Why is your hair the color that it is???teachers.stjohns.k12.fl.us/.../11.-Protein-Synthesis-2-Lecture-1.pdf · DNA -> RNA -> protein. •This idea was called the “central ... protein

• Why is your hair the color that it is???

Introduction

Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings

• George Beadle and Edward Tatum made Neurospora crassa famous. You know it as ____??

• Here’s what they did…



Fig. 17.1

• They came up with this saying: one gene - one enzyme.

• Why is this one better: one gene - one protein?

• Oops – how about this one: one gene - one polypeptide hypothesis?

• (But we are even going to change that).


• RNA is chemically similar to DNA, except

• 1.

• 2.

• 3.

Can I borrow your chocolate cake recipe?


2. The basic structural differences include:

i. DNA has deoxyribose (RNA has ribose).

ii. RNA contains uracil in lieu of thymine in

DNA.

iii. DNA is usually double stranded, RNA is

usually single stranded.

iv. The two DNA strands in double-stranded

DNA are antiparallel in directionality.

• DNA -> RNA -> protein.

• This idea was called the “central

dogma”.

• What is a “dogma”?

• As with many dogmas, we will

see later that this one will have

an exception or two.


•Let’s crunch some numbers and see what kind of code we have here.

3. In the genetic code, nucleotide triplets

specify amino acids


• Look at this simple diagram first.


Fig. 17.3

•So how many A’s, U’s,

C’s and G’s would it take

to code for a polypeptide

chain of 70 amino acids??


• Time for another race with a

Nobel Prize for the winner.

In the early 1960’s we have

revolution in America and in

biology.

• And the winner is…Marshall

Nirenberg . Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings

• By the mid-1960s the entire code was deciphered.

• Let’s look.

• See the start and stop?

• Is this code redundant?

• Ambiguous?

• Degenerate? ambiguous?


Fig. 17.4

Speaking of degenerate, here’s Brett,

Eman and Thomas at a pre-school

slumber party.

• One of the more

famous

pictures in biology.

4. The genetic code must have evolved very

early in the history of life


Fig. 17.5

• What does the picture imply about fireflies

and tobacco plants?

• We are more closely related to wart hogs

and fungi than we would like to think.


• This is similar to replication, so watch out.

1. Transcription is the DNA-directed

synthesis of RNA: a closer look


• Transcription

can be

separated

into three

stages:

initiation,

elongation,

and

termination.


Fig. 17.6a

1. The enzyme RNA-polymerase

reads the DNA molecule in the 3'

to 5' direction and synthesizes

complementary mRNA molecules

that determine the order of

amino acids in the polypeptide.

• What’s a TATA box, or a CAAT box, and a promotor?


Fig. 17.7

• Check out this one.


Fig. 17.6b

• Here’s another look.


../Animations/Transcription virtual cell.wmv

• Let’s do one of those theme things again:

• Take a minute and make a list in your notes:

• How many similarities between replication and

transcription can you name?

• How many differences?


And now for some vocab that is commonly

misused…

• Nucleic acid, nucleotide, base,

letter, amino acid, protein, and

gene are NOT synonyms.

• Differentiate, please.

• In the process of translation, a transfer RNA (tRNA) transfers amino acids from the cytoplasm’s pool to a ribosome.

• Where do the aa’s come from?

• Let’s watch this animation.

1. Translation is the RNA-directed making of a

polypeptide: protein synthesis


Fig. 17.12

http://www.youtube.com/watch?v=Ikq9AcBcohA&feature=related

• Look at tRNA. Codon? Anti-codon?

Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Fig. 17.13

• Surprise! tRNA picking up it’s amino acid involves the help of an enzyme.


Fig. 17.14

• Here’s what a ribosome looks like.

• What’s it made of???

• EPA???


Fig. 17.15a

• While very similar in structure and function,

prokaryotic and eukaryotic ribosomes have enough

differences that certain antibiotic drugs (like

tetracycline) can paralyze prokaryotic ribosomes

without inhibiting eukaryotic ribosomes.


• This is AP bio, right??

• E is for exit…


Fig. 17.15b &c

• It looks like it is the RNA in a ribosome that

holds the substrates in the right position.

• So all biological catalysts

are not proteins, some are

RNA. We will come back to

this later, it is big stuff.


Fig. 17.16

• Translation can be divided into three stages:

initiation

elongation

termination

• Notice these are the same names as in transcription. Same

concept – start making a polymer, make it longer, finish.

• Both initiation and chain elongation require energy (what

do we call such reactions?) provided by the hydrolysis of

GTP (not ATP this time).


3. Translation of the mRNA occurs in

the cytoplasm on the ribosome.

4. In prokaryotic organisms,

transcription is coupled to translation

of the message. Translation involves

energy and many steps, including

initiation, elongation and

termination.

• Initiation brings together mRNA, a tRNA with the first amino acid, and the two ribosomal subunits.

• Note the order of events.

Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Fig. 17.17

• Elongation is very repetitive.

• Can you describe it step by step?

• Note that amino acids are not being “made” or

“produced” by this process, so don’t explain it

that way.

• Your cells can make some amino acids (not all),

but during translation they are already in the

cell and are simply being joined to each other.

• Where did they come from???


• The mRNA is “read” in the 5’ to 3’ direction.

• Is this the same as the Little Train That Could?


• Here’s a diagram


Fig. 17.18

• Termination occurs when one of the three stop

codons reaches the A site.

• Note that another tRNA is not involved.


Fig. 17.19

• What’s a polyribosomes?

• Watch again


Fig. 17.20

http://vcell.ndsu.nodak.edu/animations/translation/movie.htm

Here’s an even more detailed animation/tutorial

for your viewing pleasure

• http://www.wiley.com/legacy/college/boyer/0470

003790/animations/animations.htm

• Link to Protein Synthesis

• Here’s one with neat graphics

• And now, a little ditty

http://www.wiley.com/legacy/college/boyer/0470003790/animations/animations.htm

http://www.wiley.com/legacy/college/boyer/0470003790/animations/animations.htm

../Animations/DNAi_translation_vo2-lg_wmv.zip

../Animations/Ribosome.mp3

i. The mRNA interacts with the rRNA of the

ribosome to initiate translation at the (start)

codon.

ii. The sequence of nucleotides on the mRNA

is read in triplets called codons.

iii. Each codon encodes a specific amino

acid, which can be deduced by using

a genetic code chart. Many amino acids have

more than one codon.

iv. tRNA brings the correct amino acid to

the correct place on the mRNA.

v. The amino acid is transferred to the

growing peptide chain.

vi. The process continues along the mRNA

until a “stop” codon is reached.

vii. The process terminates by release of

the newly synthesized peptide/protein.

Diagram each step of the translation of

the following mRNA transcript.

• ACCGUCAUGCCCACCGUGUGACACGCG

• Diagram EACH step (each time a new codon

moves into the ribosome).

• Include correctly paired codons and anti-

codons and amino acids.

• Label all significant parts (eg - A site) and

processes (eg - initiation).

• Although bacteria and eukaryotes carry out

transcription and translation in very similar ways,

they do have differences in cellular machinery and

in details of the processes.

• Watch here

4. Comparing protein synthesis in

prokaryotes and eukaryotes: a review


http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations.html

• Here’s something

bacteria cells can

do that yours and

mine can’t.

• Why can it do

this?


Fig. 17.22

• All this happens in the nucleus.

• At the 5’ end of the pre-mRNA molecule, a modified

form of guanine is added, the 5’ cap.

• This helps protect mRNA from hydrolytic enzymes.

• It also functions as an “attach here” signal for ribosomes.

2. Eukaryotic cells modify RNA after

transcription


• At the 3’ end, an enzyme adds 50 to 250 adenine

nucleotides, the poly(A) tail.

• In addition to inhibiting hydrolysis and facilitating

ribosome attachment, the poly(A) tail also seems to

facilitate the export of mRNA from the nucleus.


Fig. 17.8

• Now here’s a big difference between you and bacteria.

• Noncoding segments, introns, lie between coding

regions.

• Intron stands for “intervening”.

• The final mRNA transcript includes coding regions,

exons, that are translated into amino acid sequences,

plus the leader and trailer sequences.

• Exon stands for “expressed”.

• “Ex”, then, in this case, doesn’t mean it comes OUT.

The exons are the ones that stay in, the introns are the

ones that come out. Confusing, yes?



Fig. 17.9

• RNA splicing removes introns and joins exons to

create an mRNA molecule with a continuous

coding sequence. This is the RNA the ribosomes

“read”.

•A little molecular beast called a “spliceosome”

accomplishes this editing. Let’s watch:

•Look: at this then Watch here or here

• As with a ribosome, RNA, not proteins are

the catalyst in a spliceosome.


../Animations/mRNAProcessing virtual cell.wmv



../Animations/mRNASplicing virtual cell.wmv

• RNA splicing appears to have several functions.

• First, at least some introns contain sequences that control gene activity in some way.

• Splicing itself may regulate the passage of mRNA from the nucleus to the cytoplasm.

• One clear benefit of split genes is to enable one gene to encode for more than one polypeptide.

• Alternative RNA splicing gives rise to two or more different polypeptides, depending on which segments are treated as exons.

• Early results of the Human Genome Project indicate that this phenomenon may be common in humans, making that definition of a gene even tougher to nail down. The average transcript codes for 5.7 proteins.


2. In eukaryotic cells the mRNA

transcript undergoes a series of

enzyme regulated modifications.

• Addition of a poly-A tail

• Addition of a GTP cap

• Excision of introns

• What is a mutation?

• A point mutation? Gene mutation?

• Somatic mutation? Germ mutation?

5. Point mutations can affect protein

structure and function


• Here’s the classic example of a point mutation, specifically

a base-pair substitution. Watch here.


Fig. 17.23

../Animations/DNAi_sicklecell-lg.mov

• What would a silent mutation be?

• Missense mutations are those that still code for an amino acid but change the indicated amino acid. Sickle cell is a missense mutation.

• Nonsense mutations change an amino acid codon into a stop codon, nearly always leading to a nonfunctional protein.

• Which would be most likely to be lethal?


Fig. 17.24

Copyright © Pearson Education, Inc., publishing as Benjamin Cummings

• Insertions and deletions can cause frameshift

mutations.

• What would this mean, and what would it cause?



Fig. 17.24

• Mutations can occur in a number of ways.

• Errors can occur during DNA

replication, DNA repair, or DNA

recombination.


• Mutagens are chemical or physical agents that

interact with DNA to cause mutations.

• Can you name some specific ones?

• How do these relate to carcinogens?


Too much sun, as you know, can cause

the mutations that result in skin cancer.

Is all sunshine bad?

Not sure if staying out in the sun too

long is bad for you?

Check out what a thymine dimer or two

can do.

• The Mendelian concept of a gene views it as a

discrete unit of inheritance that affects phenotype.

• Morgan and his colleagues assigned genes to specific

loci on chromosomes.

• We can now view a gene as a specific nucleotide

sequence along a region of a DNA molecule.

• We can define a gene functionally as a DNA

sequence that codes for a specific polypeptide chain.

• Or is that not enough?

6. What is a gene? revisiting the question


• Even the one gene-one polypeptide definition must

be refined and applied selectively.

• Most eukaryotic genes contain large introns that have

no corresponding segments in polypeptides.

• Promotors and other regulatory regions of DNA are not

transcribed either, but they must be present for

transcription to occur.

• Our definition must also include the various types of

RNA that are not translated into polypeptides.

• Our best definition now is that a gene is a region

of DNA whose final product is either a polypeptide

or an RNA molecule. But wait! We’ll change that

too. Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings

A little song, you say??

• Check this out

• Or how about this one?

• Let’s review with some video. Shout out when

you recognize something.

../Animations/Central Dogma Zen.mp3

../Animations/ThankGodVideo.mp3

http://science-documentaries.com/?p=790

Documents

Why is your hair the color that it is???teachers.stjohns.k12.fl.us/.../11.-Protein-Synthesis-2-Lecture-1.pdf · DNA -> RNA -> protein. •This idea was called the “central ... protein