Embed Size (px)
Citation preview
1
The non-receptor tyrosine kinase Ack1 regulates activated EGFR fate by inducing 1
trafficking to the p62/NBR1 pre-autophagosome 2
3
4
Sylwia Jones, Debbie L. Cunningham, Joshua Z. Rappoport and John K. Heath 5
School of Biosciences, College of Life and Environmental Sciences, University of 6
Birmingham, Edgbaston, Birmingham, B15 2TT, United Kingdom 7
8
9
10
Address to correspondence: Joshua Z. Rappoport, School of Biosciences, University of 11
Birmingham, Edgbaston, Birmingham, B15 2TT, UK. Telephone: +44 (0) 121 414 5925. 12
Email: [email protected] 13
14
15
16
17
Running title 18
Ack1 and non-canonical EGFR degradation 19
Keywords 20
Ack1/TNK2, EGFR, p62/SQSTM1, NBR1, autophagy 21
22
© 2014. Published by The Company of Biologists Ltd.Jo
urna
l of C
ell S
cien
ceA
ccep
ted
man
uscr
ipt
JCS Advance Online Article. Posted on 10 January 2014
2
Summary 1
Growth factor signalling regulates multiple cellular functions and its misregulation has been 2
linked to cancer development and progression. Ack1 (Activated Cdc42-associated kinase 1, 3
TNK2), a non-receptor tyrosine kinase, has been implicated in trafficking and degradation of 4
epidermal growth factor receptor (EGFR), yet the precise functions remain elusive. In this 5
report we investigate the role of Ack1 in EGFR trafficking and show that Ack1 partially 6
colocalises to Atg16L-positive structures upon EGF stimulation. These are proposed to be the 7
isolation membranes during autophagosome formation. In addition we find that Ack1 8
colocalises and interacts with sequestosome 1 (p62/SQSTM1), a receptor for selective 9
autophagy, via a ubiquitin associated domain and this interaction decreases upon EGF 10
treatment, thus suggesting that Ack1 moves away from p62/SQSTM1 compartments. 11
Furthermore, Ack1 interacts and colocalises with NBR1, another autophagic receptor, and 12
this colocalisation is enhanced in the presence of ectopically expressed p62/SQSTM1. 13
Finally, Ack1 knock-down results in accelerated lysosomal localisation of EGFR upon EGF 14
treatment. Structure-function analyses of a panel of Ack1 deletion mutants have revealed key 15
mechanistic aspects of these relationships. The Mig6-homology domain and clathrin binding 16
domain both contribute to the colocalisation with EGFR, whereas the UBA domain is critical 17
for the colocalisation with p62/SQSTM1, but not NBR1. Taken together, our studies 18
demonstrate a novel role for Ack1 in diverting activated EGFR into a non-canonical 19
degradative pathway, marked by association with p62/SQSTM1, NBR1 and Atg16L. 20
21
22
23 Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
3
Introduction 1
Epidermal growth factor receptor (EGFR) is a member of the ErbB family of cell surface 2
receptor tyrosine kinases (RTKs) (Citri and Yarden, 2006). Ligand binding results in EGFR 3
dimerization, transphosphorylation and ubiquitylation, leading to activation of several 4
downstream signalling cascades (Levkowitz et al., 1998; Citri and Yarden, 2006; Schneider 5
and Wolf, 2009). Following activation, EGFR undergoes regulated endocytosis from the cell 6
surface (Rappoport and Simon, 2009; Goh et al., 2010). Internalised EGFR is targeted to 7
early endosomes, where it is sorted through the recycling compartment back to the plasma 8
membrane, or into lysosomes for degradation (Madshus and Stang, 2009). Furthermore, 9
EGFR endocytosis, incorporation into multi-vesicular bodies of late endosomes and 10
lysosomal degradation are essential for signal attenuation and uncontrolled EGFR signalling 11
has been found in different cancer types (Burke et al., 2001; Di Fiore and De Camilli, 2001; 12
Seto et al., 2002). Thus, the mechanisms that regulate EGFR trafficking are significant. 13
14
Ack1 (Activated Cdc42-associated kinase 1/TNK2) is a non-receptor tyrosine kinase that has 15
been proposed to regulate EGFR trafficking (Grovdal et al., 2008), yet the precise 16
mechanistic roles of Ack1 in this context remain elusive. High levels of Ack1 expression 17
resulted in inhibition of EGFR degradation (Grovdal et al., 2008), possibly due to the 18
disruption of endocytic machinery as a consequence of clathrin sequestration (Teo et al., 19
2001). Additionally, Ack1 down-regulation has also been shown to inhibit EGFR degradation 20
and increase recycling, and Ack1 has been proposed to regulate endosomal sorting of EGFR 21
into inner vesicles of multi vesicular bodies (Grovdal et al., 2008). Interestingly, an increased 22
Cdc42-dependent Ack1 phosphorylation has been observed in cells depleted of dynamin, and 23
in these cells Ack1 showed enhanced binding of both endocytic and ubiquitylated proteins 24
(Shen et al., 2011). 25
26
Apart from ‘classical’ lysosomal degradation, other non-canonical degradative pathways exist 27
in which misfolded proteins, protein aggregates, damaged organelles and bacteria are 28
ubiquitylated and degraded (Kraft et al., 2010). Selective autophagy is one of the major 29
degradative pathways within the cell, which eliminates ubiquitylated protein aggregates and 30
organelles. Formation of protein aggregates has been suggested to be mediated by autophagy 31
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
4
receptors, which have been shown to recognise ubiquitylated cargo; these include 1
sequestosome 1 (p62/SQSTM1) and neighbour of BRCA1 (NBR1) (Kraft et al., 2010). 2
Although autophagy takes place at the basal levels within the cell, there are various stimuli 3
that have been shown to induce autophagy, in particular withdrawal of growth factors (Wang 4
and Levine, 2010; Mizushima et al., 2011), e.g. EGF deprivation in mammary epithelial cells 5
(Fung et al., 2008). 6
7
Recently, we reported that NBR1 functions in RTK degradation (Mardakheh et al., 2009; 8
Mardakheh et al., 2010). Specifically we showed that association of NBR1 with Spred2, a 9
signalling inhibitor, promotes RTK degradation, whereas NBR1 on its own inhibits 10
degradation. In the present study we investigate the precise roles of Ack1 in EGFR 11
trafficking. We find that Ack1 interacts and colocalises with p62/SQSTM1, another 12
autophagic receptor (Lamark et al., 2009), and this interaction decreases upon EGF 13
stimulation. The UBA domain strongly regulates the association between Ack1 and 14
p62/SQSTM1, but not NBR1. Conversely, EGF stimulation results in Ack1 localisation to 15
Atg16-positive structures, which are likely to be pre-autophagosomal isolation membranes 16
(Matsushita et al., 2007; Mizushima et al., 2011). Furthermore, Ack1 silencing leads to 17
enhanced EGFR lysosomal localisation. Thus, our results define a novel role for Ack1 in 18
targeting activated EGFR into a non-canonical degradative pathway via its association with 19
autophagic receptors p62/SQSTM1 and NBR1, which influences kinetics of EGFR 20
trafficking. 21
22
Results 23
Ack1 interacts and colocalises with EGFR, but not with FGFR 24
A role for Ack1 in EGFR trafficking has been proposed (Shen et al., 2007; Grovdal et al., 25
2008), yet the precise functions remain elusive. Consistent with previous reports (Shen et al., 26
2007), we show that EGFR co-precipitates with Ack1 following EGF stimulation (Fig. 1A). 27
Constitutively active Cdc42 (caCdc42), a known Ack1 interactor (Manser et al., 1993), also 28
co-precipitates with Ack1 (Fig. 1A). In contrast FGFR1 and FGFR2 do not co-precipitate 29
with Ack1 following FGF treatment (Fig. 1A and supplementary material Fig. S1B). 30
Similarly, Ack1 colocalises with EGFR in EGF-treated cells (Fig. 1B), as represented by the 31
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
5
high Pearson’s correlation coefficient (PCC), which decreases upon deliberate misalignment 1
by pixel movement (see Materials and methods). In the case of FGFR2, the PCC is low and 2
remains low irrespective of pixel movement, indicating a lack of colocalisation between 3
Ack1 and FGFR2 (Fig. 1B). These results emphasize the differences between EGFR and 4
FGFR trafficking despite activation of similar downstream signalling pathways. Additionally, 5
truncated Ack1 (tAck1), which lacks the C-terminal portion (supplementary material Fig. 6
S1B), does not colocalise with EGFR post-EGF treatment (supplementary material Fig. S1C), 7
indicating that the C-terminal fragment is essential for the Ack1-EGFR interaction. This is 8
consistent with the studies showing that the Mig6 homology domain within the C-terminus of 9
Ack1 mediates this interaction (Shen et al., 2007). 10
In order to study the physiological relevance of this interaction, we took advantage of the 11
human prostatic adenocarcinoma cell line LNCaP, which has previously been used to study 12
endogenous Ack1 (Mahajan et al., 2005; Liu et al., 2010). As shown in Fig. 1C, the 13
colocalisation between endogenous Ack1 and EGFR can be detected in LNCaP cells. To our 14
knowledge this is the first successful report of colocalisation between endogenous Ack1 and 15
EGFR. Therefore, under physiological conditions, Ack1 and EGFR show EGF-dependent 16
colocalisation. 17
Mig6-homology domain (Mig6) and clathrin binding domain (CBD) of Ack1 both 18
contribute to the colocalisation with EGFR upon EGF stimulation 19
It has been proposed that the UBA domain of Ack1 is required for EGFR degradation, 20
whereas the Mig6 domain directly binds EGFR (Shen et al., 2007). To analyse more 21
precisely which of the Ack1 domains are required for the association with EGFR, we 22
generated a series of the C-terminal truncations of Ack1 (Fig. 2A). These include a mutant 23
with deletion of the C-terminal ubiquitin associated (UBA) domain (ΔUBA), a mutant with 24
deletion of both UBA and Mig6 homology (Mig6) domain (ΔMig6), and a mutant with 25
deletion of UBA, Mig6 and the region particularly rich in proline residues, which we 26
designated a proline-rich domain (ΔPRD). Each of these mutants was tagged with mCherry at 27
the N-terminus. In the study we also took advantage of truncated Ack1, which lacks the C-28
terminal portion (including UBA, Mig6, PRD and clathrin binding domain; CBD). Using 29
these constructs we carried out a series of colocalisation studies with EGFR-GFP upon EGF 30
stimulation. As shown in Fig. 2B, deletion of the UBA domain alone does not alter the 31
colocalisation between Ack1 and EGFR, which is similar to the full-length protein (~90%). 32
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
6
In contrast, deletion of both UBA and Mig6 domains dramatically decreases this 1
colocalisation (~43%). This is consistent with the previous reports on the role of the Mig6 2
domain in the association between Ack1 and EGFR (Shen et al., 2007). Additional removing 3
of the PRD does not have any further effects on the colocalisation with EGFR. However, the 4
absence of the clathrin binding domain, which is represented by tAck1, abolishes any 5
remaining colocalisation (Fig. 2B). These data emphasize the importance of the Mig6 domain 6
in this context and suggest that Ack1 association with clathrin also contributes to this 7
colocalisation. Importantly, the UBA domain alone has no influence on the colocalisation 8
between Ack1 and EGFR suggesting that the EGFR ubiquitylation may not be required for 9
colocalisation with Ack1. 10
Ack1 partially localises to early endosomes upon EGF stimulation 11
We further analysed the subcellular localisation of Ack1 in the context of EGF signalling, as 12
a precise localisation remains elusive, in particular in pre-EGF conditions. Immunostaining of 13
HeLa cells with an α-EEA1 (early endosome antigen 1) antibody reveals that in unstimulated 14
cells (0 minutes EGF) mCherry-Ack1 poorly colocalises with EEA1, as manifested by a very 15
low PCC (Fig. 3A). In contrast, at 15 and more noticeably at 30 minutes following EGF 16
stimulation, Ack1 colocalisation with EEA1 significantly increases. These results are 17
consistent with previous reports showing that Ack1 partially colocalises with EGFR on early 18
endosomes (Shen et al., 2007; Grovdal et al., 2008). However, recently early endosomes 19
have also been shown to be essential for autophagosome maturation (Razi et al., 2009; Tooze 20
and Razi, 2009). Therefore, we also investigated whether Ack1 colocalises with ectopically 21
expressed Rab5, which is a small GTPase that localises mostly to early endosomes, but has 22
also been found on autophagosomes and other structures (Stenmark, 2009). Similar to EEA1, 23
in unstimulated cells Ack1 colocalisation with Rab5 is very low, represented by a very low 24
PCC (supplementary material Fig. S2A); however, as with EEA1, there is an increase in 25
colocalisation between Ack1 and Rab5 following EGF treatment (supplementary material 26
Fig. S2A). Taken together, these results indicate that following EGF stimulation, Ack1 27
traffics through EEA1- and Rab5-positive compartments. However, this data also raises the 28
potential connection between Ack1 and non-canonical degradative pathways. 29
Ack1 localises to pre-autophagosomal structures upon EGF stimulation 30
Apart from the classical endo-lysosomal pathway, other non-canonical degradation pathways 31
exist. We and others show that Ack1 partially localises to EEA1-positive compartments upon 32
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
7
EGF treatment (Shen et al., 2007; Grovdal et al., 2008). As early endosomes have also been 1
reported to be required for autophagosomal maturation (Razi et al., 2009; Tooze and Razi, 2
2009), we investigated whether Ack1 may be involved in the autophagosomal pathway. Atg 3
(autophagy-related) proteins, essential for autophagy, are required for initiation and 4
maturation of autophagosomes (Mizushima et al., 2011). At the initial stages of the 5
autophagosome formation, when the isolation membrane is not yet enclosed, a multimeric 6
complex of Atg16L, Atg5 and Atg12 assembles, which dissociates upon membrane closure 7
(Mizushima et al., 2011). We therefore examined whether Ack1 colocalises with Atg16L 8
before or during EGF stimulation. As shown in Fig. 3B,, in unstimulated cells Atg16L 9
demonstrates diffuse staining; however, upon EGF stimulation, punctate Atg16-positive 10
structures can be distinguished and Ack1 localises to these structures. The colocalisation 11
between Ack1 and Atg16L was quantified on the graph in Fig. 3B; approximately 25% of 12
Ack1 puncta were positive for Atg16L following 15 minutes of EGF treatment. This was 13
significantly higher than random control regions not containing Ack1 (see Materials and 14
methods) (Fig. 3B). Additionally, the colocalisation between Ack1 and Atg16L was 15
quantified with PCC, where an increase in colocalisation is observed at 15 and 30 minutes 16
post-EGF treatment (Fig. 3B, bottom graph). Furthermore, endogenous Ack1 also colocalises 17
with endogenous Atg16 (supplementary material Fig. S2B). Finally, 18
immunoprecipitationation of endogenous Atg16L resulted in co-precipitation of endogenous 19
Ack1 (Fig. 3C). Thus, these data show that Ack1 associates with Atg16L-positive structures, 20
in particular upon EGF stimulation. Although growth factor signalling has been shown to 21
inhibit autophagy (Wang and Levine, 2010; Mizushima et al., 2011), reports exist indicating 22
a role for clathrin-mediated endocytosis in autophagosome formation (Ravikumar et al., 23
2010; Mari et al., 2011). EGF stimulation promotes clathrin-mediated endocytosis (Sorkin 24
and Goh, 2009) and may therefore provide membranes for autophagosome formation. 25
Ack1 localises within ubiquitin-rich compartments 26
Given that Ack1 may potentially be involved in the autophagosomal pathway, which involves 27
degradation of ubiquitylated cargo, and that Ack1 has previously been shown to bind both 28
mono- and poly-ubiquitin, as well as ubiquitylated proteins (Shen et al., 2007), we analysed 29
whether Ack1 colocalises with ubiquitin. Thus, we expressed GFP-Ack1 and HA-ubiquitin in 30
HeLa cells. As shown in Fig. 4A, there is a very strong colocalisation between Ack1 and 31
ubiquitin. Importantly, we observed large ubiquitin-rich structures to which Ack1 localised, 32
herein referred to as ‘ubiquitin-rich compartments’ (supplementary material Fig. S3A). As a 33
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
8
negative control we used truncated Ack1, which lacks the C-terminal portion including the 1
UBA domain (supplementary material Fig. S1B). We find that truncated Ack1 does not 2
colocalise with ubiquitin (Fig. 4A). Consistently, when performing immunoprecipitation of 3
full-length and truncated Ack1, ubiquitin binds only full-length and not with tAck1 (Fig. 4B) 4
and this is independent of EGF stimulation. Since the band detected by α-GFP antibody 5
corresponds to the one detected by α-HA antibody (Fig. 4B), and Ack1 has been shown to be 6
ubiquitylated by Nedd4 ubiquitin ligases (Chan et al., 2009; Lin et al., 2010), we propose that 7
this is ubiquitylated Ack1. Altogether, these results indicate that Ack1 is localised within 8
ubiquitin-rich compartments and that the C-terminal portion of Ack1 is important for this 9
localisation. 10
Next, we investigated whether EGFR colocalises with Ack1 within ubiquitin-rich 11
compartments. As shown in Fig. 4C, upon EGF stimulation more than 90% of Ack1 puncta 12
colocalise with EGFR, and nearly 70% of those are positive for ubiquitin. These results 13
indicate that Ack1 and EGFR are localised within ubiquitin-rich compartments following 14
EGF stimulation. Collectively, these data emphasize that Ack1 is involved in ubiquitin-15
dependent EGFR degradation. 16
We further analysed which of the Ack1 domains regulate the colocalisation between Ack1 17
and ubiquitin. We show that the high colocalisation between Ack1 and ubiquitin (~80%) 18
partially decreases following deletion of the UBA domain (~40-50%) (supplementary 19
material Fig. S3B). We observe further decrease in colocalisation following deletion of the 20
PRD (20-30%). Finally, the colocalisation is nearly abolished in the case of tAck1. 21
Importantly, the association with ubiquitin seems to be independent of EGF treatment, and 22
there is no difference in colocalisation before and after EGF stimulation (supplementary 23
material Fig. S3B). These data indicate that the UBA domain, the PRD and CBD all 24
contribute to the association between Ack1 and ubiqutin and/or ubiquitylated proteins. 25
Ack1 interacts and colocalises with p62/SQSTM1, an autophagic receptor, in 26
unstimulated cells 27
To further identify the ubiquitin-rich compartments where Ack1 is localised, we considered 28
ubiquitin-rich protein aggregates, the formation of which is a common phenomenon in non-29
canonical degradative pathways (Kraft et al., 2010). p62/SQSTM1 and NBR1 are the 30
ubiquitin-binding proteins that have been proposed to act as cargo receptors in the process of 31
autophagy (Lamark et al., 2009). We showed previously that p62 and NBR1 associate with 32
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
9
Spred2, a signalling inhibitor, to promote degradation of RTKs, whereas NBR1 on its own 1
inhibits RTKs degradation (Mardakheh et al., 2009; Mardakheh et al., 2010). Here we show 2
that Ack1 highly colocalises with p62/SQSTM1 in unstimulated cells (Fig. 5A). This is 3
represented by a high PCC, which gradually decreases upon pixel movement. Interestingly, 4
this colocalisation decreases upon EGF treatment (Fig. 5A), suggesting that EGF stimulation 5
negatively influences the interaction between Ack1 and p62/SQSTM1. 6
In addition to our colocalisation studies, we also show that endogenous p62/SQSTM1 co-7
precipitates with endogenous Ack1 in unstimulated LNCaP cells, and this interaction 8
decreases following EGF stimulation (Fig. 5B). The interaction is also preserved in cells 9
treated with bafilomycin A1, which inhibits lysosomal acidification and hence degradation 10
(Fig. 5B). This data suggests that Ack1 and p62/SQSTM1 may be interacting during fusion of 11
autophagosomes with lysosomes, a process sensitive to bafilomycin treatment (Yamamoto et 12
al., 1998). 13
p62/SQSTM1 promotes colocalisation between Ack1 and NBR1 14
We also examined the colocalisation between Ack1 and NBR1, another autophagy receptor. 15
Previously we reported that NBR1 mainly localises to the limiting membranes of the late 16
endosomes (Mardakheh et al., 2009). Here we show that Ack1 interacts with NBR1 both in 17
the presence and absence of ectopically expressed p62/SQSTM1 (supplementary material 18
Fig. S4). We also show that Ack1 colocalises with NBR1, but the colocalisation is relatively 19
low (~25%) and independent of EGF treatment (Fig. 5C). However, in the presence of 20
ectopically expressed p62/SQSTM1, the colocalisation between NBR1 and Ack1 21
dramatically increases to ~52% in serum starved cells (Fig. 5D). Furthermore, this 22
colocalisation significantly decreases post-EGF treatment (~34%). Importantly, there is a 23
very strong colocalisation between NBR1 and p62/SQSTM1 (~80%) (Fig. 5D), suggesting 24
that p62/SQSTM1 plays an active role in compartment maturation, promotes colocalisation 25
between Ack1 and NBR1, and confers EGF sensitivity on this colocalisation. 26
We also find that upon EGF stimulation, internalised EGFR partially colocalises with Ack1 27
and p62/SQSTM1 (~20%), shown in Fig. 6. This is consistent with our data showing that the 28
colocalisation between Ack1 and p62/SQSTM1 decreases post-EGF treatment. Interestingly, 29
endogenous EGFR also partially colocalises with endogenous p62/SQSTM1, and this is not 30
affected by Ack1 knock-down (supplementary material Fig. S5A). Since we show that only a 31
portion of EGFR present within the Ack1 puncta colocalises with p62/SQSTM1 (Fig. 6), it is 32
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
10
possible that any difference in colocalisation in Ack1 knock-down cells is difficult to 1
identify. Additionally, since Ack1 knock-down is not complete (supplementary material Fig. 2
S5B), it is possible that the remaining Ack1 is sufficient to mediate the colocalisation 3
between EGFR and p62/SQSTM1. Altogether, these results indicate that serum deprivation 4
promotes the interaction between Ack1 and p62/SQSTM1, whereas EGF stimulation may 5
result in Ack1 translocation away from the p62/SQSTM1 compartments. In summary, our 6
data reveal a novel association between Ack1 and the autophagy receptors p62/SQSTM1 and 7
NBR1. 8
The C-terminal UBA domain regulates the colocalisation between Ack1 and 9
p62/SQSTM1 10
We further analysed the function of several Ack1 domains with respect to colocalisation with 11
p62/SQSTM1. As shown in Fig. 7, in unstimulated cells Ack1 highly colocalises with 12
p62/SQSTM1 (~55%) and this colocalisation partially decreases upon EGF stimulation 13
(~30%). Thus, Ack1 colocalisation with p62/SQSTM1 post-EGF treatment is preserved, 14
although to a much lower extent. Deletion of the UBA domain dramatically decreases the 15
colocalisation between Ack1 and p62/SQSTM1 in unstimulated cells (~20%) and abolishes 16
EGF-sensitivity. Importantly, deletion of the UBA domain does not have any effect on the 17
colocalisation between Ack1 and NBR (supplementary material Fig. S6), indicating that the 18
colocalisation between Ack1 and p62/SQSTM1 is highly specific. Further deletion of the 19
Mig6 or PRD domains does not lead to any dramatic change in the colocalisation between 20
Ack1 and p62/SQSTM1. However, any remaining colocalisation is abrogated in the case of 21
tAck1. These data underscore the extreme significance of the UBA domain in the association 22
between Ack1 and p62/SQSTM1 and reveal that the presence of the UBA domain crucially 23
confers the EGF sensitivity on this colocalisation. 24
Ack1 silencing results in increased transient lysosomal localisation of EGFR 25
Since we identified an interaction between Ack1 and the autophagy receptors, we 26
hypothesized that Ack1 may prevent EGFR from trafficking through the canonical lysosomal 27
pathway, and rather targets it into a non-canonical degradative pathway. Therefore we 28
investigated whether EGFR localisation to lysosomes is affected in cells depleted of Ack1. 29
Thus, LNCaP cells expressing GFP-tagged EGFR were treated with siRNA against Ack1 or 30
with non-targeting RNAi control. Following serum-starvation and incubation with 31
LysoTracker, a fluorescent dye that stains lysosomes (Chazotte, 2011), the cells were imaged 32
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
11
for 30 minutes upon EGF stimulation. As shown in Fig. 8A, when compared to control 1
(supplementary material Movie S1), Ack1 knock-down promotes increased transient 2
colocalisation between EGFR and LysoTracker following EGF stimulation (supplementary 3
material Movie S2). Ack1 silencing is verified by Western blotting and quantified by real-4
time quantitative polymerase chain reaction as ~80% (supplementary material Fig. S7A 5
S7B). This observation therefore indicates that the presence of Ack1 delays EGFR 6
recruitment to lysosomes. Interestingly, EGFR degradation is not affected by Ack1 knock-7
down (supplementary material Fig. S8), indicating that the mechanism of EGFR degradation, 8
rather than the EGFR degradation rate, is regulated by Ack1. Altogether, these data strongly 9
support the proposed role of Ack1 in targeting EGFR into a non-canonical degradative 10
pathway. 11
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
12
Discussion 1
Ack1 has been identified to regulate EGFR trafficking and degradation (Grovdal et al., 2008), 2
yet a precise function for Ack1 in this context has not been largely explored. Our work 3
suggests a model for Ack1 function (Fig. 8B), in which Ack1 is localised within 4
p62/SQSTM1 and ubiquitin-rich compartments in unstimulated cells; however, upon EGF 5
stimulation, Ack1 localises away from p62/SQSTM1 to early endosomes to promote non-6
canonical trafficking of EGFR. 7
Previous studies suggest that Ack1 partially localises to early endosomes before (Prieto-8
Echaguee et al., 2010) and after EGF treatment (Shen et al., 2007; Grovdal et al., 2008). 9
However, we show that Ack1 colocalisation with the early endosomal marker EEA1 10
significantly increases post-EGF stimulation (Fig. 3A) (Shen et al., 2007; Grovdal et al., 11
2008). Following EGF treatment, Ack1 similarly colocalises with Rab5 (supplementary 12
material Fig. S2A), which localises to early endosomes and other structures including 13
autophagosomes (Stenmark, 2009). It has been shown that the fusion of early endosomes 14
with autophagosomes is required for autophagosome maturation (Razi et al., 2009). 15
Therefore, the colocalisation with EEA1 led us to assess autophagosomal localization for 16
Ack1. We find that following EGF stimulation, Ack1 partially colocalises with Atg16L (Fig. 17
3B and C), a protein critical for early stages of autophagosome formation (Matsushita et al., 18
2007). Thus, we propose that Ack1 localises to both early endosomes and autophagosomes 19
upon EGF stimulation. 20
Ack1 partially colocalises with clathrin and α-adaptin in steady-state cells (Teo et al., 2001). 21
Furthermore, Ack1 has been detected by electron microscopy on large reticular membrane 22
compartments upon EGF stimulation (Grovdal et al., 2008); however, to our knowledge 23
Ack1 localisation in serum-starved cells has not been reported. Therefore we were interested 24
in a precise Ack1 subcellular localization, in particular upon serum-starvation. Previously it 25
has been shown that Ack1 binds ubiquitin and ubiquitylated proteins (Shen et al., 2007) and 26
in cells depleted of dynamin, Ack1 exhibited increased phosphorylation and binding of 27
ubiquitylated proteins (Shen et al., 2011). Therefore, we examined the association between 28
Ack1 and ectopically expressed ubiquitin, with the observation that Ack1 binds and 29
colocalises with ubiquitin independently of EGF stimulation (Fig. 4B and C and 30
supplementary material Fig. S3B). Since ubiquitylation regulates protein degradation (Kraft 31
et al., 2010), we considered subcellular compartments rich in ubiquitylated proteins targeted 32
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
13
for degaradation. p62/SQSTM1 has been shown to act as an autophagy receptor and localise 1
to ubiquitylated protein aggregates (Kraft et al., 2010). Here we show that Ack1 colocalises 2
with p62/SQSTM1 in unstimulated cells, and this colocalisation decreases following EGF 3
stimulation (Fig. 5A). This is verified by biochemical studies, where we observe an 4
interaction between endogenous Ack1 and p62/SQSTM1, which also decreases post-EGF 5
treatment (Fig. 5B). Therefore, we propose that in unstimulated cells Ack1 mainly localises 6
to p62/SQSTM1- and ubiquitin-rich compartments. 7
In addition to our studies on p62/SQSTM1, we also observe colocalisation between Ack1 and 8
NBR1, another autophagy receptor (Lamark et al., 2009). In this case, however, the 9
colocalisation is not as striking as with p62/SQSTM1 (~25%) and is insensitive to EGF 10
treatment (Fig. 5C). This strongly emphasizes the specificity of the association between Ack1 11
and p62/SQSTM1. Importantly, colocalisation between Ack1 and NBR1 dramatically 12
increases in the presence of ectopically expressed p62/SQSTM1 (~50%) (Fig. 5D), indicating 13
that p62/SQSTM1 positively influences the colocalisation between Ack1 and NBR1. 14
Although HeLa cells express endogenous p62/SQSTM1 (Pankiv et al., 2007), it may not be 15
sufficient to affect the localisation of ectopically expressed proteins. Previously we reported 16
that NBR1 is a late endosomal protein that partially localises to autophagosomes, and that its 17
late endosomal and autophagosomal localization are independent of each other (Mardakheh 18
et al., 2009; Mardakheh et al., 2010). We therefore propose that NBR1 and p62/SQSTM1, 19
despite interacting with each other (Kraft et al., 2010), are present within different subcellular 20
compartments due to other roles that they play within the cells. Since p62/SQSTM1 and 21
NBR1 interact with each other via their Phox and Bem 1 (PB1) domains (Johansen and 22
Lamark, 2011) we suggest that this leads to an indirect colocalisation between Ack1 and 23
NBR1 in the presence of the ectopically expressed p62/SQSTM1. 24
Our structure-function studies demonstrate that the UBA domain of Ack1 is critical for the 25
association with p62/SQSTM1 (Fig. 7). Deletion of the UBA domain dramatically decreases 26
this association and desensitizes it to EGF treatment. This finding is particularly relevant 27
considering that the UBA domain of several autophagic receptors, including p62/SQSTM1 28
and NBR1, is critical for their function as it recognizes ubiquitylated cargo leading to its 29
autophagic clearance (Bjorkoy et al., 2005; Johansen and Lamark, 2011). We also show that 30
Ack1 knock-down results in accelerated trafficking of EGFR toward lysosomal 31
compartments (Fig. 8A). This therefore indicates that the presence of Ack1 prevents EGFR 32
from rapid translocation to lysosomes following EGF stimulation and suggests that Ack1 33
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
14
plays a role in mediating EGFR trafficking into a non-canonical degradative pathway. In this 1
context it is surprising that deletion of the UBA domain of Ack1 has no effect on its 2
association with EGFR, suggesting that EGFR ubiquitylation is dispensable for this 3
association. We therefore propose that the association of EGFR with the Mig6 and clathrin 4
binding domains of Ack1, accompanied by Ack1 association with ubiquitin and p62/SQSTM, 5
act as an underlying mechanism to a non-canonical trafficking of EGFR. 6
In summary, our studies identify a novel role for Ack1 in a non-canonical degradative 7
pathway. We propose that Ack1 ‘shuttles’ between the p62/SQSTM1 compartments and the 8
canonical endocytic pathway, and prevents EGFR degradation via classical lysosomal 9
degradation. 10
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
15
Materials and Methods 1
Antibodies and Reagents 2
Anti-GFP (D5.1), anti-HA-Tag (C29F4), anti-EEA1 and anti-EGFR polyclonal and 3
,monoclonal (D38B1) antibodies were purchased from Cell Signalling. Anti-ACK (A-11 and 4
C20) and anti-EGFR (R-1) were from Santa Cruz Biotechnology (Santa Cruz, CA, USA), 5
anti-c-myc (clone 9E10) from Roche Diagnostics (Mannheim, Germany). Anti-SQSTM1 6
(M01) (clone 2C11) was purchased from Abnova Taipei City, Taiwan), anti-Rab11 from 7
Invitrogen (Camarillo, CA, USA), anti-Atg16L from MBL International (Woburn, MA, 8
USA). anti-LBPA (6C4) was from Echelon (Salt Lake City, UT, USA) and anti-α-tubulin 9
from Sigma (Saint Louis, MO, USA). Alexa-Fluor-conjugated secondary antibodies for 10
immunostaining were purchased from Invitrogen. Infrared dye-conjugated secondary 11
antibodies for Western blotting as well as Quick Western Kit were purchased from Li-cor 12
(Lincoln, NE, USA). Mouse IgG was purchased from Santa Cruz, Lysotracker Red DND-99 13
from Invitrogen. Small interfering RNA (siRNA) against TNK2 and non-targeting iRNA 14
control were purchased from Dharmacon (Lafayette, CO, USA). EGF, heparin and poly-D-15
lysine were from Sigma and bafilomycin A1 from Merck Millipore (Darmstadt, Germany). 16
The FGF2 was made in-house (Anderson et al., 1998). Briefly, the protein (155 amino acids; 17
18 kDa) was expressed in E.coli from the bacterial expression vector pFC80 (provided by Dr. 18
Antonella Isacchi, Pharmacia & Upjohn, Milan, Italy) and purified by heparin-column 19
chromatography. 20
21
Plasmids 22
The murine Ack1 isoform 2 (UniProt: O54967-2) (1008 a.a.) amino terminal myc-tagged in 23
pcDNA3 vector and GFP-tagged in pEGFP-C1 vector were kindly provided by Dr. Wannian 24
Yang (Geisinger, Danville, PA, USA). For mCherry-Ack1, open reading frame (ORF) was 25
subcloned into pmCherry-C1 vector (Clontech, Mountain View, CA, USA). ORF of human 26
Ack1 isoform 2 (truncated Ack1) (UniProt: Q07912-2) in a Gateway (Invitrogen) pDONR 27
vector (Open Biosystems, Huntsville, AL, USA) was subcloned into GFP-pcDNA3, myc-28
PRK5 and pmCherry-C1 vectors. Human hFGFR1-pcDNA3.1 was a gift from Associate 29
Prof. Pamela Maher (The Scripps Research Institute, Ca, USA); human FGFR2-pEGFP-N2 30
was provided by Prof. John Ladbury (University of Texas M. D. Anderson Cancer Center, 31
Houston, TX). EGFR-pEGFP-N1 was provided by Prof. Alexander Sorkin (University of 32
Colorado, Aurora, Co, USA), pcDNA-3 L61-Cdc42-GFP encoding GFP-tagged 33
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
16
constitutively active Cdc42 (caCdc42) was provided by Dr. Neil Hotchin (University of 1
Birmingham, Birmingham, UK). Rab5-EGFP was provided by Dr. Alexandre Benmerah 2
(Cochin Institute, Paris, France). Ubiquitin/HA fusion in pMT123 vector was provided by 3
Prof. Ronald Hay, University of St. Andrews, North Haugh, St. Andrews, Fife, UK). Flag-4
p62/SQSTM1 in pcDNA3.1 vector was provided by Prof. Robert Layfield (University of 5
Nottingham, Nottingham, UK). 6
7
Ack1 C-terminal truncation mutants 8
C-terminal truncations of murine Ack1 isoform 2 were generated via PCR from a full-length 9
construct using forward and reverse primers with EcoR1 and BamH1 digestion sites, 10
respectively. The linear products were digested with EcoR1 and BamH1 restriction enzymes 11
(New England Biolabs, Ipswich, MA, USA) and ligated with pmCherry-C1 vector using T4 12
ligase (New England Biolabs). The following primers were used: forward primer for all 13
mutants: TGAGTCCGTAGAATTCGATGCAGCCGGAGGAGGGA and reverse primers for 14
ΔUBA mutant (1-910 a.a.) TAGCCTAAGTGGATCCTCATCTGACGGTGGCAGT, 15
ΔMIG6 mutant (1-680 a.a.) TAGCCTAAGTGGATCCTCAGGGCATCTGCGCCTG, ΔPRD 16
MUTANT (1-610 a.a.) TAGCCTAAGTGGATCCTCACCGTGTGGGGCTCTG. 17
18
Cell culture and transfection 19
Human embryonic kidney 293T (293T) and HeLa cells were cultured in Dulbecco’s Modified 20
Eagle Medium (DMEM) supplemented with 10% FBS with 100 IU./ml penicillin, 0.1 mg/ml 21
streptomycin and 2 mM L-glutamine, at 37 °C with 5% CO2. LNCaP cells were cultured in 22
RPMI 1640 medium supplemented with 10% FBS with 100 I.U./ml penicillin, 0.1 mg/ml 23
streptomycin, with addition of 2 mM L-glutamine, at 37 °C with 5% CO2. 293T and HeLa 24
cells were transfected with GeneJuice Transfection Reagent (Novagen, Billerica, MA, USA) 25
and LNCaP cells with Lipofectamine 2000 (Invitrogen), according to manufacturers’ 26
instructions. Cells were incubated for further 48 hours post-transfection to allow for protein 27
expression. Upon cell lysis, protein concentration in cell lysates was determined by 28
Coomassie (Bradford) Protein Assay Kit (Pierce, Rockford, IL, USA) according to the 29
manufacturer’s instruction. Cell lysates were adjusted to the same protein concentration per 30
experiment. 31
32
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
17
Cell treatment 1
When indicated, cells were starved for 4 hours in medium without serum followed by 2
stimulation with FGF2 (20 ng/ml) and heparin (10 µg/ml), or with EGF (100 ng/ml for HeLa 3
and 293T cells and 20 ng/ml for LNCaP cells) for indicated times. Cells were incubated with 4
bafilomycin A1 (400 nM) for 4 hours prior to stimulation. In the case of lysosomal staining, 5
cells were pre-incubated with LysoTracker Red (100 nM) for 30 minutes, washed twice with 6
ice-cold PBS and placed in cell imaging medium (10 µM HEPES-HBSS, pH 7.4) for live-cell 7
imaging. 8
9
Immunoprecipitation and Western blotting 10
Immunoprecipitation was performed using Protein G-Sepharose beads (Sigma), Dynabeads 11
(Invitrogen) or GFP-Trap (ChromoTek, Planegg-Martinsried, Germany) as indicated. For 12
antibody cross-linking, Dynabeads conjugated with α-Ack1 antibody were incubated with 13
dimethyl pimelidate dihydrochloride (Sigma) in triethanolamine (pH 8.2) (Sigma) following 14
by a glycine wash (pH 3.0) (Fishers Scientific, Fair Lawn, NJ, USA). Immunoblots were 15
imaged via Odyssey Application Software version 3.0 with Odyssey Imaging System (Li-16
cor). 17
18
Immunostaining and cell imaging 19
Cells were plated onto coverslips 24-48 hours prior to immunostaining. In the case of LNCaP 20
cells, coverslips were additionally pre-coated with poly-D-lysine (0.01 mg/ml) (Sigma) to 21
enable cell attachment to coverslips. Cells were washed twice with ice-cold PBS and fixed in 22
4% paraformaldehyde (PFA) (Electron Microscopy Sciences, Hatfield, PA, USA) or -20°C 23
methanol (for α-Atg16L antibody). PFA-fixed cells were permeabilised with ice-cold 0.1% 24
Triton X-100 (Sigma) for 5 minutes or 0.2% Triton X-100 for 3 minutes. For live-cell 25
imaging, cells were plated onto a dish with a glass coverslip bottom (MalTek, Ashland, MA, 26
USA) in cell imaging medium at 37 °C. Images were acquired via Nikon A1R confocal 27
microscope using 60x oil objective (N.A. 1.49) and analysed with Nikon NIS Elements 28
software. 29
30
Image quantification 31
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
18
For assessing colocalisation via Pearson’s Correlation Coefficient (PCC), a line was drawn 1
around a cell, and the correlation between two channels (e.g. green and red) was measured as 2
PCC. In the case of additional quantification with pixel shift, one channel (e.g. green) was 3
shifted one pixel at time with reference to another channel (e.g. red), up to ten pixels. The 4
gradual decrease in PCC was considered as genuine colocalisation. For assessing 5
colocalisation as a percentage, puncta were circled and those which colocalised with another 6
channel were counted and expressed as a percentage. As a negative control, the circles were 7
moved into adjacent areas negative for fluorescence in a given channel, and the random 8
colocalisation with another channel was quantified. The data were collected from at least 9
three experiments, with minimum three cells per experiment quantified. 10
11
Real-time quantitative Polymerase Chain Reaction (RT-qPCR) 12
LNCaP cells were transfected with siRNA against Ack1 or non-targeting RNAi control. 48 13
hours post-tramsfections cells were trypsinised and harvested by centrifugation, and RNA 14
was isolated with RNeasy Mini kit (Quiagen, Hilden, Germany). RNA concentration was 15
validated with NanoDrop, and 2 µg of RNA was subjected for synthesis of the cDNA with 16
cDNA synthesis kit (Life Technologies, Carlsbad, CA, USA). 25 ng of cDNA was added to 17
the PCR mix with primers for Ack1 (TNK2) or 18S (Applied Biosystems). RT-qPCR was 18
performed with ABI Prism® 7000 Sequence Detection System (Applied Biosystems, Foster 19
City, CA, USA). The data were collected from three experiments. 20
21
Statistical analysis 22
All the data were analysed with two-tailed Student’s t-test to compare the differences 23
between two means. * represents p value 0.05>p>0.01, ** represents 0.01>p>0.001 and *** 24
represents p<0.001. 25
26
27
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
19
Acknowledgements 1
This work was supported by Cancer Research UK (C80/A10171). The Nikon A1R/TIRF 2
microscope used in this study was obtained through the Birmingham Science City 3
Translational Medicine Clinical Research and Infrastructure Trials Platform, with support 4
from Advantage West Midlands. We thank Susan Brewer for cloning of the following 5
constructs: mCherry-Ack1, myc-tagged and GFP-tagged truncated Ack1, generation the C-6
terminal truncation mutants of Ack1, and for bacterial expression and purification of FGF2. 7
We also thank Professor Hing Leung (The Beatson Institute for Cancer Research, Glasgow, 8
UK) for providing LNCaP cells. 9
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
20
Anderson, J., Burns, H. D., Enriquez-Harris, P., Wilkie, A. O. M. and Heath, J. K. (1998). Apert 1
syndrome mutations in fibroblast growth factor receptor 2 exhibit increased affinity for FGF ligand. 2
Human Molecular Genetics 7, 1475-1483. 3
4
Bjorkoy, G., Lamark, T., Brech, A., Outzen, H., Perander, M., Overvatn, A., Stenmark, H. and 5
Johansen, T. (2005). p62/SQSTM1 forms protein aggregates degraded by autophagy and has a 6
protective effect on huntingtin-induced cell death. Journal of Cell Biology 171, 603-614. 7
8
Burke, P., Schooler, K. and Wiley, H. S. (2001). Regulation of epidermal growth factor receptor 9
signaling by endocytosis and intracellular trafficking. Molecular Biology of the Cell 12, 1897-1910. 10
11
Chan, W., Tian, R., Lee, Y.-F., Sit, S. T., Lim, L. and Manser, E. (2009). Down-regulation of 12
Active ACK1 Is Mediated by Association with the E3 Ubiquitin Ligase Nedd4-2. Journal of 13
Biological Chemistry 284, 8185-8194. 14
15
Chazotte, B. (2011). Labeling lysosomes in live cells with LysoTracker. Cold Spring Harbor 16
Protocols 2011, 17
18
Citri, A. and Yarden, Y. (2006). EGF-ERBB signalling: towards the systems level. Nature Reviews: 19
Molecular Cell Biology 7, 505-516. 20
21
Di Fiore, P. P. and De Camilli, P. (2001). Endocytosis and signaling: An inseparable partnership. 22
Cell 106, 1-4. 23
24
Fung, C., Lock, R., Gao, S. Z., Salas, E. and Debnath, J. (2008). Induction of autophagy during 25
extracellular matrix detachment promotes cell survival. Molecular Biology of the Cell 19, 797-806. 26
27
Goh, L. K., Huang, F., Kim, W., Gygi, S. and Sorkin, A. (2010). Multiple mechanisms collectively 28
regulate clathrin-mediated endocytosis of the epidermal growth factor receptor. Journal of Cell 29
Biology 189, 871-883. 30
31
Grovdal, L. M., Johannessen, L. E., Rodland, M. S., Madshus, I. H. and Stang, E. (2008). 32
Dysregulation of Ack1 inhibits down-regulation of the EGF receptor. Experimental Cell Research 33
314, 1292-1300. 34
35
Johansen, T. and Lamark, T. (2011). Selective autophagy mediated by autophagic adapter proteins. 36
Autophagy 7, 279-296. 37
38
Kraft, C., Peter, M. and Hofmann, K. (2010). Selective autophagy: ubiquitin-mediated recognition 39
and beyond. Nature Cell Biology 12, 836-841. 40
41
Lamark, T., Kirkin, V., Dikic, I. and Johansen, T. (2009). NBR1 and p62 as cargo receptors for 42
selective autophagy of ubiquitinated targets. Cell Cycle 8, 1986-1990. 43
44
Levkowitz, G., Waterman, H., Zamir, E., Kam, Z., Oved, S., Langdon, W. Y., Beguinot, L., 45
Geiger, B. and Yarden, Y. (1998). c-Cbl/Sli-1 regulates endocytic sorting and ubiquitination of the 46
epidermal growth factor receptor. Genes & Development 12, 3663-3674. 47
48
Lin, Q., Wang, J., Childress, C., Sudol, M., Carey, D. J. and Yang, W. (2010). HECT E3 49
Ubiquitin Ligase Nedd4-1 Ubiquitinates ACK and Regulates Epidermal Growth Factor (EGF)-50
Induced Degradation of EGF Receptor and ACK. Molecular and Cellular Biology 30, 1541-1554. 51
52
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
21
Liu, Y., Karaca, M., Zhang, Z., Gioeli, D., Earp, H. S. and Whang, Y. E. (2010). Dasatinib 1
inhibits site-specific tyrosine phosphorylation of androgen receptor by Ack1 and Src kinases. 2
Oncogene 29, 3208-3216. 3
4
Madshus, I. H. and Stang, E. (2009). Internalization and intracellular sorting of the EGF receptor: a 5
model for understanding the mechanisms of receptor trafficking. Journal of Cell Science 122, 3433-6
3439. 7
8
Mahajan, N. P., Whang, Y. E., Mohler, J. L. and Earp, H. S. (2005). Activated tyrosine kinase 9
Ack1 promotes prostate tumorigenesis: Role of Ack1 in polyubiquitination of tumor suppressor 10
Wwox. Cancer Research 65, 10514-10523. 11
12
Manser, E., Leung, T., Salihuddin, H., Tan, L. and Lim, L. (1993). A nonreceptor tyrosine kinase 13
that inhibits the GTPase activity of p21(CDC42). Nature 363, 364-367. 14
15
Mardakheh, F. K., Auciello, G., Dafforn, T. R., Rappoport, J. Z. and Heath, J. K. (2010). Nbr1 16
Is a Novel Inhibitor of Ligand-Mediated Receptor Tyrosine Kinase Degradation. Molecular and 17
Cellular Biology 30, 5672-5685. 18
19
Mardakheh, F. K., Yekezare, M., Machesky, L. M. and Heath, J. K. (2009). Spred2 interaction 20
with the late endosomal protein NBR1 down-regulates fibroblast growth factor receptor signaling. 21
Journal of Cell Biology 187, 265-277. 22
23
Mari, M., Tooze, S. A. and Reggiori, F. (2011). The puzzling origin of the autophagosomal 24
membrane. F1000 Biology Reports 3, 25. 25
26
Matsushita, M., Suzuki, N. N., Obara, K., Fujioka, Y., Ohsumi, Y. and Inagaki, F. (2007). 27
Structure of Atg5 center dot Atg16, a complex essential for autophagy. Journal of Biological 28
Chemistry 282, 6763-6772. 29
30
Mizushima, N., Yoshimori, T. and Ohsumi, Y. (2011). The Role of Atg Proteins in Autophagosome 31
Formation. Annual Review of Cell and Developmental Biology 27, 107-132. 32
33
Pankiv, S., Clausen, T. H., Lamark, T., Brech, A., Bruun, J.-A., Outzen, H., Overvatn, A., 34
Bjorkoy, G. and Johansen, T. (2007). p62/SQSTM1 binds directly to Atg8/LC3 to facilitate 35
degradation of ubiquitinated protein aggregates by autophagy. Journal of Biological Chemistry 282, 36
24131-24145. 37
38
Prieto-Echaguee, V., Gucwa, A., Craddock, B. P., Brown, D. A. and Miller, W. T. (2010). 39
Cancer-associated Mutations Activate the Nonreceptor Tyrosine Kinase Ack1. Journal of Biological 40
Chemistry 285, 10605-10615. 41
42
Rappoport, J. Z. and Simon, S. M. (2009). Endocytic trafficking of activated EGFR is AP-2 43
dependent and occurs through preformed clathrin spots. Journal of Cell Science 122, 1301-1305. 44
45
Ravikumar, B., Moreau, K., Jahreiss, L., Puri, C. and Rubinsztein, D. C. (2010). Plasma 46
membrane contributes to the formation of pre-autophagosomal structures. Nature Cell Biology 12, 47
747-U715. 48
49
Razi, M., Chan, E. Y. W. and Tooze, S. A. (2009). Early endosomes and endosomal coatomer are 50
required for autophagy. Journal of Cell Biology 185, 305-321. 51
52
Schneider, M. R. and Wolf, E. (2009). The Epidermal Growth Factor Receptor Ligands at a Glance. 53
Journal of Cellular Physiology 218, 460-466. 54
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
22
1
Seto, E. S., Bellen, H. J. and Lloyd, T. E. (2002). When cell biology meets development: endocytic 2
regulation of signaling pathways. Genes & Development 16, 1314-1336. 3
4
Shen, F., Lin, Q., Gu, Y., Childress, C. and Yang, W. (2007). Activated Cdc42-associated kinase 1 5
is a component of EGF receptor signaling complex and regulates EGF receptor degradation. 6
Molecular Biology of the Cell 18, 732-742. 7
8
Shen, H., Ferguson, S. M., Dephoure, N., Park, R., Yang, Y., Volpicelli-Daley, L., Gygi, S., 9
Schlessinger, J. and De Camilli, P. (2011). Constitutive activated Cdc42-associated kinase (Ack) 10
phosphorylation at arrested endocytic clathrin-coated pits of cells that lack dynamin. Molecular 11
Biology of the Cell 22, 493-502. 12
13
Sorkin, A. and Goh, L. K. (2009). Endocytosis and intracellular trafficking of ErbBs. Experimental 14
Cell Research 315, 683-696. 15
16
Stenmark, H. (2009). Rab GTPases as coordinators of vesicle traffic. Nature Reviews: Molecular 17
Cell Biology 10, 513-525. 18
19
Teo, M., Tan, L., Lim, L. and Manser, E. (2001). The tyrosine kinase ACK1 associates with 20
clathrin-coated vesicles through a binding motif shared by arrestin and other adaptors. Journal of 21
Biological Chemistry 276, 18392-18398. 22
23
Tooze, S. A. and Razi, M. (2009). The essential role of early endosomes in autophagy is revealed by 24
loss of COPI function. Autophagy 5, 874-875. 25
26
Wang, R. C. and Levine, B. (2010). Autophagy in cellular growth control. Febs Letters 584, 1417-27
1426. 28
29
Yamamoto, A., Tagawa, Y., Yoshimori, T., Moriyama, Y., Masaki, R. and Tashiro, Y. (1998). 30
Bafilomycin A(1) prevents maturation of autophagic vacuoles by inhibiting fusion between 31
autophagosomes and lysosomes in rat hepatoma cell line, H-4-II-E cells. Cell Structure and Function 32
23, 33-42. 33
34
35
36
37
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
23
Fig. 1. Ack1 interacts with EGFR, but not with FGFR. (A) 293T cells transfected with 1
myc-Ack1 and EGFR-GFP, FGFR2-GFP or constitutive active Cdc42-GFP (caCDC42-GFP) 2
were serum-starved following by 20 minutes stimulation with EGF or FGF2 and heparin. 3
Cells were lysed and subjected to immunoprecipitation with α-myc antibody. Western blot 4
(WB): α-GFP and α-Ack1 antibodies, (B) HeLa cells transfected with mCherry-Ack1 and 5
EGFR-GFP or FGFR2-GFP were serum-starved following by 30 minutes stimulation with 6
EGF or FGF2 with heparin. Cells were fixed and imaged via confocal microscopy. The graph 7
represents quantification of colocalisation via PCC between Ack1 and EGFR or FGFR2 upon 8
stimulation with EGF or FGF2, respectively, (C) LNCaP cells were serum-starved and 9
stimulated with EGF for 10 or 30 minutes. Cells were fixed and immunostained with α-Ack1 10
and α-EGFR antibodies. Scale bars 10 µm. Error bars represent SEM. 11
12
Fig. 2. Mig6 and CBD of Ack1 regulate colocalisation with EGFR post-EGF stimulation. 13
(A) mCherry-tagged C-terminal truncation mutants of Ack1 and tAck1, (B) HeLa cells 14
transfected with EGFR-GFP and mCherry-tagged Ack1, tAck1 or Ack1 mutants were serum-15
starved and stimulated with EGF for 30 minutes and fixed. For colocalisation as percentage, 16
Ack1, tAck1 or the Ack1 mutants’ puncta were circled and the colocalisation with EGFR was 17
quantified. Scale bars 10 µm. Error bars represent SEM. 18
19
Fig. 3. Ack1 partially colocalises with early endosomes and Atg16L-positive structures 20
upon EGF stimulation. (A) HeLa cells transfected with mCherry-Ack1 were serum-starved 21
and stimulated with EGF for indicated times and fixed, (B) HeLa cells transfected with GFP-22
Ack1 were serum-starved and stimulated with EGF for indicated times, fixed and 23
immunostained with α-Atg16L antibody. Scale bar 10 µm. For colocalisation as percentage, 24
Ack1 puncta were circled, (C) LNCaP cells were serum-starved and stimulated with EGF for 25
indicated times, lysed and subjected to IP with α-Atg16L antibody or with mouse IgG as a 26
negative control. WB: α-Atg16L and α-Ack1. Scale bars 10 µm. Error bars represent SEM. 27
28
Fig. 4. EGFR colocalises with Ack1 within ubiquitin-rich compartments upon EGF 29
treatment. (A) HeLa cells transfected with GFP-Ack1 or GFP-tAck1 and HA-ubiquitin were 30
fixed and immunostained with α-HA antibody, (B) 293T cells transfected with GFP-Ack1 or 31
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
24
GFP-tAck1 and HA-ubiquitin were serum-starved and stimulated with EGF for 30 min, lysed 1
and subjected to pull-down with GFP-trap to precipitate GFP-tagged proteins. WB: α-GFP 2
and α-HA (C) HeLa cells transfected with mCherry-Ack1, EGFR-GFP and HA-ubiquitin 3
were serum starved and stimulated with EGF for 30 min, fixed and immunostained with α-4
HA antibody. For colocalisation as percentage, Ack1 puncta were circled. Nuclear 5
localisation was excluded from analysis. Scale bars 10 µm. Error bars represent SEM. 6
7
Fig. 5. Ack1 interacts with an autophagy receptor p62/SQSTM1, and this interaction 8
decreases upon EGF stimulation. (A) HeLa cells transfected with GFP-Ack1 and p62-flag 9
were serum starved and stimulated with EGF for 30 min, fixed and immunostained with α-10
SQSTM1 antibody, (B) LNCaP cells were serum starved in the presence or absence of 11
bafilomycin and stimulated with EGF for 10 min, lysed and subjected to IP with α-Ack1 12
antibody or mouse IgG as a negative control. WB: α-Ack1 and α-SQSTM1, (C) HeLa cells 13
transfected with mCherry-Ack1 and NBR1-GFP were serum starved and stimulated with 14
EGF for 30 minu and fixed. For colocalisation as percentage, Ack1 puncta were circled, (D) 15
HeLa cells co-transfected with mCherry-Ack1, NBR1-GFP and p62-flag were serum-starved 16
and stimulated with EGF for 30 min, fixed and immunostained with α-SQSTM1 antibody. 17
For colocalisation as percentage, Ack1 puncta were circled and the colocalisation with NBR1 18
and p62/SQSTM1, or between NBR1 and p62/SQSTM1 within the Ack1 puncta, has been 19
quantified. Scale bars 10 µm. Error bars represent SEM. 20
21
Fig. 6. p62/SQSTM1 partially colocalises with Ack1 and EGFR upon EGF stimulation. 22
HeLa cells transfected with mCherry-Ack1, EGFR-GFP and p62-flag were serum starved and 23
stimulated with EGF for 30 min, fixed and immunostained with α-SQSTM1 antibody. For 24
colocalisation as percentage, Ack1 puncta were circled and the colocalisation with EGFR and 25
p62/SQSTM1, or between EGFR and p62/SQSTM1 within the Ack1 puncta, has been 26
quantified. Scale bars 10 µm. Error bars represent SEM. 27
28
Fig. 7. The UBA domain of Ack1 is critical for the association with p62/SQSTM1 and 29
confers EGF sensitivity to this association. HeLa cells transfected with p62-flag and 30
mCherry-tagged Ack1, tAck1 or Ack1 mutants were serum-starved and stimulated with EGF 31
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
25
for 30 min, fixed and immunostained with α-SQSTM1 antibody. For colocalisation as 1
percentage, Ack1, tAck1 or the Ack1 mutants’ puncta were circled. Scale bars 10 µm. Error 2
bars represent SEM. 3
4
Fig. 8. Ack1 silencing results in increased transient lysosomal localisation of EGFR. (A) 5
LNCaP cells transfected with EGFR-GFP and siRNA for Ack1 or non-silencing RNAi 6
control were serum starved and incubated with LysoTracker Red for 30 minutes. Live-cell 7
imaging was performed upon 30 minutes of EGF stimulation. PCC was measured for the area 8
within a cell (excluding the plasma membrane) at indicated times of EGF stimulation. For 9
normalisation, PCC in unstimulated cells (0 min EGF) was set as 1, and the changes in PCC 10
upon EGF stimulation were calculated relatively to the PCC value in unstimulated cells. 11
Scale bars 10 µm. Error bars represent SEM, (B) Schematic role of Ack1 in EGFR 12
trafficking. Ack1 is predominantly present within p62/SQSTM1-rich compartments in 13
serum-starved cells. Upon EGF stimulation, a portion of Ack1 translocates away from 14
p62/SQSTM1-rich compartments to early-endosomes, and diverts EGFR trafficking into a 15
non-canonical degradative pathway. When Ack1 is knocked-down, EGFR traffics via a 16
canonical lysosomal pathway. 17
18
Fig. S1. (A) Ack1 does not interact with FGFR1. 293T cells transfected with myc-Ack1 19
and FGFR1 were in complete medium (n/a) or serum-starved and stimulated with FGF2 and 20
heparin for 20 minutes. Cells were lysed and subjected to immunoprecipitation with α-21
FGFR1 antibody. WB: α-FGFR1 and α-Ack1 antibodies, (B) Schematic domain structure 22
of full-length and truncated Ack1, (C) Truncated Ack1 does not colocalise with EGFR 23
post-EGF. HeLa cells transfected with myc-tAck1 and EGFR-GFP were serum-starved and 24
stimulated with EGF for 30 minutes, fixed and immunostained with α-myc antibody. Scale 25
bars 10 µm. 26
27
Fig. S2. Ack1 partially colocalises with Rab5 post-EGF, and with Atg16. A) HeLa cells 28
transfected with mCherry-Ack1 and GFP-tagged Rab5 were serum-starved and stimulated 29
with EGF for various times. Cells were fixed and analysed via confocal microscopy. The 30
graph represents the quantification of colocalisation between Ack1 and Rab5 at various times 31
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
26
post-EGF, (B) LNCaP cells were serum-starved and stimulated with EGF for various times. 1
Cells were fixed and immunostained with α-Ack1 and α-Atg16 antibodies, and analysed via 2
confocal microscopy. Scale bars 10 µm. Error bars represent SEM. 3
4
Fig. S3. Ack1 localises within ubiquitin-rich compartments. HeLa cells transfected with 5
mCherry-Ack1 and HA-ubiquitin were fixed and immunostained with α-HA antibody, (B) 6
Several domains contribute to the colocalisation between Ack1 and ubiquitin. HeLa cells 7
transfected with HA-ubiquitin and mCherry-tagged Ack1, tAck1 or Ack1 mutants were 8
serum-starved and stimulated with EGF for 30 minutes. Cells were fixed, immunostained 9
with α-HA antibody and imaged via confocal microscopy. The graph represents the 10
quantification of colocalisation between Ack1, tAck1 or the Ack1 mutants and ubiquitin as in 11
Fig. 2B. Scale bars 10 µm. Error bars represent SEM. 12
13
Fig. S4. Both p62/SQSTM1 and NBR1 interact with Ack1. 293T cells transfected with 14
myc-Ack1, NBR1-GFP and p62/SQSTM1-flag were serum-starved and stimulated with EGF 15
for 30 minutes. Cells were lysed and subjected to immunoprecipitation with α-myc antibody. 16
WB: α-Ack1, α-GFP and α-SQSTM1 antibodies. 17
18
Fig. S5. Endogenous EGFR and p62/SQSTM1 partially colocalise in the presence and 19
absence of Ack1. A) LNCaP cells transfected with siRNA against Ack1 or non-targeting 20
RNAi control were serum-starved and stimulated with EGF for indicated times. The cells 21
were fixed and immunostained with α-EGFR and α-SQSTM1 antibodies, B) LNCaP cells 22
were transfected with siRNA against Ack1 or non-targeting RNAi control and lysed. WB: α-23
Ack1, α-tubulin. 24
25
Fig. S6. The association between Ack1 and NBR1 is not mediated by the UBA domain. 26
HeLa cells transfected with mCherry-Ack1 or ΔUBA mutant and NBR1-GFP were serum-27
starved and stimulated with EGF for 30 minutes. Cells were fixed and imaged via confocal 28
microscopy. The graph represents the quantification of colocalisation between Ack1 or 29
ΔUBA mutant and NBR1 as in Fig. 2B. Scale bars 10 µm. Error bars represent SEM. 30
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
27
Fig. S7. Ack1 silencing in LNCaP cells. A) LNCaP cells were transfected with siRNA 1
against Ack1 or non-targeting RNAi control and EGFR-GFP, and lysed. WB: α-Ack1, α-2
EGFR and α-tubulin, B) LNCaP cells were transfected with siRNA against Ack1 or non-3
targeting RNAi control. Total RNA was isolated following by the cDNA synthesis, and the 4
levels of Ack1 cDNA were quantified in reference to ribosomal 18S cDNA. Error bars 5
represent SEM. 6
7
Fig. S8. EGFR degradation rate is not affected by Ack1 knock-down. LNCaP cells 8
transfected with siRNA against Ack1 or non-targeting RNAi control were serum-starved and 9
stimulated with EGF for indicated times, then lysed. WB: α-Ack1, α-EGFR, α-tubulin. 10
Densitometry analysis from five experiments was performed using Odyssey Imaging System 11
(Li-cor). Error bars represent SEM. 12
13
Movie S1 and Movie S2. Ack1 silencing results in increased lysosomal localisation of 14
EGFR. LNCaP cells transfected with EGFR-GFP and non-silencing RNAi control (Movie 15
S1) or siRNA for Ack1 (Movie S2) were serum starved and incubated with LysoTracker Red 16
for 30 minutes. Live-cell imaging was performed upon 30 minutes of EGF stimulation, one 17
frame per minute 18
19
20
21
22
23
24
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
