TRANSPLANTATION Stress-induced cholinergic signaling ...library.tasmc.org.il/ · Marjorie Pick, Chava Perry, Tsvee Lapidot, Cinthya Guimaraes-Sternberg, Elizabeth Naparstek, Varda

TRANSPLANTATION

Stress-induced cholinergic signaling promotes inflammation-associated thrombopoiesis

Marjorie Pick, Chava Perry, Tsvee Lapidot, Cinthya Guimaraes-Sternberg, Elizabeth

Naparstek, Varda Deutsch, and Hermona Soreq.

From the Departments of Hematology and Bone Marrow Transplantation, Tel Aviv Sourasky

Medical Center, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, 64239; The

Department of Biological Chemistry, The Institute of Life Sciences, The Hebrew University,

Jerusalem, 91904, and Department of Immunology, Weizmann Institute of Science, Rehovot,

76100, Israel.

Supported by grants from the EC Alternative Splicing Network of Excellence (LHS 2004-

.1.1.5-3 (H.S.), DIP-G 3.22 and the Israel Science fund (618-02) (H.S.) as well as US-Israel

Binational Science Foundation (1999/115) (H.S and C.P.) and the Deutsches

Krebsforschungszentrum (DKFZ) and the Israel Ministry of Science (MOS) (V.R.D.).

H.S. and V.R.D. designed the study. H.S. directed the study in Jerusalem and E.N. directed

the work at the Sourasky Medical Center. M.P., C.P. and C.S. performed the study, T.L.

contributed the bone marrow transplantation experiments.

M.P. and C.P. contributed equally to this study

Blood First Edition Paper, prepublished online December 27, 2005; DOI 10.1182/blood-2005-08-3240

Copyright © 2005 American Society of Hematology

PICK et al READTHROUGH ACETYLCHOLINESTERASE IN THROMBOPOIESIS

2

Reprints: Prof. Soreq, Department of Biological Chemistry, The Institute of Life Sciences,

The Hebrew University, Jerusalem 91904, Israel. Tel. 972-2-658-5109, Fax 972-2-652-0258,

e-mail: [email protected].

Total text word count: 5,253

Abstract word count: 202

mailto:[email protected]


3

Abstract

To study the role of the stress-induced “readthrough” acetylcholinesterase splice variant,

AChE-R, in thrombopoiesis, we utilized transgenic mice over-expressing human AChE-R

(TgR). Increased AChE hydrolytic activity in the peripheral blood of TgR mice was

associated with increased thrombopoietin levels and platelet counts. Bone marrow (BM)

progenitor cells from TgR mice presented an elevated capacity to produce mixed (GEMM)

and megakaryocytes (Mks) colonies, which showed intensified labeling of AChE-R and its

interacting proteins RACK1 and PKCε. When injected with bacterial lipopolysaccharide

(LPS), parent strain FVB/N mice, but not TgR mice, showed reduced platelet counts.

Therefore, we primed human CD34+ cells with the synthetic ARP26 peptide, derived from the

cleavable C-terminus of AChE-R prior to transplantation into sub-lethally irradiated

NOD/SCID mice. Engraftment of human cells (both CD45+ and CD41+ Mk) was significantly

increased in mice that received ARP26 primed CD34+ human cell mice that received fresh

non-primed CD34+ human cells. Moreover, ARP26 induced polyploidization and proplatelet

shedding in human MEG-01 promegakaryotic cells, and human platelet engraftment increased

following ex vivo expansion of ARP26-treated CD34+ cells as compared to cells expanded

with thrombopoietin and stem cell factor. Our findings implicate AChE-R in thrombopoietic

recovery, suggesting new therapeutic modalities for supporting platelet production.


4

Introduction

The number of circulating blood cells is tightly regulated by cytokines and chemokines

capable of immediate response to various stimuli, 1 Adjustment to changing needs involves

rapid mobilization of cells from the bone marrow (BM) and the vascular marginal pool in

response to inflammation, stress or injury.2 An example is inflammation-inducible

hematopoiesis, which was thoroughly studied in murine models using bacterial

lipopolysaccharide (LPS), the main cell wall component of gram-negative bacteria.3 LPS is an

endotoxin that stimulates an acute inflammatory response via the CD14 receptor and the Toll-

like receptor-4 (TLR4) found on monocytes and tissue macrophages.4 LPS-TLR4 interaction

initiates a signal transduction cascade that leads to the release of pro-inflammatory cytokines,3

including tumor necrosis factor (TNF)-α, interleukin (IL)-1β, -6 and -8, and others. These

cytokines activate the mobilization of hematopoietic cells from the BM 5 and set in motion the

migration of leukocytes from blood vessel walls, increasing their numbers in the circulation.6

The net result of this process is an immediate and dramatic increase in the number of

circulating peripheral blood (PB) cells, needed to mount the immune response, accompanied

by a corresponding decrease in BM cell numbers, which in turn induces a compensatory

increase in their production.7

Many factors are involved in abating the inflammatory response and allowing the recovery

of hemostasis. Acetylcholine (ACh), one of these factors, acts by attenuating the secretion of

pro-inflammatory cytokines at the post-transcriptional level via activation of nicotinic

receptors on tissue macrophages.8 Circulating acetylcholinesterase (AChE) controls the levels

of ACh, suggesting promotion of the inflammatory process under AChE excess.9 There are

three C-terminally variant forms of AChE, - Synaptic (S), Erythrocytic (E) and Readthrough

(R). All are ubiquitously expressed in hematopoietic cell lineages, especially in

megakaryocytes (Mks) and erythrocytes.10-12 Importantly, AChE contributes to hematopoiesis


5

processes. In rats, the fraction of AChE-positive BM cells increases following the induction

of thrombocytopenia. In both primary cell cultures and live mice, antisense suppression of

AChE gene expression modified Mks development.13,14

Platelet production is a self-regulated process. Thrombocytopenia, a reduction in platelets

stimulates the production of thrombopoietin (TPO) and promotes megakaryocytopoiesis.7 As

platelet counts return to normal, TPO is effectively cleared from the circulation. This involves

TPO binding to its receptor, c-mpl, and its uptake into platelets and Mk.1,15 TPO is the main

physiological growth factor for Mk proliferation, differentiation and platelet production.

Nevertheless, c-mpl-/- and TPO-/- knockout mice have a residual 10% of normally functioning

Mks and platelets. This cannot be attributed to interleukin (IL) -6, -11 and leukemia inhibitory

factor (LIF), which are also known to induce Mk differentiation.16-19 suggesting the

involvement of other factor(s) in Mks differentiation.20 Chemokine-mediated interactions of

Mk progenitors with sinusoidal BM endothelial cells (BMEC) have recently been shown to

promote TPO-independent platelet production, supporting this notion.2

Pancytopenia and prolonged thrombocytopenia remain significant clinical problems for

patients undergoing BM transplantation. Engraftment of transplanted BM is usually

accomplished within 2 to 3 weeks, during which period the patient is susceptible to life-

threatening infections and bleeding. Platelet recovery after autologous stem cells or cord

blood (CB) transplantation is significantly delayed (up to 6 weeks post transplant) and is

attributable to insufficient Mk precursors in the grafts21,22 rather than low TPO levels.23,24

Based on our previous findings that the stress-induced AChE-R variant and its cleavable

C-terminal peptide, ARP, stimulate the proliferation of CD34+ hematopoietic progenitor

cells.12 We hypothesized that AChE-R and/or ARP may facilitate the proliferation and

differentiation of Mk and subsequent platelet production, following stress and in BM

transplantation. We therefore compared the baseline hematopoiesis, and responses to low


6

doses of LPS in TgR transgenic mice expressing human AChE-R to those of the age-matched

FVB/N parent strain mice. To explore the possibility that the thrombopoietic effects of AChE-

R involved ARP, we further tested the effect of synthetic ARP26 on human MEG-01

promegakaryocytic cells and on the post-transplantation recovery of blood cells and platelets

in sub-lethally irradiated NOD/SCID mice. Our findings support the notion that AChE-R and

ARP play pivotal roles in hematopoiesis and thrombopoiesis and propose a potential new

strategy and possible future use of ARP26 for improving post-engraftment thrombopoiesis.


7

Methods:

Animal models:

The animal ethics committees of The Hebrew University (approval no. NS-02-29 -

molecular and cellular biology of long term stress response) and The Weizmann Institute of

Science approved the use of animals in this study.

Transgenic mice: TgR mice expressing human (h)AChE-R were generated by injecting a

DNA construct including the proximal CMV promoter-enhancer followed by exons 2, 3, 4,

pseudointron 4’, exon 5 of the human ACHE gene (accession No. M55040) and an SV40

polyadenylation signal.25 into fertilized eggs of FVB/N mice. This transgene presented

unimpaired Mendelian inheritance over 5 generations.26 Strain and age-matched FVB/N mice

served as controls.

To generate inflammatory reaction, 5 µg LPS of E. coli origin (Sigma, St Louis, Mi) was

injected intraperitoneally (IP) in 400 µl of phosphate buffered saline (PBS, Biological

Industries, Beth Haemek, Israel).

NOD/SCID mice: Non-obese diabetic SCID (NOD/SCID) mice were maintained under

defined flora conditions in the animal facility at the Weizmann Institute (Rehovot, Israel) in

sterile intra-ventilated cages (IVC; Techniplast, Buguggiate, Italy). Mice were sub-lethally

irradiated with 375 cGy at 67 cGy/min from a 60Co source. 24 hrs later, they were injected

with 100,000 human cord blood (CB) CD34+ cells by intravenous injection in 400 µl of Hank

Balanced Salt solution (HBSS, Biological Industries). Mice were sacrificed between 2 and 6

weeks post transplantation. Samples of peripheral blood (PB, orbital bleed) and BM (femur

bone) were removed and human engraftment assessed.

Human Cell Sources: All human material used in this study was approved by the Hospital

Human Experimentation Ethics Committee of the Tel-Aviv Sourasky Medical Center in


8

accordance with the Helsinki accords. All participants gave written informed consent to

partake in the study. Cord blood (CB) cells were retrieved from human umbilical cords of

newborns of uncomplicated full-term pregnancies as described,12 in anticoagulant citrate

dextrose solution formula A-supplemented bags (Baxter, Deerfield, IL). Mononuclear cells

(MNCs) were separated using a two-step technique.27 CD34+ stem cells were purified using a

CD34+ progenitor cell isolation kit (PE, Miltenyi Biotec GmbH, Gladbach, Germany)

according to the manufacturer’s instructions.

MEG-01 cells were maintained in Iscove's Minimal Dulbecco's Medium (IMDM,

Biological Industries), supplemented with 10% horse serum.28 For experiments cells were

plated at a density of 1x106 cells/ml in 6-well plates (Nalge Nunc International), incubated

with the noted agents for 18 hours, fixed with fresh 4% paraformadehyde in phosphate PBS

(phosphate buffer 01 M; pH7.4 and 0,9% NaCl) for 1 hour and resuspended in PBS and kept

at 4°C till staining.

RT-PCR analyses: Total BM RNA was purified (RNeasy kit, Qiagen, Hilden, Germany),

and treated with DNase I (Qiagen) according to the manufacturer's protocols. Reverse

transcription (RT) involved 400ng RNA, 1 µM of each dNTP (Sigma), 10 µM DTT (Sigma),

2 µl RT buffer x5 (Sigma), 2.5 µM random hexamers (1U/µl, Sigma), 40U in 1 µl of RNase

inhibitor (Roche Molecular Biochemicals, Indianapolis, IN), 2.5 U/µl of SuperscriptTM

reverse transcriptase (Sigma) and DDW to make a total volume of 10 µl. RT was for 45’ at

420C, 5’ at 900C. Polymerase chain reaction (PCR) was performed as previously described

using selective primers for AChE-R.11 Briefly, 4 µl of PCR buffer x10 (Sigma), 2,5 µl of each

primer (10mM, Sigma), 0.5 µl TAQ polymerase (Sigma) and DDW to a final volume of 40µl

were added to the RT product. β-actin was used as a standard housekeeping transcript.


9

Acetylthiocholine (AThCh) hydrolyzing activity: Mouse plasma samples were separated

from the nucleated cell fraction by centrifugation at 4300 rpm (2000 x g, 20 min), sterilized

through a 0.2µm pore size filter and stored in aliquots at -700C until use. BM cells were

washed with PBS (Sigma) and re-suspended in low salt detergent buffer (300 mM NaCl,

0.5% Triton X-100, 50 mM Tris HCl, pH 7.6), containing a protease inhibitor cocktail (Roche

Molecular Biochemicals). AThCh activity was measured as previously described.29

Progenitor colony assays:

GEMM-and GM-CFU: mouse BM MNC cells were cultured at 2 x 105 cells per 35mm tissue

culture dish (Corning Inc., NY) in IMDM (Biological Industries) supplemented with 0.8%

methylcellulose (Sigma-Aldrich Corp., St. Louis, MO), 10% fetal calf serum (FCS, Biological

Industries) and 5 x 10-4 M 2-beta-mercaptoethanol (2-ME) (Sigma), 5 ng/mL recombinant

murine-granulocyte macrophage - colony stimulating factor (rmu-GM-CSF, R & D Systems

Inc., Minneapolis, Mn), 10 ng/mL rmu - stem cell factor (rmu-SCF, R & D), 3U/mL rhu-

erythropoietin (rhu-EPO, R & D) and rmu-Interleukin-3 (rmu-IL-3, R & D) in 5% CO2 at

37°C. Colonies of more than 40 cells were counted at day 10. Colonies containing red cells

and heterogenous cell sizes were counted as GEMM-CFU while colonies containing only

white cells and more homogenous in cell size were counted as GM-CFU.

CFU-Mk: 2 x 105 BM MNC cells per 35 mm dish were cultured in McCoy’s Medium

(Biological Industries) supplemented with 0.3% agar (Difco, MI), 10% FCS and 10-4 M 2-

ME, 2 ng/mL rmu- thrombopoietin (rmu-TPO, R & D) and 10 ng/mL rmu-SCF in 5% CO2 at

37°C for 10 days. For AChE activity staining, plates were placed into an oven for 2 hrs at

45°C with Whatmann No.1 filter paper discs carefully placed over the agar layer. The filter

paper was then gently removed and plates incubated with AChE substrate (10 mg

acetylthiocholine (AThCh) iodide dissolved in 15 mL of 0.1M dibasic sodium phosphate,


10

1mL of 0.5 M sodium citrate, 2 mL 30 mM cupric sulfate and 2 ml 5 mM potassium

ferricyanide) for up to 24 hrs at room temperature or until colonies turned brown in color.

Quantification of cytokine levels: Mouse TPO, EPO, Tumor necrosis factor-alpha (TNF-α)

and IL-6 levels in plasma of TgR and FVB/N mice were determined using Quantikine murine

enzyme-linked immunosorbent assay (ELISA) kits (R&D), according to the manufacture’s

instructions.

Immunohistochemistry: BM cell smears were fixed for 15’ with methanol, washed x3 with

PBS and then x3 with 100mM glycine to quench auto-fluorescence. Blocking buffer included

1% donkey serum (Santa Cruz Biotechnology Inc., Santa Cruz, Ca), or 1% goat serum (Santa

Cruz) for 30 min at room temperature. Antibodies against human AChE-R (Rabbit, 0.6

ug/slide),30 PKC ε (mouse, 0.5 ug/slide) (BD Biosciences, Paola Alto, CA) and RACK1

(mouse, 0.25 ug/slide) (BD Biosciences) were incubated for 60’ with blocking buffer. TBST

(Tris buffered saline with 0.2 % Tween 20) was used to wash slides after each antibody

incubation. For detection, biotin-SP-conjugated affiniPure goat anti mouse IgM or donkey

anti rabbit IgG (1:200, Jackson ImunoResearch laboratories Inc., West Grove, PN) and Cy3TM

conjugated streptavidin (1:200, Jackson) were each incubated for 30 min at room temperature.

May-Grünwald staining was performed to morphologically identify Mks.

25 µl samples of the MEG-01 cell suspension were placed on 18mm coverslips coated with

poly-L-ornithine and allowed to dry at room temperature. Briefly, paraformaldehyde-fixed

cells were incubated with 3% H2O2 in PBS for 30 min, followed by a PBS wash, incubation

with a blocking buffer containing 5% BSA, 0,8% Triton X-100 in PBS (1 hr at room

temperature). Primary antibodies; polyclonal ant-activated caspase-3 (Cell Signaling

Technology Inc.), Anti-ARP30, or SC3531 (BD Biosciences) were incubated overnight at 40C.


11

Detection was performed with the use of horse raddish peroxidase-ABC kit (Vectastain,

Vector Labs).

Cell cycle analysis: 2 x 106 MEG-01 cells were fixed in 100% ethanol at 4°C overnight,

washed twice in 0.5% bovine serum albumin (BSA) in PBS, resuspended in 1 mL of staining

solution (PBS containing 0.05 mg/mL propidium iodide, and 1 mg/mL RNAse) and incubated

at 37°C for 30 minutes. DNA content was analyzed using a FACS Calibur flow cytometer and

CellQuest software (BD Biosciences).

TUNEL staining: In situ nick-end labeling of fragmented DNA (TUNEL) was performed

using a DeadEnd kit (Promega). MEG-01 cell counts were determined on a Zeiss Axiophot

microscope, using a magnification of 400x. The results are expressed as the average ± SEM

of the percentage of positive cells in four independent fields in the same coverslip (n= at least

100 cells/ field).

Microscopy:

Scanning electron: MEG-01 cells were washed in PBS, fixed with 2.5% glutaraldehyde in

0.1 M sodium cacodylate buffer (pH 7.2) for 1 hour at room temperature, post-fixed for

30 min in 1% OsO4 in 0.1 M sodium cacodylate buffer (pH 7.2), dehydrated in ethanol and

then critical-point-dried using CO2. Samples were sputter-coated with gold and analyzed with

a JEOL 5800 scanning electron microscope.

Transmission electron: MEG-01 cells were fixed for 1 hour in 2.5% glutaraldehyde in 0.1 M

sodium cacodylate buffer (pH 7.2) at room temperature. Cells were then washed in PBS,

pelleted and post-fixed for 1 hour in 1% OsO4 in 0.1 M sodium cacodylate buffer plus 5 mM

CaCl2 and 0.8% potassium ferricyanide at room temperature. The cells were then dehydrated


12

in acetone and embedded in Epon. Ultra-thin sections were stained with uranyl acetate and

lead citrate and analyzed with a Jeol 1210 electron microscope.

Expansion and priming cultures: For cell priming experiments, 100,000 fresh CB CD34+

cells were supplemented with 2nM of peptide, ARP26 (2 nM, synthetic peptide with the

AChE-R C-terminal sequence),12 ASP43 (2nM synthetic peptide with the AChE-S C-terminal

sequence),12 or no supplement for 2 hours and injected into mice without washing. For cell

cultures, CB CD34+ cells were expanded in liquid cultures in the presence of one of the

following growth supplements: ARP26, ASP43, rhu-TPO (1 ng/mL) (R & D) together with

rhu-SCF (50 ng/mL; Genzyme Diagnostic, Cambridge, MA, USA) or no supplement

(control). Liquid cultures were initiated and maintained in 24-well tissue culture plates (1 x

105 cells/well in 1 mL). Cells were grown for 10 days at 37°C in 5% CO2 in a fully

humidified atmosphere in IMDM supplemented with 5% autologous CB plasma. At 3-day

intervals, cultures were supplemented with the same growth factor(s) and cells were counted

by trypan blue exclusion and diluted to maintain cultures at concentrations no higher then

100,000 cells/mL.32 Cultured cells were injected into NOD/SCID mice at a concentration of

100,000 or -200,000 together with 100,000 unexpanded fresh CD34+ cells per mouse as

indicated.

Detection of human cells engraftment in NOD/SCID mice: NOD/SCID mice were

sacrificed 2 to 6 weeks post-transplantation and PB and BM were analyzed following lysis of

mature RBCs with FACS lysis buffer (BD Bioscience). 5x106 cells were incubated with

human antibodies anti-CD41a-FITC (Beckman/Coulter, Fullerton, CA), anti-CD34-PE (BD

Bioscience) and anti-CD45 PerCP (BD Bioscience) (30 min, 4°C). To follow human platelet


13

engraftment, PB of NOD/SCID mice was stained with anti-human CD41a-FITC and anti-

mouse CD41a-PE (BD Bioscience), and a specific platelet gate was placed at acquisition.

At least 500,000 events per sample were acquired with a BD FACS Calibur (BD

Bioscience). Data analysis used Cell Quest and Cell Quest Pro software (BD Bioscience).

Matched isotype controls for all antibodies were used to detect background fluorescence

(supplied by Caltag and BD Bioscience). All human antibodies were pre-tested on naïve-

untransplanted mice to test for any cross-reactivity.

To detect human-originated cells, BM DNA was extracted (QIAprep Spin Miniprep Kit,

Qiagen) according to manufacturer instructions. DNA samples (100 ng, 2 µl) were incubated,

according to instructions of Roche, the manufacturer, in 10 µl containing 1µl Light CyclerTM

DNA master hybridization probe (Roche Molecular Biochemicals), 1 µl primers (5 µM sense

and 5 µM antisense), 1 µl probes (5 µM anchor and 5 µM sensor), 1.2 µl MgCl2 (3mM) and

nuclease-free water. Primer and probe sequences used to detect human and mouse TNFα are

listed in Table 1.33 PCR involved 45 cycles (95°C for 10 sec, 65°C for 7 sec and at 72°C for

20 sec). Standard curves were generated by mixing mononuclear cells (MNCs) from human

CB together with mouse BM, total number of cells being 5x106 per concentration with

mixtures of 0, 0.5, 1, 2, 5, 10, 20, 40, 60, 80 and 100% human cells. The human probe and

primer were found negative in naïve mice33 and used to detect amounts of human DNA in the

transplanted NOD/SCID mice.


14

Results

AChE-R over-expression in bone marrow and blood cells

In brain neurons, a stress-induced switch from production of AChE-S to the -R variant

elevates soluble AChE-R levels29,34 through the function of the splicing factor protein SC35.31

We hypothesized that this shift, which also occurs in blood cells,9 may reduce the control over

pro-inflammatory cytokine production by circulating ACh and the nicotinic α7 AChR.35 This

would predictably initiate progenitor cell expansion12 (Figure 1A). We utilized the TgR

transgenic mice expressing hAChE-R as a model of a chronic splicing shift towards AChE-R.

RT-PCR analysis detected human AChE-R mRNA in the BM of TgR mice, but not in strain-

matched FVB/N mice or in the TgS mice over-expressing the hAChE-S variant (Figure 1B).

AChE-R excess is associated with elevated basal and post-stress platelet counts

Basal levels of red and white blood cell counts (RBC, WBC) were similar in both TgR and

FVB/N mice (Figure 2A-B). In contrast, platelet counts were significantly higher in TgR mice

(894 ± 87 Vs 1051 ± 160 x 109/mL, Student’s t test, p < 0.001, n = 25, Figure 2C). Manual

differential counts of WBC sub-populations showed similar distributions into granulocytes,

monocytes and lymphocytes in TgR and FVB/N mice (Figure 2D), reflecting selective

thrombocytosis under chronic AChE-R overexpression.

To study the relevance of AChE-R for regulating the changes in blood cell numbers in

response to acute inflammation, LPS was injected intra-peritoneally (IP). RBC counts

predictably36-38 dropped up to 72 hrs post-LPS in control FVB/N but not TgR mice (Figure

2A). WBC dropped in both strains, but cell counts recovered considerably faster in TgR mice,

reaching significantly higher levels than those of FVB/N control mice by 72 hr post LPS

injection (p < 0.02, n = 10, Figure 2B and D). Platelet counts in FVB/N control mice dropped

significantly, as expected, to thrombocytopenic levels between 24 and 72 hrs. In contrast,


15

platelet counts in TgR mice were only slightly reduced and returned to normal values within

72 hrs (p < 0.001, n = 10, Figure 2C).

AChE-R over-expression modulates TPO and inflammatory cytokine levels

To further study our observation of elevated platelet counts in TgR mice, TPO concentrations

were measured in the plasma and BM cell extracts from TgR and FVB/N mice. Values were

significantly higher in both BM and plasma from TgR mice (p = 0.013, 0.04 respectively,

compared to FVB/N control mice (Figure 3A)), suggesting that these mice can serve as a

model of chronic inflammation.38-40 TPO levels in the TgR bone marrow increased by 24 hrs

post-LPS injection (p = 0.002), followed by a decline towards 72 hrs (p = 0.02, n = 10, Figure

3A). Both changes were larger than those occurring in FVB/N mice. In plasma, the initially

high basal TPO levels of TgR mice were maintained 24 hrs post-LPS (p = 0.01, n = 10).

However, at this time point, plasma TPO levels of FVB/N mice rose to significantly higher

values than those of TgR mice, possibly due to the corresponding dramatic drop in platelet

numbers (Figure 2C). At 72 hrs, TPO levels decreased slightly but remained higher than

normal in both mouse strains (Figure 3B).

AChE-R excess associates with higher pro-inflammatory cytokine levels

To study the possible effects of AChE-R on inflammatory reactions, we measured the levels

of pro-inflammatory cytokines in plasma and BM extracts from TgR and FVB/N mice. Both

AChE activity and interleukin (IL)-6, but not tumor necrosis factor (TNF)-α, levels were

significantly higher in the plasma of TgR mice as compared with FVB/N controls (Figure 2A

and B).

Two hrs post-LPS, TgR mice showed significantly higher levels of TNFα in plasma

(834±231 pg/mL, p< 0.04, n = 10) but significantly lower levels in BM, as compared to


16

FVB/N mice (120±66Vs 334±81, p< 0.01, n = 10, Table 2A), possibly because the main

production of TNFα occurs in peripheral blood. hAChE-R expression was accompanied by

elevated levels of catalytically active AChE and the pro-inflammatory cytokine interleukin

(IL)-6 in the serum of TgR as compared with strain and age-matched FVB/N parent strain

mice (Figure 1C) compatible with our initial hypothesis. In contrast, IL-6 levels were

comparable in TgR and FVB/N mice after LPS injection (Table 2A,B), compatible with the

notion of a pre-existing active inflammatory state in the TgR strain.

TgR mice responded to LPS injections by a further significant increase of BM AChE

catalytic activity, higher than their initially high baseline activity (Table 2A,B). This occurred

24 hrs post LPS injection (p = 0.0004, n = 10), but not at other time points.

Enhanced proliferative potential in TgR bone marrow progenitors

The proliferative potential of BM progenitor cells was evaluated by clonogenic assays using

growth factors to support the development of the specific hematopoietic lineages. Colonies

were classified as colony forming units (CFU)-Mk, CFU-granulocyte/macrophage (GM) or

CFU-granulocyte/erythrocyte/monocyte/Mk (GEMM) and were counted 10 to 14 days after

plating. TgR mice showed significantly higher baseline numbers of CFU-Mk, -GM and -

GEMM hematopoietic progenitor cells as compared to FVB/N controls (p ≤ 0.003, n = 12,

Figure 4). Following LPS injection, TgR mice maintained significantly higher number of Mk

progenitors (p < 0.0002, n = 12, Figure 4A). In FVB/N mice, the number of CFU-GM, was

predictably elevated at 24 hr post-LPS36,37 (p = 0.01, n = 12, Figure 4B) but decreased

noticeably by 48 hr. In contrast, TgR CFU-GM numbers decreased 48 hr post LPS yet

remained higher than those of FVB/N controls (p = 0.03, n =12, Figure 4B). The more modest

increase in TgR CFU-GM colonies could, perhaps, be due to the chronic exposure to AChE-

R, continuously exploiting the proliferative potential of myeloid progenitor cells. Post-LPS,


17

the numbers of multipotential, CFU-GEMM colonies were similar in TgR and FVB/N mice

(NS, n = 12, Figure 4C).

AChE-R over-expression associates with elevated megakaryocytic PKCε

AChE-R was reported to interact with the scaffold protein RACK1 and with its target

proteins, protein kinase C βII (PKC βII)41 or PKC ε42 PKC ε has been implicated in the

programming of megakaryocytic lineage commitment and potentiates the transcription factor

GATA-1.43 To study a potential AChE-R/ PKCε/ RACK1 interaction in Mks, we labeled

AChE-R, PKCε and RACK1 in BM smears from TgR and FVB/N mice (Figure 5).

TgR Mks, detected in BM smears by the May-Grünwald staining (Figure 5A), predictably

expressed higher AChE-R labeling then Mks from FVB/N mice (212.3±15.0 Vs 130.9±18.3

luminescence units, p < 10-11, n = 50, Figure 5B, F and Table 3). Intriguingly, RACK1

labeling intensity was discernibly, although insignificantly elevated in TgR Mks, as compared

to FVB/N mice (162.3±49.2 Vs 153.4±21.0, NS, n = 50, Figure 5C, F and Table 3). No

differences in the number of PKC ε − labeled Mks were detected in TgR mice (data no

shown); nevertheless, the intensity of PKC ε labeling was significantly higher as compared to

FVB/N mice (187.7±22.2 Vs 160.9±19.7 luminescence units, p < 10-5, n = 50, Figure 5D, F

and Table 3). Thus, AChE-R interaction with RACK1 and with PKCε (Figure 5E) emerged

as a putative mechanism for increased intracellular signaling in TgR Mks, compatible with

our previous findings in glioblastoma cells42 and MEG-01 cells. 28

ARP26 promotes pre-platelet formation and polyploidization in human MEG-01

promegakaryocytic cells

AChE-R is C-terminally cleaved to yield a free peptide, ARP. In human CD34+ progenitors, a

synthetic version of this peptide, ARP26, promotes megakaryocytopoiesis 12 and elevates


18

endogenous AChE gene expression. 44 To more deeply explore thess effects, we incubated a

promegakaryocytic cell line MEG01 with increasing doses of ARP26 and used

immunolabeling to follow the consequences. ARP26 increased the splice factor SC35, which

predictably led to a shift from AChE-S to AChE-R mRNA 45 with a plateau at 2 nM ARP26

(Figure 6A1). Within 24 hr, scanning electron microscopy revealed the appearance of

demarcation membranes and the initiation of shedding events resembling platelet formation in

ARP26-treated cells (Figure 6A2 and 3). TUNEL analysis excluded the possibility of cell

death and transmission electron microscopy demonstrated that treated cells contained

apparently intact nuclei and mitochondria, and highlighted thin peripheral extensions about to

demarcate (Figure 6B1-3). Importantly, ARP treatment further initiated nuclear

polyploidization in treated cells while increasing caspase3 activation, (Figure 6C1-3), known

to associate with megakaryocytopoiesis.28 These experiments suggested relevance of AChE-R

in human cells as well.

AChE-R potentiates engraftment potential in NOD/SCID mice

Next, we wished to determine whether AChE-R and/or ARP26 could improve engraftment of

transplanted BM cells and recovery from thrombocytopenia in a NOD/SCID mouse

transplantation model. Human CB CD34+ cells were primed for 2 hrs prior to injection with

ARP26, a synthetic peptide comprised of 26 amino acids of the C-terminal sequence of AChE-

R, 44 or ASP43, a 43 amino acid sequence derived from the C terminus of AChE-S.46 At 2nM,

the optimal concentration for stimulating hematopoietic stem cell proliferation, 47 human CB

CD34+ cells (1 x 105) were injected into NOD/SCID mice irradiated 24 hours earlier. Cells

were either primed and supplemented with ARP26 or primed and supplemented with ASP43.

Untreated cells served as controls. Mice were sacrificed 6 weeks post-transplantation and

single BM cell suspensions extracted from the femur bones were assessed for the presence of


19

human hematopoietic cells. Monoclonal antibodies against human CD45, CD34 and CD41

were used to assess engraftment efficacy of the transplanted human cells. Fractions of human

CD34+ cells in the post-transplant BM of NOD/SCID mice were similar in all groups (Figure

7A). However, significantly more human CD45+ cells were found in the BM of NOD/SCID

mice that were injected with ARP26 together with ARP26-primed CD34+ cells (p = 0.02, n =

12, 16 and 8 mice, respectively, Figure 7A). Fractions of human Mks (CD41+) were higher in

the BM of NOD/SCID mice that received ARP26- primed cells as compared with ASP43 -

primed or non-primed human cells (p = 0.03, n = 12, 16 and 8 mice, respectively, Figure 7A).

These results demonstrate a significantly better engraftment of transplanted ARP26-primed

human CD34+ cells, when injected with ARP26, as compared with non-ARP26 treated cells.

Quantitative PCR with human specific probes was used to assess the relative presence of

human DNA in the BM of NOD/SCID mice. Significant differences could be observed

between mice transplanted with ARP26- primed CD34+ cells as compared to cells primed with

ASP43 or non-primed cells (p = 0.015, Figure 7B). This suggested that the increased

engrafment reflected sustained presence of more nucleated cells of human origin.

Increased human platelet production in NOD/SCID mice transplanted with ARP26-

expanded cells CD34+ cells are known to differentiate in culture, producing many committed

progenitors, but have limited capacity for long-term engraftment in NOD/SCID mice.

Therefore, freshly isolated CD34+ cells are needed to enable long-term engraftment.48,49 On

the other hand, differentiated blood cells can be a better source for platelets. To explore

ARP26 effects on platelet recovery in NOD/SCID mice, we therefore attempted to ex vivo

expand committed Mk progenitor cells in the stem cell graft prior to transplantation. CD34+

cells were incubated for 10 days in medium supplemented with 10% plasma and 2nM ARP26,

2nM ASP43, or TPO (10 ng/ml) and SCF (50 ng) (growth factors optimal for Mk


20

commitment). Cells with no growth factor supplement served as control. The cultured, more

mature CD34+ cells (between 1-2 x 105) were injected, aiming to facilitate early platelet

production, together with 100,000 fresh CB CD34+ cells, used to maintain long-term

engraftment. Early platelet engraftment (2-3 weeks post transplant) and late platelet

engraftment (4- and 6 weeks post-transplant) were analyzed. Incubating CD34+ cells with

ARP26, ASP43 or TPO and SCF did not augment engraftment of human CD45+, CD34+ or

CD41+ cells (data not shown). However, the expansion enabled us to test the effect on platelet

production from the injected differentiated cells. Full blood cell counts were performed on the

transplanted NOD/SCID mice and the presence of human platelets was monitored using

platelet-specific human antibodies and flow cytometry. In NOD/SCID mice that received cells

expanded with ARP26, as compared with control cells we observed a trend toward higher

human platelet numbers, both early (between 2 and 3 weeks) and late (4-6 weeks) post-

engraftment. Importantly, platelet counts were significantly higher in ARP26 - expanded as

compared with ASP43 expanded cells, (mean, 1.27 x 106/ml control Vs 2.87 x 106/ml ARP26

expanded Vs 0.96 x 106/ml ASP43 expanded Vs 1.57 x 106/ml TPO/SCF expanded group,

P<0.05 significantly higher human platelet numbers engrafted in mice transplanted with

ARP26 expanded cells, Figure 7C) and at the late transplanted stage (mean, 5.09 x 106/ml

control Vs 22.03 x 106/ml ARP26 expanded Vs 5.42 x 106/ml ASP43 expanded Vs 3.29 x

106/ml TPO/SCF expanded group, p < 0.05 significantly higher human platelet numbers

present in the peripheral blood of transplanted mice, Figure 7B). These observations were

compatible with the hypothesis that the injected differentiated Mks facilitated platelet

production in the engrafted mice and that the enhanced AChE-R production by these cells

supported a shift towards megakaryocytopoiesis which culminated in higher platelet counts at

the later test time.


21

Discussion

To explore the putative contribution of cholinergic signaling to mammalian

thrombopoiesis, we combined the TgR transgenic mouse model with inflammatory response

analyses and BM engraftment studies. Our findings demonstrate increased thrombopoiesis in

response to increased production of the stress-induced AChE-R protein and attribute part of

the thrombopoietic process to ARP, the cleavable C-terminal peptide of AChE-R and its

interaction with the scaffold protein RACK1 and PKCε. This allowed us to extend the

concept of what has been defined by others as “The inflammatory reflex”35 to the realm of

thrombopoiesis, further supporting the notion of ex vivo augmentation for facilitating post-

transplantation thrombopoiesis.

The kidneys and the liver both produce thrombopoietin (TPO), the plasma levels of which

are regulated through receptor-mediated uptake, internalization and catabolism by Mk and

platelets.50 TPO levels are tightly controlled under normal conditions, and increase only when

Mk and platelet production is needed. TPO levels are higher than normal in patients with

reactive thrombocytosis (high platelet counts)51,52, for example in patients with acute bleeding

or with acute or chronic inflammation.51,52 Thrombocytosis associated with chronic

inflammatory conditions is related to increases in IL-6 levels.39 TPO mRNA and protein

levels increased following IL-6 administration to mice, and in cancer patients receiving IL-

6.53 However, IL-6 treatment failed to increase megakaryopoiesis in vitro and in vivo.19

The involvement of AChE-R and its C-terminal peptide, ARP in thrombopoiesis is

relatively subtle as compared with that of TPO. AChE-R is expressed in Mks10-12 and

promotes Mk proliferation in vitro.47 While the C-termini of mouse and human AChE-R share

very little sequence homology, murine AChE-R cross-reacts with anti-human ARP antibodies

and hAChE-R affects murine neuronal progenitors.54,55 In our current study we found a

significant increase in TPO levels as well as higher platelet counts in TgR mice over-


22

expressing the stress-induced AChE-R splice variant, as compared to the strain matched

FVB/N mice. LPS administration induced a rapid fall in platelet counts in both TgR and

FVB/N control mice. We found platelet recovery to be considerably faster in TgR mice than

in their strain-matched controls. Moreover, TgR mice showed faster WBC recovery than

controls following LPS-induced inflammation and maintained normal RBC values while

control FVB/N mice became pancytopenic for at least 72 hrs post-LPS injection. These

differences could be attributed to the augmented capacity of TgR BM progenitors to

proliferate and differentiate into pluripotent CFU-GEMM, CFU-GM, and CFU-Mk. The LPS-

induced fall in RBC counts can probably be attributed to enhanced degradation (due to

decreased deformability and increased osmotic fragility), consumption into micro-aggregates

and reduced production (under bone marrow suppression of erythropoietin levels.56,57. The

rapid leukocytes decrease is likely due to tissue migration 5,58. Together, these observations

support the notion that AChE-R plays an active role in the proliferation of hematopoietic

progenitors, especially Mks, without compromising their ability to differentiate into the

various hematopoietic lineages.

Our findings highlight the AChE-R effect as a bimodal one. Extracellularly, it predictably

reduces ACh levels, that way facilitating the production of pro-inflammatory cytokines with

growth factor capacities in response to inflammatory signals; intracellularly, it interacts with

partner signaling proteins, promoting cell proliferation in yet another pathway. The AChE-R

partner protein RACK1 binds to PKC ε.42 PKC ε was shown to induce megakaryocytic

differentiation in HEL and K562 cells 43 in primary human hematopoietic stem cells.59,60

Moreover, TPO increases PKC ε expression in mouse Mks,61 whereas blocking PKC

activation inhibits platelet formation 62and suppresses megakaryocytopoiesis in MEG01

cells.28 Thus, the elevated levels of AChE-R and PKC ε in Mks from TgR mice as well as the

higher plasma TPO levels in these mice supports the notion of a cholinergic promotion of


23

thrombopoietic signal transduction both through the hydrolytic and the non-enzymatic

features of AChE-R, involving two signaling pathways.

Lack of proliferating Mk progenitors in BM grafts.21,22 allo-immunization and

refractoriness to platelet transfusions63,64 impede recovery of patients with severe

thrombocytopenia after bone marrow transplantation. TPO, the physiological regulator of

thrombopoiesis has not been clinically effective due to the paucity of Mk progenitors in the

grafts.24 MGDF, the pegylated form of TPO, was retracted due to immunogenicity in healthy

donors who developed anti-TPO antibodies and became severely thrombocytopenic.65

ARP26, a synthetic peptide derived from AChE-R C-terminus, was previously shown to

facilitate the proliferation and differentiation of very early CD34+ myeloid precursors and Mk

progenitor cells. Ex vivo, ARP26 treatment was shown to yield considerably higher numbers of

platelet producing Mks than in untreated cells.47 Our current findings present proplatelet

formation and nuclear polyploidization effects in ARP26-treated MEG-01 cells and enhanced

platelet formation following ARP priming in vivo, in NOD/SCID mice. Increasing the

numbers of Mk precursors in the graft should shorten the extended nadir period of severe

thrombocytopenia, promoting successful engraftment of long term repopulating stem cells,

the appropriate targets for endogenous or exogenous TPO.

Priming CB CD34+ cells with ARP26, increased significantly the number of human CD45+

cells found in the mouse BM six weeks post transplant. Quantitative PCR analysis confirmed

larger content of the human TNFα gene (as a nuclear marker of human-originating cells) in

mice transplanted with ARP26- primed cells. Additionally, incubating CB CD34+ cells for 10

days with 2nM ARP26 improved the recovery from thrombocytopenia in NOD/SCID mice.

CD34+ cells placed in culture loose their ability for long-term engraftment due to

differentiation and commitment manifested by the acquisition of the CD38 marker.49,66

Nevertheless, these cells produce more AChE-R12 and can hence support megakaryopoiesis


24

when mixed with immature CD34+, providing clear engraftment advantages to CD45+, CD34+

and CD41+ Mk human cells. Our current study proposes a possible novel strategy to facilitate

thrombopoiesis by exposing stem cells to ARP, hopefully improving stem cell engraftment

and shortening post-transplant thrombocytopenia.


25

Acknowledgments

The authors are grateful to Ms. Shoshana Baron, Dr. Sigi Kay and to Dr. Orit Kollet for

expert technical assistance.


26

References

1. Burstein SA, Peng J, Friese P, et al. Cytokine-induced alteration of platelet and

hemostatic function. Stem Cells. 1996;14 Suppl 1:154-162.

2. Rafii S, Shapiro F, Pettengell R, et al. Human bone marrow microvascular endothelial

cells support long-term proliferation and differentiation of myeloid and megakaryocytic

progenitors. Blood. 1995;86:3353-3363.

3. Schroder NW, Heine H, Alexander C, et al. Lipopolysaccharide binding protein binds

to triacylated and diacylated lipopeptides and mediates innate immune responses. J Immunol.

2004;173:2683-2691.

4. Dunzendorfer S, Lee HK, Soldau K, Tobias PS. TLR4 is the signaling but not the

lipopolysaccharide uptake receptor. J Immunol. 2004;173:1166-1170.

5. Quesenberry P, Morley A, Stohlman F, Jr., Rickard K, Howard D, Smith M. Effect of

endotoxin on granulopoiesis and colony-stimulating factor. N Engl J Med. 1972;286:227-232.

6. Lagasse E, Weissman IL. Flow cytometric identification of murine neutrophils and

monocytes. J Immunol Methods. 1996;197:139-150.

7. Nagata Y, Shozaki Y, Nagahisa H, Nagasawa T, Abe T, Todokoro K. Serum

thrombopoietin level is not regulated by transcription but by the total counts of both

megakaryocytes and platelets during thrombocytopenia and thrombocytosis. Thromb

Haemost. 1997;77:808-814.

8. Wang H, Yu M, Ochani M, et al. Nicotinic acetylcholine receptor alpha7 subunit is an

essential regulator of inflammation. Nature. 2003;421:384-388.

9. Pick M, Flores-Flores C, Grisaru D, Deutsch V, Soreq H. Blood-cell Specific

Acetylcholinesterase Splice Variations under Changing Stimuli. Annals of New York

Academy of Science. 2004;1018:85-95.


27

10. Kawashima K, Fujii T. Extraneuronal cholinergic system in lymphocytes. Pharmacol

Ther. 2000;86:29-48.

11. Lev-Lehman E, Deutsch V, Eldor A, Soreq H. Immature human megakaryocytes

produce nuclear-associated acetylcholinesterase. Blood. 1997;89:3644-3653.

12. Grisaru D, Deutsch V, Shapira M, et al. ARP, a peptide derived from the stress-

associated acetylcholinesterase variant has hematopoietic growth promoting activities.

Molecular Medicine. 2001;7:93-105.

13. Soreq H, Patinkin D, Lev-Lehman E, et al. Antisense oligonucleotide inhibition of

acetylcholinesterase gene expression induces progenitor cell expansion and suppresses

hematopoietic apoptosis ex vivo. Proc Natl Acad Sci U S A. 1994;91:7907-7911.

14. Lev-Lehman E, Ginzberg D, Hornreich G, et al. Antisense inhibition of

acetylcholinesterase gene expression causes transient hematopoietic alterations in vivo. Gene

Ther. 1994;1:127-135.

15. Matsumura I, Kanakura Y. Molecular control of megakaryopoiesis and

thrombopoiesis. Int J Hematol. 2002;75:473-483.

16. Ishibashi T, Kimura H, Uchida T, Kariyone S, Friese P, Burstein SA. Human

interleukin 6 is a direct promoter of maturation of megakaryocytes in vitro. Proc Natl Acad

Sci U S A. 1989;86:5953-5957.

17. Teramura M, Kobayashi S, Yoshinaga K, Iwabe K, Mizoguchi H. Effect of interleukin

11 on normal and pathological thrombopoiesis. Cancer Chemother Pharmacol. 1996;38

Suppl:S99-102.

18. Nakashima K, Taga T. gp130 and the IL-6 family of cytokines: signaling mechanisms

and thrombopoietic activities. Semin Hematol. 1998;35:210-221.

19. Gainsford T, Nandurkar H, Metcalf D, Robb L, Begley CG, Alexander WS. The

residual megakaryocyte and platelet production in c-mpl-deficient mice is not dependent on


28

the actions of interleukin-6, interleukin-11, or leukemia inhibitory factor. Blood.

2000;95:528-534.

20. Bunting S, Widmer R, Lipari T, et al. Normal platelets and megakaryocytes are

produced in vivo in the absence of thrombopoietin. Blood. 1997;90:3423-3429.

21. Bertolini F, de Vincentiis A, Lanata L, et al. Allogeneic hematopoietic stem cells from

sources other than bone marrow: biological and technical aspects. Haematologica.

1997;82:220-238.

22. Domenech J, Linassier C, Gihana E, et al. Prolonged impairment of hematopoiesis

after high-dose therapy followed by autologous bone marrow transplantation. Blood.

1995;85:3320-3327.

23. Kuter DJ. Whatever happened to thrombopoietin? Transfusion. 2002;42:279-283.

24. Kanamaru S, Kawano Y, Watanabe T, et al. Low numbers of megakaryocyte

progenitors in grafts of cord blood cells may result in delayed platelet recovery after cord

blood cell transplant. Stem Cells. 2000;18:190-195.

25. Sternfeld M, Ming G, Song H, et al. Acetylcholinesterase enhances neurite growth and

synapse development through alternative contributions of its hydrolytic capacity, core protein,

and variable C termini. J Neurosci. 1998;18:1240-1249.

26. Sternfeld M, Patrick JD, Soreq H. Position effect variegations and brain-specific

silencing in transgenic mice overexpressing human acetylcholinesterase variants. J Physiol

Paris. 1998;92:249-255.

27. Pick M, Nagler A, Grisaru D, Eldor A, Deutsch V. Expansion of megakaryocyte

progenitors from human umbilical cord blood using a new two-step separation procedure. Br J

Haematol. 1998;103:639-650.

28. Guimaraes-Steinberg C, Meerson A, Soreq H. MicroRNA modulation of

megakaryocytopoiesis involves cholinergic signaling. Leuk Res. in press.


29

29. Kaufer D, Friedman A, Seidman S, Soreq H. Acute stress facilitates long-lasting

changes in cholinergic gene expression. Nature. 1998;393:373-377.

30. Sternfeld M, Shoham S, Klein O, et al. Excess "read-through" acetylcholinesterase

attenuates but the "synaptic" variant intensifies neurodeterioration correlates. Proc Natl Acad

Sci U S A. 2000;97:8647-8652.

31. Meshorer E, Bryk B, Toiber D, et al. SC35 promotes sustainable stress-induced

alternative splicing of neuronal acetylcholinesterase mRNA. Mol Psychiatry. 2005;10:985-

997.

32. Pick M, Eldor A, Grisaru D, Zander A, Shenhav M, Deutsch V. Ex vivo expansion of

megakaryocyte progenitors from cryopreserved umbilical cord blood. A potential source of

megakaryocytes for transplantation. Exp Hematol. 2002;30:1079.

33. Nitsche A, Becker M, Junghahn I, et al. Quantification of human cells in NOD/SCID

mice by duplex real-time polymerase-chain reaction. Haematologica. 2001;86:693-699.

34. Soreq H, Seidman S. Acetylcholinesterase--new roles for an old actor. Nat Rev

Neurosci. 2001;2:294-302.

35. Tracey KJ. The inflammatory reflex. Nature. 2002;420:853-859.

36. Peterson VM, Madonna GS, Vogel SN. Differential myelopoietic responsiveness of

BALB/c (Itys) and C.D2 (Ityr) mice to lipopolysaccharide administration and Salmonella

typhimurium infection. Infect Immun. 1992;60:1375-1384.

37. Yokochi T, Nakashima I, Kato N, Miyadai T, Yoshida K, Kimura Y. In vivo effects of

bacterial lipopolysaccharide on proliferation of macrophage colony-forming cells in bone

marrow and peripheral lymphoid tissues. Infect Immun. 1985;47:496-501.

38. Stohlawetz P, Folman CC, von dem Borne AE, et al. Effects of endotoxemia on

thrombopoiesis in men. Thromb Haemost. 1999;81:613-617.


30

39. Kaser A, Brandacher G, Steurer W, et al. Interleukin-6 stimulates thrombopoiesis

through thrombopoietin: role in inflammatory thrombocytosis. Blood. 2001;98:2720-2725.

40. Zahorec R. Ratio of neutrophil to lymphocyte counts--rapid and simple parameter of

systemic inflammation and stress in critically ill. Bratisl Lek Listy. 2001;102:5-14.

41. Birikh KR, Sklan EH, Shoham S, Soreq H. Interaction of "readthrough"

acetylcholinesterase with RACK1 and PKCbeta II correlates with intensified fear-induced

conflict behavior. Proc Natl Acad Sci U S A. 2003;100:283-288.

42. Perry C, Sklan EH, Soreq H. CREB regulates AChE-R-induced proliferation of

human glioblastom cells. Neoplasia. 2004;6.

43. Racke FK, Wang D, Zaidi Z, et al. A potential role for protein kinase C-epsilon in

regulating megakaryocytic lineage commitment. J Biol Chem. 2001;276:522-528.

44. Grisaru D, Pick M, Perry C, et al. Hydrolytic and non-enzymatic functions of

acetylcholinesterase co-modulate hematopoietic stress responses. J Immunol. in press.

45. Meshorer E, Biton IE, Ben-Shaul Y, et al. Chronic cholinergic imbalances promote

brain diffusion and transport abnormalities. Faseb J. 2005;19:910-922.

46. Perry C, Sklan EH, Birikh K, et al. Complex regulation of acetylcholinesterase gene

expression in human brain tumors. Oncogene. 2002;21:8428-8441.

47. Deutsch V, Pick M, Perry C, et al. The stress-associated acetylcholinesterase variant

AChE-R is expressed in human CD34(+) hematopoietic progenitors and its C-terminal

peptide ARP promotes their proliferation. Exp Hematol. 2002;30:1153-1161.

48. Laterveer L, van Damme J, Willemze R, Fibbe W. Continuous infusion of interleukin-

6 in sublethally irradiated mice accelerates platelet reconstitution and the recovery of myeloid

but not of megakaryocytic progenitor cells in bone marrow. Exp Hematol. 1993;21:1621-

1627.


31

49. Guenechea G, Segovia J, Albella B, et al. Delayed engraftment of nonobese

diabetic/severe combined immunodeficient mice transplanted with ex vivo-expanded human

CD34(+) cord blood cells. Blood. 1999;93:1097-1105.

50. Wendling F, Maraskovsky E, Debili N, et al. c-MPL ligand is a humoral regulator of

megakaryocytopoiesis. Nature. 1994;369:571-574.

51. Espanol I, Hernandez A, Cortes M, Mateo J, Pujol-Moix N. Patients with

thrombocytosis have normal or slightly elevated thrombopoietin levels. Haematologica.

1999;84:312-316.

52. Karakus S, Ozcebe OI, Haznedaroglu IC, et al. Circulating thrombopoietin in clonal

versus reactive thrombocytosis. Hematology. 2002;7:9-12.

53. Cluitmans FH, Esendam BH, Veenhof WF, Landegent JE, Willemze R, Falkenburg

JH. The role of cytokines and hematopoietic growth factors in the autocrine/paracrine

regulation of inducible hematopoiesis. Ann Hematol. 1997;75:27-31.

54. Dori A, Cohen B, Silverman WF, Pollack Y, Soreq H. Functional manipulations of

acetylcholinesterase splice variants highlight alternative splicing contributions to murine

neocortical development. Cerebral Cortex. 2004;in press.

55. Mor I, Grisaru D, Titelbaum L, et al. Modified testicular expression of stress-

associated "readthrough" acetylcholinesterase predicts male infertility. Faseb J.

2001;15:2039-2041.

56. Gwozdzinski K, Pieniazek A, Kaca W. Lipopolysaccharide from Proteus mirabilis

O29 induces changes in red blood cell membrane lipids and proteins. Int J Biochem Cell Biol.

2003;35:333-338.

57. Eichelbronner O, Sielenkamper A, Cepinskas G, Sibbald WJ, Chin-Yee IH. Endotoxin

promotes adhesion of human erythrocytes to human vascular endothelial cells under

conditions of flow. Crit Care Med. 2000;28:1865-1870.


32

58. Nave H, Bedoui S, Moenter F, et al. Reduced tissue immigration of monocytes by

neuropeptide Y during endotoxemia is associated with Y2 receptor activation. J

Neuroimmunol. 2004;155:1-12.

59. Oshevski S, Le Bousse-Kerdiles MC, Clay D, et al. Differential expression of protein

kinase C isoform transcripts in human hematopoietic progenitors undergoing differentiation.

Biochem Biophys Res Commun. 1999;263:603-609.

60. Marchisio M, Bertagnolo V, Celeghini C, Vitale M, Capitani S, Zauli G. Selective

modulation of specific protein kinase C (PKC) isoforms in primary human megakaryocytic

vs. erythroid cells. Anat Rec. 1999;255:7-14.

61. Rojnuckarin P, Miyakawa Y, Fox NE, Deou J, Daum G, Kaushansky K. The roles of

phosphatidylinositol 3-kinase and protein kinase Czeta for thrombopoietin-induced mitogen-

activated protein kinase activation in primary murine megakaryocytes. J Biol Chem.

2001;276:41014-41022.

62. Rojnuckarin P, Kaushansky K. Actin reorganization and proplatelet formation in

murine megakaryocytes: the role of protein kinase calpha. Blood. 2001;97:154-161.

63. Hogge DE, McConell M, Jacobson C, Sutherland HU, Benny WB, Massing BG.

Platelet refractoriness and alloimmunization in pediatric oncology and bone marrow

transplant patients. Transfusion. 1995;35:645-652.

64. Ishida A, Handa M, Wakui M, Okamoto S, Kamakura M, Ikeda Y. Clinical factors

influencing posttransfusion platelet increment in patients undergoing hematopoietic

progenitor cell transplantation--a prospective analysis. Transfusion. 1998;38:839-847.

65. Basser RL, O'Flaherty E, Green M, et al. Development of pancytopenia with

neutralizing antibodies to thrombopoietin after multicycle chemotherapy supported by

megakaryocyte growth and development factor. Blood. 2002;99:2599-2602.


33

66. Li K, Liu J, Fok TF, et al. Human neonatal blood: stem cell content, kinetics of

CD34+ cell decline and ex vivo expansion capacity. Br J Haematol. 1999;104:178-185.


34

TNFα 5’-3’ sequence

Human sense primer AGGAACAGCACAGGCCTTAGTG

antisense primer AAGACCCCTTCCAGATAGATGG

Human probe GCCCCTCCACCCATGTGCTCC-FL

AC-RED640 CACCCACCACCATCAGCCGCATC

Mouse sense primer GGCTTTCCGAATTCACTGGAC

Antisense primer CCCCGGCCTTCCAAATAAA

Table 1. The DNA sequence of the primers and probes. PCR template, primers and

HybProbes are single-stranded. One HybProbe is labeled with the fluorescent donor dye

Fluorescein – Sensor (FL), the other one is labeled with an acceptor dye (LCRed 640, Anchor

(AC)). The donor dye is excited by blue light of 470 nm and emits green light of 530 nm.

Nucleotide sequences are based on sequence of the human and mouse tumor necrosis factor

� gene (accession numbers M26331 and Y00467).33


35

A) Inflammatory cytokine levels post LPS

TNFα (pg/ml) IL-6 (pg/ml)

Plasma BM Plasma BM

0 2hrs 0 2hrs 0 2hrs 0 2hrs

TgR 0 834±231 30±4.2 120±66 34±2.5 1418±62 35±4.3 507±135

FVB/N 0 538±217 23±8.3 334±81 20±4.5 1378±40 8±2.7 498±331

p NS 0.04 NS 0.01 0.01 NS 0.001 NS

B) AThCh hydrolysing activity/min/mg of protein post LPS

BM Plasma

LPS (hrs post) LPS (hrs post)

0 24 72 0 24 72

TgR 20±3.0 14.2±4.3 13.1±1.8 87±1.5 31.7±12.8 7.7±0.4

FVB/N 14±2.7 6.3±1.9 11.0±0.7 15±1.5 27.0±13.1 9.3±1.0

p 0.02 0.00004 NS 0.001 NS NS

Table 2. Cytokine production and AChE catalytic activity in LPS-injected TgR mice. A)

TNFα and IL-6 levels were measured before and 2 hrs post LPS-injection. B) AChE catalytic

activity assessed by its AThCh hydrolyzing activity/min/mg of protein was measured in

plasma and bone marrow cell extracts (BM) of LPS-injected mice (n = 10). Shown are

average concentrations ± SD in plasma or BM proteins.


36

Antibody FVBN TgR P values

No Antibody 116.8±8.7 122.4±11.8 NS

Hu AChE-R 130.94±18.26 212.3±15.0 1 x 10-11

RACK1 153.4±21.0 162.3±49.2 NS

PKCε 160.9±19.7 187.8±22.7 3 x 10-6

Table 3. Luminescence intensity of human AChE-R, RACK1 and PKCε in Mks.

Luminescence levels (from 1, low luminescence to 220, bright) were determined using a

upright Zeiss microscope, ImageProTM image capture and Adobe Photoshop V 5.5 analysis

for each megakaryocyte stained in the bone marrow smears (n = 50 per antibody). NS = Not

significant using Student’s t-test. Background staining was detected by incubation with no

primary antibody.


37

Figure 1

Figure 1. Transgene facilitation of hematopoietic regulators. A) The proposed concept

involves stress-induced switch from production of AChE -S to the -R variant, resulting in

hematopoietic progenitor cell expansion towards the megakaryocyte lineage and increased

platelet counts. B) Human (h) AChE-R DNA construct inserted into the FVB/N mouse

genome. h AChE-R cDNA-derived 100 base pair product was successfully amplified in bone

marrow DNA of TgR, but not TgS or FVB/N mice (n=12, left arrow). A mouse actin product

(130 base pair, right arrow) appeared in all 3 tested lines, FVB/N, TgR and TgS.


38

Figure 2

Figure 2. Shorter post-LPS hematopoietic recovery in TgR mice. Shown are RBC x 109

(A), WBC x 106(B) and platelet (Plts x 106) (C) counts per ml of FVB/N (dashed line) and

TgR mice (solid line) (n=25) in peripheral blood. D) Results of morphological examination of


39

peripheral blood smears from TgR and FVB/N mice, at different time points post LPS

injection as indicated. Asterisks denote significant differences and results are presented as

mean ± SD of WBC x 106 per ml of blood (p < 0.02, n = 10). (+) indicates the time point post-

LPS treatment where quantitation was performed.


40

Figure 3

Figure 3. Changes in TPO levels in response to LPS injection. Thrombopoietin (TPO)

levels were measured in A) bone marrow cell lysates and B) plasma from TgR and FVB/N

mice. Asterisks denote significantly different values. Results are presented as mean ± SD (p <

0.04, n = 10). (+) indicates the time point where quantitation was performed.


41

Figure 4

Figure 4. Facilitated progenitor cells potential in TgR mice. Committed colony-forming

units of A) megakaryocyte (CFU-Mk), B) granulocytic/monocytic (CFU-GM) and C) multi-

potential (CFU-GEMM) progenitors were quantified in a semisolid colony formation assay.

Asterisks denote significantly different values. Assays were set up in triplicates from bone

marrow preparations (4 mice per time point). Values represent mean ± SD. (+) indicates the

time point where quantitation was performed. Asterisks denote significantly different values

(p < 0.05, Student’s t-test).


42

Figure 5

Figure 5. AChE-R, RACK1 and PKC ε expression in megakaryocytes. A) BM smears

were stained with May-Grünwald (A) and specific antibodies to detect AChE-R (B), RACK1

and PKCε (D). E) Illustration of the putative interaction between the three proteins F)

Population distributions of Mk labeling intensities for AChE-R, RACK1 and PKCε. White

bars represent FVB/N and grey, TgR mice BM labeling intensities. Note the shift to the right,

indicating increased levels of these 3 proteins in Mks from TgR as compared with FVB/N

mice. n = 50 cells per test.


43

Figure 6. ARP26 promotes proplatelet formation and nuclear polyploidization in human

MEG01 promegakaryocytic cells. A) ARP26 dose response and proplatelet formation.

1. Shown are the effects of the noted ARP26 doses following 24 hr incubation with MEG01

cells. Note increase in the splice factor SC35 and corresponding substitution of AChE-S

mRNA with AChE-R mRNA, which appears to plateau under 2 nM ARP26. 2 and 3 Scanning

electron microscopy demonstration of proplatelet-like demarcations in ARP26-treated cells.

Shown are a representative untreated (2) and an ARP26-treated cell (3) for 24 hr post-

treatment. B) Transmission electron microscopy. 1. Control cell. Inset: TUNEL analysis of

control and treated cells, excluding the possibility of ARP26-induced apoptosis. 2. ARP26-


44

treated cell. Note intact nuclear membrane, numerous mitochondria and peripheral membrane

demarcations. 3. Enlarged section, highlighting the numerous demarcations. C) Enhanced

nuclear polyploidization and caspase 3 activation under ARP26 treatment of MEG01 cells. 1.

Flow cytometric analysis. Note increase in both side and forward scatter of ARP26-treated as

compared to control (CTR) cells. 2. Nuclear polyploidization. Note that within 24 hr, ARP26

treatment increases the fractions of cells with 16n and 32n nuclei by Ca. 2-fold while

decreasing the fractions of cells with 2n and 4n nuclei. 3. Caspase 3 activation. Throughout

the 4 day post-treatment, ARP26 consistently enhances the levels of activated caspase-3.


45

Figure 7

C


46

Figure 7. Enhanced human blood cell engraftment in NOD/SCID mice. 100,000 human

CB CD34+ cells were injected into the tail vein of pre-irradiated NOD/SCID mice with no

priming of cells (none, white diamond symbol), or following priming of cells with ARP26 for

2-4 hours and injection with human ARP26 (black square symbol) or ASP43 (gray triangle

symbol). Bone marrow was harvested 6 weeks post-transplantation. A) CD34+, CD45+ and

CD41+ human cells were detected using flow cytometry and monoclonal antibodies, n = 12,16

and 8 mice, respectively. B) Quantitative real time PCR using human TNFα primers to detect

human DNA in the mouse bone marrow. Sensitivity limit was 10%. n = 12, 16 and 8 mice

respectively. Asterisks denote significant differences. Lines represent mean values. C) Pre-

cultured CD34+ cells expanded with ARP26 improve platelet counts. 100,000 human CD34+

cells were injected into mice (n = 9) together with 1-200,000 CD34+ cells cultured for 10 days

with no supplement (Control, Ctrl), 2nM ARP26, 2nM ASP43 or human TPO/SCF (T/S).

Human platelets per mL of mouse blood were quantified using anti CD41, specific for human

platelets. The mean differences (denoted by lines) between groups were large with statistical

differences observed in the experimental group of mice that received CD34+ cells stimulated

with synthetic peptide ARP in vitro for 10 days together with fresh CB CD34+ cells (denoted

by asterisks).

Documents

TRANSPLANTATION Stress-induced cholinergic signaling ...library.tasmc.org.il/ · Marjorie Pick, Chava Perry, Tsvee Lapidot, Cinthya Guimaraes-Sternberg, Elizabeth Naparstek, Varda