stress


148


epigenetic mechanisms. OMICS 15: 839-857





e1002020

Shi J, Zhang L, An H, Wu C, Guo X (2011) GhMPK16, a novel stress-

responsive group D MAPK gene from cotton, is involved in disease

resistance and drought sensitivity. BMC Mol Biol 12: 22

Song CP, Agarwal M, Ohta M, Guo Y, Halfter U, Wang P, Zhu JK (2005)

Role of an Arabidopsis AP2/EREBP-type transcriptional repressor in

abscisic acid and drought stress responses. Plant Cell 17: 2384-2396

Stumpo DJ, Graff JM, Albert KA, Greengard P, Blackshear PJ (1989)

Molecular cloning, characterization, and expression of a cDNA encoding

the "80- to 87-kDa" myristoylated alanine-rich C kinase substrate: a

major cellular substrate for protein kinase C. Proc Natl Acad Sci USA 86:

4012-4016

Teige M, Scheikl E, Eulgem T, Doczi R, Ichimura K, Shinozaki K, Dangl JL,

Hirt H (2004) The MKK2 pathway mediates cold and salt stress signaling

in Arabidopsis. Mol Cell 15: 141-152

Verslues PE, Agarwal M, Katiyar-Agarwal S, Zhu J, Zhu JK (2006) Methods

and concepts in quantifying resistance to drought, salt and freezing,

abiotic stresses that affect plant water status. Plant J 45: 523-539

Vij S, Tyagi AK (2007) Emerging trends in the functional genomics of the

abiotic stress response in crop plants. Plant Biotechnol J 5: 361-380

Xiong L, Zhua J-K (2002) Salt tolerance. The Arabidopsis Book The

American Society of Plant Biologists

Xue QZ, Liu QP (2007) Computational identification and phylogenetic

analysis of the MAPK gene family in Oryza sativa. Plant Physiol

Biochem 45: 6-14

Chapter IV

149

Yamaguchi-Shinozaki K, Shinozaki K (2006) Transcriptional regulatory

networks in cellular responses and tolerance to dehydration and cold

stresses. Annu Rev Plant Biol 57: 781-803

Yi SY, Kim JH, Joung YH, Lee S, Kim WT, Yu SH, Choi D (2004) The

pepper transcription factor CaPF1 confers pathogen and freezing

tolerance in Arabidopsis. Plant Physiol 136: 2862-2874

Zhang L, Tian LH, Zhao JF, Song Y, Zhang CJ, Guo Y (2009) Identification



149: 916-928


150

Chapter V

151

OsEREBP2 is a multifunctional AP2/ERF transcription

factor mediating abiotic stress and hormone signaling

pathways

Chapter V

OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways

152

TABLE OF CONTENTS – CHAPTER V

Abstract ....................................................................................... 153

Introduction ................................................................................. 154

Material and Methods ................................................................. 157

Plant material and growth conditions ........................................... 157

Construction of plasmids ............................................................. 158

OsEREBP2 subcellular localization ............................................. 159

Arabidopsis transformation and abr1 complementation assays ... 160

Gene expression analysis by semi-quantitative reverse transcription-PCR (RT-PCR) ....................................................... 162

Results ......................................................................................... 162

OsEREBP2 is dispersed throughout the cell ............................... 162

Arabidopsis plants over-expressing OsEREBP2 show a hormone-related phenotype ........................................................ 165

OsEREBP2 over-expression modulates the expression of genes involved in plant development and hormone signaling ...... 166

OsEREBP2 gene promoter region contains cis-elements involved in ABA-, auxin- and cytokinin- responsiveness .............. 168

OsEREBP2 and ABR1 have similar functions ............................. 170

Discussion ................................................................................... 172


References .................................................................................. 181

Chapter V

153

ABSTRACT

Plant growth and development are highly affected by different

abiotic stresses, leading to high losses in crop productivity. The

integration of stress responses with developmental programs

involves several transcription factors (TFs) that can function as

integrators of internal and external stimuli. OsEREBP2 encodes a

multifunctional TF that belongs to the AP2/ERF family and it was

previously described as a putative regulator of high salinity, drought,

cold and ABA responses in rice. Using a transient expression assay,

we have shown that, under high salinity, GFP::OsEREBP2, in

addition to the nucleus, also accumulates in spot-like structures

dispersed within the cell. In addition, Arabidopsis plants over-

expressing OsEREBP2 revealed that this regulatory protein may

have a role in hormone mediated plant developmental processes.

The transgenic plants showed abnormal phenotype responses to

auxin and/or cytokinin and deregulation of genes involved in the

primary responses to these hormones. Moreover, in these transgenic

plants, genes involved in the maintenance and function of the shoot

apical meristem (SAM) were also up-regulated, suggesting a role for

OsEREBP2 in the SAM developmental processes. The identification

of several cis-elements responsive to cytokinins, auxins and ABA at

the promoter of OsEREBP2 further indicated that the expression of

this gene may be regulated by these hormones. Complementation

studies revealed that OsEREBP2 heterologous expression can

rescue the abr1 germination phenotype both under high salinity and

ABA treatments, suggesting a function similar to that of ABR1.


154

INTRODUCTION

Plants are continuously exposed to changes in the environment

which can negatively affect their growth and development, resulting

in significant reductions in crop yield worldwide (Ahuja et al. 2010).

To cope with adverse environmental conditions, plants adjust their

growth and development according to external stimuli (Peleg and

Blumwald 2011). High salinity and drought stress conditions are well

known to cause growth retardation, affecting particularly leaf growth

and shoot development (Munns and Tester 2008). Moreover, low

temperatures severely affect reproductive development, causing

pollen and ovule infertility and decreasing the rate of seed filling,

ultimately leading to lower grain yield (Nayyar et al. 2010).

Plant hormones are involved in the integration of environmental

signals in the endogenous developmental programs (Jaillais and

Chory 2010; Santner and Estelle 2009). Among others, abscisic acid

(ABA), cytokinins and auxins are hormones with a direct or indirect

role in abiotic stress responses (Peleg and Blumwald 2011). ABA

plays important roles in several developmental processes and

adaptive stress responses (Raghavendra et al. 2010). This hormone

is involved in the regulation of seed development and stomatal

aperture (Hubbard et al. 2010; Raghavendra et al. 2010; Xue-Xuan

et al. 2010). ABA is synthesized in response to several stress

conditions and is able to coordinate the expression of several stress-

responsive genes (Hubbard et al. 2010; Xue-Xuan et al. 2010).

Drought and high salinity result in high ABA levels, which will

promote stomatal closure and accumulation of osmoprotectants,

enabling plants to adapt to water deficit conditions (Hubbard et al.

2010; Raghavendra et al. 2010). Cold stress also induces ABA

accumulation but to a lower level (Xue-Xuan et al. 2010). The ABA

Chapter V

155

role in cold stress responses is not fully understood, however, it has

been suggested to be related with freezing tolerance, which involves

the induction of drought stress-responsive genes (Mahajan and

Tuteja 2005; Xue-Xuan et al. 2010). Auxins and cytokinins are

master regulators of plant development and mutually regulate their

signaling pathways and metabolism (Moubayidin et al. 2009). These

hormones can regulate the biosynthesis of each other in order to

maintain optimal hormone levels for developmental and

environmental responses (Jones et al. 2010). Auxins are involved in

root and shoot architecture, flower organ development and in abiotic

stress responses (Chapman and Estelle 2009; Zhang et al. 2009b).

Environmental signals were shown to differentially regulate auxin

biosynthesis depending on the plant species (Acharya and Assmann

2009; Zhao 2010). In rice, auxin concentration decreases under

drought stress, promoting the expression of LEA (Late

Embryogenesis Abundant) genes involved in drought tolerance

acquisition (Zhang et al. 2009b). Cytokinins are regulators of leaf

senescence, apical dominance, shoot differentiation and root

proliferation (Hirose et al. 2007; Hirose et al. 2008; Kudo et al. 2010).

This hormone has also been described as a negative regulator of

abiotic stress responses, probably through the repression of stress-

responsive genes (Nishiyama et al. 2011). Cytokinin production was

shown to decrease in response to water deficit conditions and this

decrease enhances ABA sensitivity, thus leading to enhanced

tolerance to stress conditions (Nishiyama et al. 2011; Rivero et al.

2009).

The coordination of hormone and abiotic stress signaling

pathways allows a balance between plant development and the

response to stress stimuli (Peleg and Blumwald 2011). The

integration of internal and external stimuli responses was suggested


156

to occur at transcriptome level, rather than by cross-talk during signal

transduction, and the transcription factors (TFs) may be the key

integrators of these responses (Jaillais and Chory 2010). PIF4

encodes a bHLH (basic Helix-Loop-Helix) TF protein involved in plant

responses to light and high temperature (Duek and Fankhauser

2005; Koini et al. 2009). Studies with the pif4 mutant revealed that

this TF may be a regulator of the auxin-mediated signaling pathway

controlling the developmental adaptations that occur under high

temperature conditions (Koini et al. 2009). The AP2/ERF family of

TFs comprises proteins involved in biotic and abiotic stress

responses, but also in hormone regulation (Dietz et al. 2010). The

presence of the highly conserved AP2 DNA-binding domain

characterizes these regulatory proteins. A member of this family,

CAP2, was identified in chickpea and shown to be induced by

drought, high salinity, ABA and auxin treatments (Shukla et al. 2006).

In addition, tobacco plants over-expressing CAP2 displayed

improved tolerance to drought and salt stress conditions, as well as

higher levels of auxin-responsive genes, in comparison with wt

plants. Therefore, this regulatory protein was proposed to be

involved in both abiotic stress and auxin signaling pathways.

OsEREBP2 is an AP2/ERF protein with a single AP2 DNA-binding

domain and predicted to belong to the Xa group of ERF proteins due

to the presence of a CMX-1-like motif (Chapter 2) (Nakano et al.

2006). OsEREBP2 gene expression was shown to be highly induced

by cold (5ºC and 10ºC), drought, high salinity, and ABA treatment,

indicating that this TF modulates rice responses to different abiotic

stress conditions (Chapter 2). In addition, OsEREBP2 was shown to

bind to the promoter and regulate the expression of OsRMC (rice

Root Meander Curling) (Chapters 2 and 3). OsRMC encodes a

receptor-like kinase that functions as a negative regulator of salt

Chapter V

157

stress responses (Zhang et al. 2009a). OsRMC knockdown lines

displayed enhanced tolerance to high salinity conditions and higher

levels of transcripts from stress-responsive genes. OsEREBP2 was

also proposed to be involved in biotic stress responses due to the

observed transcript up-regulation in rice plants treated with a

functional analog of salicylic acid, benzothiadiazole (Shimono et al.

2007). Given that salicylic acid (SA) mediates plant response against

pathogens, OsEREBP2 may be involved in rice response to

pathogen infection.

The Arabidopsis ABR1 is an OsEREBP2 orthologue. It is also

member of the Xa group of ERF proteins and it was shown to be

involved in biotic and abiotic stress responses, as well as in hormone

signaling pathways. ABR1 transcript levels accumulated under cold,

high salinity, drought and ABA treatments (Pandey et al. 2005). In

addition, knock-out mutants displayed hypersensitivity to osmotic

stress induced by high salinity and mannitol, and increased

expression of ABA-regulated genes (Pandey et al. 2005). The mutant

also showed enhanced susceptibility to pathogen infection (Hwang

and Choi 2011).

OsEREBP2 has been described as a multifunctional protein with a

putative role in biotic and abiotic stress responses. This study

revealed that OsEREBP2 may play a role in hormonal signaling and

plant development. In addition, it showed that OsEREBP2 may have

a similar function to the ABR1 gene from Arabidopsis.


Plant material and growth conditions

Arabidopsis thaliana ecotype Columbia (Col-0) and the abr1

mutant (SALK_012151) were used in this study. Seedlings were


158

germinated and grown in the greenhouse under long-day conditions

(16 h/8 h, light/dark) until reaching the flowering stage for plant

transformation. Seeds were surface-sterilized in a solution of 1.5%

sodium hypochloride containing 0.1% Tween-20 as described in

Chapter 4 and stratified at 4ºC for 3 d. After sown in Murashige and

Skoog (MS) medium containing 1% sucrose and 2.6 mM MES buffer,

the seeds were transferred to a growth chamber at 22ºC and 40

µmol m-2 s-1 of light. Transgenic plants over-expressing OsEREBP2

were not transferred to soil due to the abnormal phenotype observed

and were then maintained in the described growth medium.

Construction of plasmids

OsEREBP2 coding sequence was isolated from rice cDNA

prepared as described in Chapter 2. Total RNA was extracted from

14 days-old seedlings with the RNeasy Plant Mini kit (Qiagen,

Courtaboeuf, France) and cDNA was synthesized following the

instructions of the Transcriptor High Fidelity cDNA Synthesis kit

(Roche, Basel, Switzerland). OsEREBP2 sequence was amplified

with the PhusionTM high-fidelity DNA polymerase (Finnzymes,

Vantaa, Finland) in the presence of 1 M Betaine and 2.5% DMSO,

using the GW-OsEREBP2-Fw/-Rv primers (Table 1). The amplified

fragment was cloned into the entry vector pDONR221 with the BP

recombinase and subsequently transferred to the destination vectors

through the LR recombinase, according to the manufacturer’s

instructions (Invitrogen, CA, USA). The destination vectors

pH7WGF2 and pEarleyGate201 were used to obtain the

GFP::OsEREBP2 and the 35S::HA::OsEREBP2 constructs,

respectively. To generate the construct for phenotypic

complementation, the CaMV35S promoter was removed from the

35S::HA::OsEREBP2 construct through restriction with EcoRI-XhoI

Chapter V

159

and replaced by the ABR1 promoter (2453 bp upstream the start

codon). The ABR1 promoter fragment was isolated from Col-0

genomic DNA extracted with the QuickExtractTM Plant DNA

Extraction Solution (Epicentre, Madison, USA) following the

manufacturer’s instructions. Amplification was performed with the

PhusionTM high-fidelity DNA polymerase and the specific primers

ProABR-Fw/-Rv (Table 1). The ProABR::OsEREBP2 construct was

sequenced with ProABR-Fw/-Rv and the internal primers

ProABRmid-Fw/-Rv (Table 1).

OsEREBP2 subcellular localization

Onion epidermis cell layers were bombarded with 1 µm gold

microparticles coated with 1.6 or 1.2 µg of 35S::GFP (pH7WGF2

vector) or GFP::OsEREBP2 constructs, respectively. DNA-coating

was performed with spermidine (0.1 M) and CaCl2 (2.5 M) and the

prepared particles were bombarded using a particle gun-mediated

system (PSD-1000/HE, Bio-Rad, CA, USA). Bombarded tissues

were then incubated overnight under dark conditions on filter paper

soaked in sterile water. The epidermal cell layers were incubated

with or without 500 mM NaCl solution and stained with DAPI (17 µM)

(Sigma-Aldrich, Gillingham Dorset, UK). Images were taken with a

Nikon TE300 microscope under different light fields. OsEREBP2

subcellular localization was also analyzed in Arabidopsis protoplasts.

Protoplast isolation from Arabidopsis suspension cells (Col-0

ecotype) was performed as described in Chapter 3. The protoplasts

were transfected with 5 µg 35S::GFP or 8 µg GFP::OsEREBP2 by

the polyethylene glycol-mediated process previously described

(Chapter 3) and incubated overnight in the dark at 22ºC. Protoplast

samples were also treated with 500 mM NaCl. Confocal optical

section stacks were collected with a Leica TCS SP inverted laser


160

scanning confocal microscope (Leica Heidelberg GmbH, Mannheim,

Germany) equipped with a krypton and an argon laser. The

microscopy data was recorded and then transferred to the Image J

software and composite using Adobe Photoshop.

Arabidopsis transformation and abr1 complementation assays

Agrobacterium-mediated transformation of Arabidopsis plants

(ecotype Col-0) was carried out by the floral dip method (Clough and

Bent 1998). Col-0 plants were transformed using an Agrobacterium

(strain LBA4404) culture containing the 35S::HA::OsEREBP2

construct. The seeds were sown on MS medium containing 1%

sucrose, 2.6 mM MES buffer, 0.1 mM BASTA and 0.2 mM

cefotaxime and the transformed seedlings (survivors) were

transferred to MS medium supplemented with 1% sucrose and 2.6

mM MES buffer. Transgene expression was analyzed by semi-

quantitative RT-PCR. The Arabidopsis knockout mutant abr1

(SALK_012151) was obtained from the Nottingham Arabidopsis

Stock Centre (NASC, Loughborough, UK). Homozygous mutant

plants were isolated and the suppression of ABR1 expression was

confirmed by RT-PCR with the ABR1-Fw/-Rv primers (Table 1). To

obtain abr1/OsEREBP2 transgenic plants, homozygous mutant

plants were transformed with an Agrobacterium culture carrying the

35S::HA::OsEREBP2 or the ProABR::HA::OsEREBP2 constructs by

the floral dip method. ABR::OsEREBP2 homozygous plants (T2)

were obtained as described in Chapter 4. T0 seeds were screened in

selective medium and ten T1 resistant seedlings were transferred to

soil to produce seeds. The transgene expression was analyzed with

the GW-OsEREBP2-Fw/-Rv primers. Phenotypic complementation of

the abr1 mutant was analyzed through seed germination studies

performed as described in Chapter 4. Approximately 40 seeds from

Chapter V

161

wt, abr1 mutants and ABR::OsEREBP2 plants were plated in

triplicate on MS medium with or without 150 mM NaCl or 0.7 µM

ABA. Germination (emergence of radicles) was scored daily for 6

days.

Table 1. Oligonucleotide sequences used for the cloning procedures and

gene expression studies. The underlined region corresponds to the

Gateway recombination sequences and the remaining region is specific to

the target DNA.


GW-OsEREBP2-Fw GGGGACAAGTTTGTACAAAAAAGCAGGCTATATGACGGTGGCGGGGGCGTCGGAGCT

GW-OsEREBP2-Rv GGGGACCACTTTGTACAAGAAAGCTGGGTGGACAGAATCCGGCGGCTACTGCGTGTGC

PEPINO/PAS2-Fw TGCTCAGACTGCCGCCGTTC

PEPINO/PAS2-Rv CGCTGGTGATACCGGTAGGGT

KNAT2-Fw GGCTAGGGATCGAAGAAGCGGC

KNAT2-Rv TGGCTGTCATCCGCTGCTATGT

ARR5-Fw CTACTCTTCTTGATATGGCTGAG

ARR5-Rv TATCGTACGTGGAATCTGATAAAC

IAA4-Fw ATGGAAAAAGTTGATGTTTATGATGAGCT

IAA4-Rv AAGACCACCACAACCTAAACCTTTAACTTC

ABR1-Fw GCGGTGAAGGTAGCGGAGAA

ABR1-Rv TGTCGAACGTACCGAGCCAA

ProABR1-Fw ATGAATTCGTGGCCACAGTTTCCAGAAT

ProABR1-Rv ATCTCGAGCAAAACCCTCCTTCTAAATCCTC

ProABR1mid -Fw AATCTGCGACTTTTTAACAATACGA

ProABR1mid -Rv TTCGCCCGAATCGAGTCTAATA

Actin-Fw GGCGATGAAGCTCAATCCAAACG

Actin-Rv GGTCACGACCAGCAAGATCAAGACG


162

Gene expression analysis by semi-quantitative reverse transcription-

PCR (RT-PCR)

Total RNA was extracted according to the instructions of the

RNeasy Plant Mini kit (Qiagen, Courtaboeuf, France). cDNA was

synthesized from 0.5-1 µg of total RNA using the Transcriptor High

Fidelity cDNA Synthesis kit (Roche, Base Switzerland) following the

manufacturer’s instructions. PCR reactions were performed with

gene specific primers for PEPINO/PAS2 (At5g10480), KNAT2

(At1g70510), ARR5 (At3g48100) and IAA4 (At5g43700) (Table 1).

Controls were carried out with primers for Actin (At2g37620) (Table

1).

RESULTS

OsEREBP2 is dispersed throughout the cell

To assess OsEREBP2 subcellular localization, onion epidermal

cells were bombarded with the GFP::OsEREBP2 construct and

incubated under dark conditions. The TF was mainly localized in the

nucleus, while the GFP protein was dispersed between the nucleus

and the cytosol (Figure 1).

Chapter V

163

Figure 1. Cellular localization of OsEREBP2. Onion epidermal tissues were

bombarded with the indicated constructs. After bombardment the tissues

were incubated overnight under dark conditions and stained with DAPI.

Photographs were taken under different light fields and merged images

were prepared in the Image J software Scale bars ≈ 100 µm.

The subcellular distribution of OsEREBP2 was also analyzed in

Arabidopsis protoplasts transfected with the GFP::OsEREBP2

construct. Under control conditions, the fusion protein was

predominantly localized in the nucleus being also observed a few

spots in the cytosol (Figure 2A). Under salt stress, OsEREBP2 was

strongly located in the nucleus and many spot-like structures were

dispersed within the cell (Figure 2D).


164

Figure 2. OsEREBP2 cellular localization in Arabidopsis protoplasts

transfected with plasmids expressing the fusion protein GFP::OsEREBP2

(A-F) or the GFP protein (G-L). Fluorescence images were taken with a

confocal laser scanning microscope. Confocal image stacks were recorded

with a section spacing of 1 µm and projections of consecutive confocal

sections are shown. GFP fluorescence was excited with the argon laser

(488 nm) and detected at 512 nm to 520 nm (A, D, G, J). Bright field images

are shown in B, E, H, K. Merged images (C, F, I, L) were prepared with the

Image J software. Scale bars = 5 µm.

Chapter V

165

Arabidopsis plants over-expressing OsEREBP2 show a hormone-

related phenotype

To characterize OsEREBP2 biological function, Arabidopsis

plants over-expressing the TF (OsEREBP2-OX-L1 to L5) were

generated and studied. The gene expression analysis confirmed that

the five independent lines had high expression of the transgene

(Figure 4). The transgenic seedlings displayed a relatively normal

phenotype during the first 20 days after germination (Figures 3D,

3E). The plants were afterwards transferred to growth medium,

without selection, instead of soil due to the abnormal phenotypes

observed. Forty-three days after germination, L1 cultures displayed

several narrow leaves and short roots (Figure 3A). Callus-like tissues

and vitreous leaves were continuously formed during the following

months (Figure 3F). The cultures of L1, propagated in hormone-free

medium, were composed of a mixture of green and white calli and

were not able to form roots. By month 13 the cultures were

considered dead due to the brownish appearance of the callus-like

structures and the lack of new leaves. The transgenic cultures L2

and L3 displayed a more severe phenotype (Figures 3B, 3C), which

is correlated with the higher level of OsEREBP2 (Figure 4). After

germination the seedlings de-differentiate into callus-like tissues and

did not form leaves or roots. Fifty days after germination these

tissues exhibited a brownish appearance and were not able to

propagate in hormone-free medium. OsEREBP2-OX cultures L4

displayed a phenotype similar to L1 with callus-like tissues, several

leaves and few roots (Figure 3G). The leaves were less vitreous than

in the L1 and the callus-like tissues also propagated in hormone-free

medium. Stems and flowers developed ectopically from the callus-

like tissues (L4) 251 days after germination (Figure 3I). Two seeds


166

were able to mature although the majority of the flowers were sterile.

The seeds were germinated and the seedlings developed several

leaves and short stems with several flowers. The cultures L5 showed

a bushy rosette composed of leaves with a relatively normal shape

(Figure 3H). De-differentiation to callus-like tissues with a brownish

appearance was observed 120 days after germination and no new

leaves were formed during the following weeks.

Figure 3. Phenotype of Arabidopsis plants over-expressing OsEREBP2.

Lines: L1 (A, F), L2 (B), L3 (C), L4 (D, G, I), L5 (E, H). Plants were

photographed 43 days (A-C), 20 days (D, E), 329 days (F), 222 days (G),

59 days (H) and 251 days (I) after germination. Scale bars ≈ 30 mm.

OsEREBP2 over-expression modulates the expression of genes

involved in plant development and hormone signaling

To investigate the putative role of OsEREBP2 in plant

development and hormone signaling, the expression patterns of

specific genes was analyzed in OsEREBP2-OX plants. The

PEPINO/PAS2 gene expression was analyzed due to the high

similarity between the phenotype of OsEREBP2-OX plants and the

PEPINO/PAS2 mutants (Torres-Ruiz et al. 2002). All the transgenic

Chapter V

167

plants showed a clear decrease in PEPINO/PAS2 transcript level as

compared to wt (Col-0) (Figure 4). The KNAT2 gene encodes a class

I KNOX protein involved in plant development (Pautot et al. 2001). A

higher accumulation of the KNAT2 transcript was detected in the

transgenic lines L1-L4, but no correlation was observed between the

KNAT2 and OsEREBP2 transcript levels (Figure 4).

Figure 4. Expression analysis in wt (Col-0) and OsEREBP2-OX plants.

Total RNA was isolated from 43 (L1-L3) or 110 (L4, L5) days-old transgenic

plants and from wt plants with the second pair of leaves well expanded. RT-

PCR was performed with the primers indicated in Table 1. Actin was used

as internal control. The Image J program was used to determine the

normalized gene expression ratio.

The shoot and root phenotype of OsEREBP2-OX plants suggests

a deregulation of auxin and/or cytokinin responses. To characterize

OsEREBP2 role in hormone signaling, the expression pattern of

genes involved in cytokinin and auxin primary responses was

analyzed. ARR5 encodes a type-A ARR implicated in cytokinin

primary responses (To et al. 2007). Most transgenic plants showed a

decrease in ARR5 transcript as compared to wt. A lower level of

ARR5 transcript was observed in L2 and L3 transgenic plants, which

correlates with the highest OsEREBP2 transcript level, and the

strongest phenotype (Figure 4). The deregulation of ARR5


168

expression indicates that OsEREBP2 may have a role in cytokinin

primary responses. To characterize OsEREBP2 role in auxin primary

responses, the expression pattern of the Aux/IAA (AUXIN/INDOLE-3-

ACETIC ACID) gene IAA4 was analyzed (Figure 4). A significant

decrease in IAA4 gene expression was detected in all transgenic

compared to wt plants (Figure 4). The decrease of IAA4 transcript

accumulation in L2 and L3, correlated with the plant phenotype and

OsEREBP2 expression level, suggests that OsEREBP2 promotes

auxin responses through repression of IAA4. In fact, two Ethylene-

Responsive Elements (EREs) were identified in the IAA4 promoter,

suggesting that OsEREBP2 directly regulates IAA4 gene expression.

OsEREBP2 gene promoter region contains cis-elements involved in

ABA-, auxin- and cytokinin- responsiveness

The OsEREBP2 promoter region was analyzed to identify putative

cis-elements involved in transcriptional regulation by cytokinins,

auxins and ABA (Figure 5). To identify these regulatory sequences,

we have used PLACE and PlantPAN databases and sequences

reported in the literature. Considering as gene promoter the 2000 bp

upstream the start codon (ATG), 13 putative cytokinin-responsive

ARR-binding elements, with a consensus sequence (A/C/G/T)GATT,

were identified. These sequences were reported to be binding sites

for two type-B ARRs, ARR1 and ARR2, involved in Arabidopsis

cytokinin responses (Choi et al. 2010; Sakai et al. 2000; Sakai et al.

2001). In addition, two putative ARR10-binding elements, with the

consensus sequence AGAT(C/T/A)(C/T/A)(T/G)(A/C/TG), were

identified. ARR10 encodes a type-B ARR shown to recognize the

core sequence AGATT and to be involved in cytokinin signal

transduction pathways (Hosoda et al. 2002; Ishida et al. 2008). One

cytokinin-enhanced protein binding element TATTAG (Du et al.

Chapter V

169

2007) was identified. This element was reported to be crucial for the

activation of cytokinin-responsive genes in cucumber (Fusada et al.

2005). The ARR-binding elements identified in OsEREBP2 promoter

were also reported to be present in the promoter of several rice type-

A RRs with a putative role in cytokinin responses (Du et al. 2007; Ito

and Kurata 2006; Jain et al. 2006). In addition, auxin-related

sequences with the consensus TGTCNC or GNGACA (Kepinski and

Leyser 2002) were also identified within the OsEREBP2 promoter

region, indicating a putative regulation by auxins. The core motifs

TGTC and GACA were shown to be required for the binding of

Arabidopsis ARFs to the promoter of auxin-responsive genes

(Chapman and Estelle 2009). In rice, OsARF1 was reported to bind

to this core sequence in the promoter of the CROWN ROOTLESS5

(CRL5) gene, which is induced by auxins and encodes an AP2/ERF

TF (Kitomi et al. 2011).

ABA-dependent gene regulation usually requires the presence of

ABA-Responsive Elements (ABREs) and coupling elements (CE)

within the gene promoter (Hubbard et al. 2010; Zhang et al. 2005).

The ABRE core motif ACGT is highly conserved, but the flanking

sequences vary significantly. In contrast, the CEs are poorly

conserved and can be substituted by other functional elements, such

as ABREs themselves and Dehydration-Responsive Element (DRE).

The OsEREBP2 promoter region contains two ABRE sequences with

the core motif ACGT and one ABRE-related sequence (Kaplan et al.

2006). The gap between the ABRE sequences is within the

previously predicted distance for functional ABRE-ABRE pairs

(Gomez-Porras et al. 2007). This is consistent with the fact that

OsEREBP2 gene expression is regulated by ABA (Chapter 2).


170

Figure 5. Hormone-related cis-elements identified in the OsEREBP2 gene

promoter. The promoter region was defined as the 2000 bp sequence

upstream the translation start codon (ATG). The search for regulatory

sequences was performed using the PLACE and PlantPAN databases and

regulatory elements reported in the literature. ABA-Responsive Element

(ABRE), Arabidopsis Response Regulator (ARR). The symbols used in the

sequences correspond to: N = G/A/T/C, M = A/C, H = A/C/T, K = G/T, Y =

T/C and B = G/T/C.

OsEREBP2 and ABR1 have similar functions

OsEREBP2 and ABR1 belong to the Xa group of ERF proteins

due to the presence of the CMX-1 motif in the aa sequence (Nakano

et al. 2006). These proteins share only 44% aa identity over the full

aa sequence, but a much higher homology (89%) within the AP2

domain. Limited conservation outside the AP2 domain was

previously described, and several rice and Arabidopsis AP2/ERF

proteins with low homology were considered as functional homologs

(Dubouzet et al. 2003; Gutterson and Reuber 2004). To assess

Chapter V

171

whether OsEREBP2 and ABR1 have similar functions, homozygous

abr1 mutant plants were transformed with the OsEREBP2 transgene

driven by the Arabidopsis ABR1 promoter. The rice TF was initially

over-expressed (using the CaMV35S promoter) in the abr1 mutant,

but no transgenic plants were obtained. Thus, a construct that

allowed the transgene expression driven by the ABR1 endogenous

promoter was prepared and used to transform the abr1 mutants.

Only one homozygous ABR::OsEREBP2 transgenic line was

obtained (Figure 6A). The phenotype complementation was

assessed through seed germination studies in MS medium

containing either 150 mM NaCl or 0.7 µM ABA. In control conditions,

no significant differences in seed germination rate were observed

between wt, abr1 mutants and the ABR::OsEREBP2 transgenic

seeds (Figure 6B). Under high salinity and ABA treatments, abr1

seed germination was inhibited (Figures 6C, 6D), confirming the

previously described hypersensitivity of the abr1 mutant to these

treatments (Pandey et al. 2005). On the other hand, the

ABR::OsEREBP2 seeds showed a seed germination rate similar to

wt under both treatments. After 2 days in 150 mM NaCl, only 11% of

the abr1 seeds had germinated, in contrast to 60% of wt and 44% of

ABR::OsEREBP2 (Figure 6C). After 2 days in 0.7 µM ABA,

approximately 50% of wt and ABR::OsEREBP2 seeds had

germinated, whereas only 18% of mutant seeds germinated (Figure

6D). These results indicate that OsEREBP2 gene expression

rescued the abr1 seed germination phenotype.


172

Figure 6. Analysis of gene expression and germination rate of

ABR::OsEREBP2 transgenic seeds. (A) OsEREBP2 and ABR1 gene

expression analysis in wt (Col-0), abr1 mutants and the ABR::OsEREBP2

transgenic line. Total RNA was extracted from plants with the second pair of

leaves well expanded. Actin gene expression was used as internal control.

Germination rate analysis on MS medium without (B) or with 150 mM NaCl

(C) or 0.7 µM ABA (D). The percentage of seeds germinated was recorded

during 6 days. Data are means ± SD (n ≈ 100).

DISCUSSION

Plants undergo developmental programs and respond to external

signals through the activation and repression of specific genes. The

transcription factors (TFs) involved, after being synthesized in the

cytosol, need to be translocated into the nucleus to exert their

function (Gill 2003). The presence of a nuclear localization signal

(NLS) in their protein sequence ensures that they can be transported

to the nucleus. OsEREBP2 was shown to contain a NLS sequence

(Chapter 2), indicating that the protein can be transported into the

nucleus. Our results indicated that, under control conditions,

Chapter V

173

OsEREBP2 is mainly localized in the nucleus and, under high salinity

conditions, besides a strong accumulation in the nucleus also appear

to concentrate in spot-like structures in the cytosol. The spot-like

pattern under salt stress suggests an accumulation of OsEREBP2 in

subcellular organelles in response to this stress. A bioinformatic

analysis (PredictProtein and iPSORT software) of OsEREBP2

protein sequence indicated that besides the predicted NLS, the TF

may contain a mitochondrial and/or chloroplast target signal.

Thereby, this TF may be targeted to both the nucleus and the

mitochondrial and/or chloroplast in response to high salinity. Several

TFs have been predicted to be targeted to the nucleus and the

mitochondria or chloroplast in Arabidopsis and rice (Schwacke et al.

2007). The AP2/ERF family was among the families with more TFs

predicted to contain two target sequences. However, only a few TFs

have been characterized regarding their dual intracellular localization

in nuclei and mitochondria/chloroplast (Krause and Krupinska 2009).

APL1 encodes a MYB TF involved in developmental processes,

shown to be targeted to both nuclei and mitochondria (Bonke et al.

2003; Carrie et al. 2009). In barley, the Whirly1 TF was detected in

nuclei and chloroplasts within the same cell (Grabowski et al. 2008).

Protein target to different cell compartments is thought to be

regulated by developmental or environmental signals (Schwacke et

al. 2007; Silva-Filho 2003; Yogev and Pines 2011). In animals, a

fraction of the TF p53 is translocated from the nucleus to the

mitochondria in response to death stimulus such as hypoxia and

induces cell apoptosis (Sansome et al. 2001). In plants, a few TFs

bound with organelle membranes were shown to be translocated to

the nucleus in response to stress conditions (Krause and Krupinska

2009). The DnaJ-type Zn finger Tsip1 was shown to be bound to

chloroplast surface, but under treatment with salicylic acid it


174

dissociates from it and forms a complex with the AP2/ERF TF Tsi1

(Ham et al. 2006). The Tsip1-Tsi1 complex accumulates in the

nucleus and induces several stress-responsive genes. Dual protein

targeting is thought to be an important mechanism which allows

communication between the nucleus and the organelles in response

to biotic and abiotic stress conditions (Schwacke et al. 2007). We

suggest that OsEREBP2 has a function in such mechanisms;

however, this must be further investigated.

OsEREBP2 biological function was analyzed in Arabidopsis plants

over-expressing this TF. OsEREBP2-OX plants displayed abnormal

shoot and root phenotype, and de-differentiated into callus-like

structures in hormone free medium. Cell de-diferentiation and

proliferation may be related to an imbalance auxin/cytokinin ratio or

to impaired responses to these hormones (Frank et al. 2000; Harrar

et al. 2003). The phenotype of OsEREBP2-OX plants is similar to the

reported for Arabidopsis mutants with abnormal responses to auxin

and cytokinin. The pasticcino (pas) mutants displayed bushy

rosettes, ectopic shoots and tissue de-differentiation to callus-like

structures after germination in hormone-free medium (Faure et al.

1998). Although no significant difference in hormone content was

detected in these mutants, they revealed higher sensitivity to

cytokinins (Faure et al. 1998). Gene expression studies revealed that

the pas mutants have higher competence for cell division due to

deregulation of cytokinin and auxin primary response genes (Harrar

et al. 2003). PASTICCINO (PAS) genes PAS1, PEPINO/PAS2 and

PAS3 were shown to regulate cell division and differentiation through

the control of the amplitude of cytokinin and auxin responses (Harrar

et al. 2003). In addition, the encoded proteins were reported to have

important roles in very-long-chain fatty acids (VLCFA) synthesis

(Bach et al. 2008; Baud et al. 2004; Roudier et al. 2010). VLCFA are

Chapter V

175

components of plant seeds, cuticular waxes and sphingolipids that

are membrane constituents and signaling molecules (Bach and

Faure 2010). Modifications in VLCFA nature or levels affect several

plant development processes, through deregulation of

organogenesis and alterations in cell size, division and differentiation

(Bach and Faure 2010).

The similarities between the phenotypes of pas mutants and the

OsEREBP2-OX plants suggest that OsEREBP2 interferes with PAS-

mediated pathways or with PAS gene expression regulation. In fact,

OsEREBP2-OX plants tend to have reduced PEPINO/PAS2

transcript levels as compared to wt. The down regulation of

PEPINO/PAS2 gene expression appears to be correlated with the

increased OsEREBP2 transcript level and, at least partially, with the

phenotype severity of the transgenic lines. Our results suggest that

OsEREBP2 negatively regulates PEPINO/PAS2 gene expression.

PEPINO/PAS2 encodes an anti-phosphatase that may function in the

control of cell proliferation by direct binding to substrates preventing

their de-phosphorylation by phosphatases (Torres-Ruiz et al. 2002).

In addition, PEPINO/PAS2 was shown to function as a hydroxyl fatty

acyl CoA dehydratase in the elongation steps of the VLCFAs

synthesis (Bach et al. 2008). Its activity in this biosynthetic pathway

was characterized as essential for plant development, but the

specific role of PAS-mediated VLCFA pathway is still unclear (Bach

et al. 2008). A BLAST analysis revealed that rice has proteins with

high homology to PEPINO/PAS2, but their function is not yet

characterized (Torres-Ruiz et al. 2002). The rice VLCFA pathway is

also poorly understood, although studies with rice mutants suggested

that VLCFA pathways have an important role in rice shoot

development (Ito et al. 2011). oni1 mutants displayed short leaves

and fused organs and were not able to reach the reproductive stage.


176

ONION1 (ONI1) encodes a fatty acid elongase involved in VLCFA

synthesis and shown to be necessary for normal shoot development

(Ito et al. 2011). Therefore, the role of VLCFA synthesis in plant

development may be at least partially conserved in Arabidopsis and

rice and OsEREBP2 may function in rice developmental processes

involving the regulation of VLCFA pathways mediated by PAS

orthologues.

OsEREBP2-OX plants phenotype may also be related to defects

in the root apical meristem (RAM) and the shoot apical meristem

(SAM), which can be caused by abnormal responses to auxins

and/or cytokinins. Primary roots result from cell division in the root

apical meristem (RAM) and subsequent cell expansion and

differentiation (Stahl and Simon 2010). Auxins promote and maintain

stem cell activity, whereas cytokinins promote cell differentiation

(Stahl and Simon 2010). Thus, the deregulation of hormone content

or responses can induce defects in the RAM function that may lead

to abnormal root phenotypes. Similarly, the shoot architecture can be

affected by SAM abnormal auxins and/or cytokinins content or

responses (Itoh et al. 2000). High levels of cytokinins are detected in

the central zone of the SAM to promote stem-cell proliferation and

inhibit their differentiation. In contrast, auxin triggers organ primordial

initiation through repression of cytokinin biosynthesis in the

peripheral zone of the SAM (Su et al. 2011). In addition, the proper

pattern of leaf initiation is greatly influenced by the SAM shape and

organization. The enlargement of SAM affects the rate of leaf

production and changes in SAM organization can alter leaf

morphogenesis (Itoh et al. 2000). Class I KNOX (Knotted1-like

homeobox) proteins are homeodomain TFs with important functions

in the SAM (Hay and Tsiantis 2010). KNOX gene expression is

activated in the central region of the SAM to prevent cell

Chapter V

177

differentiation and maintain the stem cell activity, whereas it is

repressed in the periphery of the SAM where organs are initiated to

allow their formation (Scofield and Murray 2006). The KNAT2 gene

encodes a class I KNOX protein expressed during embryogenesis in

the base of the SAM and repressed when leaf primordia are initiated

(Hay and Tsiantis 2010; Pautot et al. 2001). This protein was shown

to mediate cytokinin and ethylene function in the SAM (Hamant et al.

2002). Misexpression of KNAT2 in the meristem was reported to

affect leaf cell expansion and differentiation, leading to malformed

leaves (Scofield and Murray 2006). KNAT2 gene expression was up-

regulated in the five OsEREBP2-OX plants as compared to wt. No

correlation was observed between the KNAT2 and either OsEREBP2

transcript levels or the severity of the phenotype; nevertheless the

higher accumulation of KNAT2 suggests that the transgenic plants

are affected in the SAM function. Studies in Arabidopsis and rice

reported the noncorrelation between the phenotype severity and the

expression levels of KNOX genes (Ito et al. 2001; Ito et al. 2009).

The studies suggest that the phenotype severity is related to the

amount of protein accumulation, which may not correlate with the

KNOX transcript level. The obtained results are in agreement with

the increased accumulation of KNAT2 transcripts reported in pas

mutants (Harrar et al. 2003). In these mutants, KNAT2 was shown to

be expressed in a larger zone of the meristem, as compared to wt,

allowing the ectopic formation of shoots (Harrar et al. 2003).

Similarly, OsEREBP2-OX abnormal shoot phenotype may be related

to deregulation of KNAT2 gene expression. KNOX genes have been

identified in rice and reported to have a role in the SAM function

(Reiser et al. 2000). Based on sequence similarity and expression

pattern, OSH6 was considered to be a rice orthologue of KNAT2

(Hay and Tsiantis 2010). OSH6 transcripts were detected in the base


178

of the SAM and OSH6 was shown to have a putative role in SAM

maintenance and leaf development (Ito et al. 2001; Ito et al. 2009).

Thus, OsEREBP2 may have a role in the SAM development through

the regulation of KNOX gene expression.

To further characterize OsEREBP2 role in cytokinin responses,

the ARR5 gene expression was analyzed in the OsEREBP2-OX

plants. ARR5 encodes a type-A ARR highly induced by cytokinins

(To et al. 2007). Type-A ARRs function as repressors to reduce

cytokinin responses. Reduced ARR5 transcript levels were detected

in most OsEREBP2-OX plants, suggesting that OsEREBP2 is

affecting cytokinin signaling pathways. Down-regulation of type-A

ARRs (ARR4, ARR5 and ARR6) was detected in BOLITA/ESR2

over-expressing lines (Ikeda et al. 2006). The Arabidopsis

BOLITA/ESR2 gene encodes a DORNROESCHEN-LIKE (DRNL)

protein belonging to the ERF subfamily of TFs (Pereira et al. 2006).

Its over-expression induces de-differentiation of true leaves to callus-

like tissues and defects in the root system (Ikeda et al. 2006; Pereira

et al. 2006). Similarly to OsEREBP2-OX plants, the callus-like

tissues proliferated in hormone-free medium and some gave rise to

leaves, stems and flowers. Based on gene expression analysis,

BOLITA/ESR2 was reported to have a putative function in cell

proliferation and differentiation, as well as in auxin and cytokinin

hormone signaling pathways (Pereira et al. 2006). ARR5 transcript

level was lower in BOLITA/ESR2-OX plants with severe phenotypes

as observed in OsEREBP2-OX plants. The reduced expression of

type-A ARRs was proposed to be related to the higher expression of

AHP6 and/or AtCKX7 genes in BOLITA/ESR2 transgenic plants

(Ikeda et al. 2006). AHP6 encodes an Arabidopsis histidine

phosphotransfer (AHP)-like protein (Mahonen et al. 2006; Muller and

Sheen 2007). Phosphotransfer proteins (AHPs) function as

Chapter V

179

intermediates in cytokinin responses that transfer the phosphoryl

group from the cytokinin receptors to nuclear Arabidopsis type-B

response regulators (ARRs) (Kieber et al. 2010). The type-B ARRs

and the cytokinin response factors (CRFs) regulate the cytokinin

primary response genes, which include type-A ARRs (Rashotte et al.

2006). AHP6 do not display phosphotransfer activity because it lacks

the conserved histidine residue required to accept the phosphoryl

group from the receptors (Mahonen et al. 2006; Muller and Sheen

2007). The inhibitory effect of AHP6 in cytokinin signaling was

suggested to involve competition with other AHPs for interaction with

hormone receptors or ARR proteins (Muller and Sheen 2007). The

phosphotransfer mechanism involved in cytokinin signal transduction

was shown to be putatively conserved in Arabidopsis and rice (Ito

and Kurata 2006). Orthologues of cytokinin receptors, histidine

phosphotransfer (HPt) proteins, and type-A and type-B response

regulators (RRs) were identified in rice, but their function in the

hormone signaling is not fully understood (Ito and Kurata 2006).

Three HPt proteins that lack the conserved histidine residue were

identified in the rice genome (OHP3, OHP4 and OHP5), and

therefore rice may have a functional orthologue of AHP6 (Ito and

Kurata 2006). The AtCKX7 gene encodes a cytokinin

oxidase/dehydrogenase enzyme involved in the irreversible

degradation of cytokinins (Schmulling et al. 2003a). CKX enzymes

were identified in maize and wheat, and shown to have a putative

role in seed development (Schmulling et al. 2003b). In rice, OsCKX2

was proposed to regulate grain production through the control of

cytokinin transport to the meristem, thus influencing the meristem

size and/or flower number (Werner et al. 2006).

OsEREBP2 putative role in auxin responses was assessed

through the analysis of the IAA4 gene expression in the OsEREBP2-


180

OX plants. Aux/IAA proteins function as auxin-response inhibitors

that form heterodimers with AUXIN RESPONSE FACTORs (ARFs)

to prevent the activation of auxin-responsive genes (Moubayidin et

al. 2009). Reduced IAA4 transcript level was detected in the

OsEREBP2-OX plants compared to wt, suggesting that the rice TF is

interfering with auxin responses. Down-regulation of IAA4 and IAA1

gene expression was reported in the pas mutants under normal

growth conditions (Harrar et al. 2003). Aux/IAA transcript level

increased upon auxin treatment, but the amplitude of response was

lower than the observed in wt plants, suggesting that the mutants

have a reduced primary response to auxin (Harrar et al. 2003). In

rice, several Aux/IAA and ARF proteins were identified and shown to

have a role in auxin responses and plant development (Nakamura et

al. 2006; Wang et al. 2007; Xiong et al. 2009). OsIAA3 gene

expression was highly induced by auxin and gain-of-function mutants

displayed several developmental defects, such as reduced crown

root formation and abnormal leaf formation (Nakamura et al. 2006).

Gene expression studies also revealed that several Aux/IAA and

ARF proteins may also be involved in abiotic stress responses,

suggesting a cross-talk between auxin and abiotic stress signaling

pathways in rice (Jain and Khurana 2009; Xiong et al. 2009).

Taken together these results suggest that OsEREBP2 has a role

in plant development processes mediated by cytokinins and auxins.

Moreover, the TF putative function in abiotic stress responses

indicates that it can function as a coordinator of the developmental

adjustments required for plant adaptation to changes in

environmental conditions. The identification of cis-elements known to

confer regulation by cytokinin, auxin and ABA, suggests that

OsEREBP2 gene expression is regulated by these hormones, further

implicating the TF in plant developmental processes.

Chapter V

181

OsEREBP2 and ABR1 belong to the Xa group of ERF proteins

and have a putative role in abiotic stress responses (Chapter 2)

(Pandey et al. 2005). The transcript level of both genes is induced in

response to ABA, low temperature, high salinity and drought stress

treatments. To confirm whether these TFs have a similar function,

abr1 mutants were transformed to express OsEREBP2 under the

control of the ABR1 promoter. Thereby, we showed that OsEREBP2

may have a similar function to ABR1. Further studies need to be

performed to confirm that OsEREBP2 can also function as an ABA

repressor. Nevertheless, the described regulation of the TF gene

expression by ABA, the identification of ABA-regulated cis-elements

in the promoter region and the observed mutant seed phenotype

rescue indicates that OsEREBP2 has a role in ABA responses.

In the present study, we have shown that salt stress induces

OsEREBP2 accumulation in spot-like structures which may

colocalize with mitochondria or chloroplasts. In addition, we have

shown that OsEREBP2 plays an important role in plant

developmental processes and hormone signaling pathways. We

suggest that OsEREBP2 may be an integrator of the external stimuli

into the plant developmental programs.

ACKNOWLEDGMENTS

Tânia Serra carried out the experimental work. The planning of

the research work and discussion of results was performed by Tânia

Serra, Ana Paula Santos, M. Margarida Oliveira and Nelson Saibo.

REFERENCES


182

Acharya BR, Assmann SM (2009) Hormone interactions in stomatal

function. Plant Mol Biol 69: 451-462

Ahuja I, de Vos RC, Bones AM, Hall RD (2010) Plant molecular stress

responses face climate change. Trends Plant Sci 15: 664-674

Bach L, Faure JD (2010) Role of very-long-chain fatty acids in plant

development, when chain length does matter. Comptes Rendus Biol

333: 361-370

Bach L, Michaelson LV, Haslam R, Bellec Y, Gissot L, Marion J, Da Costa

M, Boutin JP, Miquel M, Tellier F, Domergue F, Markham JE, Beaudoin

F, Napier JA, Faure JD (2008) The very-long-chain hydroxy fatty acyl-

CoA dehydratase PASTICCINO2 is essential and limiting for plant

development. Proc Natl Acad Sci USA 105: 14727-14731

Baud S, Bellec Y, Miquel M, Bellini C, Caboche M, Lepiniec L, Faure JD,

Rochat C (2004) gurke and pasticcino3 mutants affected in embryo

development are impaired in acetyl-CoA carboxylase. EMBO Rep 5:

515-520

Bonke M, Thitamadee S, Mahonen AP, Hauser MT, Helariutta Y (2003) APL

regulates vascular tissue identity in Arabidopsis. Nature 426: 181-186

Carrie C, Kuhn K, Murcha MW, Duncan O, Small ID, O'Toole N, Whelan J

(2009) Approaches to defining dual-targeted proteins in Arabidopsis.

Plant J 57: 1128-1139

Chapman EJ, Estelle M (2009) Mechanism of auxin-regulated gene

expression in plants. Annu Rev Genet 43: 265-285

Choi J, Huh SU, Kojima M, Sakakibara H, Paek KH, Hwang I (2010) The

cytokinin-activated transcription factor ARR2 promotes plant immunity

via TGA3/NPR1-dependent salicylic acid signaling in Arabidopsis. Dev

Cell 19: 284-295

Clough SJ, Bent AF (1998) Floral dip: a simplified method for

Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J

16: 735-743



Chapter V

183



Du L, Jiao F, Chu J, Jin G, Chen M, Wu P (2007) The two-component signal

system in rice (Oryza sativa L.): a genome-wide study of cytokinin signal

perception and transduction. Genomics 89: 697-707





Duek PD, Fankhauser C (2005) bHLH class transcription factors take centre

stage in phytochrome signalling. Trends Plant Sci 10: 51-54

Faure JD, Vittorioso P, Santoni V, Fraisier V, Prinsen E, Barlier I, Van

Onckelen H, Caboche M, Bellini C (1998) The PASTICCINO genes of

Arabidopsis thaliana are involved in the control of cell division and

differentiation. Development 125: 909-918

Frank M, Rupp HM, Prinsen E, Motyka V, Van Onckelen H, Schmulling T

(2000) Hormone autotrophic growth and differentiation identifies mutant

lines of Arabidopsis with altered cytokinin and auxin content or signaling.


Fusada N, Masuda T, Kuroda H, Shimada H, Ohta H, Takamiya K (2005)

Identification of a novel cis-element exhibiting cytokinin-dependent

protein binding in vitro in the 5'-region of NADPH-protochlorophyllide

oxidoreductase gene in cucumber. Plant Mol Biol 59: 631-645

Gill G (2003) Post-translational modification by the small ubiquitin-related

modifier SUMO has big effects on transcription factor activity. Curr Opin

Genet Dev 13: 108-113

Gomez-Porras JL, Riano-Pachon DM, Dreyer I, Mayer JE, Mueller-Roeber

B (2007) Genome-wide analysis of ABA-responsive elements ABRE and

CE3 reveals divergent patterns in Arabidopsis and rice. BMC Genomics

8: 260

Grabowski E, Miao Y, Mulisch M, Krupinska K (2008) Single-stranded DNA-

binding protein Whirly1 in barley leaves is located in plastids and the

nucleus of the same cell. Plant Physiol 147: 1800-1804


184



Ham BK, Park JM, Lee SB, Kim MJ, Lee IJ, Kim KJ, Kwon CS, Paek KH

(2006) Tobacco Tsip1, a DnaJ-type Zn finger protein, is recruited to and

potentiates Tsi1-mediated transcriptional activation. Plant Cell 18: 2005-

2020

Hamant O, Nogue F, Belles-Boix E, Jublot D, Grandjean O, Traas J, Pautot

V (2002) The KNAT2 homeodomain protein interacts with ethylene and

cytokinin signaling. Plant Physiol 130: 657-665

Harrar Y, Bellec Y, Bellini C, Faure JD (2003) Hormonal control of cell

proliferation requires PASTICCINO genes. Plant Physiol 132: 1217-1227

Hay A, Tsiantis M (2010) KNOX genes: versatile regulators of plant

development and diversity. Development 137: 3153-3165

Hirose N, Makita N, Kojima M, Kamada-Nobusada T, Sakakibara H (2007)

Overexpression of a type-A response regulator alters rice morphology

and cytokinin metabolism. Plant Cell Physiol 48: 523-539

Hirose N, Takei K, Kuroha T, Kamada-Nobusada T, Hayashi H, Sakakibara

H (2008) Regulation of cytokinin biosynthesis, compartmentalization and

translocation. J Exp Bot 59: 75-83

Hosoda K, Imamura A, Katoh E, Hatta T, Tachiki M, Yamada H, Mizuno T,

Yamazaki T (2002) Molecular structure of the GARP family of plant Myb-

related DNA binding motifs of the Arabidopsis response regulators. Plant

Cell 14: 2015-2029

Hubbard KE, Nishimura N, Hitomi K, Getzoff ED, Schroeder JI (2010) Early

abscisic acid signal transduction mechanisms: newly discovered

components and newly emerging questions. Genes Dev 24: 1695-1708

Hwang BK, Choi DS (2011) Proteomics and functional analyses of pepper

abscisic acid-responsive 1 (ABR1), which is involved in cell death and

defense signaling. Plant Cell 23: 823-842

Ikeda Y, Banno H, Niu QW, Howell SH, Chua NH (2006) The ENHANCER

OF SHOOT REGENERATION 2 gene in Arabidopsis regulates CUP-

SHAPED COTYLEDON 1 at the transcriptional level and controls

cotyledon development. Plant Cell Physiol 47: 1443-1456

Chapter V

185

Ishida K, Yamashino T, Yokoyama A, Mizuno T (2008) Three type-B

response regulators, ARR1, ARR10 and ARR12, play essential but

redundant roles in cytokinin signal transduction throughout the life cycle

of Arabidopsis thaliana. Plant Cell Physiol 49: 47-57

Ito Y, Eiguchi M, Kurata N (2001) KNOX homeobox genes are sufficient in

maintaining cultured cells in an undifferentiated state in rice. Genesis 30:

231-238

Ito Y, Kimura F, Hirakata K, Tsuda K, Takasugi T, Eiguchi M, Nakagawa K,

Kurata N (2011) Fatty acid elongase is required for shoot development in

rice. Plant J 66: 680-688

Ito Y, Kurata N (2006) Identification and characterization of cytokinin-

signalling gene families in rice. Gene 382: 57-65

Ito Y, Tsuda K, Yamaki S, Miyao A, Hirochika H, Kurata N (2009) Isolation

and mapping of three rice mutants that showed ectopic expression of

KNOX genes in leaves. Plant Sci 177: 131-135

Itoh JI, Kitano H, Matsuoka M, Nagato Y (2000) Shoot organization genes

regulate shoot apical meristem organization and the pattern of leaf

primordium initiation in rice. Plant Cell 12: 2161-2174

Jaillais Y, Chory J (2010) Unraveling the paradoxes of plant hormone

signaling integration. Nat Struct Mol Biol 17: 642-645

Jain M, Khurana JP (2009) Transcript profiling reveals diverse roles of

auxin-responsive genes during reproductive development and abiotic

stress in rice. FEBS J 276: 3148-3162

Jain M, Tyagi AK, Khurana JP (2006) Molecular characterization and

differential expression of cytokinin-responsive type-A response

regulators in rice (Oryza sativa). BMC Plant Biol 6: 1

Jones B, Gunneras SA, Petersson SV, Tarkowski P, Graham N, May S,

Dolezal K, Sandberg G, Ljung K (2010) Cytokinin regulation of auxin

synthesis in Arabidopsis involves a homeostatic feedback loop regulated

via auxin and cytokinin signal transduction. Plant Cell 22: 2956-2969

Kaplan B, Davydov O, Knight H, Galon Y, Knight MR, Fluhr R, Fromm H

(2006) Rapid transcriptome changes induced by cytosolic Ca2+


186

transients reveal ABRE-related sequences as Ca2+

-responsive cis-

elements in Arabidopsis. Plant Cell 18: 2733-2748

Kepinski S, Leyser O (2002) Ubiquitination and auxin signaling: a degrading

story. Plant Cell 14 Suppl: S81-95

Kieber JJ, Argueso CT, Raines T (2010) Cytokinin signaling and

transcriptional networks. Curr Opin Plant Biol 13: 533-539

Kitomi Y, Ito H, Hobo T, Aya K, Kitano H, Inukai Y (2011) The auxin

responsive AP2/ERF transcription factor CROWN ROOTLESS5 is

involved in crown root initiation in rice through the induction of OsRR1, a

type-A response regulator of cytokinin signaling. Plant J 67: 472-484

Koini MA, Alvey L, Allen T, Tilley CA, Harberd NP, Whitelam GC, Franklin

KA (2009) High temperature-mediated adaptations in plant architecture

require the bHLH transcription factor PIF4. Curr Biol 19: 408-413

Krause K, Krupinska K (2009) Nuclear regulators with a second home in

organelles. Trends Plant Sci 14: 194-199

Kudo T, Kiba T, Sakakibara H (2010) Metabolism and long-distance

translocation of cytokinins. J Integr Plant Biol 52: 53-60



Mahonen AP, Bishopp A, Higuchi M, Nieminen KM, Kinoshita K,

Tormakangas K, Ikeda Y, Oka A, Kakimoto T, Helariutta Y (2006)

Cytokinin signaling and its inhibitor AHP6 regulate cell fate during

vascular development. Science 311: 94-98

Moubayidin L, Di Mambro R, Sabatini S (2009) Cytokinin-auxin crosstalk.


Muller B, Sheen J (2007) Advances in cytokinin signaling. Science 318: 68-

69



Nakamura A, Umemura I, Gomi K, Hasegawa Y, Kitano H, Sazuka T,

Matsuoka M (2006) Production and characterization of auxin-insensitive

rice by overexpression of a mutagenized rice IAA protein. Plant J 46:

297-306

Chapter V

187



Nayyar H, Thakur P, Kumar S, Malik JA, Berger JD (2010) Cold stress

effects on reproductive development in grain crops: An overview. Env

Exp Bot 67: 429-443

Nishiyama R, Watanabe Y, Fujita Y, Le DT, Kojima M, Werner T, Vankova

R, Yamaguchi-Shinozaki K, Shinozaki K, Kakimoto T, Sakakibara H,

Schmulling T, Tran LS (2011) Analysis of cytokinin mutants and

regulation of cytokinin metabolic genes reveals important regulatory

roles of cytokinins in drought, salt and abscisic acid responses, and

abscisic acid biosynthesis. Plant Cell 23: 2169-2183

Pandey GK, Grant JJ, Cheong YH, Kim BG, Li L, Luan S (2005) ABR1, an

APETALA2-domain transcription factor that functions as a repressor of

ABA response in Arabidopsis. Plant Physiol 139: 1185-1193

Pautot W, Dockx J, Hamant O, Kronenberger J, Grandjean O, Jublot D,

Traas J (2001) KNAT2: evidence for a link between knotted-like genes

and carpel development. Plant Cell 13: 1719-1734

Peleg Z, Blumwald E (2011) Hormone balance and abiotic stress tolerance

in crop plants. Curr Opin Plant Biol 14: 290-295

Pereira A, Marsch-Martinez N, Greco R, Becker JD, Dixit S, Bergervoet

JHW, Karaba A, de Folter S (2006) BOLITA, an Arabidopsis AP2/ERF-

like transcription factor that affects cell expansion and

proliferation/differentiation pathways. Plant Mol Biol 62: 825-843

Raghavendra AS, Gonugunta VK, Christmann A, Grill E (2010) ABA

perception and signalling. Trends Plant Sci 15: 395-401

Rashotte AM, Mason MG, Hutchison CE, Ferreira FJ, Schaller GE, Kieber

JJ (2006) A subset of Arabidopsis AP2 transcription factors mediates

cytokinin responses in concert with a two-component pathway. Proc Natl

Acad Sci USA 103: 11081-11085

Reiser L, Sanchez-Baracaldo P, Hake S (2000) Knots in the family tree:

evolutionary relationships and functions of knox homeobox genes. Plant

Mol Biol 42: 151-166


188

Rivero RM, Shulaev V, Blumwald E (2009) Cytokinin-dependent

photorespiration and the protection of photosynthesis during water

deficit. Plant Physiol 150: 1530-1540

Roudier F, Gissot L, Beaudoin F, Haslam R, Michaelson L, Marion J, Molino

D, Lima A, Bach L, Morin H, Tellier F, Palauqui JC, Bellec Y, Renne C,

Miquel M, Dacosta M, Vignard J, Rochat C, Markham JE, Moreau P,

Napier J, Faure JD (2010) Very-long-chain fatty acids are involved in

polar auxin transport and developmental patterning in Arabidopsis. Plant

Cell 22: 364-375

Sakai H, Aoyama T, Oka A (2000) Arabidopsis ARR1 and ARR2 response

regulators operate as transcriptional activators. Plant J 24: 703-711

Sakai H, Honma T, Aoyama T, Sato S, Kato T, Tabata S, Oka A (2001)

ARR1, a transcription factor for genes immediately responsive to

cytokinins. Science 294: 1519-1521

Sansome C, Zaika A, Marchenko ND, Moll UM (2001) Hypoxia death

stimulus induces translocation of p53 protein to mitochondria. Detection

by immunofluorescence on whole cells. FEBS Lett 488: 110-115

Santner A, Estelle M (2009) Recent advances and emerging trends in plant

hormone signalling. Nature 459: 1071-1078

Schmulling T, Werner T, Motyka V, Laucou V, Smets R, Van Onckelen H

(2003a) Cytokinin-deficient transgenic Arabidopsis plants show multiple

developmental alterations indicating opposite functions of cytokinins in

the regulation of shoot and root meristem activity. Plant Cell 15: 2532-

2550

Schmulling T, Werner T, Riefler M, Krupkova E, Bartrina y Manns I (2003b)

Structure and function of cytokinin oxidase/dehydrogenase genes of

maize, rice, Arabidopsis and other species. J Plant Res 116: 241-252

Schwacke R, Fischer K, Ketelsen B, Krupinska K, Krause K (2007)

Comparative survey of plastid and mitochondrial targeting properties of

transcription factors in Arabidopsis and rice. Mol Genet Genomics 277:

631-646

Scofield S, Murray JA (2006) KNOX gene function in plant stem cell niches.

Plant Mol Biol 60: 929-946

Chapter V

189




Shukla RK, Raha S, Tripathi V, Chattopadhyay D (2006) Expression of

CAP2, an APETALA2-family transcription factor from chickpea,

enhances growth and tolerance to dehydration and salt stress in

transgenic tobacco. Plant Physiol 142: 113-123

Silva-Filho MC (2003) One ticket for multiple destinations: dual targeting of

proteins to distinct subcellular locations. Current Opinion in Plant Biology

6: 589-595

Stahl Y, Simon R (2010) Plant primary meristems: shared functions and

regulatory mechanisms. Curr Opin Plant Biol 13: 53-58

Su YH, Liu YB, Zhang XS (2011) Auxin-cytokinin interaction regulates

meristem development. Mol Plant 4: 616-625

To JP, Deruere J, Maxwell BB, Morris VF, Hutchison CE, Ferreira FJ,

Schaller GE, Kieber JJ (2007) Cytokinin regulates type-A Arabidopsis

Response Regulator activity and protein stability via two-component

phosphorelay. Plant Cell 19: 3901-3914

Torres-Ruiz RA, Haberer G, Erschadi S (2002) The Arabidopsis gene

PEPINO/PASTICCINO2 is required for proliferation control of

meristematic and non-meristematic cells and encodes a putative anti-

phosphatase. Dev Genes Evol 212: 542-550

Wang D, Pei K, Fu Y, Sun Z, Li S, Liu H, Tang K, Han B, Tao Y (2007)

Genome-wide analysis of the auxin response factors (ARF) gene family

in rice (Oryza sativa). Gene 394: 13-24

Werner T, Köllmer I, Bartrina I, Holst K, Schmülling T (2006) New insights

into the biology of cytokinin degradation. Plant Biol 8: 371-381

Xiong LZ, Song YL, Wang L (2009) Comprehensive expression profiling

analysis of OsIAA gene family in developmental processes and in

response to phytohormone and stress treatments. Planta 229: 577-591

Xue-Xuan X, Hong-Bo S, Yuan-Yuan M, Gang X, Jun-Na S, Dong-Gang G,

Cheng-Jiang R (2010) Biotechnological implications from abscisic acid

(ABA) roles in cold stress and leaf senescence as an important signal for


190

improving plant sustainable survival under abiotic-stressed conditions.

Crit Rev Biotechnol 30: 222-230

Yogev O, Pines O (2011) Dual targeting of mitochondrial proteins:

Mechanism, regulation and function. Bba-Biomembranes 1808: 1012-

1020

Zhang L, Tian LH, Zhao JF, Song Y, Zhang CJ, Guo Y (2009a) Identification



149: 916-928

Zhang SW, Li CH, Cao J, Zhang YC, Zhang SQ, Xia YF, Sun DY, Sun Y

(2009b) Altered architecture and enhanced drought tolerance in rice via

the down-regulation of indole-3-acetic acid by TLD1/OsGH3.13

activation. Plant Physiol 151: 1889-1901

Zhang W, Ruan J, Ho TH, You Y, Yu T, Quatrano RS (2005) Cis-regulatory

element based targeted gene finding: genome-wide identification of

abscisic acid- and abiotic stress-responsive genes in Arabidopsis

thaliana. Bioinformatics 21: 3074-3081

Zhao Y (2010) Auxin biosynthesis and its role in plant development. Annu

Rev Plant Biol 61: 49-64

Chapter VI

191


Chapter VI


192

Rice is a salt-sensitive plant with high commercial value and

closely related to other very important crop species such as wheat,

barley and maize. The study of rice stress adaptation mechanisms

may help to improve rice cultivars as well as other crops. In this

thesis, we have studied the transcriptional regulation of the rice Root

Meander Curling (OsRMC) gene. OsRMC was selected among other

salt stress responsive genes not only because of its high induction by

salinity (Chapter 2), but also for its role as negative regulator of salt

stress response as well as putative role in stress signal perception.

The perception and transduction of stress signals is crucial to

activate the mechanisms responsible for plant survival under stress.

The perception of salt stress signals is thought to involve plasma

membrane proteins, such as receptor-like kinases and calcium

sensors, but no specific protein has been identified as a salt stress

sensor.

The role of salt stress negative regulators is also largely unknown.

Abiotic stress conditions induce the expression of several genes

whose products lead to adverse effects on plant development.

OsRMC was suggested as repressor of the expression of salt stress-

responsive genes, thereby fine-tuning plant responses to salt stress.

The study of OsRMC gene expression regulation may therefore

provide new insights on the high salinity stress response in this

species.

Aiming to identify transcription factors (TFs) regulating OsRMC

gene expression, a salt-induced cDNA expression library was

constructed and screened using the yeast one-hybrid system

(Chapter 2). This library became an important genetic tool for

identification of either protein-DNA or protein-protein interactions

involved in salt stress responses. Two TFs OsEREBP1 and

OsEREBP2, belonging to the ERF subfamily, were shown to directly

Chapter VI

193

bind to the same GCC-like DNA-motif present in the promoter of

OsRMC and to negatively regulate its gene expression (Chapter 3).

Both TFs were also shown to interact with a synthetic probe

containing two tandem repeats of the GCC box motif. OsEREBP1

was proposed to bind DNA, alone or in combination with itself or

other regulatory proteins and to function as an activator or repressor

depending on the adjacent DNA-motifs. DRE-like and MYB

recognition cis-elements were found near the GCC-like motif in the

OsRMC promoter (Chapter 3). Previous studies have suggested that

the combination of cis-elements can affect gene expression

regulation. If so, OsEREBP1 may bind cooperatively to the GCC-like

and DRE-like motifs to modulate OsRMC gene expression. This

effect, however, was not observed in our transient expression

assays, likely because no DRE-like motif is present near the S1 site

in the DNA fragment 3 of OsRMC promoter used in the reporter

plasmid. To confirm this hypothesis, it would be interesting to

perform transient expression assays using a reporter plasmid

carrying both cis-elements in the promoter fragment. Mutations in

any of these DNA motifs could confirm the relevance of the

combinatorial interaction in the regulation of OsRMC gene

expression. Additionally, electrophoretic mobility shift assays

(EMSAs) should be performed with the same DNA probes to confirm

the formation of a slower migrating OsEREBP1–DNA complex. The

identification of a MYB-recognition motif (MYBR) near the GCC-like

motif suggests that OsEREBP1 regulates OsRMC gene expression

cooperatively with MYB proteins. OsRMC regulation may occur

through TFs independent binding or dimerization. The yeast two-

hybrid system can be used to identify proteins interacting with

OsEREBP1 and to assess its putative homodimerization. The results

obtained must be further confirmed by bimolecular fluorescence


194

complementation (BiFC). Additionally, the biological function of the

homo- or heterodimers may be assessed by transient expression

assays and EMSAs can be performed with fragments of the OsRMC

promoter containing the specific cis-elements. The yeast two-hybrid

screening may also allow the identification of proteins that regulate

the TF at post-translational level. OsEREBP1 was previously shown

to be phosphorylated by the MAPK OsBWMK1 and this modification

enhanced the TF binding to DNA. It would however be interesting to

identify new proteins interacting with OsEREBP1.

The subcellular localization studies revealed that OsEREBP1

locates in the nucleus, whereas OsEREBP2 is mainly located in the

nucleus under control conditions and accumulates in spot-like

structures under salt stress (Chapters 4 and 5). The prediction of a

mitochondria and/or chloroplast target signal in OsEREBP2 protein

sequence suggests that this TF locates in these cell structures. To

confirm if the spot-like structures correspond to mitochondria,

transient expression assays should be performed using a fluorescent

marker, such as the MitoTracker Red. The TF localization in

chloroplasts should be assessed through the observation of the

chlorophyll autofluorescence. These results should be

complemented with transient expression assays using OsEREBP2

protein forms mutated in the NLS and/or the predicted mitochondria

and/or chloroplast target signal. OsEREBP2 was shown to have a

putative role in drought, cold and hormone responses (Chapters 2

and 5); therefore, it would also be interesting to analyze the TF

localization in response to these stimuli. The results obtained should

also be confirmed through studies with Arabidopsis plants over-

expressing OsEREBP2 fused to GFP. Analyses of plant roots

exposed to high salinity and other stimuli may confirm the results

obtained with Arabidopsis protoplasts.

Chapter VI

195

The role of OsEREBP1 in abiotic stress responses was initially

analyzed through its transcriptional regulation by salt, drought, cold

(10ºC and 5ºC) and ABA treatments (Chapter 2). OsEREBP1

transcript level was only slightly affected by drought and moderate

cold, suggesting that OsEREBP1 protein level is mainly regulated by

post-translational modifications. Indeed, we observed that under high

salinity OsEREBP1 protein level increased due to both higher protein

synthesis and enhanced protein stability (Chapter 4). OsEREBP1

protein stability under salt stress may involve post-translational

modifications, namely phosphorylation and SUMOylation. The

described OsEREBP1 phosphorylation by OsBWMK1 prompted us

to determine the MAPK kinase activity under high salinity.

OsBWMK1 encodes three alternatively spliced transcripts,

OsBWMK1L, OsBWMK1M and OsBWMK1S, but only one

(OsBWMK1S) was shown to increase the transcript level under salt

stress. Therefore, the kinase activity of the OsBWMK1S encoded

protein was assessed, but no significant difference was detected

between control and salt stress treatments (Chapter 4). The kinase

activity of the protein forms encoded by the other OsBWMK1

transcripts should also be determined through in vitro kinase assays.

Additionally, to confirm whether the higher OsEREBP1 protein

stability is dependent on its phosphorylation state, we should perform

experiments with Arabidopsis protoplasts subjected to salt stress

treatments and over-expressing the TF mutated in the putative

phosphorylation sites. In silico studies showed that OsEREBP1 has a

putative SUMOylation site with high score. Given that protein

modification by SUMOylation was reported to increase protein

stability, we should test this modification by carrying out in vitro

SUMOylation assays with the wild-type (wt) protein and a protein

form mutated in the predicted SUMOylation site. The protein level of


196

both forms should be also analyzed through over-expression in

Arabidopsis protoplasts in control and salt stress conditions.

OsEREBP1 functional characterization was evaluated in

Arabidopsis plants over-expressing the TF (Chapter 4). OsEREBP1-

OX plants displayed enhanced sensitivity to salt stress during

germination, whereas no significant differences in root phenotype

and plant survival were detected at seedling stage. We propose here

that under high salinity this TF is mainly regulated by post-

translational modifications and that the effect observed during

germination partially results from a slight increase in ABA sensitivity.

The lack of a stress-related phenotype in OX-OsEREBP1 plants may

be due to the low protein levels (maintained through protein turnover)

under control conditions. The OsEREBP1 protein level should be

analyzed in transgenic vs wild type Arabidopsis plants. The

identification of putative ubiquitination sites in OsEREBP1 sequence

suggests that this protein is degraded through the proteasome.

Recently, at GPlantS, we have confirmed by yeast two-hybrid and

BiFC, that OsEREBP1 and OsEREBP2 interact with the rice E3

ubiquitin ligase OsHOS1 (data not shown). Degradation assays with

total protein extracts from rice wt and RNAi plants silencing

OsHOS1, revealed that OsEREBP1 and OsEREBP2 degradation

involves the proteasome. To complement these results, in vitro

ubiquitination assays should also be performed. Additionally,

OsEREBP1-OX and wt plants should be treated with MG132 to block

the proteasome for TF protein quantification by Western blot. To

further characterize the OsEREBP1 turnover modulated by salt

stress, studies involving ubiquitination and over-expression of a form

mutated in the predicted ubiquitination residues should be

conducted.

Chapter VI

197

Treatments of OsEREBP1-OX plants with ABA revealed that seed

germination is slightly affected by this hormone and seedling root

growth is more affected than wt. Because no difference in

OsEREBP1 transcript levels was detected in rice seedlings subjected

to ABA treatments (Chapter 2), we proposed that the regulation of

this TF is ABA-induced at post-translational level. Therefore, it would

be interesting to study the ABA role on OsEREBP1 protein synthesis

and stability. Arabidopsis protoplasts over-expressing OsEREBP1

and treated with ABA and cycloheximide should be analyzed. In

addition, Arabidopsis plants over-expressing different forms of the

OsEREBP1 protein (mutated in ubiquitination, phosphorylation or

SUMOylation sites, depending on previous results) and subjected to

ABA treatments could provide new insights regarding the TF role in

ABA responses.

OsEREBP1 function in drought stress responses is proposed to

vary with the plant developmental stage. Transgenic seedlings

showed enhanced root growth, whereas no different seedling

survival was observed after PEG-induced water deficit conditions.

Although PEG is considered to mimic the conditions imposed by soil

dehydration, survival studies in soil should be performed to truly

evaluate OsEREBP1 role in drought stress responses. The analysis

of the TF gene expression and protein levels at different stages of

rice development and with plants subjected to drought stress may

also provide new insights regarding the TF function.

To complement and confirm the results obtained in Arabidopsis,

further studies should be performed with OsEREBP1 mutants or rice

silencing/over-expressing lines. These plants should be analyzed

regarding their phenotype under high salinity, drought stress and

ABA treatments. In addition, a genome-wide transcriptional profile


198

analysis of these plants would allow the identification of OsEREBP1

target genes and further elucidate the TF function.

OsEREBP2 encodes a multifunctional protein putatively involved

in high salinity, ABA, drought and low temperature responses.

OsEREBP2 transcript levels transiently accumulated in rice plants

subjected to those abiotic stress conditions (Chapter 2). To further

investigate the function of OsEREBP2 in abiotic stress responses,

we generated Arabidopsis plants over-expressing this TF (Chapter

5). The transgenic plants displayed abnormal shoot and root

phenotypes and de-differentiated into callus-like tissues in hormone

free medium. The observed phenotype was proposed to be related to

abnormal responses to auxin and/or cytokinins. Additionally, we

observed deregulation of genes involved in very-long-chain fatty acid

synthesis and in the shoot apical meristem (SAM) maintenance and

function. These results indicated that OsEREBP2 is involved in plant

developmental processes. The abnormal phenotype hinders the

generation of homozygous plants and characterization under abiotic

stress conditions. This limitation could be overcome by having TF

expression driven by an inducible promoter such as a steroid-

inducible promoter. Those transgenic plants could then be subjected

to abiotic stress and hormone treatments for phenotypic evaluation.

Microscopic analysis of the SAM structure may provide further

insights into OsEREBP2 function in plant development. Additionally,

the levels of cytokinins and auxins should be measured in the

transgenic plants to confirm whether OsEREBP2 is affecting

hormone synthesis. To complement and confirm the obtained results,

studies with rice OsEREBP2 mutants or silencing/over-expressing

lines must be performed.

ERF proteins were initially characterized as regulators of ethylene

signal transduction pathways. Given that ethylene is a regulator of

Chapter VI

199

several processes in plant growth and development, it would also be

interesting to evaluate OsEREBP1 and OsEREBP2 gene expression

in response to ethylene.

Several ERF proteins have been implicated in biotic stress

responses due to their binding to the cis-element GCC box, which is

usually present in the promoter of pathogenesis-responsive genes.

The OsEREBP1 role in biotic stress responses was confirmed

through the observation that OsEREBP1-OX rice plants show

enhanced resistance to bacterial infection (Seo et al. 2011). The fact

that OsEREBP1 is regulated by OsBWMK1, involved in rice defense

responses, further supports the OsEREBP1 function in biotic stress

signaling pathways. OsEREBP2 showed an enhanced transcript

accumulation in rice plants treated with a functional analog of

salicylic acid (Shimono et al. 2007). Therefore, it was proposed to

have a role in biotic stress responses. OsRMC was previously

characterized as a negative regulator of jasmonic acid responses, a

hormone highly associated to biotic stress signaling. Therefore,

OsEREBP1 and OsEREBP2 may modulate the OsRMC gene

expression in response to biotic stress stimuli. The analysis of

OsEREBP1 and OsEREBP2 mutants or silencing lines should

provide new insights regarding this subject. The transcript profile of

these plants may also reveal new TF targets with a role in biotic

stress responses.

The study of the transcriptional network involved in abiotic stress

responses allowed the identification of candidate genes, potentially

useful in breeding programs. TFs are excellent candidates for the

generation of tolerant plants, mainly because they can modulate the

expression of a wide range of target genes and lead to the activation

of the mechanisms necessary for plant adaptation to stress

conditions. The identification and characterization of two ERF


200

proteins with a functional role in abiotic stress responses provides

new knowledge regarding rice transcriptional networks. Further

studies need to be performed to deeply depict the function of the

identified TFs. Nevertheless, they may be considered good

candidates for the generation of improved crops through

conventional molecular breeding and/or genetic engineering

approaches.

REFERENCES





e1002020




This work was supported by a PhD fellowship (Ref.

SFRH/BD/31011/2006) awarded to Tânia Serra and the research

projects POCI/BIA_BCM/56063/2004, PEst-OE/EBQ/LA0004/2011

and PTDC/BIA_BCM/099836/2008.

Documents

WORK PERFORMED AT - Universidade Nova de Lisboa Tania Serra.pdfstrong negative effect on rice production. High salinity severely affects rice growth and reduces grain yield, as it