113RESEARCH ARTICLE

INTRODUCTIONPlant embryos exhibit both apicobasal and central-peripheral (radial)polarity. The shoot and root apical meristems (SAM and RAM,respectively) form at opposite ends of the apicobasal axis andcontain stem cell populations that give rise to all postembryonictissue. Lateral organs such as cotyledons arise at the boundary of thecentral and peripheral domains, and adopt the pattern present in theradial axis of the embryo. Thus, genes that specify central identityare also expressed on the adaxial (upper) side of developingcotyledon primordia, whereas genes that specify peripheral identityare expressed on the abaxial (lower) side. This continuity supportsthe conclusion that the adaxial surface of a lateral organ is acomponent of the central domain, whereas the abaxial side is acomponent of the peripheral domain (Kerstetter et al., 2001;McConnell et al., 2001).

Genes involved in the specification of radial polarity were initiallyidentified in screens for mutations that affect the adaxial-abaxialpolarity of leaves and floral organs. In Arabidopsis, these screenshave produced mutations in three families of transcription factors.Members of the class III HD-ZIP family of transcription factorspromote adaxial identity (McConnell et al., 2001; Emery et al.,2003), whereas KANADI (KAN) and YABBY (YAB) transcriptionfactor families promote peripheral and abaxial identity (Kerstetteret al., 2001; Eshed et al., 2001; Siegfried et al., 1999). Evidence thatthese genes are also important for embryonic development isprovided by the phenotype of gain-of-function alleles, and thephenotype of embryos lacking more than one member of these genefamilies. For example, mutations that cause the HD-ZIP III genePHB to be ectopically expressed in the peripheral-abaxial domainproduce SAMs (central structures) on the abaxial side of leaves

(McConnell and Barton, 1998). Conversely, phb phv rev triplemutants lack a SAM (Emery et al., 2003). Ectopic expression ofKAN1 in the central domain of the embryo blocks the developmentof the SAM, whereas kan1 kan2 kan4 triple mutant embryos haveoutgrowths on the abaxial surface of cotyledons and the peripheryof the hypocotyl that have characteristics of leaf primordia(Kerstetter et al., 2001; Izhaki and Bowman, 2007).

The studies described above have begun to address thedevelopmental role of KAN genes in embryonic and postembryonicdevelopment. However, the mechanism responsible for the initialestablishment of radial polarity in embryogenesis remains a mystery.To identify factors in the polarity pathway that act upstream of KANgenes, we took advantage of an enhancer trap insertion in KAN2 thatexpresses green fluorescent protein (GFP) in the peripheral-abaxialdomain of both embryonic and postembryonic organs. A screen formutations that affect the expression of this reporter produced allelesof two genes, GRAND CENTRAL (GCT) and CENTER CITY (CCT),which we found encode the Arabidopsis homologs of MED13 andMED12.

In yeasts and animals, Med13 and Med12 act as transcriptionalrepressors by inhibiting core Mediator, a multisubunit complex thatallows transcription factors bound at upstream enhancer elements toactivate RNA polymerase II. Med13 and Med12 have identicalmutant phenotypes in each organism (Samuelsen et al., 2003; Yodaet al., 2005; Janody et al., 2003), indicating that they have similarbiological functions. In humans, MED13 negatively regulatestranscription by causing an allosteric change in core Mediator thatprevents its association with RNA polymerase II (Knuesel et al.,2009), whereas MED12 recruits the histone methyltransferase G9ato core Mediator, promoting epigenetic silencing of target genes viamethylation of chromatin H3K9 (Ding et al., 2008). In yeasts andDrosophila, Med13 and Med12 physically interact with Cyclin-dependent kinase 8 (Cdk8) and Cyclin C (CycC) to form a complexknown as the Cdk8 module of Mediator (Samuelsen et al., 2003;Loncle et al., 2007). However, the observation that in DrosophilaCdk8 and CycC do not have the same mutant phenotype as Med13(skd – FlyBase) and Med12 (kto – FlyBase), implies that these

Development 137, 113-122 (2010) doi:10.1242/dev.043174

1Department of Biological Sciences, University of Pennsylvania, Philadelphia, PA19104, USA. 2Department of Plant Biology and Pathology, The Waksman Institute,Rutgers University, Piscataway, NJ 08854, USA.

*Author for correspondence (spoethig@sas.upenn.edu)

Accepted 9 October 2009

SUMMARYThe Arabidopsis embryo becomes patterned into central and peripheral domains during the first few days after fertilization. Ascreen for mutants that affect this process identified two genes, GRAND CENTRAL (GCT) and CENTER CITY (CCT). Mutations in GCTand CCT delay the specification of central and peripheral identity and the globular-to-heart transition, but have little or no effecton the initial growth rate of the embryo. Mutant embryos eventually recover and undergo relatively normal patterning, albeit atan inappropriate size. GCT and CCT were identified as the Arabidopsis orthologs of MED13 and MED12 – evolutionarily conservedproteins that act in association with the Mediator complex to negatively regulate transcription. The predicted function of theseproteins combined with the effect of gct and cct on embryo development suggests that MED13 and MED12 regulate patternformation during Arabidopsis embryogenesis by transiently repressing a transcriptional program that interferes with this process.Their mutant phenotype reveals the existence of a previously unknown temporal regulatory mechanism in plant embryogenesis.

KEY WORDS: Arabidopsis, Embryo, Heterochrony, MEDIATOR, MED12, MED13, Polarity, KANADI

The MED12-MED13 module of Mediator regulates the timingof embryo patterning in ArabidopsisC. Stewart Gillmor1, Mee Yeon Park1, Michael R. Smith1, Robert Pepitone2, Randall A. Kerstetter2

and R. Scott Poethig1,*

DEVELO

PMENT

114

components are functionally distinct (Loncle et al., 2007). In bothDrosophila and Caenorhabditis elegans, Med13 and Med12 specifycell identity by regulating downstream targets of the Wnt signalingpathway (Janody et al., 2003; Yoda et al., 2005; Carrera et al., 2008).In particular, the Drosophila Med13 and Med12 genes skuld andkohtalo control the cell affinities that maintain boundaries betweenanteroposterior and dorsoventral compartment boundaries ofthe wing disc (Janody et al., 2003; Loncle et al., 2007). Thedevelopmentally specific phenotypes of mutations in Med13 andMed12 in Drosophila and C. elegans are consistent with amicroarray analysis of these genes in yeast, which indicates that theyregulate a relatively small number of genes (Samuelsen et al., 2003).This is in contrast to core Mediator, which is required for nearly alltranscription (Kornberg, 2005).

The core Mediator complex was recently purified fromArabidopsis suspension culture cells (Bäckström et al., 2007). Thepurified complex contained most of the components present in thecore complex in other organisms, but was missing proteins in theCdk8 module, consistent with the limited and transient interactionsobserved between these proteins and core Mediator in other systems(Andrau et al., 2006). The phenotype of mutations in twocomponents of the core complex (PFT1/MED25 and SWP/MED14)has been described in Arabidopsis. Mutations of PFT1/MED25delay flowering under suboptimal light conditions (Cerdán andChory, 2003; Bäckström et al., 2007), whereas mutations ofSWP/MED14 cause a premature arrest in cell proliferation duringvegetative growth, resulting in extreme dwarfing (Autran et al.,2002). By contrast, mutations in the Arabidopsis Cdk8 homologHEN3 have a mild reduction in cell expansion in leaves, and onlyshow more severe phenotypes in combination with mutations thataffect pre-mRNA processing (Wang and Chen, 2004).

Here we show that MED13 and MED12 regulate developmentalpatterning in Arabidopsis. We found that MED13, corresponding tothe GCT gene, and MED12, corresponding to the CCT gene, areabsolutely required for KAN expression during early embryogenesis,and promote KAN expression during postembryonic developmentas well. Analysis of markers for the SAM and vascular tissueshowed that gct and cct mutations have a unique effect on embryopatterning: the initiation of a number of patterning genes is delayedfor several days, after which they are expressed in an almost normalmanner. The expression pattern and proposed biochemical functionof GCT and CCT is consistent with a role for these genes intransiently repressing transcription of genes that would otherwiseinterfere with radial pattern formation. Our results reveal a role forMED12 and MED13 in the regulation of developmental timing, anduncover a novel temporal component of pattern formation inArabidopsis embryogenesis.

MATERIALS AND METHODSGenetic stocks and growth conditionsAll seed stocks are in the Columbia ecotype. Enhancer trap lines E2023 andE2331 were generated using the pBIN 35S mGAL4-VP16+UAS mGFP5-ER vector, containing a minimal promoter driving ER localized mGFP5(Haseloff, 1999). E2023 contains at least two copies of the GAL4-UAS::GFP enhancer trap in inverted orientation in the second intron of theKAN2 gene (at bp 2889 of the genomic sequence relative to start codon), aswell as a second linked T-DNA insertion between genes At1g29880 andAt1g29890. The enhancer sequences driving E2331 expression have notbeen defined. The kan1-12 allele (Kerstetter et al., 2001) and the kan2-4allele (SALK_095643) (Wu et al., 2008) were used for double mutantanalysis. Plants were grown under 16 hours fluorescent illumination (100E/m2; Sylvania VHO) at 22°C in Farfard #2 soil. SALK T-DNA insertionlines (Alonso et al., 2003) and SAIL T-DNA insertion lines (Sessions et al.,

2002) were obtained from the Arabidopsis Stock Center (ABRC) atwww.arabidopsis.org. Seed for gct-2, cct-1, E2023, E2331 and gPHB-GUShave been deposited in the Arabidopsis Stock Center (ABRC).

E2023 seeds were mutagenized as follows: 100 mg of seed wassuspended in 25 ml of water with 3 l Tween-20 for 15 minutes, rinsed andthen soaked overnight in water at 4°C on a rotator. Seeds were thensuspended in 10 ml of 0.4% ethyl methane sulfonate in 100 mM sodiumphosphate buffer (pH 7) for 9 hours on a rotator at room temperature, andsubsequently rinsed 10 times with 25 ml of water. Embryos from threeconsecutive siliques on the main inflorescence of 2500 M1 plants wereexamined for changes in E2023 expression and embryo morphology. Themain inflorescence of M1 plants was consistently found to have two or threesectors, and thus our screen comprised 5000-7500 individual mutagenizedsectors. Mutant lines were backcrossed three times before analysis.

Molecular biologyRNA in situ hybridization was performed using a protocol obtained fromJeff Long (www.its.caltech.edu/~plantlab/protocols/insitu.pdf), with thefollowing minor modifications. The probe was hybridized to slides at atemperature of 60-65°C overnight. The blocking and antibody dilutionsolutions were produced using maleic acid instead of Tris-HCl. For the STM,GCT and CCT probes, partial cDNA sequences were amplified andtranscribed using the following primers: STM-T7, 5�-CAAGCTTA -ATACGACTCACTATAGGGAAAGGATTGCCCAAGACAT-3�; STM-SP6, 5�-CTCTAGATTTAGGTGACACTATAGGATCCATC ATAA C G -AAATCGT-3�; GCT-SP6, 5�-ATTTAGGTGACACTATA GAAGC CC -CAAATTAGTTCTACAAGTGG-3�; GCT-T7, 5�-TAATA CGAC -TCACTAT AGGGAGACCAGGTCCAGAACCTCTGC-3�; CCT-SP6,5�-ATTTAG GTGACACTATAGAAGAAGCTTGTATCTGTATT AGATT -GC-3�; CCT-T7, 5�-TAATACGACTCACTATAGGGAGACCTTC CT -CAAT CACTTCC CC-3�.

The gPHB-GUS translational fusion construct was made by cloning10443 bp upstream of the PHB stop codon in front of the GUS+ gene in thepCAMBIA3300 vector, with an NAAIRS linker replacing the PHB stopcodon. This DNA fragment contains all sequences from the previous geneon the 5� end of PHB until the PHB stop codon, including all introns and themiR165/166 target sequence. Plants homozygous for the gPHB-GUSconstruct show mild adaxialized phenotypes, indicating that the PHB-GUSfusion protein is biologically active.

Microscopy and histologyThe E2023 genetic screen was conducted using a Leica MZFLIIIfluorescence microscope equipped with a long pass GFP filter. To detectGUS activity, embryos were stained at 37°C for 1h (pKAN::GUS,pSTM::GUS) or overnight (gPHB-GUS) according to Donnelly et al.(Donnelly et al., 1999). Embryos were cleared in Hoyer’s solution (bentcotyledon stage embryos) or mounted in 5% glycerol (globular to torpedostage) and examined with DIC optics. Confocal images were obtained usinga Leica TCS SL confocal microscope with a 20� water immersion lens.Embryos were removed from ovules using DuMont #5 forceps and mountedin 1�MS salts plus 500 mM glucose. Globular and heart stage embryoswere counterstained by adding Nile Red to MS-glucose to a finalconcentration of 3 g/ml (Jenik et al., 2005). For camera lucida drawings,wild-type and mutant leaves were vacuum infiltrated with 1% Tween 20 inwater, and manually sketched using an Olympus BX40 microscopeequipped with a U-DA light tube and mirror.

RESULTSA genetic screen to identify upstream regulatorsof peripheral-abaxial polarityThe KAN family of transcription factors specify peripheral-abaxialidentity beginning in early embryogenesis (Kerstetter et al., 2001;Eshed et al., 2004). To identify genes that act upstream of KAN inthe embryo polarity pathway, we took advantage of the enhancertrap line E2023, which contains a GAL4-UAS::GFP insertion(Haseloff, 1999) that disrupts the KAN2 gene (see Materials andmethods). This line expresses GFP strongly and constitutively

RESEARCH ARTICLE Development 137 (1)

DEVELO

PMENT

within the peripheral-abaxial domain of embryos, the abaxialvasculature of leaves and the abaxial domain of carpels (Fig. 1A-F),an expression pattern that is essentially identical to that of KAN2(Emery et al., 2003; Eshed et al., 2004). It has no obviousmorphological defect beyond the production of a small longitudinalridge of tissue below the first bract, and an occasional flower withfive petals (data not shown).

Examination of approximately 6000 mutagenized M1 sectors(see Materials and methods) yielded more than 50 mutant lineswith a heritable effect on E2023 expression. Five of these linessegregated embryos with a nearly identical recessive mutantphenotype, consisting of a decrease in the intensity of E2023expression (Fig. 1G-J,M-P), and an increase in size of the SAM(see below). Complementation analysis revealed that thesemutations represented two genes, which were named GRANDCENTRAL (GCT) (four alleles) and CENTER CITY (CCT) (oneallele), to reflect the increased size of the SAM and the decreasein expression of the peripheral-abaxial enhancer trap E2023. No

significant phenotypic differences were noted between the variousalleles of gct; gct-2 and cct-1 (hereafter referred to as gct and cct)were used for all of the experiments presented here. Homozygousplants produce very few seeds, and thus gct and cct embryos wereobtained from heterozygous plants, allowing us to stage thedevelopment of mutant embryos by observing wild-type embryossegregating in the same silique. Thus, for all analyses in thismanuscript, the developmental stage of mutant embryos wasinferred from wild-type siblings of the same chronological age.GCT and CCT also regulate the expression of E2023 duringpostembryonic development, and affect the timing of a variety ofdevelopmental transitions including the embryo-to-seedlingtransition, vegetative phase change and flowering time. Thispaper focuses primarily on their role in embryogenesis.

GCT and CCT are absolutely required for E2023 expression at theheart stage of embryogenesis, and promote the correct level ofexpression later in embryo development (Fig. 1G-J,M-P). E2023 isundetectable in gct embryos (Fig. 1G-I) until the bent cotyledon

115RESEARCH ARTICLETemporal control of embryo patterning

Fig. 1. Mutations in GRAND CENTRAL (GCT) and CENTER CITY (CCT) cause decreased expression of the peripheral-abaxial enhancertrap E2023. (A-F)E2023 is a KAN2 reporter expressed in the peripheral-abaxial domain of wild-type plants. Early heart (A), late heart (B), torpedo(C) and bent cotyledon (D) embryos; inset in D shows embryo cross section. Abaxial view of a 10-day-old seedling (E) reveals that E2023 isexpressed in abaxial vascular tissue of expanded cotyledons and leaves, and throughout the abaxial side of leaf primorida (arrowhead). Carpels ofwild-type flower (F). gct (G-L) and cct (M-R) delay and reduce the expression of E2023. Early heart (G,M), late heart (H,N), torpedo (I,O) and bentcotyledon (J,P) stage embryos. Ten-day-old gct (K) and cct (Q) seedlings (insets in K and Q: 2� magnification of leaves). gct (L) and cct (R) carpels.Scale bars: 20m in A-D,G-J,M-P; 1 mm in E-F,K-L,Q-R.

Fig. 2. gct enhances the polarity phenotypes of kanadi mutants. (A-D)Wild-type (A), kan1 kan2 (B), gct (C) and gct kan1 kan2 (D) embryosat the early bent cotyledon stage of development. (E-H)Four-week-old wild-type (E) and kan1 (F) plants with inflorescences removed, and 5-week-old gct (G) and gct kan1 (H) plants. (I-L)Camera lucida drawings of adaxial and abaxial mesophyll tissue of leaf 1 of wild-type (I), kan1 (J), gct (K)and gct kan1 (L). (M-P)Wild-type (M), kan1 (N), gct (O) and gct kan1 (P) flowers. The arrowheads in D and P point to sites of ectopic outgrowths.The dotted lines in M-P underline stigmatic tissue. The leaves in E, F and G are numbered according to the order of their initiation. Scale bars:20m in A-D; 1 cm in E-H; 2 mm in M-P. D

EVELO

PMENT

116

stage (Fig. 1J), and is weakly expressed beginning at the torpedostage in cct embryos (Fig. 1O). At the bent cotyledon stage, itsexpression is confined to patches on the abaxial side of thecotyledons in both mutants (Fig. 1J,P). After germination, gct andcct express E2023 in leaves in the same spatial pattern as wild-typeplants, but at a reduced level (Fig. 1K,Q). E2023 expression was notdetectable in carpels of gct and cct plants (Fig. 1L,R). Plantsheterozygous for both gct and cct segregated the same range ofembryo phenotypes as plants heterozygous for gct or cct only,implying that double mutant embryos have essentially the samephenotype as single mutants. Although we did not attempt toidentify double mutants during embryogenesis, plants homozygousfor both gct and cct were identified after germination usingmolecular markers, and supported this conclusion. This resultsuggests that GCT and CCT have closely related functions and mayact in the same pathway.

gct enhances polarity defects of kanadi mutantsKAN1, KAN2 and KAN4 have overlapping functions in thespecification of abaxial identity, and produce strong effects onembryo polarity only when all three genes are absent (Izhaki andBowman, 2007). The observation that gct and cct reduce theexpression of E2023 (KAN2) but do not have a polarity phenotypeas severe as the kan1 kan2 kan4 triple mutant, suggests that GCT andCCT may not completely abolish KAN gene expression duringembryogenesis, or may affect the expression of some KAN genes butnot others. Reasoning that this effect might be visible only in asensitized genetic background, we characterized the phenotype ofgct in combination with kan1 and kan1 kan2.

gct enhanced the phenotype of kan mutations at every stage ofplant development we examined. The embryonic phenotype ofkan1kan2 double mutants is similar to that of gct (Fig. 2A-C). Likegct (Fig. 2C), kan1kan2 embryos (Fig. 2B) display a slight delay inmorphogenesis, and have cotyledons that splay outward, aphenotype typical of a loss of abaxial identity. gct kan1kan2 triplemutants resemble gct, but differ from gct in having ectopic growthson both the cotyledons and hypocotyl (arrowheads, Fig. 2D). Theseectopic growths have previously been observed only in kan1 kan2kan4 triple mutants (Izhaki and Bowman, 2007).

gct also enhanced kan1 postembryonic phenotypes. Whereasthe leaves of kan1 and gct are held horizontally (Fig. 2E-G), theleaves of gct kan1 double mutants stand upright, curl upwards andare irregularly expanded (Fig. 2H). This effect on leafmorphology is associated with a change in polarity of mesophyllcells. Adaxial (palisade) mesophyll cells are typically round anddensely packed, whereas abaxial (spongy) mesophyll cells areirregular in shape and are separated by large air spaces (Fig. 2I).kan1 (Fig. 2J), and to a lesser extent gct (Fig. 2K), cause spongymesophyll cells to be less convoluted and more highly packedthan normal. The spongy mesophyll of gct kan1 plants (Fig. 2L)shows an enhanced loss of abaxial identity, consisting of moredensely packed, less branched cells that have a morphologyintermediate between wild-type adaxial and abaxial mesophyllcells. Although kan1 and gct do not have a major effect on carpeldevelopment (Fig. 2M-O), gct kan1 flowers (Fig. 2P) have anenlarged septum with increased stigmatic tissue, less valve tissueand abaxial projections of carpel and papillary tissue, and areessentially identical to the flowers of kan1 kan2/+ plants (Pekkeret al., 2005). These results are consistent with the decreasedexpression of E2023 in gct, and suggest that GCT contributes tothe specification of peripheral-abaxial identity by promoting theexpression of KAN2.

GCT and CCT regulate KAN expressionindependently of PHBTo further characterize the role of GCT and CCT in the specificationof adaxial-abaxial polarity, we examined the effect of gct and cctmutations on expression of a representative member of the KAN, YABand class III HD-ZIP gene families. The pKAN1::GUS construct (Wuet al., 2008) expresses GUS in the peripheral domain of the hypocotylthroughout embryogenesis (Fig. 3P-R). gct and cct delayed theexpression of pKAN1::GUS until the torpedo stage of development(Fig. 3S-T,V-W) and slightly reduced its level of expression, but bythe bent cotyledon stage had no obvious effect on its spatial expression

RESEARCH ARTICLE Development 137 (1)

Fig. 3. GCT and CCT promote KAN1 expression in earlyembryogenesis. (A-D)gPHB-GUS is expressed in the SAM and vascularprimodia of wild-type transition stage embryos (A), on the adaxial side ofcotyledons and in vascular primordia of wild-type heart stage embryos(B), in vascular primordia and the adaxial epidermis of cotyledons in wild-type torpedo stage embryos (C) and in the SAM of bent cotyledonembryos (D). A similar pattern is observed in gct (E-H) and cct (I-L)embryos, with the exception that gPHB-GUS is not expressed in theadaxial epidermis of cotyledons. (M-O)A pFIL::dsRed-N7 transcriptionalfusion is expressed on the abaxial face of cotyledons in torpedo stagewild-type (M) gct (N) and cct (O) embryos. (P-R)Expression of apKAN1::GUS transcriptional fusion in the peripheral domain of wild-typeembryos at the heart (P), torpedo (Q) and bent cotyledon stages (R). Noexpression of pKAN1::GUS in heart stage gct (S) and cct (V) embryos,initiation of expression in torpedo stage gct (T) and cct (W) embryos, andreduced but spatially normal expression in wild-type bent cotyledon stagegct (U) and cct (X) embryos. Scale bar: 20m.

DEVELO

PMENT

pattern (Fig. 3R,U,X). Thus, gct and cct have the same effect on theexpression of KAN1 as they have on the expression of KAN2 (Fig. 1G-J,M-P). By contrast, gct and cct did not affect the expression ofpFIL::dsRed-N7, a reporter for the abaxially expressed geneYABBY1/FILAMENTOUS FLOWER (FIL) (Heisler et al., 2005) (Fig.3M-O; see Fig. S1 in the supplementary material).

Class III HD-ZIP genes interact antagonistically with KAN genes(Eshed et al., 2004). To determine if the decrease in KAN1 and KAN2expression in gct and cct embryos is the result of an increase in HD-ZIPIII expression, we examined their effect on expression of theHD-ZIPIII gene PHB. Because PHB is regulated post-transcriptionally by miR165/miR166, this experiment wasconducted using a reporter in which GUS was fused to the C-terminal end of a PHB genomic clone (gPHB-GUS). This constructhas an expression pattern identical to that reported for PHB mRNA(McConnell et al., 2001) (Fig. 3A-D). Interestingly, although gct andcct reduced gPHB-GUS expression on the adaxial side ofcotyledons, the timing and overall GUS pattern in these mutants wasessentially normal. Thus, the decrease in KAN expression in gct andcct is not attributable to an increase in the size of the PHB expressiondomain, or to an increase in the level of PHB expression.

GCT and CCT encode MED13 and MED12, predictedtranscriptional repressors conserved in alleukaryotesThe molecular identities of GCT and CCT were determined using amap-based approach (Lukowitz et al., 2000). GCT is located on thelower arm of chromosome 1 and corresponds to At1g55325; all fourEMS-induced gct alleles contained mutations in At1g55325, and aT-DNA insertion in At1g55325 (SAIL_1169_H11) has a phenotypeidentical to these EMS alleles and failed to complement the mutant

phenotype of gct-2 (Fig. 4A). CCT is located at the top ofchromosome 4 and corresponds to At4g00450; cct-1 is a missensemutation in At4g00450, and two T-DNA insertions in At4g00450(SALK_108241 and SALK_124276) have a phenotype identical tocct-1 and failed to complement this point mutation (Fig. 4B).

GCT and CCT are single copy genes in Arabidopsis. The predictedGCT protein has 1921 amino acids (AA), and contains a serine-richregion between AA 407 and 426. gct-3 changes the first serine of thisdomain to an asparagine, suggesting that this domain is functionallyimportant. AA 1088-1179 of the predicted GCT protein are 42%identical to the MED13 pfam06333 domain (Fig. 4A). The entirepredicted GCT protein is 16% identical and 19% similar to humanMED13, and regions of identity and similarity are distributedthroughout the protein (see Fig. S2 in the supplementary material).The predicted CCT protein is 2144 AA long; AA 69-127 are 37%identical to the MED12 pfam09497 domain (Fig. 4B). The entirepredicted CCT protein is 12% identical and 21% similar to humanMED12 (NP_056150), and regions of identity and similarity aredistributed throughout the protein (see Fig. S3 in the supplementarymaterial). These results suggest that the MED12/MED13 regulatorymodule of Mediator is conserved in plants.

GCT and CCT are dynamically expressed duringembryo developmentThe expression of GCT and CCT during embryogenesis wascharacterized by RNA in situ hybridization. GCT mRNA wasdetected in both the apical and basal cell at the one-cell embryo stage(Fig. 4C), whereas CCT was first detected at the dermatogen stageof embryogenesis (Fig. 4L). Both genes are expressed in all cells ofthe embryo proper and suspensor through the globular stage ofembryogenesis (Fig. 4C-F,L-M), but their expression begins to

117RESEARCH ARTICLETemporal control of embryo patterning

Fig. 4. GCT and CCT encode the Arabidopsishomologs of the transcriptional regulators MED13and MED12, and are dynamically expressed duringembryogenesis. (A)GCT corresponds to At1g55325. Thelocation and the nature of mutant alleles are shown.Serine-rich region (AA 407-426) shown in dark gray.Region of 42% identity (P-value 9e–11) to pfam06333MED13 domain shown in light gray (AA 1088-1179).(B)CCT corresponds to At4g00450. Region of 37%identity (P-value 5e–13) to pfam09497 MED12 domain(AA 69-127) is shown in light gray. (C-K)mRNA in situhybridization analysis of GCT expression in (C) one-cell, (D)octant, (E) dermatogen, (F) globular, (G) heart, (H) torpedo,(I) bent cotyledon, (J) SAM of bent cotyledon, and (K) RAMof bent cotyledon stage embryos. (L-R)RNA in situhybridization analysis of CCT expression in (L) dermatogen,(M) globular, (N) heart, (O) torpedo, (P) bent cotyledon,(Q) SAM of bent cotyledon and (R) RAM of bent cotyledonstage embryos. (S)GCT sense probe; (T) CCT sense probe.Scale bar: 10m.

DEVELO

PMENT

118

decrease in the periphery of the hypocotyl and on the abaxial side ofcotyledons starting at the heart stage (Fig. 4G,N). This trendcontinues through the torpedo stage (Fig. 4H,O), and by the bentcotyledon stage GCT and CCT mRNAs are restricted to the vasculartissue and SAM and RAM (Fig. 4I-K,P-R). This pattern is consistentwith the temporal effect of gct and cct mutations on the expressionof E2023 and pKAN1::GUS (Figs 1 and 3), and suggests that thesegenes are important in the peripheral domain of the embryo onlyearly in embryogenesis. Postembryonically, public microarrayexpression data indicate that GCT and CCT are expressed in mosttissue types, with highest expression in the shoot apex (Winter et al.,2007).

gct and cct uncouple cell division, patternformation, and morphogenesisOur analysis of GCT and CCT expression demonstrated that theirmRNAs are present in wild-type embryos before the initiation ofKAN expression. To explore additional roles for GCT and CCT inearly embryogenesis, the histological phenotype of wild-type, gctand cct embryos was characterized from the earliest stages ofdevelopment. We found that pattern formation and morphogenesisare delayed in gct and cct embryos compared with wild type (Fig.5A-K).

In both gct and cct the first division of the apical cell is transverseto the long axis of the embryo, instead of parallel as in wild type(arrows, Fig. 5A,B); furthermore, cells of the embryo proper(brackets) are abnormally elongated, and in this respect resemblesuspensor cells (marked by the dashed line). gct (Fig. 5D) and cct(Fig. 5E) globular embryos are more elongated than wild type (Fig.5C), and have more suspensor cells. The more severely affectedembryos also lack the lens-shaped cell produced by asymmetricdivision of the uppermost cell of the suspensor (asterisks in Fig.5D,E), and have one or more extra tiers of cells between thesuspensor and the lower tier of the embryo (‘x’ in Fig. 5D,E). Theseextra tiers probably result from the abnormal first division plane ofthe apical cell shown in Fig. 5A,B. Although the percentage ofphenotypically mutant gct and cct embryos segregating in siliquesof heterozygous plants is quite low at the octant, dermatogen andglobular stages (approximately 5%), these phenotypes were neverobserved in octant (n227), dermatogen (n215) or globular stage(n344) embryos from wild-type plants.

In wild-type embryogenesis, the onset of the heart stage ofdevelopment is marked by the initiation of cotyledon primordiaon the upper flanks of the embryo, and the appearance ofelongated vascular cells (Fig. 5F). gct and cct delay both of thesepatterning events (Fig. 5G,H). The most strongly affected mutants

RESEARCH ARTICLE Development 137 (1)

Fig. 5. gct and cct mutants uncouple patternformation, growth and morphogenesis in earlyembryos. (A,B)Wild-type and gct embryos at the octantstage (A), and wild-type and cct embryos at thedermatogen stage (B). The plane of the first division ismarked with an arrow, the embryo is marked with abracket and the suspensor is marked with a dashed line.(C)Wild-type globular stage embryo. (D)Weak (left) andstrong (right) globular stage gct embryos. (E)Globularstage cct embryos show similar defects. In B-E, the cells ofthe upper tier and their derivatives (u), the lower tier andtheir derivatives (t), extra tiers in gct and cct (x) and theuppermost cell of the suspensor and its derivatives(asterisks) are labeled. (F)Wild-type early heart stageembryo. (G)Early heart stage gct embryos with two (left)or one (middle) small cotyledon primordia, or withrandom divisions throughout the embryo (right).(H)Similar phenotypes are seen in early heart stage cctembryos. (I-K)At the wild-type late heart stage (I), gct (J,left) and cct (K, left) embryos with two cotyledonprimordia, and gct (J, right) and cct (K, right) embryoswith random divisions throughout the embryo. In F-K, theshoot apical meristem, root apical meristem, and vascularprimordia (vp) are indicated with lines, and the cotyledonprimordia with arrowheads. (L)Cell numbers in medialsections of wild-type, gct and cct embryos at the earlyglobular, late globular, early heart and late heart stages.Standard deviation is shown at top of bars in L (n≥8). Allimages in A-K are tracings of cleared embryos. At eachdevelopmental stage, the percentage of each phenotypicclass of mutant embryos in siliques of heterozygous plantsis shown, along with the total number of embryos scored.All images shown at equal magnification. Scale bar:10m.

DEVELO

PMENT

(right, Fig. 5G,H) display a disorganized cell division pattern.This class probably represents a subsequent stage in thedevelopment of the severely affected globular embryos illustratedin Fig. 5D,E (right). At the wt late heart stage (Fig. 5I), themajority of gct (left, Fig. 5J) and cct (left, Fig. 5K) embryos haveformed two small cotyledon primordia, and show increasinglynormal histological organization, such as the presence ofelongated vascular precursor cells. By contrast, a small numberof gct and cct embryos (right, Fig. 5J,K) continue to divide in ahighly disorganized fashion. Despite this, gct and cct embryoshave the same number of cells as wild-type embryos through theearly heart stage of development, demonstrating that thedevelopmental delay in these mutants is not a consequence of ageneral reduction in growth rate (Fig. 5L). A significant differencein cell number is only observed at the late heart stage, and this iscompletely attributable to the onset of cotyledon development inwild-type embryos at this stage.

At the bent cotyledon stage, the majority of gct and cct embryoshave elongated – albeit short – cotyledons, and an unusually largeSAM (Fig. 6B,G,D,I), whereas a small percentage display onlyrudimentary cotyledons and completely lack a SAM (Fig. 6C,H,E,J).The frequency of this latter class is similar to the frequency ofembryos that lack cotyledons at the late heart stage of development(Fig. 5J,K), suggesting that this is the mature morphology of theseseverely affected embryos. gct and cct also affect the organization

of the RAM and root cap, but to a lesser extent than the SAM (Fig.6K-N). gct and cct increase the size of hypocotyl cells, but do notchange the number of tissue layers in the hypocotyl (Fig. 6O-Q).

GCT and CCT are transiently required for SAM andvascular specificationThe observation that gct and cct delay the expression of KAN1 andKAN2 as well as provascular and cotyledon differentiation indicatesthat these genes play a key role in temporal regulation of embryopattern formation. To more broadly characterize the function of GCTand CCT in pattern formation, we examined the expression ofmolecular markers for the SAM (pSTM::GUS) (Kirch et al., 2003),RAM (pWOX5::GFP) (Xu et al., 2006) and vascular tissue (E2331)in wild-type and mutant embryos. In wild type, the expressionof pSTM::GUS is first detected at the transition stage ofembryogenesis, just as cotyledon primordia emerge on the flanks ofthe SAM (compare Fig. 7A and 7B). The size of the STM expressiondomain then increases, reaching its maximum extent at the bentcotyledon stage (Fig. 7C-E). In situ hybridization with an STM probedemonstrated that the SAM of mature gct and cct embryos isapproximately 2.5 times larger than normal (Fig. 7E,I,M). AlthoughpSTM::GUS is expressed much later in mutant embryos than in theirwild-type siblings, in both genotypes pSTM::GUS expression is firstdetected at the morphological heart stage (Fig. 7H,L). Thus, gct andcct delay pSTM::GUS expression in absolute time, but not with

119RESEARCH ARTICLETemporal control of embryo patterning

Fig. 6. SAM and RAM defects in late stage gct and cct embryos. (A-E)Bent cotyledon stage wild-type, gct and cct embryos: 86% (n151) oflate stage gct embryos have an enlarged SAM (B); 14% (n151) of late stage gct embryos lack the small vacuolated cells and layered tissueorganization characteristic of the SAM (C); 94% (n171) of late stage cct embryos have an enlarged SAM (D); 6% (n171) of late stage cctembryos lack a SAM (E). (F)Medial section of wild-type SAM contains an average of 25±1 cells, (n15). (G)Medial section of enlarged gct SAMcontains an average of 68±5 cells (n15). (H)gct embryo with large vacuolated cells in place of the SAM. (I)Medial section of enlarged cct SAMcontains an average of 66±8 cells (n15). (J)cct embryo with large vacuolated cells in place of the SAM. (K)Medial optical section of a wild-typeRAM. (L)Of gct embryos, 86% had a slightly disorganized root cap and extra cells in RAM (n84). (M)In addition, 14% of gct embryos lacked mostcells of the root cap (n84). (N)Of cct embryos, 100% (n81) had a slightly disorganized root cap and extra cells in RAM. (O-Q)Hypocotyl of wild-type (O), gct (P) and cct (Q) embryos. Percentages in B-E refer to mutant embryos only, which are easily distinguished at late stages by theirmeristem phenotype. In A-E, the location of the SAM and RAM are shown in boxes. Original cleared images and tracings of the SAM, RAM orhypocotyl are shown in F-Q. The SAM was defined as the region bounded by vascular tissue. A-E and F-Q shown at equal magnification. Scale bars:40m in A; 10m in F. Asterisks indicate quiescent center cells of root meristem. co, cortex; en, endodermis; ep, epidermis; lrc, lateral root cap; p,pericycle; v, vascular tissue; x, extra RAM cells.

DEVELO

PMENT

120

respect to developmental stage. This suggests that the delay in STMexpression is a consequence of delayed patterning. By contrast, gctand cct do not affect the timing of pWOX5::GFP. This RAM markerwas expressed in all but the most phenotypically severe gct and cctembryos at both the wild-type heart and bent cotyledon stages (seeFig. S4 in the supplementary material).

The enhancer trap E2331 expresses GFP brightly in vasculartissue starting at the early globular stage and throughout the rest ofembryonic development (Fig. 7N-Q), and is therefore an excellentmarker for vascular patterning. gct and cct embryos do not express

E2331 at the globular or heart stages (Fig. 7R,S,V,W). E2331expression begins in the basal part of the hypocotyl of torpedo stagegct and cct embryos (Fig. 7T,X), and by the bent cotyledon stage, itis expressed throughout the vascular tissue of mutant embryos (Fig.7U,Y); at this stage, the expression pattern of E2331 in mutantembryos is essentially normal (Fig. 7Q). Thus, gct and cct delay theexpression of E2331 both in absolute time and relative to themorphogenetic stage of the embryo, suggesting that they play adirect role in vascular patterning.

DISCUSSIONPattern formation is a result of temporally and spatially regulatedchanges in gene expression. Although considerable attention hasbeen paid to the spatial component of this problem, the temporalregulation of developmental patterning is an open question. Here weshow that growth and pattern formation can be dissociated duringembryogenesis in Arabidopsis, and demonstrate a role forGCT/MED13 and CCT/MED12 in the temporal regulation of radialpolarity (summarized in Fig. 8).

GCT and CCT regulate the timing of genesrequired for peripheral-abaxial identityPeripheral-abaxial identity is specified by the KANADI family oftranscription factors. gct and cct mutations delay the onset of KAN1and KAN2 expression, implying that GCT and CCT directly orindirectly promote the expression of these genes early inembryogenesis. Interestingly, the absence of KAN1 and KAN2expression early in development is not accompanied by a change in

RESEARCH ARTICLE Development 137 (1)

Fig. 7. Delayed expression of STM and the provascular enhancertrap E2331 in gct and cct. (A-D)Expression of a pSTM::GUStranscriptional fusion (Kirch et al., 2003) in wild-type globular (A),transition (B), heart (C) and torpedo (D) stage embryos. (E)Detection ofSTM mRNA by in situ hybridization in wild-type bent cotyledon stageembryos. (F-M)pSTM::GUS expression is not seen in gct or cct embryosat the transition (F,J) or heart (G,K) stages. Torpedo stage gct and cctembryos initiate pSTM::GUS expression (H,L), and bent cotyledon stagegct and cct embryos show an expanded STM expression domain (I,M).(N-Q)Enhancer trap marker E2331 is expressed in vascular primorida ofglobular (N), heart (O), torpedo (P) and bent cotyledon (Q) stageembryos. (R-Y)gct and cct embryos at the globular (R,V) and heart(S,W) stages do not express E2331. Beginning at the torpedo stage,E2331 expression begins in lower vascular primordia of gct (T) and cct(X) embryos. At the bent cotyledon stage, E2331 is expressedthroughout vascular primordia of gct (U) and cct (Y) embryos. Scalebars: 20m.

Fig. 8. gct and cct dissociate growth from temporal control ofearly embryo patterning. A summary of the results presented in thismanuscript. During early embryogenesis, growth (i.e. cell division)proceeds at the same rate in wild-type, gct and cct embryos (gray bars).By contrast, radial patterning in gct and cct embryos is delayed forseveral days compared with wild type (dashed black bar), after which itresumes normally (solid black bar). gct and cct embryos express markersfor STM, PHB, FIL and WOX5 consistent with their stage ofmorphogenesis (i.e. normally), whereas expression of markers forKAN1, KAN2 and the vascular enhancer trap E2331 is delayed bothtemporally, and with respect to the morphology of the embryo.

DEVELO

PMENT

the expression of at least two other genes involved in thespecification of adaxial-abaxial polarity – the abaxial gene, FIL, andthe adaxial gene, PHB. This result provides an exception to theantagonism that is generally observed between KAN and PHB geneexpression: typically, a decrease in KAN1 and KAN2 expression inleaves is associated with an increase in the PHB expression domain(Eshed et al., 2004). This antagonistic relationship has also beenobserved in early embryogenesis (Grigg et al., 2009). Oneexplanation for the lack of an increased PHB expression domain ingct and cct is that at the heart stage there are residual levels of KAN1and KAN2 gene expression that cannot be detected by our reporterconstructs. Another possibility is that GCT and CCT are required tomediate the antagonistic interactions between PHB and KAN. If thisis the case, further studies on the role of GCT and CCT may lead toan understanding of the molecular nature of PHB-KAN antagonisticinteractions.

In light of the importance of the phytohormone auxin inapicobasal and radial patterning of Arabidopsis embryos (Nawy etal., 2008), it is interesting to note that both the abnormal orientationof the first division of the apical cell in gct and cct and the resultantdouble octant embryos are also observed in monopteros andbodenlos auxin response mutants (Berleth and Jürgens, 1993;Hamann et al., 1999). The phenotypic similarity of these fourmutants points to a possible role for GCT and CCT in promotingauxin transcriptional responses in early embryogenesis. Therelationship between GCT, CCT and auxin is an exciting area forfuture research.

GCT and CCT are required for temporalcoordination of growth and pattern formationduring embryonic developmentMature gct and cct embryos typically possess an enlarged SAMand abnormally shaped cotyledons. The basis for the phenotypebecame apparent when we examined the effect of these mutationson the rate of cell division and the timing of various events inembryo development. Whereas gct and cct had little or no effecton the rate of cell division early in embryo development, theydelayed key morphogenetic events, including production ofprovascular tissue, cotyledon initiation and the initiation of theSAM. We suspect that this delay explains the effect of thesemutations on meristem size, because the effect does not persistafter germination, as is the case for mutations in meristemmaintenance genes such as WUS and the CLV loci (Schoof et al.,2000). Temporal defects were also apparent at the level of geneexpression, and were of two types. Some genes – such as STM,PHB and FIL – were expressed later than normal, but at the correctmorphological stage. Others – specifically KAN1, KAN2 and theprovascular marker E2331 – were delayed in time, with respect tothe morphology of the embryo, and also relative to genes withwhich their expression is normally synchronized.

These results demonstrate the existence of a mechanism fortemporally coordinating events in plant embryogenesis, and indicatethat GCT and CCT are important components of this mechanism.Interestingly, among the Arabidopsis Mediator genes that have beenfunctionally characterized, this role in temporal regulation ofdevelopment is apparently specific to GCT/MED13 andCCT/MED12. For example, mutations in the Arabidopsis coreMediator components SWP (MED14) and MED21 result in severelydwarfed and lethal phenotypes (respectively) (Autran et al., 2002;Dhawan et al., 2009). By contrast, loss-of-function mutations inArabidopsis HEN3/CDK8, a protein that in Drosophila physicallyinteracts with MED12 and MED13, have a subtle phenotype that is

apparently unrelated to developmental timing (Wang and Chen,2004). This divergence in function between MED12/13 and CDK8parallels studies in Drosophila, where, despite their physicalinteraction, mutations in Med12 and Med13 condition differentphenotypes from Cdk8 mutants (Loncle et al., 2007).

Transient requirement for Arabidopsis MED13 andMED12 in embryo patterningWith rare exceptions (Carrera et al., 2008), yeast and animal Med13and Med12 proteins act as transcriptional repressors (Samuelsen etal., 2003; Ding et al., 2008; Knuesel et al., 2009). With this in mind,one attractive hypothesis is that GCT and CCT regulate the maternal-to-zygotic transition in early embryogenesis, perhaps by repressingzygotic transcription during the window of early embryogenesiswhen development is thought to be predominantly under maternalcontrol (Pagnussat et al., 2005; Grimanelli et al., 2005) (reviewedby Baroux et al., 2008). In this scenario, the delayed patternformation and morphogenesis seen in early gct and cct embryoswould be attributed to a confusion in cell and tissue identity causedby a heterochronic overlap of normally distinct maternal and zygoticpatterning programs. This overlap would be relieved after the firstfew days of embryogenesis, when zygotic transcription normallypredominates, and would explain the delayed initiation of radialpatterning in gct and cct embryos. Regardless of the mechanism,identification of the direct targets of GCT and CCT is a high priorityfor future research, and should illuminate the role that these genesplay in temporal control of radial patterning in early embryogenesis.

AcknowledgementsJ. Haxby isolated and initially characterized the E2023 and E2331 lines. We aregrateful to K. Gallagher for the use of a 20� water immersion objective. M.Heisler (pFIL::dsRed-N7), W. Werr (pSTM::GUS) and R. Heidstra (pWOX5::GFP)kindly provided reporter constructs. L. Gutiérrez-Nava, M. Willmann, K. Earley,C. Hunter, K.G. and D. Wagner provided helpful discussions. Thanks to D.Grimanelli, W. Lukowitz, P. Jenik, G. Wu, M.W. and K.E. for comments on themanuscript. This work was funded by an NIH NRSA fellowship to C.S.G.(5F32GM069104-03), and by a DOE grant to R.S.P. and C.S.G. (DE-FG02-99ER20328). Deposited in PMC for release after 12 months.

Author contributionsC.S.G. designed and performed all experiments with the exception of in situhybridizations (M.Y.P.), and molecular and genetic characterization of theE2023 line (M.R.S., R.P. and R.A.K.). C.S.G and R.S.P. analyzed data and wrotethe manuscript.

Supplementary materialSupplementary material for this article is available athttp://dev.biologists.org/lookup/suppl/doi:10.1242/dev.043174/-/DC1

ReferencesAlonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J., Chen, H., Shinn, P.,

Stevenson, D. K., Zimmerman, J., Barajas, P., Cheuk, R. et al. (2003).Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301,653-657.

Andrau, J.-C., van de Pasch, L., Lijnzaad, P., Bijma, T., Koerkamp, M. G., vande Peppel, J., Werner, M. and Holstege, F. C. P. (2006). Genome-widelocation of the coactivator Mediator: binding without activation and transientCDK8 interaction on DNA. Mol. Cell 22, 179-192.

Autran, D., Jonak, C., Belcram, K., Beemster, T. S., Kronenberger, J.,Granjean, O., Inzé, D. and Traas, J. (2002). Cell numbers and leafdevelopment in Arabidopsis: a functional analysis of the STRUWWELPETER gene.EMBO J. 21, 6036-6049.

Bäckström, S., Elfving, N., Nilsson, R., Wingsle, G. and Bjöklund, S. (2007).Purification of a plant Mediator from Arabidopsis thaliana identifies PFT1 as theMed25 subunit. Mol. Cell 26, 717-729.

Baroux, C., Autran, D., Gillmor, C. S., Grimanelli, D. and Grossniklaus, U.(2008). The maternal to zygotic transition in animals and plants. Cold SpringHarb. Symp. Quant. Biol. 73, 89-100.

Berleth, T. and Jürgens, G. (1993). The role of the monopteros gene inorganizing the basal body region of the Arabidopsis embryo. Development 118,575-587.

121RESEARCH ARTICLETemporal control of embryo patterning

DEVELO

PMENT

122

Carrera, I., Janody, F., Leeds, N., Duveau, F. and Treisman, J. E. (2008). Pygopusactivates Wingless target gene transcription through the Mediator complexsubunits Med12 and Med13. Proc. Natl. Acad. Sci. USA 105, 6644-6649.

Cerdán, P. D. and Chory, J. (2003). Regulation of flowering time by light quality.Nature 423, 881-885.

Dhawan, R., Luo, H., Foerster, A., Abuqamar, S., Du, H., Briggs, S., Scheid, O.and Mengiste, T. (2009). HISTONE MONOUBIQUITINATION1 interacts with asubunit of the Mediator complex and regulates defense against necrotrophicfungal pathogens in Arabidopsis. Plant Cell 21, 1000-1019.

Ding, N., Zhou, H., Esteve, P. O., Chin, H. G., Kim, S., Xu, X., Joseph, S. M.,Friez, M. J., Schwartz, C. E., Pradhan, S. et al. (2008). Mediator linksepigenetic silencing of neuronal gene expression with x-linked mentalretardation. Mol. Cell 31, 347-359.

Donnelly, P. M., Bonetta, D., Tsukaya, H., Dengler, R. E. and Dengler, N. G.(1999). Cell cycling and cell enlargement in developing leaves of Arabidopsis.Dev. Biol. 215, 407-419.

Emery, J. F., Floyd, S. K., Alvarez, J., Eshed, Y., Hawker, N. P., Izhaki, A.,Baum, S. F. and Bowman, J. L. (2003). Radial patterning of Arabidopsis shootsby class III HD-ZIP and KANADI genes. Curr. Biol. 13, 1768-1774.

Eshed, Y., Baum, S. F., Perea, J. V. and Bowman, J. L. (2001). Establishment ofpolarity in lateral organs of plants. Curr. Biol. 11, 1251-1260.

Eshed, Y., Izhaki, A., Baum, S. F., Floyd, S. K. and Bowman, J. L. (2004).Asymmetric leaf development and blade expansion in Arabidopsis are mediatedby KANADI and YABBY activities. Development 131, 2997-3006.

Grigg, S., Galinha, C., Kornet, N., Canales, C., Scheres, B. and Tsiantis, M.(2009). Repression of apical homeobox genes is required for embryonic rootdevelopment in Arabidopsis. Curr. Biol. 19, 1485-1490.

Grimanelli, D., Perotti, E., Ramirez, J. and Leblanc, O. (2005). Timing of thematernal-to-zygotic transition during early seed development. Plant Cell 17,1061-1072.

Hamann, T., Mayer, U. and Jürgens, G. (1999). The auxin-insensitive bodenlosmutation affects primary root formation and apical-basal patterning in theArabidopsis embryo. Development 126, 1387-1395.

Haseloff, J. (1999). GFP variants for multispectral imaging of living cells. MethodsCell Biol. 58, 139-151.

Heisler, M. G., Ohno, C., Das, P., Sieber, P., Reddy, G. V., Long, J. A. andMeyerowitz, E. M. (2005). Patterns of auxin transport and gene expressionduring primordium development revealed by live imaging of the Arabidopsisinflorescence meristem. Curr. Biol. 15, 1899-1911.

Izhaki, A. and Bowman, J. L. (2007). KANADI and class III HD-ZIP gene familiesregulate embryo patterning and modulate auxin flow during embryogenesis inArabidopsis. Plant Cell 19, 495-508.

Janody, F., Martiroysan, Z., Benlali, A. and Treisman, J. E. (2003). Two subunitsof the Drosophila Mediator complex act together to control cell affinity.Development 130, 3691-3701.

Jenik, P. D., Jurkuta, R. E. J. and Barton, M. K. (2005). Interactions between thecell cycle and embryonic patterning in Arabidopsis uncovered by a mutation inDNA polymerase epsilon. Plant Cell 17, 3362-3377.

Kerstetter, R. A., Bollman, K., Taylor, R. A., Bomblies, K. and Poethig, R. S.(2001). KANADI regulates organ polarity in Arabidopsis. Nature 411, 706-709.

Kirch, T., Simon, R., Grünewald, M. and Werr, W. (2003). TheDORNROSCHEN/ENHANCER OF SHOOT REGENERATION1 gene of Arabidopsisacts in the control of meristem cell fate and lateral organ development. PlantCell 15, 694-705.

Knuesel, M. T., Meyer, K. D., Bernecky, C. and Taatjes, D. J. (2009). Thehuman CDK8 subcomplex is a molecular switch that controls Mediatorcoactivator function. Genes Dev. 23, 439-451.

Kornberg, R. D. (2005). Mediator and the mechanism of transcriptionalactivation. Trends Biochem. Sci. 30, 235-239.

Loncle, N., Boube, M., Joulia, L., Boschiero, C., Werner, M., Cribbs, D. L. andBourbon, H. M. (2007). Distinct roles for Mediator Cdk8 module subunits inDrosophila development. EMBO J. 26, 1045-1054.

Lukowitz, W., Gillmor, C. S. and Scheible, W. R. (2000). Positional cloning inArabidopsis: why it feels good to have a genome initiative working for you.Plant Physiol. 123, 795-805.

McConnell, J. R. and Barton, M. K. (1998). Leaf polarity and meristem formationin Arabidopsis. Development 125, 2935-2942.

McConnell, J. R., Emery, J., Eshed, Y., Bao, N., Bowman, J. L. and Barton, M.K. (2001). Role of PHABULOSA and PHAVOLUTA in determining radialpatterning in shoots. Nature 411, 709-713.

Nawy, T., Lukowitz, W. and Bayer, M. (2008). Talk global, act local-patterningthe Arabidopsis embryo. Curr. Opin. Plant Biol. 11, 28-33.

Pagnussat, G. C., Yu, H. J., Ngo, Q. A., Rajani, S., Mayalagu, S., Johnson, C.S., Capron, A., Xie, L. F., Ye, D. and Sundaresan, V. (2005). Genetic andmolecular identification of genes required for female gametophyte developmentand function in Arabidopsis. Development 132, 603-614.

Pekker, I., Alvarez, J. P. and Eshed, Y. (2005). Auxin response factors mediateArabidopsis organ asymmetry via modulation of KANADI activity. Plant Cell 17,2899-2910.

Samuelsen, C. O., Baraznenok, V., Khorosjutina, O., Spahr, H., Kieselbach, T.,Holmberg, S. and Gustafsson, C. M. (2003). TRAP230/ARC240 andTRAP240/ARC250 Mediator subunits are functionally conserved throughevolution. Proc. Natl. Acad. Sci. USA 100, 6422-6427.

Schoof, H., Lenhard, M., Haecker, A., Mayer, K. F., Jürgens, G. and Laux, T.(2000). The stem cell population of Arabidopsis shoot meristems is maintainedby a regulatory loop between the CLAVATA and WUSCHEL genes. Cell 100, 635-644.

Sessions, A., Burke, E., Presting, G., Aux, G., McElver, J., Patton, D., Dietrich,B., Ho, P., Bacwaden, J., Ko, C. et al. (2002). A high-throughput Arabidopsisreverse genetics system. Plant Cell 14, 2985-2994.

Siegfried, K. R., Eshed, Y., Baum, S. F., Otsuga, D., Drews, G. N. andBowman, J. L. (1999). Members of the YABBY gene family specify abaxial cellfate in Arabidopsis. Development 126, 4117-4128.

Wang, W. and Chen, X. (2004). HUA ENHANCER3 reveals a role for a cyclin-dependent protein kinase in the specification of floral organ identity inArabidopsis. Development 131, 3147-3156.

Winter, D., Vinegar, B., Nahal, H., Ammar, R., Wilson, G. V. and Provart, N. J.(2007). An “electronic fluorescent pictograph” browser for exploring andanalyzing large-scale biological data sets. PLoS ONE 2, e718.

Wu, G., Lin, W. C., Huang, T., Poethig, R. S., Springer, P. S. and Kerstetter, R.A. (2008). KANADI1 regulates adaxial-abaxial polarity in Arabidopsis by directlyrepressing the transcription of ASYMMETRIC LEAVES2. Proc. Natl. Acad. Sci.USA 105, 16392-16397.

Xu, J., Hofhuis, H., Heidstra, R., Sauer, M., Friml, J. and Scheres, B. (2006). Amolecular framework for plant regeneration. Science 311, 385-388.

Yoda, A., Kouike, H., Okano, H. and Sawa, H. (2005). Components of thetranscriptional Mediator complex are required for asymmetric cell division in C.elegans. Development 132, 1885-1893.

RESEARCH ARTICLE Development 137 (1)

DEVELO

PMENT