Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
University of IowaIowa Research Online
Theses and Dissertations
Spring 2011
The isoprenoid biosynthesis pathway andregulation of osteoblast differentiationMegan Moore WeivodaUniversity of Iowa
Copyright 2011 Megan Moore Weivoda
This dissertation is available at Iowa Research Online: https://ir.uiowa.edu/etd/1106
Follow this and additional works at: https://ir.uiowa.edu/etd
Part of the Pharmacology Commons
Recommended CitationWeivoda, Megan Moore. "The isoprenoid biosynthesis pathway and regulation of osteoblast differentiation." PhD (Doctor ofPhilosophy) thesis, University of Iowa, 2011.https://doi.org/10.17077/etd.fycowap2
THE ISOPRENOID BIOSYNTHESIS PATHWAY AND REGULATION OF OSTEOBLAST DIFFERENTIATION
by
Megan Moore Weivoda
An Abstract
Of a thesis submitted in partial fulfillment of the requirements for the Doctor of Philosophy
degree in Pharmacology in the Graduate College of The University of Iowa
May 2011
Thesis Supervisor: Professor Raymond J. Hohl
1
Statins, drugs commonly used to lower serum cholesterol, have been shown to
stimulate osteoblast differentiation and bone formation. By inhibiting HMG-CoA
reductase (HMGCR) statins deplete the cellular isoprenoid biosynthetic pathway products
farnesyl pyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP). Current
thought in the field is that statins stimulate bone formation through the depletion of
GGPP, since exogenous GGPP prevents the effects of statins on osteoblasts in vitro.
We hypothesized that direct inhibition of GGPP synthase (GGPPS) would
similarly stimulate osteoblast differentiation. Digeranyl bisphosphonate (DGBP), a
specific inhibitor of GGPPS, decreased GGPP levels in MC3T3-E1 pre-osteoblasts and
calvarial osteoblasts leading to impaired protein geranylgeranylation. In contrast to our
hypothesis, DGBP inhibited the matrix mineralization of MC3T3-E1 cells and the
expression of osteoblast differentiation markers in calvarial osteoblasts. The effect on
mineralization was not prevented by exogenous GGPP. By inhibiting GGPPS, DGBP led
to an accumulation of the GGPPS substrate FPP. We show that FPP and GGPP levels
decreased during MC3T3-E1 and calvarial osteoblast differentiation, which correlated
with decreased expression of HMGCR and FPP synthase. The decrease in FPP during
differentiation was prevented by DGBP treatment. The accumulation of FPP following 24
h DGBP treatment correlated with activation of the glucocorticoid receptor, suggesting a
potential mechanism by which DGBP-induced FPP accumulation may inhibit osteoblast
differentiation.
To further investigate whether FPP inhibits osteoblast differentiation, we utilized
the squalene synthase (SQS) inhibitor zaragozic acid (ZGA), which causes a greater
accumulation of FPP than can be achieved with GGPPS inhibition. ZGA treatment
2
decreased osteoblast proliferation, gene expression, alkaline phosphatase (ALP) activity,
and matrix mineralization of calvarial osteoblasts. Prevention of ZGA-induced FPP
accumulation with HMGCR inhibition prevented the effects of ZGA on osteoblast
differentiation. Treatment of osteoblasts with exogenous FPP similarly inhibited matrix
mineralization. These results suggest that the accumulation of FPP negatively regulates
osteoblast differentiation.
While we did not find that specific depletion of GGPP stimulates osteoblast
differentiation, we obtained evidence that GGPP does negatively regulate the
differentiation of these cells. Exogenous GGPP treatment inhibited primary calvarial
osteoblast gene expression and matrix mineralization. Interestingly, GGPP pre-treatment
increased markers of insulin signaling, despite reduced phosphorylation of the insulin
receptor (InsR). Inhibition of osteoblast differentiation by GGPP led to the induction of
PPARγ and enhanced adipogenesis in osteoblastic cultures, suggesting that GGPP may
play a role in the osteoblast versus adipocyte fate decision. Adipogenic differentiation of
primary bone marrow stromal cell (BMSC) cultures was prevented by DGBP treatment.
Altogether these data present novel roles for the isoprenoids FPP and GGPP in the
regulation of osteoblast differentiation and have intriguing implications for the isoprenoid
biosynthetic pathway in the regulation of skeletal homeostasis.
Abstract Approved: ______________________________________________ Thesis Supervisor ______________________________________________ Title and Department ______________________________________________ Date
THE ISOPRENOID BIOSYNTHESIS PATHWAY AND REGULATION OF OSTEOBLAST DIFFERENTIATION
by
Megan Moore Weivoda
A thesis submitted in partial fulfillment of the requirements for the Doctor of Philosophy
degree in Pharmacology in the Graduate College of The University of Iowa
May 2011
Thesis Supervisor: Professor Raymond J. Hohl
Graduate College The University of Iowa
Iowa City, Iowa
CERTIFICATE OF APPROVAL
____________________________
PH.D. THESIS
_____________
This is to certify that the Ph. D. thesis of
Megan Moore Weivoda
has been approved by the Examining Committee for the thesis requirement for the Doctor of Philosophy degree in Pharmacology at the May 2011 graduation.
Thesis Committee: ________________________________ Raymond J. Hohl, Thesis Supervisor ________________________________ Christopher M. Adams ________________________________ John G. Koland ________________________________ Frederick W. Quelle ________________________________ David F. Wiemer
For the LORD gives wisdom; From His mouth come knowledge and understanding;
Proverbs 2:6 The Bible
ii
ACKNOWLEDGEMENTS
I would like to begin by extending my extreme gratitude to my thesis advisor, Dr.
Raymond J. Hohl, for welcoming me into his lab and allowing me the opportunity to
investigate the isoprenoid pathway in osteoblast differentiation. Additionally, I want to
thank my thesis committee members: Drs. Christopher M. Adams, John G. Koland,
Frederick W. Quelle, and David F. Wiemer for their time and guidance. I also wish to
thank the Department of Pharmacology for allowing me the opportunity to join their
department and continue my academic studies.
I would also like to thank past and present members of the Hohl laboratory.
Specifically, thanks to Dr. Amel Dudakovic and Brian Wasko for the lunches and coffee
breaks that led to stimulating scientific discussions. Also, thanks to Dr. Craig Kuder for
his advice and helpful encouragement throughout my time at Iowa. I would also like to
thank Dr. Huaxiang Tong for his help in measuring intracellular isoprenoids.
I would like to thank the Vanderbilt Center for Bone Biology. My time there laid
the foundation for my love of bone biology. Specifically, thanks to Drs. James Edwards
and XiangLi Yang Elefteriou for instruction in the proper study of bone biology. I would
like to extend my gratitude to the late Dr. Gregory R. Mundy (1942-2010). His
enthusiasm for bone biology and scientific discovery will live on in me as I continue my
academic career.
I would like to thank my family as well as my husband’s family for all of their
love and support. To my parents, Larry and Cindy Moore, thanks for always believing in
me. And last, but not least, I wish to thank my husband, Aaron Weivoda, for his constant
love, encouragement, and support of my scientific career.
iii
iv
TABLE OF CONTENTS
LIST OF TABLES vi LIST OF FIGURES vii LIST OF ABBREVIATIONS ix CHAPTER I: INTRODUCTION 1
The Skeleton and Bone Remodeling 1 Osteoporosis 2 Isoprenoid Biosynthetic Pathway 5 Osteoblast Differentiation and the Isoprenoid Biosynthetic Pathway 8 Hypothesis 12
CHAPTER II: INHIBITION OF GERANYLGERANYL PYROPHOSPHATE SYNTHASE (GGPPS) AND OSTEOBLAST DIFFERENTIATION 16
Abstract 16 Introduction 17 Materials and Methods 18 Results 21 Discussion 24
CHAPTER III: ACCUMULATION OF FPP AND OSTEOBLAST DIFFERENTIATION 34
Abstract 34 Introduction 35 Materials and Methods 36 Results 40 Discussion 44
CHAPTER IV: GGPP AND THE OSTEOBLAST VERSUS ADIPOGENIC FATE DECISION 58
Abstract 58 Introduction 59 Materials and Methods 61 Results 66 Discussion 72
CHAPTER V: SUMMARY 88
The Isoprenoid Pathway and Osteoblast Differentiation 88 Future Studies 93 Conclusion 95
REFERENCES 96
v
LIST OF TABLES
Table 1. Rat primers for real-time qPCR analysis 29
vi
LIST OF FIGURES
Figure 1. Skeletal bone remodeling 14 Figure 2. The isoprenoid biosynthetic pathway 15 Figure 3. DGBP reduces intracellular GGPP and impairs protein
geranylgeranylation 30 Figure 4. DGBP inhibits osteoblast differentiation and matrix
mineralization 31 Figure 5. DGBP leads to an accumulation of intracellular FPP 32 Figure 6. DGBP leads to activation of the glucocorticoid receptor 33 Figure 7. The isoprenoid biosynthetic pathway and primary
calvarial osteoblast differentiation 48 Figure 8. ZGA leads to increases in endogenous FPP and GGPP 49 Figure 9. ZGA leads to inhibition of osteoblast differentiation 50 Figure 10. SQSI-154 causes an accumulation of FPP and inhibits
osteoblast matrix mineralization 52 Figure 11. Inhibition of HMGCR prevents FPP accumulation and
inhibition of osteoblast differentiation in cells treated with ZGA 53
Figure 12. GGPP depletion does not restore osteoblast
mineralization 55 Figure 13. Addition of exogenous mevalonate and co-treatment with
FTI-277 56 Figure 14. GGPP inhibits primary calvarial osteoblast differentiation 78 Figure 15. GGPP increases the expression of PPARγ 79 Figure 16. Inhibition of PPARγ transcriptional activity does not
prevent the effects of GGPP on osteoblast mineralization 80 Figure 17. GGPP enhances adipogenesis 81
vii
Figure 18. Specific inhibition of GGPPS inhibits adipogenesis 83 Figure 19. GGPP treatment does not increase geranylgeranylation 84 Figure 20. GGPP reduces InsR phosphorylation 85 Figure 21. GGPP enhances insulin-induced Erk1/2 activation and
glucose uptake 86 Figure 22. Proposed mechanisms for the inhibition of osteoblast
differentiation by GGPP 87
viii
LIST OF ABBREVIATIONS
ALP Alkaline Phosphatase
BMD Bone Mineral Density
BMP Bone Morphogenetic Protein
BMSC Bone Marrow Stromal Cell
BP Bisphosphonate
C/EBPα CCAAT/Enhancer-Binding Protein α
Col1a1 Type I Collagen
DGBP Digeranyl Bisphosphonate
DMAPP Dimethylallyl Pyrophosphate
FOH Farnesol
FPP Farnesyl Pyrophosphate
FPPS Farnesyl Pyrophosphate Synthase
FTase Farnesyl Transferase
FTI Farnesyl Transferase Inhibitor
GGOH Geranylgeraniol
GGPP Geranylgeranyl Pyrophosphate
GGPPS Geranylgeranyl Pyrophosphate Synthase
GGTase Geranylgeranyl Transferase
Glut4 Glucose Transporter 4
GPP Geranyl Pyrophosphate
GR Glucocorticoid Receptor
HAP Hydroxyapatite
HMGCR HMG-CoA Reductase
IGF-1 Insulin-like Growth Factor 1
ix
x
InsR Insulin Receptor
IPP Isopentenyl Pyrophosphate
IRS-1 Insulin Receptor Substrate
LDL Low-density Lipoprotein
M-CSF Macrophage Colony Stimulating Factor
MSC Mesenchymal Stem Cell
NBP Nitrogenous Bisphosphonate
OCN Osteocalcin
OPG Osteoprotegrin
OST-PTP Osteotesticular Protein Tyrosine Phosphatase
PPAR Peroxisome Proliferator-Activated Receptor
PTH Parathyroid Hormone
PTPase Protein Tyrosine Phosphatase
RANKL Receptor Activator of NFkB Ligand
Runx2 Runt Related Transcription Factor 2
SNP Single Nucleotide Polymorphism
SQS Squalene Synthase
TGFβ Transforming Growth Factor beta
UCP1 Uncoupling Protein 1
ZGA Zaragozic Acid
1
CHAPTER I: INTRODUCTION
The Skeleton and Bone Remodeling
The skeleton serves several vital functions in human physiology, including
mechanical support, protection of internal organs, storage and metabolism of calcium and
phosphate, and regulation of hematopoiesis(1, 2). Because of these important roles, it is
necessary that there is a mechanism to replace microfractures and weakened bone that
result from daily stress on the skeleton. This process is referred to as bone remodeling (1,
3, 4).
Bone remodeling occurs throughout the adult lifespan and consists of bone
resorption by multi-nucleated, hematopoietic-derived osteoclasts and bone formation by
mesenchymal-derived osteoblasts. Bone resorption and formation are balanced so that the
amount of bone resorbed is equal to the amount of new bone formed (1-3). This balance
is controlled by intricate signaling pathways that determine the replication,
differentiation, function, and death of bone resorbing and forming cells(3). Much of this
signaling occurs directly between the osteoblasts and osteoclasts, otherwise referred to as
osteoblast-osteoclast coupling(5). Osteoblasts secrete factors that stimulate and inhibit
osteoclast differentiation and activity. Receptor activator of NFκB ligand (RANKL) and
macrophage colony stimulating factor (M-CSF) are produced by osteoblasts and are
necessary for osteoclastic differentiation from their hematopoietic precursors.
Osteoprotegerin (OPG), which is also produced by osteoblasts, acts as a soluble receptor
for RANKL, preventing the association of RANKL with RANK on pre-cursor or mature
osteoclasts. Osteoblasts control the ratio of secreted RANKL and OPG to regulate
2
osteoclastic differentiation and activity(1, 4). In turn, osteoclasts influence osteoblast
differentiation and bone formation through the resorption-dependent release of insulin-
like growth factor (IGF)-1, transforming growth factor (TGF)-ß, and bone morphogenetic
proteins (BMPs) from the bone matrix. Release of these growth factors promote
osteoblast migration to resorption sites and stimulate osteoblast differentiation(1) (Figure
1).
Osteoporosis
The balance between bone resorption and bone formation is influenced by
genetic, nutritional, hormonal, and environmental factors(1, 6), and disruption of this
balance results in bone disease. Overactivity of osteoblasts (osteosclerosis) and decreased
osteoclast activity (osteopetrosis) result in high bone mass phenotypes due to bone
formation being in excess of bone resorption (1). In contrast, when bone resorption is in
excess of bone formation, low bone mass phenotypes occur. Osteoporosis is the most
common disease of low bone mass and is characterized by reduced bone mineral density
(BMD), leading to increased bone fragility and increased risk for fractures(1, 7, 8).
Osteoporosis can result from increased osteoclastic bone resorption due to the estrogen
deficiency following menopause (post-menopausal or type I osteoporosis) or the age-
related decrease in osteoblast number and vitality (senile osteoporosis or type II
osteoporosis)(1, 9).
Osteoporosis affects approximately eight million women and two million men in
the United States(3, 4). An additional 34 million individuals have osteopenia, or low bone
mass, putting them at risk for developing the disease(4). It is estimated that one in two
3
women and one in four men over the age of 55 will develop an osteoporotic fracture in
their lifetime(4). Worldwide there are approximately nine million osteoporotic fractures
each year, with over half of these occurring in Europe and the Americas(8). These
fractures are major health problems for the elderly, causing significant morbidity and
mortality(7, 8, 10). Osteoporotic fractures also result in high costs to health care services.
The direct costs of osteoporotic fractures in the United States in 2005 were estimated to
be $19 billion(4, 8, 10).
Current therapies for osteoporosis, including estrogen-replacement therapy
(ERT), selective estrogen receptor modifiers (SERMs), calcitonin, denosumab, and the
bisphosphonates (BPs), aim to inhibit osteoclastic bone resorption. ERT and SERMs act
to replace or mimic the estrogen that is lost in the post-menopausal period and that
contributes to osteoporosis. Activation of the estrogen receptor in osteoblasts increases
the ratio of secreted OPG to RANKL resulting in decreased osteoclast differentiation and
bone resorption (4, 9). Calcitonin is a hormone that binds to the calcitonin receptor on
osteoclasts to inhibit resorptive activity (4, 11). Denosumab is a monoclonal antibody
targeting RANKL that has recently been approved by the United States Food and Drug
Administration (FDA). By acting as a soluble receptor for RANKL, similar to OPG,
Denosumab prevents the differentiation and activity of osteoclasts(4, 5, 11). Currently,
the most widely prescribed drugs for osteoporosis are the BPs (4, 11, 12).
The BPs are synthetic analogs of pyrophosphate, consisting of a non-hydrolyzable
phosphonate-carbon-phosphonate (P-C-P) backbone with two variable side chains, R1
and R2. The BP core gives these compounds a strong affinity for bone mineral (5, 12).
This affinity can be further enhanced by a hydroxyl group in the R1 position and a
4
nitrogen group in the R2 position. Nitrogen containing BPs are referred to as nitrogenous
BPs (NBPs), whereas BPs without a nitrogen in this position are referred to as non-
nitrogenous BPs (non-NBPs). BPs are released from the bone surface by the acidic pH
generated in the osteoclast resorption lacunae, allowing uptake of the drug into the
osteoclasts (12). Non-NBPs act by being incorporated into adenosine triphosphate (ATP),
resulting in the formation of non-hydrolyzable ATP analogues and osteoclast apoptosis.
In contrast, the more potent NBPs inhibit the enzyme farnesyl pyrophosphate synthase
(FPPS) as depicted in Figure 2(13-15). As will be discussed in greater detail later, FPPS
is an enzyme in the isoprenoid biosynthetic pathway. Inhibition of FPPS leads to
decreased levels of the isoprenoids farnesyl pyrophosphate (FPP) and geranylgeranyl
pyrophosphate (GGPP). These molecules are necessary for the isoprenylation and
membrane localization of several proteins involved in the osteoclastic F-actin ring
formation, and the subsequent development of the resorption lacunae. Inhibition of FPPS
by the NBPs prevents the development of the F-actin ring and resorption lacunae, leading
to the inhibition of osteoclast activity. There is also some speculation that NBPs may
inhibit the differentiation of pre-osteoclasts into mature osteoclasts (5, 12). By inhibiting
FPPS, NBPs also lead to an accumulation of the FPPS substrate isopentenyl
pyrophosphate (IPP). Monkkonen, et al. demonstrated that this accumulation of IPP leads
to the formation of a novel ATP analogue, ApppI. ApppI inhibits the mitochondrial
ADP/ATP translocase and results in osteoclast apoptosis(16). However preliminary
reports describing mice deficient for bim, a protein involved in apoptosis, suggest that the
main mechanism for inhibition of osteoclastic bone resorption by NBPs is inhibition of
protein prenylation and osteoclast resorptive activity (17). By preventing osteoclastic
5
bone resorption via inhibition of osteoclast differentiation, stimulation of osteoclast
apoptosis, or inhibition of osteoclast resorptive activity, BPs reduce the risk of
osteoporotic fractures (4, 11). NBPs, such as zoledronate, have also proven useful in the
treatment of osteolytic bone diseases, such as multiple myeloma and metastatic breast
cancer, acting to prevent the tumor-induced osteoclastic bone resorption; these drugs may
also have direct effects on tumor cells(18).
While anti-resorptive therapies are effective in preventing further bone loss and
reducing the incidence of fractures, they are not able to restore bone structure that has
been lost (3). Anabolic agents that stimulate osteoblastic bone formation have the
potential to reconstruct the skeleton and to restore bone structure. This would be
especially beneficial for patients who have sustained substantial bone loss (19). Currently
the only anabolic agent approved by the FDA is the recombinant parathyroid hormone
(PTH) peptide fragment, teriparatide. Teriparatide is administered intermittently and
results in an increase in the number and activity of osteoblasts. However, because of its
high cost, teriparatide use is currently confined to only high risk populations (1).
Therefore, much research is being done to develop novel agents to stimulate osteoblast
differentiation and bone formation as a treatment for osteoporosis and other conditions of
low bone mass.
Isoprenoid Biosynthetic Pathway
The isoprenoid biosynthetic pathway is the source of numerous biological
compounds (Figure 2). β-Hydroxymethylglutaryl coenzyme A (HMG-CoA), derived
from acetyl-CoA, is reduced to mevalonate in a reaction catalyzed by HMG-CoA
6
reductase (HMGCR). Mevalonate is then phosphorylated by mevalonate kinase, to form
5-phosphomevalonate. This compound undergoes an additional phosphorylation and
decarboxylation to form the five-carbon isopentenyl pyrophosphate (IPP), the basic
building block referred to as an isoprene unit. IPP isomerizes to dimethylallyl
pyrophosphate (DMAPP), and together IPP and DMAPP are converted to the ten-carbon
geranyl pyrophosphate (GPP) by FPPS. Addition of a second molecule of IPP to GPP by
FPPS results in the formation of the fifteen-carbon FPP. FPP is the branch point of the
isoprenoid biosynthetic pathway. Squalene synthase catalyzes the head to head
condensation of two FPP molecules to form squalene, the first committed step towards
cholesterol biosynthesis. Alternatively, GGPP synthase (GGPPS) combines FPP and IPP
to form the twenty-carbon GGPP. GGPP is a precursor for several longer chain
isoprenoids, including ubiquinone (20, 21).
In addition to serving as substrates for the synthesis of sterols and longer-chain
non-sterol isoprenoids, FPP and GGPP are utilized in the isoprenylation of proteins.
Isoprenylation is a posttranslational protein modification and consists of the addition of
an isoprenoid group to a carboxy-terminal cysteine. This modification is necessary for the
correct localization of certain proteins, including small GTPases, and can therefore
influence protein activity as well as protein-protein interactions(21-23). In a search of the
Swiss-Prot database, 300 proteins were identified as potential targets of protein
prenylation (24). FPP is the substrate for farnesyl transferase (FTase) and GGPP is the
substrate for geranylgeranyl transferases I and II (GGTases I and II), resulting in
farnesylation and geranylgeranylation of proteins, respectively. FTase and GGTase I are
heterodimeric, zinc metalloenzymes made up of a common α subunit and divergent ß
7
subunits. FTase and GGTase I recognize the carboxy-terminal CAAX motif, in which C
is the prenylated cysteine residue and A represents aliphatic residues. The presence of
serine, methionine, alanine, or glutamine at the X residue designates the protein as an
FTase substrate, whereas a leucine designates the protein as a GGTase I substrate.
Following this prenylation, the AAX peptide is cleaved, and the cysteine residue is
methylated. Similar to FTase and GGTase I, GGTase II, otherwise known as Rab
GGTase, is a heterodimeric protein made up of GGTase II α and ß subunits. In contrast to
FTase and GGTase I, GGTase II requires Rab escort protein 1 (Rep1) for its activity.
GGTase II targets CC, CAC, CCX, or CCXX carboxy-terminal motifs and
geranylgeranylates one or both cysteine residues (21-23).
FPP and GGPP, as well as their metabolites, have also been shown to act as
ligands for certain receptors. The alcohol form of FPP, faresol (FOH) activates the
farnesoid X receptor (FXR)(25) whereas the alcohol form of GGPP, geranylgeraniol
(GGOH) has been shown to inhibit the activity of liver X receptor (LXR)-α(26). More
recently, Das, et al. demonstrated that FPP binds and activates the estrogen, thyroid, and
glucocorticoid receptors (27). Interestingly, the activation of the glucocorticoid receptor
by FPP occurred in primary keratinocytes and resulted in inhibition of wound healing in
skin organ cultures (28). In addition to activating nuclear hormone receptors, FPP has
been found to be an agonist of the G-protein coupled receptor (GPCR), GPR92 (29), and
an antagonist of the LPA3 receptor (30). It has also been demonstrated that FPP activates
the calcium channel TRPv3 resulting in nociceptive behaviors in inflamed animals,
suggesting that FPP is a novel endogenous pain-producing substance (31).
8
There are several FDA-approved pharmaceutical agents that target enzymes in the
isoprenoid biosynthetic pathway, namely the statins and NBPs. Statins are commonly
used to lower serum cholesterol (32) and act by inhibiting HMG-CoA reductase (33). By
inhibiting HMG-CoA reductase, statins inhibit cholesterol biosynthesis, leading to an
upregulation of the low-density lipoprotein (LDL) receptor. LDL receptor upregulation
leads to the increased clearance of plasma LDL cholesterol. In addition to depletion of
cholesterol, the inhibition of HMG-CoA reductase by statins leads to decreased
production of the isoprenoids FPP and GGPP. As described above, FPP and GGPP have
several biological functions and their depletion by statins is thought to give rise to
pleiotropic effects, such as the activation of endothelial nitric oxide synthase (eNOS)
leading to blood vessel dilation(32, 34).
NBPs make up a second class of pharmaceutically available agents targeting the
isoprenoid biosynthetic pathway. These drugs, as mentioned previously, are potent
inhibitors of osteoclastic bone resorption and are widely used in the management of
osteoporosis and cancer-induced osteolytic bone disease(12). The pyrophosphate-like
backbone targets these agents to the bone mineral, where they are taken up by the
osteoclast. NBPs inhibit FPPS leading to the depletion of the isoprenoids FPP and GGPP.
This leads to the impaired protein prenylation of several small GTPases that are
necessary for osteoclast activity, and therefore inhibition of bone resorption(13-15).
Osteoblast Differentiation and the Isoprenoid Biosynthesis Pathway
Osteoblasts are derived from mesenchymal stem cells (MSCs) in the bone marrow
(1). MSCs are multi-potential cells capable of differentiating into adipocytes, myoblasts,
9
fibroblasts, chondrocytes and osteoblasts (1, 2). Differentiation into these various cell
types is controlled by the expression of lineage-specific transcription factors (2, 35). In
differentiating into mature osteoblasts, MSCs commit to the osteo-chondroprogenitor
lineage, followed by the osteoprogenitor lineage. These cells then undergo an expansion
followed by maturation into mature osteoblasts expressing osteocalcin (OCN) and type I
collagen (Col1a1). Importantly, these cells exhibit the ability to form collagen-based
extracellular matrices and mineral deposits (1, 35).
As mentioned above, statins deplete FPP and GGPP leading to several pleiotropic
effects(32). Mundy, et al. demonstrated that statins stimulate osteoblast differentiation
and bone formation through the induction of BMP-2 expression (36). These results have
been subsequently supported by several in vitro(37-44) and in vivo(45, 46) studies. There
have also been positive correlations cited between higher BMDs and patients
administered lipophilic statins(47-50). The ability of statins to stimulate osteoblast
differentiation has been attributed to the depletion of GGPP, since the addition of
exogenous GGPP or GGOH prevents the effects of statins in vitro (41, 43). Consistent
with this observation, NBPs, which similarly deplete endogenous GGPP, stimulate
osteoblast differentiation in in vitro MSC cultures (51, 52). It is important to note,
however, that some studies have found negative effects for NBPs on osteoblast
differentiation (53, 54). In support of GGPP depletion stimulating osteoblast
differentiation, a report by Yoshida, et al. demonstrated that the expression of GGPPS
decreases during the osteoblastic differentiation of the MC3T3-E1 pre-osteoblast cell
line(55). Consistent with this, Takase, et al. demonstrated that mevalonate kinase, the
enzyme downstream of HMGCR, decreases following treatment with the anabolic
10
peptide hormone, PTH(56). Addition of exogenous GGOH to MC3T3-E1 pre-osteoblast
cultures prevented osteoblast differentiation as measured by matrix mineralization and
the expression of the osteoblastic genes alkaline phosphatase (ALP) and BMP-2 (55).
In studying the differentiation of osteoblasts and bone formation, much attention
is paid to the differentiation of MSCs into an alternate cell type involved in bone
homeostasis, the adipocyte (2). Although initially assumed to be inert, adipocytes are
now known to be central players in energy homeostasis and insulin sensitivity (2, 57),
synthesizing and transporting lipids, as well as secreting adipokines, such as leptin and
adiponectin (2, 58).
The decreased bone mass characteristic of osteopenia and osteoporosis is
associated with an increase in bone marrow adiposity. Interestingly, factors that promote
osteoblastogenesis inhibit adipogenesis and vice versa (2, 6, 58). For example,
peroxisome proliferator-activated receptor (PPAR)-γ2, a member of the PPAR subfamily
of nuclear hormone receptors (57), is a positive regulator of adipogenic differentiation
and a negative regulator of osteoblast differentiation, acting to suppress the activity of the
osteoblast transcription factor runt-related transcription factor (Runx)-2 (2, 35, 58). As
mentioned previously, GGPP depletion by statin drugs stimulates osteoblast
differentiation(36). Consistent with stimulators of osteoblastogenesis inhibiting
adipogenesis, statin-mediated GGPP depletion results in the inhibition of adipogenic
differentiation, demonstrating the importance of GGPP and geranylgeranylation to
adipogenesis (42, 59). Interestingly, in contrast to the decreased GGPPS exhibited by
differentiating MC3T3-E1 pre-osteoblasts(55), GGPPS is highly expressed in adipose
11
tissue of the leptin-deficient ob/ob mice, and its expression increases during the
adipogenic differentiation of the 3T3-L1 cell line (60).
In addition to studying the role of the isoprenoid pathway in osteoblast
differentiation models through the use of small molecule inhibitors, there has been much
recent investigation into single nucleotide polymorphisms (SNPs) found in isoprenoid
pathway enzymes that may contribute to skeletal disease. Several studies have noted that
a non-coding SNP in the FPPS gene (rs2297480) may be a genetic marker for lower
BMD in postmenopausal Caucasian women. BMD was lower at all skeletal sites
measured in women with CC or CA genotypes as compared to the AA genotype at this
site (61). A separate study investigating this SNP demonstrated that individuals with the
CC genotype showed a decreased response to two years of treatment with NBPs(62).
Although the effect of this SNP on enzyme activity and FPP production has not been
studied, one would speculate that this non-coding SNP may lead to greater expression of
FPPS, making patients less responsive to NBP therapy. A SNP in GGPPS has also been
noted to have skeletal effects. In a recent study by Choi, et al. patients homozygous for a
deletion SNP at -8188A (rs3840452) in this enzyme displayed higher femoral neck BMD
and a decreased response to NBP therapy, however their population size was very small
(n=144) and separate studies will be required to confirm their results(63). If the
significance of this SNP on the skeleton is confirmed, one may speculate that these
patients exhibit lower GGPPS expression, leading to lower GGPP levels, resulting in
higher BMD. While the authors of these studies emphasized the impact of these SNPs on
osteoclastic activity, it cannot be ruled out that these SNPs may impact osteoblastic bone
12
formation, especially considering the negative effects of exogenous GGOH on
osteoblastic cultures published by Yoshida, et al(55).
Hypothesis
The body of evidence summarized above raises several questions. If statins lead
to osteoblast differentiation through the depletion of GGPP and subsequent impaired
geranylgeranylation, would specific inhibition of GGPPS similarly yield increased
osteoblast differentiation? Additionally, if one assumes that in standard conditions, all
geranylgeranylated proteins are isoprenylated, why does the addition of exogenous
GGOH inhibit osteoblast differentiation? And what is the impact of other isoprenoids?
Does FPP, which has been shown to activate numerous nuclear hormone receptors
involved in maintenance of the skeleton, influence osteoblast activity? The studies
presented in this manuscript examine these questions and aim to determine the influence
of the isoprenoid pathway on osteoblast differentiation.
Herein I document studies intended to address these questions. Digeranyl
bisphosphonate (DGBP), a novel inhibitor of GGPPS (Figure 2) developed by our and
Dr. David F. Wiemer’s lab at the University of Iowa(64, 65), was utilized to determine
whether specific depletion of GGPP led to enhanced osteoblast differentiation, similar to
statin-induced osteoblast differentiation. By inhibiting GGPPS, DGBP leads to the
accumulation of the substrate FPP. DGBP and squalene synthase (SQS) inhibitors, which
similarly cause FPP accumulation, were employed to determine whether FPP plays a
negative role in osteoblast differentiation. Lastly, studies were performed to determine
whether GGPP itself may influence the osteoblast versus adipocyte fate decision and to
13
determine potential mechanisms by which GGPP inhibits osteoblast differentiation. The
overall aim of this work was to test the hypothesis that the intermediates of the isoprenoid
biosynthetic pathway negatively regulate osteoblast differentiation.
14
Figure 1. Skeletal bone remodeling.
15
Figure 2. The isoprenoid biosynthetic pathway. This illustration diagrams the conversion of mevalonate to the isoprenoid metabolites (IPP, DMAPP, GPP, FPP, squalene, and GGPP). Specific enzymes responsible for production of certain metabolites are indicated in italics. Specific inhibitors of these enzymes are also noted.
16
CHAPTER II: THE EFFECTS OF DIRECTION INHIBITION OF GERANYLGERANYL PYROPHOSPHATE SYNTHASE (GGPPS) ON
OSTEOBLAST DIFFERENTIATION Abstract
Statins, drugs commonly used to lower serum cholesterol, have been shown to stimulate
osteoblast differentiation and bone formation. These effects have been attributed to the
depletion of geranylgeranyl pyrophosphate (GGPP). In this study, we tested whether
specific inhibition of GGPP synthase (GGPPS) with digeranyl bisphosphonate (DGBP)
would similarly lead to increased osteoblast differentiation. DGBP concentration
dependently decreased intracellular GGPP levels in MC3T3-E1 pre-osteoblasts and
primary rat calvarial osteoblasts, leading to impaired Rap1a geranylgeranylation. In
contrast to our hypothesis, 1 µM DGBP inhibited matrix mineralization in the MC3T3-E1
pre-osteoblasts. Consistent with this finding, DGBP inhibited the expression of alkaline
phosphatase (ALP) and osteocalcin (OCN) in primary osteoblasts. By inhibiting GGPPS,
DGBP caused an accumulation of the GGPPS substrate farnesyl pyrophosphate (FPP).
This effect was observed throughout the time course of MC3T3-E1 pre-osteoblast
differentiation. Interestingly, DGBP treatment led to activation of the glucocorticoid
receptor in MC3T3-E1 pre-osteoblast cells, consistent with recent findings that FPP
activates nuclear hormone receptors. These findings demonstrate that direct inhibition of
GGPPS, and the resulting specific depletion of GGPP, does not stimulate osteoblast
differentiation. This suggests that in addition to depletion of GGPP, statin-stimulated
osteoblast differentiation may depend on the depletion of upstream isoprenoids, including
FPP.
17
Introduction
As discussed previously, osteoporosis is a condition characterized by low BMD
that puts one at greater risk for debilitating fractures(7, 8), and current treatments inhibit
bone resorption by osteoclasts to prevent further bone loss and reduce fracture risk(3, 11).
However, anabolic agents that stimulate bone formation by osteoblasts are needed to
restore bone mass and structure in patients who have sustained substantial bone loss(3,
19).
Statins, drugs commonly used to lower serum cholesterol, have positive effects on
osteoblast differentiation and bone formation both in vitro(36, 37, 39, 41, 43) and in
vivo(36, 66, 67). Additionally, clinical trials have indicated a positive correlations
between increased BMD and patients administered lipophilic statins(47, 48).
Through inhibition of HMGCR, statins deplete downstream isoprenoid
metabolites, including FPP and GGPP, resulting in impaired protein isoprenylation. It is
thought that the effects of statins on bone are due to the depletion of GGPP, since
addition of exogenous GGPP or GGOH to statin-treated osteoblasts prevents the effects
of statins on osteoblast differentiation and matrix mineralization(41, 43). Consistent with
this hypothesis, NBPs, which inhibit FPPS(14, 15) and deplete cells of GGPP, have been
shown to stimulate osteoblast differentiation in vitro(51, 52) and prevent the negative
effects of dexamethasone on osteoblast differentiation(68). It is important to note,
however, that several other studies have reported that NBPs decrease osteoblast
proliferation and matrix mineralization(53, 54).
DGBP is a BP that specifically inhibits GGPPS(64, 65). We hypothesized that if
statin-stimulated osteoblast differentiation occurred through the depletion of GGPP,
18
direct inhibition of GGPPS with DGBP would similarly result in increased osteoblast
differentiation and matrix mineralization.
Materials and Methods
Cell culture. The MC3T3-E1 pre-osteoblast cell line was obtained from ATCC.
The animal protocol used for isolation of primary rat calvarial cells was approved by the
Institutional Animal Care and Use Committee at the University of Iowa. Primary rat
osteoblast cells were obtained by three sequential enzyme digestions of calvariae from
two day old neonatal Sprague-Dawley rats (Harlan). Digestions were performed with
0.05% collagenase type I and 1% trypsin (Invitrogen) in serum free α modified essential
medium (α-MEM) (Invitrogen) at 37 oC with shaking. The first two digestions (10 and
20 minutes, respectively) were discarded. Following the final digestion (60 minutes),
cells were centrifuged and resuspended in α-MEM containing 10% fetal bovine serum
(FBS) and 1x penicillin-streptomycin (Invitrogen). Cells were grown in a humidified
atmosphere with 5% CO2 at 37 oC in 10 cm plates.
Cells were subcultured for experiments at a density of 1x104 cells/cm2. All
experiments were carried out in osteoblast differentiation medium. This consisted of -
MEM with 10 mM β-glycerophosphate and 50 µg/mL L-ascorbic acid (Fischer
Scientific). Treatments were replaced every 3-4 days until the termination of the
experiment.
FPP/GGPP Quantification. MC3T3-E1 pre-osteoblasts and primary calvarial
osteoblasts were plated in 10 cm plates. Upon confluency cells were treated for with
DGBP (Wiemer lab, University of Iowa) (0.1, 1, 10, 100 µM) for 24 h. Alternatively,
19
MC3T3-E1 pre-osteoblasts were treated with or without 1µM DGBP for 1, 2, or 4 weeks.
FPP and GGPP levels were determined as previously reported by reverse phase
HPLC(69). Briefly, cells were washed twice with phosphate buffered saline (PBS)
(Invitrogen) and isoprenoid pyrophosphates were extracted from cells and used as
substrates for incorporation into fluorescent GCVLS or GCVLL peptides by
farnesyltransferase or geranylgeranyl transferase I. The prenylated fluorescent peptides
were separated by reverse phase HPLC and quantified by fluorescence detection. Total
FPP and GGPP levels were normalized to total protein content as measured by the
bichinconic (BCA) assay. Values are expressed as pmoles per mg protein.
Western blotting. MC3T3-E1 pre-osteoblasts were plated in 10 cm plates. Upon
confluency, cells were treated for 24 h. At the end of the experiment, media were
removed and cells were washed twice in PBS. Cells were collected with a cell scraper
after the addition of 2% sodium dodecyl sulfate (SDS)-lysis buffer. Lysates were
transferred to a 1.5 ml tube, heated to 100 oC for five minutes, and passed through a 27-
guage needle. Lysates were then centrifuged and supernatant transferred to a fresh 1.5 ml
tube. Protein concentrations were determined by the BCA method. Proteins were
resolved on 12% (Rap1a and Ras) or 7.5% (glucocorticoid receptor or Sp1) SDS-PAGE
gels and transferred to polyvinylidene difluoride membranes by electrophoresis. Primary
and secondary antibodies were added sequentially for 1 h and proteins were visualized
using an enhanced chemiluminescence detection kit from GE Healthcare. Anti pan-Ras
was obtained from InterBiotechnology. Rap1a, glucocorticoid receptor, Sp1, αTub, and
ßTub antibodies were obtained from Santa Cruz Biotechnology, Inc. Phospho (serine
211) glucocorticoid receptor antibody was obtained from Abcam. Horseradish
20
peroxidase-conjugated anti-mouse and anti-rabbit secondary IgG antibodies were from
GE Healthcare while anti-goat secondary IgG antibody was from Santa Cruz
Biotechnology, Inc.
Mineralization assay. MC3T3-E1 pre-osteoblasts were plated in 24-well plates.
Treatment began when cells reached confluency. After 28 days of culture, cells were
fixed for one hour in ice-cold 70% ethanol. Cells were then washed thoroughly with
deionized water; mineralization was detected with 40 mM Alizarin red, pH=4.2 for 15
minutes. Following staining, cells were washed thoroughly with deionized water to
remove non-specific Alizarin red. Images were captured using a Canon EOS Rebel XS.
Mineralization was quantified as described previously(70). Briefly, Alizarin Red was
eluted with 10% acetic acid per well. Plates were shaken on an orbital rotator for 15 min.
The acetic acid and cells were transferred to a 1.5 mL tube and heated to 85 oC for 10
minutes. The samples were then cooled on ice and centrifuged. The supernatant was
transferred to a new tube and 10% ammonium hydroxide was added. Samples were
vortexed vigorously and aliquots were transferred to a 96-well plate. The absorbance was
read at 405 nm on a Thermomax Microplate Reader (Molecular Devices). Absorbance
was compared to a standard curve; values were expressed as total mol Alizarin Red per
well.
Real-time quantitative polymerase chain reaction (qPCR). Primary calvarial
osteoblasts were plated in 6-well plates. Treatment was applied when cells reached
confluency. Eight days following the onset of treatment, total RNA was isolated from
each well using Qiashredders and the RNeasy Mini Kit (Qiagen). During the isolation, a
DNase step was performed (Qiagen). One µg of RNA was reverse-transcribed into cDNA
21
using the iScript cDNA Synthesis Kit (Bio-Rad). Real-time PCR was performed with
Sybr Green Master Mix (Applied Biosystems) with an ABI SDS 7900 HT instrument
(Applied Biosystems). The real-time protocol consisted of 2 min at 50oC, 10 min at
95oC, followed by 40 cycles of 95oC (15 sec) and 60oC (one min). Dissociation curves
were obtained following real-time qPCR to ensure the proper amplification of target
cDNAs. Primers were obtained from Integrated DNA Technologies (Iowa City, IA) and
eluted in TE Buffer (Ambion). Sequences and amplicon lengths are found in the Table 1.
Nuclear/Cytosol Fractionation. MC3T3-E1 pre-osteoblasts were plated in 10 cm
plates. Upon confluency, cells were treated with 1 µM dexamethasone (Sigma) or DGBP
(10, 50, and 100 µM). Cells were treated for 24 h. Nuclear and cytosolic fractions were
obtained with the nuclear/cytosol fractionation kit from Biovision. Cells were lysed and
fractionated as described by the kit protocol. Alternatively, whole cell lysate was
obtained by lysing the cells with RIPA buffer with added protease and phosphatase
inhibitors. Protein concentrations were determined with the BCA method. Western
blotting was performed as described above.
Statistical Analysis. Data are expressed as means +/- standard error of the mean.
All experiments were repeated at least twice with similar results. Differences between
two groups were compared using unpaired student’s t tests. Statistical significance was
defined by p values less than 0.05.
Results
DGBP decreases GGPP levels and impairs protein geranylgeranylation. To
determine whether DGBP inhibited GGPPS in MC3T3-E1 pre-osteoblasts and primary
22
rat calvarial osteoblasts, cells were treated with increasing concentrations of DGBP for
24 h. DGBP reduced intracellular GGPP levels at concentrations of 1-100 µM (Figure
3A). This decrease in GGPP correlated with the appearance of unprenylated Rap1a, a
geranylgeranylated protein, in MC3T3-E1 pre-osteoblasts (Figure 3B) and primary
calvarial osteoblasts (data not shown). Lovastatin, which reduces both FPP and GGPP,
impaired both the farnesylation of Ras (appearance of an upper band) and the
geranylgeranylation of Rap1a. In contrast, DGBP, which does not deplete FPP, had no
effect on the farnesylation of Ras. Impaired geranylgeranylation of Rap1a by lovastatin
and DGBP was prevented by the addition of 20 µM GGPP. However, impaired
farnesylation of Ras by lovastatin-mediated FPP depletion was not prevented by the
addition of exogenous GGPP.
Mineralization is inhibited by DGBP independently of GGPP depletion. To
determine the effects of depletion of GGPP on osteoblast mineralization, MC3T3-E1 pre-
osteoblasts were treated with DGBP for 28 days. One micromolar DGBP significantly
reduced osteoblast mineralization as evidenced by reduced Alizarin red staining as
determined visually (Figure 4A) or by elution and quantification of the stain by
absorbance measurement (Figure 4B). DGBP at concentrations of 1.0 µM or less had no
significant effect on osteoblast viability as measured by MTT assay throughout the time
course of osteoblast differentiation (data not shown).
To determine whether the negative effect of DGBP on osteoblast mineralization
was due to the depletion of GGPP, GGPP add-backs were performed. 20 µM GGPP
alone significantly reduced mineralization of MC3T3 cell cultures as compared to control
23
wells. The addition of GGPP with DGBP did not prevent the effects of DGBP on
osteoblast mineralization.
Expression of osteoblastic genes is inhibited by DGBP. In order to determine the
effects of GGPPS inhibition on osteoblast differentiation, primary rat calvarial
osteoblasts were treated with 1.0 M DGBP for eight days, followed by the assessment
of osteoblastic gene expression. As shown in Figure 4C, treatment of the osteoblast cells
for eight days with 1.0 µM DGBP significantly inhibited the expression of ALP and
OCN, with no effect on the expression of Col1a1.
DGBP leads to an accumulation of FPP. To determine whether the inhibition of
GGPPS perturbs the level of its substrate, FPP, intracellular FPP was measured in
MC3T3-E1 pre-osteoblasts and primary rat calvarial osteoblasts after 24 hours of DGBP
treatment. Treatment with DGBP resulted in a concentration-dependent increase in
intracellular FPP in both cell types (Figure 5A). To determine whether the effect of
DGBP on GGPP depletion (Figure 3A) and FPP accumulation (Figure 5A) was transient,
intracellular GGPP and FPP were assessed throughout the four-week time course of
MC3T3-E1 cell differentiation. As shown in Figure 5B, MC3T3-E1 cell GGPP levels
were significantly decreased after four weeks of control differentiation. One M DGBP
significantly decreased GGPP levels at each time point assessed. Similarly to GGPP,
MC3T3-E1 differentiation cultures exhibited decreased intracellular FPP after four weeks
of control differentiation. Treatment of the differentiation cultures with 1.0 M DGBP
resulted in a significant accumulation of FPP at each time point, and prevented the
decrease of FPP exhibited during control differentiation.
24
DGBP treatment leads to glucocorticoid receptor activation in osteoblasts. It has
been shown recently that certain nuclear hormones, including the thyroid receptor,
estrogen receptor, and glucocorticoid receptor (GR), are bound and activated by FPP (27,
28). To determine whether the accumulation of intracellular FPP by DGBP correlates
with activation of nuclear hormone receptors in osteoblasts, phosphorylation of the GR
was assessed in MC3T3-E1 pre-osteoblast cells following 24 hours of treatment with
DGBP (10, 50, or 100 µM) or 1.0 µM of the GR agonist dexamethasone. As shown in
Figure 6A, dexamethasone led to the appearance of phosphorylated (Serine 211)-GR.
Similar to treatment with the GR agonist, DGBP led to increased phosphorylated-GR
with all concentrations tested. The level of phosphorylated-GR normalized to total GR
was quantified using densitometry (Figure 6B).
Nuclear accumulation of the GR following DGBP treatment of the MC3T3-E1
pre-osteoblasts was also assessed. One micromolar dexamethasone led to a decrease in
cytosolic and an increase in nuclear GR (Figure 6C). DGBP treatment had no effect on
cytosolic levels of the GR, however, the higher concentrations of DGBP (50 and 100
µM) led to increased nuclear GR. The nuclear and cytosolic GR levels were quantified
using densitometry (Figure 6D).
Discussion
These data demonstrate that the specific inhibition of GGPPS in osteoblasts by the
BP DGBP results in the depletion of intracellular GGPP and impaired protein
geranylgeranylation. In contrast to our hypothesis, specific depletion of GGPP does not
25
lead to increased osteoblast differentiation. Importantly, inhibition of GGPPS leads to an
accumulation of the GGPPS substrate, FPP, and the subsequent activation of the GR.
As mentioned earlier, statins have been shown to stimulate osteoblast
differentiation and bone formation(36, 37, 39, 41, 43). These effects have been attributed
to decreased GGPP, since the addition of exogenous GGPP prevents statin-stimulated
osteoblast mineralization(41) and BMP-2 expression(43). Consistent with this, NBPs,
which similarly decrease GGPP, have been shown to stimulate osteoblast differentiation
in vitro(51, 52).
The results presented here have important consequences for the studies showing
positive effects of statins and NBPs on osteoblast differentiation. Direct inhibition of
GGPPS and depletion of GGPP inhibited osteoblast differentiation and matrix
mineralization of MC3T3-E1 pre-osteoblasts and primary rat calvarial osteoblasts. These
results suggest that the depletion of isoprenoids upstream of GGPP may be essential for
normal osteoblast differentiation.
One possibility is that DGBP inhibits osteoblast mineralization due to its
bisphosphonate core backbone. It has been reported that bisphosphonates display a
pyrophosphate-like effect to prevent hydroxyapatite (HAP) crystal growth(71). This
would be consistent with studies showing negative effects of NBPs on osteoblast matrix
mineralization. However, the structure of DGBP lacks the traditional R1 hydroxyl group
of the NBP structure. Clodronate, a non-NBP which similarly lacks the hydroxyl group,
exhibits lower inhibitory effects on HAP crystal growth in vitro than NBPs.
Concentrations less than or equal to 1 µM clodronate fail to inhibit osteoblast
mineralization(53, 54). This suggests that at the concentration tested in this study, DGBP
26
did not inhibit mineralization through a pyrophosphate-like effect on HAP crystal
growth; however, the binding affinity of DGBP for HAP has not been published.
As shown in Figure 4, exogenous GGPP inhibited osteoblast mineralization in the
presence or absence of DGBP suggesting the effect of DGBP to inhibit matrix
mineralization is not through GGPP depletion. This is consistent with data from Yoshida,
et al. showing that GGOH inhibits expression of osteoblastic genes and mineralization in
MC3T3-E1 pre-osteoblasts(55). We demonstrated that intracellular GGPP levels
decreased during MC3T3-E1 pre-osteoblast differentiation, in agreement with data from
Yoshida, et al. demonstrating decreased GGPPS expression and activity during MC3T3-
E1 pre-osteoblast differentiation(55). Interestingly, the GGPPS substrate FPP similarly
decreases during osteoblast differentiation, suggesting that isoprenoids upstream of
GGPP play a role in regulating osteoblast differentiation. This is consistent with work
published by Takase, et al. demonstrating decreased mevalonate kinase expression
following treatment of osteoblasts with the anabolic peptide PTH (56).
There have been many roles reported for FPP, in addition to being a precursor for
cholesterol synthesis and a substrate for protein prenylation. FPP has been reported to be
an activator of TRPv3(31) channels, an antagonist of the LPA3 receptor(30), and an
agonist of GPR92 orphan receptor(29). A study by Das, et al. showed that FPP activates
several nuclear hormone receptors, including the thyroid receptor, estrogen receptor, and
GR(27). Additionally, FPP activated the GR in epithelial cells and was found to play a
role in the regulation of wound healing(28). Figure 6 demonstrates that DGBP increased
the phosphorylation of the GR at serine residue 211, similar to the GR agonist
dexamethasone, and high concentrations of DGBP caused an increase in nuclear GR. The
27
decrease in cytosolic GR localization was evident with the GR agonist dexamethasone,
but not with DGBP. This may be due to the fact that dexamethasone is itself an agonist of
the GR, whereas activation of the GR by DGBP is likely indirect and dependent upon the
inhibition of GGPPS and the ensuing FPP accumulation. High doses of glucocorticoids
are known to have negative effects on the skeleton through direct effects on osteoblasts to
inhibit proliferation and differentiation(72). This suggests that activation of the GR by
FPP may play a role in the negative effects of DGBP on osteoblasts. Vukelic, et al. also
demonstrated that treatment with statins promotes wound healing through the depletion
of endogenous FPP(28). This calls to question whether statin drugs would similarly
decrease basal GR activity in pre-osteoblasts, which has been shown to be required for
osteoblast differentiation in murine models(72, 73). However, the low levels of activated
GR in the absence of dexamethasone or DGBP argues against a role for the low basal
levels of FPP in supporting GR activity. Taken together these results suggest that the
accumulation of FPP by GGPPS inhibition inhibits osteoblast differentiation potentially
through the activation of the GR, or other nuclear hormone receptors.
As mentioned previously, several publications have reported that a non-coding
SNP in the FPPS gene (rs2297480) correlates with BMD. Caucasian women with CC or
CA genotypes at this position displayed lower BMD at all sites measured as compared to
the AA genotype(61). Consistent with this, Marini, et al. 2008 demonstrated that post-
menopausal osteoporosis patients with the CC genotype showed a decreased response to
two years of NBP therapy as compared to the AA or AC genotypes (62). While the
functional consequence of this SNP has not been determined, this work highlights the
importance of FPP in the skeleton. It is possible that this SNP leads to higher expression
28
of FPPS and increased levels of FPP, potentially negatively affecting osteoblast
differentiation.
In summary, direct inhibition of GGPPS with DGBP depletes GGPP in
osteoblasts resulting in impaired geranylgeranylation. DGBP inhibits osteoblast matrix
mineralization and this is not prevented by GGPP add-backs, suggesting that the effect of
DGBP on matrix mineralization is independent of GGPP depletion. Consistent with the
effect of DGBP on matrix mineralization, DGBP inhibits expression of osteoblastic genes
in primary rat calvarial osteoblasts. Interestingly, inhibition of GGPPS led to an
accumulation of the GGPPS substrate FPP, and this accumulation remained over the
course of osteoblastic differentiation. This increase in FPP correlated with increased
phosphorylation and nuclear accumulation of the glucocorticoid receptor. Together these
results suggest a potential role for the depletion of isoprenoids upstream of GGPP, such
as FPP, in osteoblast differentiation.
29
Gene Entrez Gene
ID F/R Primer Sequence 5'-3'
Amplicon length (bps)
F AGACGCAGGTGTTCTTGGTCCTAA Adiponectin 246253
R 244
GAATTTGCCAGTGCTGCCGTCATA F AATCGGAACAACCTGACTGACCCT
ALP 25586 R
111 AATCCTGCCTCCTTCCACTAGCAA
F TGATCACCTGAACTCCACCAACCA BMP2 29373
R 176
AACCCTCCACAACCATGTCCTGAT F AGGCCAAGAAGTCGGTGGATAAGA
C/EPBα 24252 R
144 TGTCACTGGTCAACTCCAACACCT
F AGCAAAGGCAATGCTGAATCGTCC Col1a1 29393
R 125
TGCCAGATGGTTAGGCTCCTTCAA F TCCAGCACTTCTCCCAGATTGTCA FPPS 83791 R
193 AGGCTCTCAGCATCCTGTTTCCTT
F TGACTCTACCCACGGCAAGTTCAA GAPDH 24383
R 141
ACGACATACTCAGCACCAGCATCA F ATTTGGTCAAGGCCAGAAAGCACC GGPPS 291211 R
200 AAAGCCACTAGTGAAGGGTTCCCA
F TTCACGTTGGTCTCGGTGCTCTTA Glut4 25139
R 172
CCACAAAGCCAAATATGGCCACGA F TTCCAAGGGTACGGAGAAAGCACT HMGCR 25675 R
178 TTCTCTCACCACCTTGGCTGGAAT
F AGAACAGACAAGTCCCACACAGCA OCN 25295
R 185
TATTCACCACCTTACTGCCCTCCT F TCTCCAGCATTTCTGCTCCACACT PPARγ 25664 R
182 AGGCTCTTCATGTGGCCTGTTGTA
F TAAGGGACTCGAGGAGGTCAAGAA PPARγ2 25664
R 83
GGGAGTTAAGATGAATTTAGCGCTGC F AAGCACAAGTGATTGGCCGAACTG Runx2 367218 R
88 CCTCAACCACGAAGCCTGCAATTT
F ATTTCACAAGAATCAGGGCGTGGG Twist1 85489
R 111
ATCAGAATGCAGAGGTGTGAGGGT F ACTGGACCAAGGCTCTCAGAACAA
Twist2 59327 R
80 TTCCAGGCTTCCTCGAAACAGTCA
F AAAGCCATCTGCACGGGATCAAAC UCP1 24860
R 199
TCTGCCAGTATGTGGTGGTTCACA Table 1. Rat primers for real-time qPCR analysis.
30
Figure 3. DGBP reduces intracellular GGPP and impairs protein geranylgeranylation. A, Cells were treated with DGBP for 24 h. GGPP levels were quantified and normalized to total protein content. Data are expressed as pmoles per mg protein (% control). ap<.05 as compared to control MC3T3-E1 cells. bp<.05 as compared to control primary osteoblasts. B, MC3T3-E1 cells were treated with lovastatin or DGBP for 24 h. Total protein was isolated and used for Western blot analysis of protein prenylation. The Rap1a antibody probes for non-geranylgeranylated Rap1a, and a visible band indicates impaired geranylgeranylation. The Ras antibody probes for total Ras. The lower band is farnesylated Ras, and the upper band is non-farnesylated Ras. The existence of the upper band indicates impaired farnesylation of Ras. α-tubulin was used as a loading control.
31
Figure 4. DGBP inhibits osteoblast differentiation and matrix mineralization. A, MC3T3-E1 pre-osteoblasts were treated with 1µM DGBP in differentiation medium for 28 days. Alizarin red was used to detect mineralization. B, Mineralization was quantified by elution of Alizarin red and measurement of absorbance at 405nm. Data are expressed as µg Alizarin red per well (% control). ap<0.05 as compared to control, bp<0.05 as compared to DGBP treated osteoblasts. C, Cells were treated with 1µM DGBP for eight days. cDNA was transcribed from extracted mRNA and used for real time qPCR analysis of osteoblastic gene expression. Expression was normalized to the housekeeping gene GAPDH. *p<0.05 as compared to control.
32
Figure 5. DGBP leads to an accumulation of intracellular FPP. A, Cells were treated with indicated concentrations of DGBP. ap<0.05 as compared to control MC3T3-E1 cells. bp<0.05 as compared to control primary osteoblasts. B&C, MC3T3-E1 cells were treated with 1 µM DGBP for 1, 2, or 4 weeks. At each time point, intracellular levels of GGPP (B) and FPP (C) were assessed. ap<.05 as compared to week 1 controls, bp<.05 as compared to week 2 controls, cp<.05 as compared to week 4 controls. FPP levels were quantified and normalized to total protein content. Data are expressed as pmoles per mg protein (% control).
33
Figure 6. DGBP leads to activation of the glucocorticoid receptor. MC3T3-E1 cells were treated with 1.0 µM dexamethasone or DGBP (10, 50, and 100 µM) for 24 h. A, Whole cell lysate was extracted and Western blots were run to probe for total GR, P-GR (serine 211), and the housekeeping gene ß-tubulin. B, P-GR was normalized to total GR using densitometry. C, Nuclear/cytosol fractions were obtained and probed for total GR, Sp1 (nuclear), and ß-tubulin (cytosol). D, Levels of nuclear and cytosolic GR were quantified by densitometry and compared to control nuclear and cytosolic GR (% control).
34
CHAPTER III: EFFECTS OF FARNESYL PYROPHOSPHATE ACCUMULATION ON CALVARIAL OSTEOBLAST DIFFERENTIATION
Abstract
Statins, drugs commonly used to lower serum cholesterol, have been shown to
stimulate osteoblast differentiation and bone formation. Statins inhibit HMG-CoA
reductase (HMGCR), the first step of the isoprenoid biosynthetic pathway, leading to the
depletion of the isoprenoids farnesyl pyrophosphate (FPP) and geranylgeranyl
pyrophosphate (GGPP). The effects of statins on bone have previously been attributed to
the depletion of GGPP, since exogenous GGPP prevents statin-stimulated osteoblast
differentiation in vitro. However, in a recent report we demonstrated that the specific
depletion of GGPP did not stimulate, but in fact, inhibited osteoblast differentiation. This
draws the question of whether there are potential roles for other isoprenoids in the
regulation of osteoblast differentiation. We demonstrate that the expression of HMGCR
and FPP synthase (FPPS) decreased during primary calvarial osteoblast differentiation.
This correlated with decreased FPP and GGPP levels during differentiation. Zaragozic
acid (ZGA) inhibits the isoprenoid biosynthetic pathway enzyme squalene synthase
(SQS), leading to an accumulation of the SQS substrate FPP. ZGA treatment of calvarial
osteoblasts resulted in the inhibition of osteoblast differentiation as measured by
osteoblastic gene expression, alkaline phosphatase (ALP) activity, and matrix
mineralization. Osteoblast differentiation was restored by simultaneous HMGCR
inhibition, which prevented the accumulation of FPP. In contrast, specifically inhibiting
GGPP synthase (GGPPS) to lower the ZGA-induced increase in GGPP did not restore
osteoblast differentiation. Specificity of HMGCR inhibition to restore osteoblast
35
mineralization in ZGA treated cultures through the reduction in isoprenoid accumulation
was confirmed with mevalonate add-back experiments. Similar to ZGA treatment,
exogenous FPP inhibited the mineralization of primary calvarial osteoblasts.
Interestingly, the effects of FPP accumulation on osteoblasts were found to be
independent of protein farnesylation. Our findings are the first to demonstrate that the
accumulation of FPP impairs osteoblast differentiation and suggests that the depletion of
this isoprenoid may be necessary for normal and statin-induced bone formation.
Introduction
Statins, drugs commonly used to lower serum cholesterol, have several pleiotropic
effects. Mundy, et al. showed that these drugs could stimulate BMP-2 expression and
stimulate bone formation by osteoblasts(36). These results have been subsequently
supported by several in vitro(37-44) and in vivo(45, 46) studies. Additionally,
administration of lipophilic statins has been positively correlated with higher BMDs in
these patients(47-50).
Statins inhibit HMGCR, the first enzyme in the isoprenoid biosynthetic
pathway(33, 74) (Figure 2). Through inhibition of HMGCR, statins lead to the depletion
of FPP and GGPP, resulting in impaired protein prenylation. Current thought is that
statin-stimulated osteoblast differentiation occurs through the depletion of GGPP and
diminution of protein geranylgeranylation, since addition of exogenous GGPP or GGOH
prevent the effects of statins on bone(40, 43).
We demonstrated in Chapter II that, in contrast to our hypothesis, specific
inhibition of GGPPS by DGBP, which depleted GGPP, led to inhibition of osteoblast
36
differentiation. We also noted that FPP levels decrease during MC3T3-E1 pre osteoblast
differentiation and this was prevented by DGBP treatment. In this study we sought to
determine whether isoprenoids upstream of GGPP, specifically FPP, have a negative
effect on osteoblast differentiation, potentially playing a role in the regulation of bone
formation.
Materials and Methods
Primary cell isolation and culture. The MC3T3-E1 pre-osteoblast cell line was
obtained from ATCC. The animal protocol used for isolation of primary cells was
approved by the Institutional Animal Care and Use Committee at the University of Iowa.
Primary rat osteoblast cells were obtained by three sequential enzyme digestions of
calvariae from two day old neonatal Sprague-Dawley rats (Harlan). Digestions were
performed with 0.05% collagenase type I (Sigma) and 1% trypsin (Invitrogen) in serum
free α modified essential medium (α-MEM) (Invitrogen) at 37oC with shaking. The first
two digestions (10 and 20 minutes, respectively) were discarded. The last digestion (60
minutes) was collected and cells were centrifuged and resuspended in α-MEM containing
10% fetal bovine serum (FBS) and 1x penicillin-streptomycin (Invitrogen). Cells were
grown in a humidified atmosphere with 5% CO2 at 37oC in 10 cm plates. Upon
confluency cells were sub-cultured for experiments at a density of 1x104 cells/cm2.
All experiments were carried out in osteoblast differentiation medium. This
consisted of -MEM with 10 mM β-glycerophosphate (Sigma) and 50 µg/mL L-ascorbic
acid (Fischer Scientific). Compounds utilized for experimental treatments included
zaragozic acid (Sigma), lovastatin (Sigma), mevalonate (Sigma), farnesyl transferase
37
inhibitor (FTI)-277 (Sigma), or digeranyl bisphosphonate (DGBP). SQSI-154 (or LWS-
154), an alternative squalene synthase inhibitor synthesized in Dr. David F. Wiemer’s lab
at the University of Iowa, was also tested with MC3T3-E1 pre-osteoblast cultures.
Treatments were replaced every 3-4 days until the termination of the experiment.
Zaragozic acid, FTI-277, SQSI-154, and DGBP were dissolved in water. Lovastatin and
mevalonic acid lactone were subjected to lactone hydolysis, followed by dilution with
water or RPMI medium, respectively.
Cell Proliferation Assay. Cells were plated in 24 well plates. Upon confluency,
cells were treated for 72 h. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
(MTT) (Calbiochem) was added to cells and the reaction was incubated at 37oC with 5%
CO2 for 3 h. The reaction was terminated with MTT stop solution (HCl, tritonX-100, and
isopropyl alcohol). Plates were shaken overnight at 37oC. Absorbance was measured at
540 nm with a reference wavelength of 650 nm.
Real-time quantitative polymerase chain reaction (qPCR). Primary calvarial
osteoblasts were plated in 6-well plates. Treatment was applied when cells reached
confluency. Four to five days following the onset of treatment, total RNA was isolated
from each well using Qiashredders and the RNeasy Mini Kit (Qiagen). During the
isolation, a DNase step was performed (Qiagen). One µg of RNA was reverse-transcribed
into cDNA using the iScript cDNA Synthesis Kit (Bio-Rad). Real-time qPCR was
performed with Sybr Green Master Mix (Applied Biosystems) on an ABI SDS 7900 HT
(Applied Biosystems). The real-time protocol consisted of 2 minutes at 50oC, 10 minutes
at 95oC, followed by 40 cycles of 95oC (15 seconds) and 60oC (one minute).
Dissociation curves were obtained following the real-time qPCR to ensure the proper
38
amplification of target cDNAs. Primers were obtained from Integrated DNA
Technologies (Iowa City, IA, USA) and eluted in TE Buffer (Ambion). Sequences and
amplicon lengths are found in the Table 1.
Mineralization assay. Primary calvarial osteoblasts were plated in 24 well plates.
Treatment began when cells reached confluency. After 14 days of culture, cells were
fixed for one hour in ice cold 70% ethanol. Cells were then washed thoroughly with DI
H2O; mineralization was detected with 40 mM Alizarin red (Sigma), pH=4.2 for 15
minutes. Following staining, cells were washed thoroughly with DI H2O to remove non-
specific Alizarin red. Images were captured using a Canon EOS Rebel XS.
Mineralization was quantified as described previously(70). Briefly, Alizarin Red was
eluted with 10% acetic acid. Plates were shaken on an orbital rotator for 15 minutes.
The acetic acid and cells from each well were transferred to a 1.5 mL tube and heated to
85oC for 10 minutes. The samples were then cooled on ice and centrifuged. The
supernatant was transferred to a new tube and 10% ammonium hydroxide was added.
Samples were vortexed vigorously and aliquots were transferred to a 96 well plate. The
absorbance was read at 405 nm on a Thermomax Microplate Reader (Molecular
Devices). Absorbance was compared to an Alizarin red standard curve; values were
expressed as total mol Alizarin Red per well.
Alkaline Phosphatase (ALP) activity assay. Calvarial osteoblasts were plated in
12-well plates. One week following the onset of treatment, cells were washed twice with
PBS (Invitrogen). Cells were lysed with 0.2% Triton-X 100 (Sigma) and subjected to two
freeze thaw cycles. Cells were transferred to 1.5 mL tubes and centrifuged. The
supernatants were utilized in the ALP assay. Five mg ALP substrate tablets (pNPP)
39
(Sigma) were dissolved in alkaline buffer (Sigma) (40mg/10mL). Cell lysate or control
lysis buffer was transferred to a 96 well plate and substrate solution was added to each
well. The assay was carried out at 37oC for 10 minutes. Absorbance was read at 405 nm
on a Thermomax Microplate reader (Molecular Devices). ALP activity (units/mL) was
calculated from a standard curve created with 4-nitrophenol. ALP activity was
normalized to total protein content measured by BCA assay. Values are expressed as
ALP units per mg protein per minute.
FPP/GGPP Quantitation. Calvarial osteoblasts were plated in 10cm plates. Upon
confluency cells were treated for 24 hours. FPP and GGPP levels were determined as
previously reported by reverse phase HPLC(69). Briefly, cells were washed twice with
PBS (Invitrogen) and isoprenoid pyrophosphates were extracted from cells and used as
substrates for incorporation into fluorescent GCVLS or GCVLL peptides by
farnesyltransferase or geranylgeranyl transferase I. The prenylated fluorescent peptides
were separated by reverse phase HPLC and quantified by fluorescence detection. Total
FPP and GGPP levels were normalized to total protein content as measured by BCA
assay. Values are expressed as pmoles FPP or GGPP per mg protein.
Statistical Analysis. Data are expressed as means ± SEM. All experiments were
repeated at least twice with similar results. Differences between two groups were
compared using unpaired student’s t tests. Statistical significance was defined by p values
less than 0.05.
40
Results
The expression of isoprenoid biosynthetic pathway enzymes decreases during
osteoblast differentiation. To determine intracellular levels of the isoprenoids FPP and
GGPP during osteoblast differentiation, calvarial osteoblasts were treated with
differentiation medium for 0, 4, 7, or 10 days. At each end point intracellular isoprenoids
were extracted and quantified by HPLC as described in the methods. Both FPP and
GGPP decreased over the course of osteoblast differentiation (Figure 7A).
Expression of isoprenoid pathway enzymes was also assessed. Calvarial
osteoblasts were treated with differentiation medium for 0, 2, 4, or 7 days. At each end
point cells were analyzed for expression of the isoprenoid pathway enzymes HMGCR,
FPPS, and GGPPS. Expression of HMGCR and FPPS decreased significantly during
osteoblast differentiation (Figure 7B). In contrast, GGPPS levels increased significantly
at day 7. Differentiation was assessed by expression of the mature osteoblast marker
OCN (Figure 7C).
ZGA leads to an accumulation of FPP. To determine the effect of the squalene
synthase inhibitor, zaragozic acid (ZGA) (Figure 2) on accumulation of intracellular FPP
and GGPP levels in osteoblasts, calvarial osteoblasts were treated with ZGA (1-10 µM).
FPP and GGPP were both increased following treatment with ZGA (Fig. 8). GGPP
increased maximally with one M ZGA. In contrast, FPP, which was increased
significantly with one µM ZGA, increased greater with higher doses of ZGA (5-10 M).
Control levels of FPP and GGPP in primary calvarial osteoblasts were 3.8 ± 0.3 and 1.5 ±
0.3 pmol per mg protein, respectively.
41
ZGA inhibits osteoblast mineralization and osteoblast gene expression. To
examine whether ZGA inhibits matrix mineralization, calvarial osteoblasts were treated
with 1-10 µM ZGA for two weeks followed by Alizarin red staining of calcium
deposition. As shown in Figure 9A and B, ZGA significantly inhibited matrix
mineralization, with 5 and 10 µM ZGA resulting in nearly total inhibition of matrix
mineralization.
The effect of ZGA on osteoblast viability was assessed by MTT assay. Cells were
treated with 0.5-25 µM ZGA for 72 hours. As shown in Figure 9C, maximal inhibition of
proliferation was approximately 40% which occurred with 5-25 µM ZGA.
To determine whether ZGA inhibits osteoblast differentiation, ALP activity and
expression of osteoblast differentiation markers were analyzed. For analysis of
expression, cells were treated for four days with 1-10 µM ZGA. Figure 9D shows the
inhibition of expression of osteoblast markers ALP, BMP-2, and OCN following four
days of treatment. Transcription factor Runx2 and the late osteoblastic gene Col1a1 were
affected to a lesser extent. For analysis of ALP activity, cells were treated with 1-10 µM
ZGA for seven days. Consistent with decreased expression of ALP, ZGA inhibited ALP
activity in a concentration-dependent manner (Figure 9E).
SQSI-154 causes an accumulation of FPP and inhibits MC3T3-E1 pre-osteoblast
differentiation. To confirm the effects of FPP accumulation on osteoblasts we utilized a
novel SQS inhibitor, SQSI-154 synthesized by Dr. David F. Wiemer’s lab at the
University of Iowa. Treatment of MC3T3-E1 pre-osteoblasts with SQSI-154, otherwise
referred to as LWS-154, led to a concentration-dependent accumulation of FPP (Figure
10A), similar to ZGA treatment of primary rat calvarial osteoblasts. MC3T3-E1 pre-
42
osteoblasts were cultured for 28 days in the presence or absence of 0.5-5.0 M SQSI-154.
SQSI-154 inhibited osteoblast matrix mineralization at all concentrations tested as
measured by the elution of Alizarin red (Figure 10B).
Inhibition of osteoblast differentiation and mineralization by ZGA is prevented by
inhibition of HMGCR but not GGPPS. To assess whether the effect of ZGA to inhibit
osteoblast differentiation and matrix mineralization is due specifically to the
accumulation of isoprenoids, lovastatin co-treatments were utilized. As described earlier,
statins inhibit HMGCR resulting in the depletion of mevalonate and its subsequent
metabolites, including FPP and GGPP. Figure 11A demonstrates that 1.0 µM lovastatin
alone led to a reduction in intracellular FPP and GGPP. Five micromolars ZGA, as shown
earlier, led to a significant increase in intracellular FPP levels. Co-treatment of 1 µM
lovastatin with 5 µM ZGA led to a significant increase in FPP as compared to control;
however, the FPP accumulation was significantly decreased as compared to ZGA alone.
ZGA also increases GGPP levels (Fig 8). At a concentration of 1.0 µM digeranyl
bisphosphonate (DGBP), which specifically targets GGPPS (64, 65), the enzyme
downstream of FPPS (Figure 2), led to a slight accumulation of FPP. Co-treatment of 5.0
µM ZGA and 1.0 µM DGBP reduced the accumulation of GGPP (Figure 11B). As
expected, there was no significant reduction in FPP accumulation as compared to ZGA
alone (Figure 11A).
Figures 11C-E show that the lovastatin concentration chosen for ZGA co-
treatments (1.0 µM) alone had only minimal effects on matrix mineralization and
increased ALP activity of calvarial osteoblasts, with no effect on osteoblast viability.
Similar to previous experiments, 5.0 µM ZGA inhibited osteoblast viability, ALP
43
activity, and mineralization. Co-treatment of 5.0 µM ZGA with 1.0 µM lovastatin
resulted in a significant restoration of matrix mineralization, osteoblast viability, and
ALP activity as compared to ZGA alone. This suggests that the effect of ZGA to inhibit
osteoblast differentiation is due to the accumulation of isoprenoids.
To confirm that the inhibition of osteoblast differentiation and matrix
mineralization by ZGA was not due to the increase in GGPP, DGBP co-treatments were
utilized. Alone, 1.0 µM DGBP led to a decrease in ALP activity (Figure 11E) and matrix
mineralization (Figure 11C), with no effect on osteoblast viability (Figure 11D). In
contrast to lovastatin, DGBP did not prevent the inhibition of matrix mineralization,
osteoblast viability, and ALP activity by ZGA treatment of primary calvarial osteoblasts
(Figures 11C-E). Higher concentrations of DGBP (5.0 µM) were toxic in the absence of
ZGA. In the presence of 5.0 M ZGA, 5 M DGBP led to a reduction of GGPP below
control levels (Figure 12A); however, similarly to the 1.0 µM DGBP co-treatment, these
concentrations did not restore osteoblast matrix mineralization (Figure 12B). Treatment
of primary calvarial osteoblasts with 5-20 µM exogenous FPP for two weeks led to
decreased matrix mineralization (Figure 12C).
Restoration of osteoblast differentiation by lovastatin co-treatment is due to
prevention of isoprenoid accumulation. To determine whether the restoration of
osteoblastic differentiation and matrix mineralization by lovastatin co-treatments was
through the prevention of isoprenoid accumulation, mevalonate (Mev) add-back
experiments were performed. Addition of 5 mM Mev alone had no effect on matrix
mineralization as measured by Alizarin red staining (Figure 13A). ZGA inhibited matrix
mineralization and this was restored by co-treatment with 5.0 µM lovastatin. Addition of
44
5.0 mM Mev to the ZGA and lovastatin co-treatment significantly decreased
mineralization as compared to ZGA or lovastatin alone. This data suggests that the
restoration of osteoblast differentiation by lovastatin is due to the prevention of
isoprenoid accumulation and not an off target effect of lovastatin.
The effect of FPP accumulation on inhibition of osteoblast differentiation is not
due to increased protein farnesylation. To test whether the negative effects of FPP
accumulation on osteoblast differentiation are due to increased protein farnesylation,
farnesyltransferase inhibitor (FTI) co-treatments were done. FTI-277 was employed at
concentrations of 0.1, 1.0, and 10.0 µM alone or in combination with 5 µM ZGA. As
shown in Fig. 13B, FTI-277 had no significant effect on osteoblast mineralization at any
concentration tested. In combination with ZGA, FTI-277 did not have any significant
effect on ZGA-induced inhibition of osteoblast differentiation. This suggests that the
accumulation of isoprenoids, such as FPP, act independently of farnesylation to inhibit
osteoblast differentiation.
Discussion
The results presented herein demonstrate that isoprenoids upstream of GGPP,
specifically FPP, have negative effects on osteoblast differentiation. This was evidenced
by ZGA treatment, which increased FPP and GGPP isoprenoid levels, leading to
inhibition of osteoblast differentiation, which could be prevented by inhibition of
HMGCR, but not that of GGPPS.
Together with the results presented in Chapter II, these data have important
implications for the numerous studies reporting positive effects of statins on osteoblast
45
differentiation. As described earlier, several in vitro(37-44) and in vivo(45, 46)
experiments have shown positive effects of statins on osteoblast differentiation and bone
formation. These findings have been attributed to the depletion of GGPP (40, 43).
Consistent with this paradigm, several studies have found that nitrogenous
bisphosphonates (NBPs), which inhibit FPPS, (13, 15, 75), similarly leading to GGPP
depletion (Figure 2), stimulate osteoblast differentiation (51, 52, 76-80). It is important to
note however that the effects of NBPs on osteoblasts are unclear, as some studies have
shown the ability to inhibit matrix mineralization and cause osteoblast apoptosis(53, 54,
81, 82).
Our studies show that the isoprenoids FPP and GGPP, as well as the expression of
HMGCR and FPPS, decrease during primary calvarial osteoblast differentiation. This is
similar to the decrease in FPP and GGPP levels demonstrated during the differentiation
of MC3T3-E1 pre-osteoblasts, described in Chapter II. However, in contrast to the
previous study by Yoshida, et al(83), expression of GGPPS increased with primary
osteoblast differentiation. This increased expression may be occurring in order to
compensate for the decreased intracellular GGPP levels during osteoblast differentiation.
Unlike HMGCR and FPPS, GGPPS expression is not regulated by SREBP2, suggesting
that GGPPS expression may be modulated by a separate signal, such as intracellular
GGPP levels. The results showing decreased expression of HMGCR and FPPS, as well as
decreased FPP during osteoblast differentiation, suggest that depletion of more than just
GGPP plays a role in osteoblast differentiation. Consistent with this, Takase, et al. show
that the anabolic protein PTH leads to a reduction in mevalonate kinase expression(56). It
46
is important to note that the results presented in this study and those of Yoshida, et al. are
in agreement that GGPP levels decrease during osteoblast differentiation (83).
ZGA treatment led to an increase in intracellular FPP and GGPP and decreased
osteoblast differentiation and matrix mineralization. We concluded that the negative
effects of ZGA on osteoblast differentiation were due to accumulation of upstream
isoprenoid metabolites, specifically FPP, not GGPP. Several lines of evidence support
this conclusion. GGPP increased maximally at a concentration of 1.0 µM ZGA; however
inhibition of osteoblast gene expression and ALP activity did not occur with this
concentration. While 1.0 µM ZGA did decrease matrix mineralization, maximal
inhibition of matrix mineralization, did not occur with this concentration. Secondly,
addition of DGBP, which prevented the accumulation of GGPP in ZGA-treated cultures,
did not prevent the inhibition of osteoblast viability, ALP activity, or matrix
mineralization. In contrast, addition of lovastatin, which inhibits HMGCR thereby
preventing the accumulation of FPP (and likely other upstream isoprenoids which were
not measured in this study), restored osteoblast viability, ALP activity, and matrix
mineralization. These experiments suggest that ZGA inhibits osteoblast differentiation
and matrix mineralization through the accumulation of upstream isoprenoid metabolites.
Additionally, treatment with exogenous FPP inhibited matrix mineralization, suggesting
that the accumulation of FPP is responsible for the negative effects of ZGA. The effects
of FPP on matrix mineralization were less than those of ZGA. This is likely due to this
isoprenoid’s poor cellular permeability, which limits the intracellular concentrations of
FPP that accumulate with exogenous FPP treatment.
47
There has been much study recently into potential roles for FPP aside from
protein farnesylation and the production of sterols and non-sterol isoprenoids. Das, et al.
showed that FPP binds and activates several nuclear receptors, including the thyroid
hormone receptor, estrogen receptor, and glucocorticoid receptor(27). In a more recent
report, Vukelic, et al. demonstrated that modulation of FPP levels altered wound healing
through modulation of glucocorticoid receptor activities(28). We demonstrated in
Chapter II that DGBP, which also causes an accumulation of FPP (Figure 5A), activates
the glucocorticoid receptor in MC3T3-E1 pre-osteoblasts (Figure 6). The potential role of
FPP and other isoprenoid metabolites to activate nuclear hormone receptors remains a
potential mechanism of ZGA-mediated inhibition of osteoblast differentiation and matrix
mineralization. In support of a non-prenylation role for FPP in inhibiting osteoblast
differentiation, the effects of ZGA on osteoblast mineralization were not prevented by
inhibition of farnesylation with FTI-277.
In summary, we demonstrate for the first time in this report that the expression of
isoprenoid pathway enzymes HMGCR and FPPS are down-regulated during osteoblast
differentiation, and the accumulation of isoprenoids upstream of GGPP, including FPP,
impairs osteoblast differentiation. Our results suggest a role for the depletion of FPP in
normal and statin-stimulated osteoblast differentiation.
48
Figure 7. The isoprenoid biosynthetic pathway and primary calvarial osteoblast differentiation. A, Intracellular FPP and GGPP decrease during osteoblast differentiation. Data are expressed as pmoles per mg protein, percent day 0 (mean ± SEM), n=2. B, Expression of the isoprenoid pathway enzymes HMGCR and FPPS decrease during osteoblast differentiation. mRNA levels were quantified by real-time qPCR and were normalized to the reference gene GAPDH. Data are expressed as relative units (mean ± SEM). *p<.05 versus undifferentiated cells (day 0), n=3. C, OCN expression increased on days 2-7 showing the differentiation of the calvarial osteoblasts. Expression was normalized to the reference gene GAPDH, and data was expressed as relative units (mean ± SEM), n=3.
49
Figure 8. ZGA leads to increases in endogenous FPP and GGPP. A, Primary calvarial osteoblasts were treated with increasing doses of ZGA (1-10 µM). FPP and GGPP are expressed as pmoles per mg protein fold vehicle (mean ± SEM). ap<0.05 versus control, bp<0.05 versus 1 µM ZGA, n=2.
50
Figure 9. ZGA leads to inhibition of osteoblast differentiation. A,B ZGA concentration-dependently (1-10 µM) inhibited matrix mineralization of calvarial osteoblasts as assessed by Alizarin red staining (A) and quantification of eluted dye (B). Data are expressed as micromoles Alizarin red per well, percent vehicle (mean ± SEM). *p<0.05 versus control treated cells, n=3. C, ZGA inhibited cell viability as measured by MTT assay. Values are expressed as percent control (mean ± SEM), n=3. D, ZGA inhibited expression of osteoblastic differentiation markers ALP, BMP2, and OCN as measured by real-time qPCR. Partial inhibition of expression was observed for Col1a1 and Runx2. Data are normalized to the reference gene GAPDH and expressed as percent vehicle (mean ± SEM). *p<0.05 versus control treated cells, n=3. E, ZGA inhibited ALP activity of calvarial osteoblasts. ALP activity was assayed and normalized to protein content. Data are reported as ALP units/mg protein/minute, percent vehicle (mean ± SEM). *p<0.05 as compared to control treated cells, n=3.
51
52
Figure 10. SQSI-154 causes an accumulation of FPP and inhibits osteoblast matrix mineralization. A, MC3T3-E1 pre-osteoblasts were treated with increasing concentrations of SQSI-154 (0.5-5 µM). FPP and GGPP are expressed as pmoles per mg protein, fold vehicle (mean ± SEM), n=2. B, SQSI-154 inhibited matrix mineralization of MC3T3-E1 pre-osteoblasts as assessed by quantification of Alizarin red staining. Data are expressed as moles Alizarin red per well, percent vehicle (mean ± SEM), n=3
53
Figure 11. Inhibition of HMGCR prevents FPP accumulation and inhibition of osteoblast differentiation in cells treated with ZGA. Primary calvarial osteoblasts were treated with 5µM ZGA in the presence or absence of an inhibitor to HMGCR (Lov 1 µM) or GGPPS (DGBP 1 µM). A, The accumulation of FPP by ZGA was prevented by inhibition of HMGCR, but not inhibition of GGPPS. Values in A and B are expressed as pmoles per mg protein, fold vehicle (mean ± SEM). ap<0.05 as compared to control, bp<0.05 as compared to ZGA treated cells, n=2. B, 1 M DGBP reduced the accumulation of GGPP (mean SEM), n=2 C, Inhibition of HMGCR prevented the inhibition of mineralization by ZGA, whereas inhibition of GGPPS did not. Osteoblast mineralization was assessed by Alizarin red staining followed by elution and quantification of dye. Values were expressed as µg Alizarin red per well (mean ± SEM). ap<0.05 as compared to control, bp<0.05 as compared to ZGA treated cells, n=3. D, Cell viability was assessed by MTT assay and expressed as percent vehicle (mean ± SEM), n=3. Additionally, E, ALP activity was assessed. Values were normalized to protein content. Data were expressed as percent vehicle, ALP units per mg protein per minute (mean ±S EM). ap<0.05 as compared to vehicle, bp<0.05 as compared to ZGA treated cells, n=3.
54
55
Figure 12. GGPP depletion does not restore osteoblast mineralization. A and B, Primary calvarial osteoblasts were treated with 5 µM ZGA and/or 5 µM DGBP. A, GGPP levels were quantified following 24 hours of treatment and are expressed as pmole per mg protein, percent vehicle. ap<0.05 as compared to vehicle control, bp<0.05 as compared to 5 µM ZGA alone, (mean ± SEM) n=2. B, Cells were treated for 14 days and mineralization was assessed by Alizarin red staining and elution of the stain. Data are expressed as percent vehicle (mean ± SEM), *p<0.05 as compared to vehicle, n=3. C, Primary calvarial osteoblasts were treated with FPP for two weeks. Mineralization was assessed by Alizarin red staining.
56
Figure 13. Addition of exogenous mevalonate and co-treatment with FTI-277. A, Cells were treated with ZGA, Lov, or ZGA/Lov combination in the presence or absence of 5 mM exogenous mevalonate (Mev). Osteoblast mineralization was assessed by Alizarin red staining followed by elution and quantification of dye. Values were expressed as µg Alizarin red per well (mean ± SEM). ap<0.05 as compared to control, bp<.05 as compared to ZGA treated cells, cp<.05 as compared to ZGA/Lov control, n=3. B, Cells were treated with 5 µM ZGA in the presence or absence of FTI-277 (0.1-10 µM). Osteoblast mineralization was assessed by Alizarin Red staining followed by elution and quantification of dye. Values were expressed as µg Alizarin red per well, percent control (mean ± SEM), n=3.
57
58
CHAPTER IV: GGPP AND THE OSTEOBLAST VS. ADIPOCYTE FATE DECISION Abstract Osteoblasts and adipocytes are derived from mesenchymal stem cells and play
important roles in the homeostasis of the skeleton. During the osteoblastic differentiation
of MC3T3-E1 pre-osteoblasts and primary calvarial osteoblasts there is a decrease in the
isoprenoid geranylgeranyl pyrophosphate (GGPP). Consistent with this, osteoblast
differentiation has been shown to be stimulated by statin drugs through the depletion of
GGPP. In contrast, adipogenic differentiation of 3T3-L1 cells results in increased
expression of GGPP synthase (GGPPS), and GGPP lowering agents inhibit adipogenesis
in vitro. In this study, we tested the hypothesis that GGPP levels play a role in the
osteoblast versus adipocyte fate decision by inhibiting osteoblast differentiation and
enhancing adipogenesis. We found that exogenous GGPP reduced osteoblastic gene
expression and matrix mineralization in primary calvarial osteoblast cultures. GGPP
treatment of primary calvarial osteoblasts and primary bone marrow stromal cells
(BMSCs) also led to the increased expression of total peroxisome proliferator activated
receptor (PPAR)-γ as well as the PPARγ2 splice variant. Inhibition of PPARγ
transcriptional activity did not prevent the effects of GGPP on osteoblast differentiation.
Enhanced PPARγ expression correlated with the increased formation of Oil Red O-
positive cells in these cultures. Additionally, primary calvarial osteoblasts treated with
GGPP exhibited increased expression of the adipokine adiponectin. In contrast to
previous reports utilizing other cell types, treatment of osteoblasts with GGPP did not
increase geranylgeranylation, suggesting that GGPP itself may be acting as a signaling
molecule. GGPP treatment of MC3T3-E1 pre-osteoblasts and primary calvarial
59
osteoblasts led to enhanced insulin-induced Erk signaling and increased glucose uptake;
it is important to note, however, that there was a decrease in the phosphorylation of the
insulin receptor. Altogether these findings demonstrate a negative role for GGPP in
osteoblast differentiation, leading to increased adipogenesis. Additionally, the effects of
GGPP on insulin signaling and glucose uptake implicate a role for this isoprenoid in
physiological energy homeostasis.
Introduction As discussed in previous chapters, statins have been shown to stimulate osteoblast
differentiation and bone formation(36-44). Statins act by inhibiting HMGCR, the first
step of the isoprenoid biosynthetic pathway and the rate-limiting step of cholesterol
biosynthesis (33). By inhibiting HMGCR, statins also deplete GGPP, leading to impaired
protein geranylgeranylation. It has been thought that the positive effects of statins on
osteoblasts are due to the depletion of GGPP, since addition of this isoprenoid prevents
these effects in vitro. While we show in Chapter II that specific depletion of GGPP does
not lead to osteoblast differentiation, there is evidence that GGPP does have a negative
role in this process. We have demonstrated in Chapters II and III that GGPP levels
decrease during osteoblast differentiation in the cases of both primary calvarial
osteoblasts(84) and MC3T3-E1 pre-osteoblasts(85). We also demonstrated that GGPP
addition to MC3T3-E1 cell cultures inhibited matrix mineralization(85) consistent with
another study showing that GGOH, which can be converted to GGPP by intracellular
kinases, inhibits osteoblast differentiation in MC3T3-E1 pre-osteoblast cultures(55).
Osteoblasts are derived from mesenchymal stem cells (MSCs). In studying the
differentiation of osteoblasts and bone formation, much attention is paid to the
60
differentiation of another mesenchymal-derived cell type involved in bone homeostasis,
the adipocyte (2, 57). Although initially thought to be inert(6, 58, 86), adipocytes are now
known to be central players in the control of energy balance and whole body lipid
homeostasis. Through their secreted adipokines, adipocytes play a role in obesity,
atherogenesis, diabetes, and inflammation(57, 58). Differentiation into osteoblasts or
adipocytes is controlled by the expression of lineage specific transcription factors, such
as Runx2 or PPARγ2, respectively(57). Interestingly, factors that induce adipogenesis
inhibit osteoblast differentiation and vice versa. For example, PPAR2 ligands, such as
the thiazolidinedione anti-diabetic drugs, promote adipogenesis and inhibit osteoblast
differentiation(2, 57, 58, 87, 88).
In the identification of mammalian GGPPS, Vicent, et al. found that this
isoprenoid biosynthetic enzyme was highly expressed in the liver, skeletal muscle, and
adipose tissue of the ob/ob mice, a model of leptin deficiency. Additionally, Vicent, et al.
demonstrated that GGPPS expression increases during the adipogenic differentiation of
3T3-L1 cells (60). Consistent with this, statins, which as mentioned above deplete GGPP,
have been shown to inhibit adipogenesis(42, 59).
Given these data, we hypothesized that GGPP may influence the osteoblastic
versus adipogenic fate decision, promoting adipogenesis and inhibiting
osteoblastogenesis. Herein we demonstrate the negative effects of GGPP on osteoblasts
and propose potential mechanisms by which GGPP exerts these effects. We also
demonstrate for the first time an adipogenic enhancing effect of GGPP.
61
Materials and Methods
Cell culture. The MC3T3-E1 pre-osteoblast cell line was obtained from ATCC.
The animal protocol used for isolation of primary rat calvarial cells and primary rat bone
marrow stromal cells was approved by the Institutional Animal Care and Use Committee
at the University of Iowa. Primary rat osteoblasts were obtained by three sequential
enzyme digestions of calvariae from two day old neonatal Sprague-Dawley rats (Harlan).
Digestions were performed with 0.05% collagenase type I and 1% trypsin (Invitrogen) in
serum free α modified essential medium (α-MEM) (Invitrogen) at 37 oC with shaking.
The first two digestions (10 and 20 minutes, respectively) were discarded. Following the
final digestion (60 minutes), cells were centrifuged and resuspended in growth medium.
Primary rat bone marrow stromal cells (BMSCs) were obtained by isolation of the femur
and tibia from five-week-old male rats. The epiphyses were removed in sterile conditions
and the bone was flushed with α-MEM. The cell mixture was strained to remove debris.
The cell mixture was washed, centrifuged, and resuspended in growth medium. Cells
were cultured in α-MEM containing 10% fetal bovine serum (FBS) and 1x penicillin-
streptomycin (Invitrogen). Cells were grown in a humidified atmosphere with 5% CO2 at
37oC in 10 cm plates.
Cells were subcultured for experiments at a density of 1x104 cells/cm2. Primary
calvarial osteoblast experiments were carried out in osteoblast differentiation medium,
consisting of -MEM with 10 mM β-glycerophosphate (Sigma) and 50 µg/mL L-
ascorbic acid (Fischer Scientific). Primary BMSC culture experiments were carried out in
control, osteoblast, or adipocyte differentiation medium. BMSC osteoblast differentiation
medium consisted of -MEM with 10 mM β-glycerophosphate (Sigma), 50 µg/mL L-
62
ascorbic acid (Fischer Scientific), and 0.1 µM dexamethasone (Sigma). Adipocyte
differentiation medium consisted of -MEM with 0.5 µg/mL insulin, 0.5 mM
isobutylmethylxanthine, 200 µM indomethacin, and 1.0 µM dexamethasone (all
purchased from Sigma). Treatments were replaced every 3-4 days until the termination of
the experiment.
FPP/GGPP Quantification. Primary BMSCs were plated in 10 cm plates. Upon
confluency cells were treated with DGBP (Dr. David F. Wiemer laboratory, University of
Iowa) (0.1, 1, 10, 100 µM) for 24 h. FPP and GGPP levels were determined as previously
reported by reverse phase HPLC(69). Briefly, cells were washed twice with phosphate
buffered saline (PBS) (Invitrogen) and isoprenoid pyrophosphates were extracted from
cells and used as substrates for incorporation into fluorescent GCVLS or GCVLL
peptides by farnesyltransferase or geranylgeranyl transferase I. The prenylated
fluorescent peptides were separated by reverse phase HPLC and quantified by
fluorescence detection. Total FPP and GGPP levels were normalized to total protein
content as measured by bichinconic (BCA) assay. Values are expressed as pmoles per mg
protein.
Western blotting. MC3T3-E1 pre-osteoblasts and primary calvarial osteoblasts
were plated in 10 cm plates. Upon confluency, cells were serum-starved overnight. The
cells were pre-treated with GGPP (20 µM) or GGPP vehicle (MeOH:10mM NH4OH, 7:3)
for 30 minutes, followed by treatment with 100 nM insulin for 0, 5, 10, 15, or 30 minutes.
At the end of the experiment, media was removed and cells were washed twice in ice-
cold PBS. Cells were collected with a cell scraper after the addition of RIPA buffer
supplemented with protease inhibitor cocktail, sodium vanadate, sodium fluoride, and
63
phenylmethylsulphonyl fluoride. Lysates were transferred to a 1.5 ml tube, incubated on
ice for 30 min, and passed through a 27-guage needle. Lysates were then centrifuged and
supernatant was transferred to a fresh 1.5 ml tube. Protein concentrations were
determined by the BCA method. Proteins were resolved on 7.5% SDS-PAGE gels and
transferred to polyvinylidene difluoride membranes by electrophoresis. Membranes were
blocked in 0.5% BSA (insulin receptor, phosph-insulin receptor, insulin receptor
substrate (IRS), phospho-IRS, Akt, and phospho-Akt antibodies) or 0.5% skim milk (α-
tubulin, phospho-Erk, Erk). Primary antibody was added to the blocking mixture and
membranes were rotated at 4oC overnight. Membranes were washed and secondary
antibodies were added in 0.5% skim milk for 1 h at 37oC. Proteins were visualized using
an enhanced chemiluminescence detection kit from GE Healthcare. Insulin receptor
(InsR)-, phospho-InsR- (Tyr1150,1151), IRS-1, phospho-IRS-1(Ser612), Akt, and
phospho-Akt antibodies were obtained from Cell Signaling. Antibodies to α-tubulin,
Erk1/2, phospho-Erk1/2, and Rab6 were obtained from Santa Cruz Biotechnology, Inc.
Horseradish peroxidase-conjugated anti-mouse and anti-rabbit secondary antibodies were
purchased from GE Healthcare.
Triton X-114 separation. MC3T3-E1 pre-osteoblasts were plated in 10 cm plates.
When the cells reached confluency they were treated for 24 h with 20 µM lovastatin,
GGPP vehicle, 10 µM GGPP, or 20 µM GGPP. Cells were washed twice with ice-cold
PBS and lysed in ice-cold Triton X-114 lysis buffer (20 mM Tris pH 7.5, 150 mM NaCl,
and 1% Triton X-114). Cell lysate was then passed through a 27-gauge needle,
centrifuged, and transferred to a new tube as described above. Separation of aqueous and
detergent phases was performed as described previously(89). Briefly, cells were
64
incubated at 37°C for 10 min and then centrifuged at room temperature at for 2 min. The
upper phase (aqueous) was transferred to a new tube. The lower phase (detergent) was
washed with lysis buffer lacking detergent, and separation was performed as described
above. Following the wash, the lower phase was diluted into buffer lacking detergent.
Protein concentrations were determined by the BCA method and Rab6
geranylgeranylation was assessed by gel electrophoresis and Western blot.
Mineralization assay. Primary calvarial osteoblasts were plated in 24-well plates.
Treatment began when cells reached confluency. After 14 days of culture, cells were
fixed for one hour in ice-cold 70% ethanol. Cells were then washed thoroughly with
deionized water; mineralization was detected with 40 mM Alizarin red, pH =4.2 for 15
min. Following staining, cells were washed thoroughly with deionized water to remove
non-specific Alizarin red. Images were captured using a Canon EOS Rebel XS.
Mineralization was quantified as described previously(70). Briefly, Alizarin Red was
eluted with 10% acetic acid per well. Plates were shaken on an orbital rotator for 15
minutes. The acetic acid and cells were transferred to a 1.5 mL tube and heated to 85oC
for 10 minutes. The samples were then cooled on ice and centrifuged. The supernatant
was transferred to a new tube and 10% ammonium hydroxide was added. Samples were
vortexed vigorously and aliquots were transferred to a 96 well plate. The absorbance was
read at 405 nm on a Thermomax Microplate Reader (Molecular Devices). Absorbance
was compared to a standard curve; values were expressed as total mol Alizarin Red per
well.
Real-time quantitative polymerase chain reaction (qPCR). Primary calvarial
osteoblasts or primary BMSCs were plated in 6-well plates. Alternatively, primary
65
BMSCs cultured in adipogenic medium were plated in 10 cm plates. Treatment was
applied when cells reached confluency. Five days (calvarial osteoblasts) or seven days
(BMSCs) following the onset of treatment with GGPP or GGPP vehicle, total RNA was
isolated from each well using Qiashredders and the RNeasy Mini Kit (Qiagen).
Alternatively, BMSCs cultured with digeranyl bisphosphonate (DGBP) were cultured for
two weeks prior to RNA isolation. During the isolation, a DNase step was performed
(Qiagen). One µg of RNA was reverse-transcribed into cDNA using the iScript cDNA
Synthesis Kit (Bio-Rad). Real-time PCR was performed with Sybr Green Master Mix
(Applied Biosystems) on ABI SDS 7900 HT (Applied Biosystems). The real-time
protocol consisted of 2 minutes at 50 oC, 10 minutes at 95 oC, followed by 40 cycles of
95 oC (15 seconds) and 60 oC (one minute). Dissociation curves were obtained following
real-time qPCR to ensure the proper amplification of target cDNAs. Primers were
obtained from Integrated DNA Technologies (Iowa City, IA, USA) and eluted in TE
Buffer (Ambion). The primers for qPCR are found in Table 1.
Oil Red O-Staining. Primary calvarial osteoblasts or BMSCs were plated in 12-
well plates. Cells were treated in specified conditions for 14 days, washed twice with
1xPBS, and fixed in 4% paraformaldehyde for 30 min. Cells were washed twice with
PBS, followed by a wash with 2-propanol:deionized water (6:4). A 0.5% Oil Red O stock
was prepared in 2-propanol. The stock was mixed with DI H2O at a ratio of 6:4 Oil Red
O stock to DI H2O. This mixture was allowed to sit ten minutes and then filtered.
Following the wash steps, cells were stained with filtered Oil Red O for one hour. Oil
Red O was removed and cells were washed with DI H2O. Stained cells were stored in 1x
66
PBS until quantification. Staining was visualized with light microscopy and Oil Red O
positive cells were quantified.
Glucose Transport. Primary calvarial osteoblasts and MC3T3-E1 pre-osteoblasts
were plated in 6-well plates. Upon confluency, cells were serum starved overnight. Cells
were treated with control, GGPP vehicle, or 20 M GGPP for 4.5 h. Following treatment,
cells were washed with ice cold glucose transport buffer (140 mM NaCl, 5 mM KCl, 1
mM MgCl2, 1.5 mM CaCl2, 15 mM N-2-hydroxyethylpiperazine-N-2-ethanesulfonic
acid). Uptake experiments were performed as described previously(90). Briefly, the cells
were incubated with glucose transport buffer containing 0.1 mM cold D-glucose and 2-
deoxy-D-2-[1-3H] glucose (1 Ci/mL, ARC) for ten min at room temperature. The buffer
was removed and the cells were washed with glucose transport buffer. The cells were
lysed in 1 mL of 2% SDS lysis buffer. The radioactivity in each sample was measured by
a liquid scintillation counter. Glucose uptake was normalized to protein content as
measured by the BCA assay.
Statistical Analysis. Data are expressed as means standard error of the mean
(SEM). All experiments were repeated at least twice with similar results. Differences
between two groups were compared using unpaired student’s t tests. Statistical
significance was defined by p values less than 0.05.
Results
GGPP inhibits osteoblast differentiation. To determine the effect of GGPP on
osteoblast differentiation, we treated primary calvarial osteoblasts with osteoblastic
differentiation medium in the presence or absence of GGPP. As shown in Figure 14A and
67
B, 10 and 20 M GGPP significantly inhibited osteoblast mineralization, as measured by
Alizarin red staining. Consistent with this, expression of the osteoblastic genes ALP,
BMP-2, and OCN were significantly decreased following five days of treatment with 10
or 20 M GGPP (Figure 14C). In contrast, there was no significant effect of GGPP on the
expression of Col1a1.
GGPP induces expression of PPARγ. Since it has been noted that GGPPS
expression increases during the adipogenic differentiation of 3T3-L1 cells(60), we
measured whether exogenous GGPP could stimulate the expression of PPARγ, a
dominant regulator of adipogenesis(88). Interestingly, 20 µM GGPP led to a significant
increase in total PPARγ expression in primary calvarial osteoblasts (Figure 15A).
Specific measurement of the PPAR2 splice variant, which is predominantly expressed
by adipocytes, showed that, similar to PPARγ expression, 20 M GGPP significantly
increased the expression of PPARγ2 as compared to control and GGPP vehicle-treated
calvarial osteoblasts (Figure 15A).
The effect of GGPP on total PPARγ and PPAR2 expression was also assessed in
BMSC cultures. As demonstrated in Figure 15B, treatment of BMSC cultures with 20
M GGPP for seven days led to a significant increase in PPARγ expression. This was
exhibited in adipogenic, control, and osteogenic culture conditions. Expression of PPAR
in GGPP-treated control or osteoblastic BMSC cultures was comparable to PPAR
expression levels in control adipogenic cultures. Similar to primary calvarial osteoblast
cultures, GGPP treatment increased the expression of the PPARγ2 splice variant in
adipogenic, control, and osteogenic conditions (Figure 15C).
68
Inhibition of PPARγ transcriptional activity does not prevent the effects of GGPP
on osteoblast differentiation. Agents that activate PPARγ, such as the thiazolidinediones,
are known to antagonize osteoblast differentiation (58). To test whether PPAR
activation was the mechanism by which GGPP inhibits osteoblast differentiation, we
employed the PPARγ antagonist GW9662. Primary calvarial osteoblasts were treated
with 20 µM GGPP or GGPP vehicle in the presence or absence of 0.1, 1.0, or 10 µM
GW9662. The highest concentration of GW9662 had a slight positive effect on osteoblast
matrix mineralization as measured by Alizarin red staining. However, GW9662 did not
prevent the effects of GGPP on the inhibition of osteoblast mineralization (Figure 16A
and B).
GGPP promotes adipogenesis. Because GGPP increased PPARγ expression, we
hypothesized that GGPP may stimulate adipogenesis. Primary calvarial osteoblasts were
cultured in osteoblastic differentiation medium for two weeks in the presence or absence
of 20 M GGPP. Cultures were stained with Oil Red O to detect lipid droplet containing
cells. Total Oil Red O-positive cells were quantified in each well using light microscopy.
As shown in Figure 17A, treatment with GGPP led to a significant increase in the number
of Oil Red O-positive cells per well. These experiments were also carried out in the
presence of 1.0 M rosiglitazone, a PPARγ agonist. At this concentration, rosiglitazone
had no significant effect on the number of Oil Red O-positive cells in control conditions.
The addition of rosiglitazone in the presence of GGPP led to a greater increase in the
number of Oil Red O-positive cells as compared to GGPP alone; this increase was not
significant. No Oil Red O-positive cells were detected in BMSC osteoblast cultures with
control, GGPP vehicle, or GGPP (data not shown). The addition of 1.0 µM rosiglitazone
69
led to the appearance of Oil Red O-positive cells in BMSC osteoblast cultures. 20 µM
GGPP significantly increased the formation of Oil Red O-positive cells in the presence of
rosiglitazone (Figure 17B).
The effect of GGPP on adipogenic gene expression was also assessed. GGPP
treatment of primary calvarial osteoblasts led to a small but significant increase in
adiponectin expression (Figure 17D). Treatment with rosiglitazone significantly
increased the expression of adiponectin as compared to control osteoblasts as well as
GGPP-treated osteoblasts. The combination of 1.0 µM rosiglitazone with GGPP led to a
significant increase in adiponectin expression as compared to rosiglitazone control or
GGPP alone. Also of note, GGPP treatment led to the increased expression of uncoupling
protein (UCP)-1 and to slightly decreased glucose transporter (Glut)-4 expression (Figure
17E and F). Co-treatment with rosiglitazone did not result in a significant increase in
PPARγ (Figure 17C) or UCP1 (Figure 17E). Similarly, co-treatment with rosiglitazone
did not potentiate the decrease in Glut4 expression (Fig. 17F).
Specific depletion of GGPP inhibits adipogenesis. Since GGPP increased the
expression of certain adipogenic markers and the number of Oil Red O-positive cells, we
tested whether specific depletion of GGPP would inhibit adipocyte differentiation. As
described in Chapter II, DGBP is a specific inhibitor of GGPPS (64, 65). Treatment of
BMSCs for 24 h with increasing concentrations of DGBP led to a significant decrease in
intracellular GGPP. Similar to the treatment of MC3T3-E1 pre-osteoblasts and primary
calvarial osteoblasts, DGBP treatment resulted in a significant increase in the GGPPS
substrate FPP (Figure 18A)(85).
70
BMSCs were treated with adipogenic medium in the presence or absence of
DGBP (0.1, 0.5, or 1.0M) for two weeks, followed by Oil Red O-staining. Alternatively,
BMSCs were treated with 1.0 M lovastatin. As expected, lovastatin reduced the
formation of Oil Red O positive-cells. Similarly, DGBP reduced formation of Oil Red O-
positive cells at concentrations of 0.5 and 1.0 M (Figure 18B and C). Adipogenic
differentiation was also assessed by expression of adipogenic markers. Similar to
treatment with lovastatin, treatment with 1.0 M DGBP inhibited the expression of the
adipogenic genes PPAR, adiponectin, and CCAAT/enhancer-binding protein (C/EBP)
(Figure 18D).
GGPP treatment does not increase protein geranylgeranylation. Previous reports
have suggested that exogenous GGPP causes cellular effects through an increase in
protein geranylgeranylation. To determine whether the addition of GGPP increases
geranylgeranylation in osteoblasts we analyzed the detergent/aqueous fractionation of the
geranylgeranylated protein Rab6. Rab6 is a GGTase II substrate. Prenylated Rab6
associates with the detergent fraction whereas, unprenylated Rab6 localizes to the
aqueous fraction. MC3T3-E1 pre-osteoblasts were treated for 24 h with 20 M lovastatin,
GGPP vehicle, 10 M GGPP, or 20 M GGPP. In control conditions Rab6 was detected
in the detergent phase and not the aqueous phase indicating that all of the Rab6 was
prenylated (Figure 19). As expected, treatment of the cells with lovastatin, which depletes
GGPP, decreased the levels of Rab6 in the detergent phase and caused the appearance of
unprenylated Rab6 in the aqueous phase. The addition of GGPP vehicle, 10 M GGPP or
20 M GGPP did not result in detection of aqueous Rab6. 20 M GGPP caused a slight
reduction in Rab6 protein levels as evidenced by decreased Rab6 in the detergent phase
71
with no appearance of Rab6 in the aqueous phase. These results suggest that exogenous
GGPP does not increase protein geranylgeranylation of Rab6.
GGPP decreases insulin receptor activation in osteoblasts. A report by Chen, et
al. demonstrated that GGPP could activate PTPase-1B activity in vitro, leading to
enhanced dephosphorylation of an insulin receptor (InsR) peptide substrate(91). Recent
studies have demonstrated that InsR signaling is essential for osteoblast differentiation
(92, 93). To test whether GGPP inhibits osteoblast differentiation through activation of
PTPase-1B and negative regulation of InsR signaling, the effect of GGPP on InsR
phosphorylation was tested. MC3T3-E1 pre-osteoblasts were pretreated with 20 M
GGPP or vehicle for 30 min, followed by stimulation with 100 nM insulin. GGPP pre-
treatment decreased the phosphorylation of the InsR at Tyr 1150/1151 in response to the
insulin treatment at each time point tested (Figure 20A). Since decreased InsR signaling
in InsR knockout osteoblasts is associated with decreased Runx2 activity and the
increased expression of the runx2 inhibitors, twist1 and twist2(93), we tested whether
similar effects occurred in osteoblasts treated with GGPP. GGPP treatment led to a
decrease in runx2 expression; however this was not significant (Figure 20B). While
twist1 expression was not significantly altered in primary calvarial osteoblasts cultured
with GGPP for 5 days, twist2 expression was increased approximately four-fold (Figure
20C).
GGPP increases insulin signaling. A recent study noted that GGPPS expression
leads to enhanced Erk1/2 activation and subsequent negative regulation of insulin
receptor substrate (IRS)-1(94). We therefore examined the effect of exogenous GGPP on
Erk1/2 phosphorylation. We found that Erk1/2 phosphorylation is increased with GGPP
72
treatment alone. This activation was increased further with insulin treatment to a greater
extent than cells treated with GGPP vehicle (Figure 21A). Phosphorylation of Akt was
not affected by GGPP. There was a slight increase in the phosphorylation of IRS-1 at
serine 612. In contrast to what would be expected by decreased InsR phosphorylation and
enhanced negative regulation of insulin signaling, glucose uptake by MC3T3-E1 pre-
osteoblasts and calvarial osteoblasts was enhanced by treatment with GGPP (Figure
21B).
Discussion
Herein, we demonstrate that GGPP inhibits osteoblast differentiation, and
enhances adipogenic differentiation of primary calvarial and BMSC osteoblast cultures.
Adipogenic differentiation of BMSCs could be inhibited through the specific inhibition
of GGPPS. GGPP pre-treatment decreased the phosphorylation of the InsR, enhanced
Erk1/2 phosphorylation, and increased glucose uptake, suggesting potential mechanisms
by which GGPP acts to inhibit osteoblast differentiation.
Our finding that GGPP negatively regulates osteoblast differentiation is consistent
with the conclusions of Yoshida, et al. that GGPP depletion is important for osteoblast
differentiation (55). However, we did not detect an effect for GGOH on the
differentiation of primary calvarial osteoblasts (data not shown). This may be due to our
use of primary osteoblasts instead of the MC3T3-E1 pre-osteoblast cell line utilized in
the study by Yoshida, et al. It is possible that the primary cells do not express the kinases
necessary to phosphorylate GGOH in the absence of GGPP-lowering agents. Due to the
lack of identification of these kinases, we were unable to test this hypothesis. Consistent
73
with a negative role for GGPP in osteoblast differentiation, we demonstrated in Chapters
II and III that GGPP levels decrease during osteoblast differentiation(84, 85).
Additionally, PTH treatment, which stimulates anabolic bone formation, has been shown
to reduce the expression of the upstream isoprenoid pathway enzyme mevalonate kinase.
The effect of PTH to stimulate BMP-2 expression was prevented by the addition of
exogenous GGPP, suggesting that PTH stimulates BMP-2 expression through the
negative regulation of mevalonate kinase expression and the resulting decrease in GGPP
(56).
GGPP treatment led to an induction of PPARγ expression. PPARγ exists as two
splice variants, PPARγ1 and PPARγ2. PPARγ1 is expressed in a wide range of tissues,
including the liver, adipose tissue, and bone, whereas PPARγ2 is expressed primarily in
adipogenic cells (87). GGPP treatment increased total PPAR as well as the PPAR2
splice variant expression. This presented the possibility that PPARγ activity was
responsible for the GGPP-mediated suppression of osteoblast differentiation, since agents
that activate PPAR have previously been noted for inhibition of osteoblast
differentiation (2, 35, 58). However, treatment with GW9662, an irreversible PPARγ
antagonist, did not prevent the effects of GGPP on osteoblast mineralization. GW9662
acts by covalently binding cysteine residue 285 on PPAR resulting in the loss of ligand
binding (95). While this experiment confirmed that the effect of GGPP to inhibit
osteoblast differentiation is not due to the induction of PPARγ transcriptional activity, it
remains possible that PPARγ may be inhibiting osteoblast differentiation through non-
transcriptional effects. This was not specifically tested in this study.
74
Age associated bone loss is accompanied by an increase in bone marrow adiposity
(2, 86). This has been described as a change in the intrinsic differentiation potential of
mesenchymal stem cells, increasing their tendency to differentiate towards the adipogenic
lineage (35). Interestingly, PPAR2 is upregulated in bone marrow from old animals, as
compared to that from adult animals (86). Due to the effect of GGPP to enhance PPARγ
expression and adipogenesis, it would be of great interest to determine whether GGPP
levels change during aging and potentially contribute to increased marrow adiposity.
As demonstrated in the recent publications by Ferron, et al. and Fulzele, et al.
osteoblasts express the InsR and InsR signaling in osteoblasts is necessary for osteoblast
differentiation and bone formation (92, 93). Fulzele, et al. found that InsR signaling
negatively regulates the expression of twist1 and 2, inhibitors of Runx2 transcriptional
activity. Therefore, InsR signaling led to enhanced Runx2 activity (93). The InsR is
negatively regulated by PTPase-1B in osteoblasts (92). A study by Chen, et al.
demonstrated that GGPP enhanced the activity of PTPase-1B in vitro(91). We
demonstrate that GGPP pre-treatment reduces the phosophorylation of the InsR.
Additionally, osteoblasts treated with GGPP display increased expression of the Runx2
inhibitor, twist2, consistent with data from Fulzele, et al. demonstrating negative
regulation of twist2 expression by InsR signaling. Together this suggests that increased
levels of GGPP may lead to decreased osteoblast differentiation through the inhibition of
InsR signaling (Figure 22A).
InsR signaling in osteoblasts has been demonstrated to be necessary for whole-
body glucose homeostasis due to its positive effect on OCN production by the osteoblast
(92, 93). Secreted OCN enhances -cell proliferation and insulin secretion, insulin
75
sensitivity, and energy expenditure (96). Aged mice deficient for InsR expression in
osteoblasts developed increased peripheral adiposity, hyperglycemia, and insulin
resistance (93). Increased levels of GGPP may additionally lead to reduced serum insulin,
hyperglycemia, and insulin resistance due to reduced expression of OCN by osteoblasts
through the negative regulation of insulin receptor signaling in osteoblasts.
In addition to the effects specifically on osteoblasts, PTPase-1B is associated with
the responsiveness of several other tissues to insulin. Because of this, PTPase1B
knockout mice display increased insulin sensitivity and are protected from diet-induced
obesity. In contrast, PTPase-1B overexpression results in insulin resistance due to
reduced insulin receptor signaling (97). The data presented here suggests the possibility
that, in addition to its effects on osteoblasts, GGPP levels may play a role in pathological
insulin resistance and diabetes.
Interestingly, a recent study demonstrates that GGPPS expression is associated
with increased Erk activation, leading to negative regulation of the InsR substrate, IRS-
1(94). We demonstrate here that GGPP treatment increased Erk1/2 phosphorylation. We
also noted a slight increase in the phosphorylation of IRS-1 at serine 612.
Phosphorylation at the residue negatively affects IRS-1 signaling. This suggests that in
addition to GGPP inhibiting InsR signaling through enhanced PTPase-1B activity, GGPP
may also inhibit InsR signaling through Erk activation and the subsequent inhibition of
the InsR substrate, IRS-1 (Figure 22A).
Contrary to what would be expected with decreased InsR phosphorylation and
increased Erk-mediated negative regulation of insulin signaling, glucose transport was
increased by GGPP treatment of MC3T3-E1 pre-osteoblasts and primary calvarial
76
osteoblasts. This evidence provides yet another possible mechanism by which GGPP
inhibits osteoblast differentiation and promotes adipogenesis. GGPP has been shown to
antagonize LXR(26). LXR is known to be involved in hepatic insulin signaling(98) and
LXR/b knockout mice exhibit enhanced glucose uptake in vivo(99). Inhibition of LXR
by GGPP may explain the increased glucose uptake in treated osteoblasts. Additionally,
certain oxysterols are agonists for LXR; oxysterols have been shown to stimulate
osteoblast differentiation and impair adipogenesis in vitro(100). This suggests that GGPP
may mediate its effects on osteoblasts through antagonism of LXR (Figure 22B).
Although endogenous GGPP levels have not been thoroughly studied in
conditions of aging or disease, one recent publication demonstrated a link between a
single nucleotide polymorphism (SNP) in GGPPS and BMD. In a population of Korean
women, patients with a homozygous deletion allele at -8188 of GGPPS (rs3840452)
displayed higher BMD at the femoral neck than women heterozygous and homozygous
for the insertion at this SNP. The response rate of women exhibiting the homozygous
deletion allele in GGPPS to BP therapy was lower; these patients displayed a seven-fold
higher risk of non-response to BP therapy (63). While the consequence this SNP has not
been studied, the data presented here leads to the speculation that the deletion allele may
lead to decreased GGPPS expression and that the decreased GGPP levels subsequently
lead to higher BMD. The population size in the evaluation of this SNP was very low, and
these results must be verified in a larger population. While the aim of their study was to
determine the effects of the GGPPS variant on osteoclasts, it cannot be ruled out that this
SNP may also influence osteoblast differentiation and bone formation. The study by
77
Choi, et al. provides preliminary evidence that in vivo GGPP levels have a role in
regulating the skeleton.
Altogether, our investigations demonstrate that GGPP negatively regulates
osteoblast differentiation resulting in increased PPARγ expression and enhanced
adipogenesis. Also, our results demonstrating decreased InsR phosphorylation, enhanced
Erk1/2 phosphorylation, and increased glucose transport in response to GGPP treatment
have intriguing implications for a role of GGPP in the modulation of energy metabolism
as well as skeletal homeostasis. The mechanism by which GGPP exerts these effects
should be further characterized in order to determine novel therapeutic targets for the
treatment of diseases such as osteoporosis and diabetes.
78
Figure 14. GGPP inhibits primary calvarial osteoblast differentiation. A and B, primary calvarial osteoblasts were treated with 5-20 µM GGPP for two weeks. A, Mineralization was assessed by Alizarin red staining followed by (B) elution and quantification of the dye at 405 nm. Data are expressed as mole Alizarin red per well, percent vehicle (mean ± SEM), *p<0.05. C, Primary calvarial osteoblasts were treated with 10 or 20 µM GGPP for five days. Osteoblastic gene expression was assessed by qPCR. Expression of osteoblastic genes was normalized to the expression of GAPDH, and expressed as percent vehicle (mean±SEM), *p<0.05, n=3.
79
Figure 15. GGPP increases the expression of PPARγ. A, primary calvarial osteoblasts were treated with GGPP for 5 days. Expression of total PPARγ and the PPARγ2 splice variant was assessed by qPCR. B and C, Primary BMSCs were treated in adipogenic, control, or osteogenic medium for seven days in the presence or absence of 20 µM GGPP. qPCR was used to assess the expression of (B) total PPARγ and (C) PPARγ2. Expression was normalized to GAPDH. Data are expressed as relative units (mean ± SEM), *p<0.05 as compared to GGPP vehicle in each condition, n=3.
80
Figure 16. Inhibition of PPARγ transcriptional activity does not prevent the effects of GGPP on osteoblast mineralization. Primary calvarial osteoblasts were treated with increasing concentrations of GW9662 in the presence or absence of 20 µM GGPP. Mineralization was assessed by (A) Alizarin red staining followed by (B) elution and quantification of the dye at 405 nm. Data are expressed as percent vehicle (mean ± SEM) n=3.
81
Figure 17. GGPP enhances adipogenesis. A, Primary calvarial osteoblasts were treated with 20 µM GGPP for two weeks in the presence or absence of 1 µM rosiglitazone. Total Oil Red O-positive cells per well were quantified (mean SEM). ap<0.05 as compared to vehicle-treated osteoblasts, bp<0.05 as compared to rosiglitazone treated osteoblasts, n=3. B, BMSC osteoblast cultures were treated with 1 M rosiglitzaone in the presence of control, GGPP vehicle, or 20 M GGPP for two weeks. The number of Oil Red O-positive cells were quantified in 5 visual fields per well (mean SEM), *p<0.05 as compared to GGPP vehicle, n=3. C-F, Primary calvarial osteoblasts were treated with control, GGPP vehicle, or 20 M GGPP for five days. qPCR was used to assess expression of (C) PPAR, (D) adiponectin, (E) UCP1, and (F) Glut4. Expression was normalized to GAPDH. Data are expressed as relative units (mean S EM). ap<0.05 as compared to vehicle-treated osteoblasts, bp<0.05 as compared to rosiglitazone-treated osteoblasts, cp<0.05 as compared to GGPP treated osteoblasts, n=3.
82
83
Figure 18. Specific inhibition of GGPPS decreases adipogenesis. A, BMSCs were treated with DGBP (0.1-100 µM) for 24 h. DGBP concentration-dependently reduced BMSC GGPP and increased the substrate FPP levels, n=2. B-D, BMSCs were treated in adipogenic medium with 1 µM Lov or 0.1-1.0 µM DGBP for two weeks. B, Cultures were stained with Oil Red O and (C) Oil Red O-positive cells were quantified in 5 visual fields per well and averaged. *p<0.05, n=3. D, mRNA was isolated and qPCR was used to analyze the expression of adipogenic genes. Expression was normalized to GAPDH and data are expressed as relative units (mean SEM). *p<0.05 as compared to control treatment, n=3.
84
Figure 19. GGPP treatment does not increase geranylgeranylation. MC3T3-E1 pre-osteoblasts were treated with indicated treatments for 24 h. Following lysis, the cell lysates were fractionated to aqueous and detergent phases. Western blot was used to assess the amounts of geranylgeranylated (detergent fraction) and non-geranylgeranylated (aqueous fraction) Rab6.
85
Figure 20. GGPP reduces InsR phosphorylation. A, Serum starved MC3T3-E1 pre-osteoblasts were pre-treated 30 min with GGPP or vehicle, followed by treatment with 100 nM insulin for 0-30 min. Western blots were used to detect phosphorylated InsR (Tyr1150/1151), total InsR, and α-tubulin (loading control). B and C, primary calvarial osteoblasts were treated with GGPP for 5 days. qPCR was used to assess expression of (B) Runx2 and (C) Twist1 and Twist2. mRNA was normalized to GAPDH mRNA (mean ± SEM). *p<0.05, n=3.
86
Figure 21. GGPP enhances insulin-induced Erk1/2 activation and glucose uptake. A, Serum starved primary calvarial osteoblasts (left) and MC3T3-E1 pre-osteoblasts (right) were pre-treated with GGPP for 30 min followed by treatment with 100 nM insulin for 0-30 min. Western blots were used to detect phosphorylated Erk1/2, total Erk1/2, phosphorylated Akt, total Akt, phosphorylated IRS-1 (serine 612), and total IRS-1. B. Serum starved primary calvarial osteoblasts (left) and MC3T3-E1 pre-osteoblasts (right) were treated with 20 µM GGPP for 4.5 h. Following the treatment, glucose uptake was measured. Data are expressed as disintegrations per minute (DPM) per g protein, mean ± SEM.
87
Figure 22. Proposed mechanisms for the inhibition of osteoblast differentiation by GGPP.
88
CHAPTER V: SUMMARY
The Isoprenoid Pathway and Osteoblast Differentiation
Based on published findings that statins stimulate osteoblast differentiation and
bone formation(36-40, 42, 67, 101, 102) and that this occurs through the depletion of
GGPP(41, 43), we hypothesized that specific depletion of GGPP with DGBP would
similarly lead to osteoblast differentiation. In contrast to our hypothesis, DGBP treatment
inhibited osteoblast differentiation as measured by osteoblast gene expression and matrix
mineralization. This led us to explore the effects of FPP accumulation, a secondary effect
of GGPPS inhibition, on osteoblast differentiation.
To determine whether FPP accumulation inhibits osteoblast differentiation, we
employed the SQS inhibitor, ZGA. Inhibition of SQS with ZGA led to a greater
accumulation of FPP than can be achieved by GGPPS inhibition. ZGA treatment also led
to increases in GGPP; however GGPP did not accumulate to the extent of FPP.
Consistent with our hypothesis, ZGA inhibited the differentiation of osteoblasts as
measured by gene expression, ALP activity, and matrix mineralization. ZGA also
inhibited osteoblast viability, suggesting that the accumulation of FPP prevents osteoblast
expansion. Co-treatment of calvarial cells with ZGA and lovastatin prevented the
accumulation of FPP as well as the inhibitory effects of ZGA on osteoblast viability,
differentiation, and matrix mineralization. These inhibitory effects could be restored by
the addition of mevalonate, the product downstream of the statin target, HMGCR.
Together this mechanistic data suggests that FPP accumulation negatively regulates
osteoblast differentiation.
89
As mentioned previously, FPP has been shown to bind and activate several
nuclear hormone receptors, including the estrogen, thyroid, and glucocorticoid receptors
(27). Interestingly, upon analysis of the glucocorticoid receptor, we demonstrated that
DGBP-induced FPP accumulation led to the activation of the glucocorticoid receptor as
measured by nuclear translocation and phosphorylation(85). A role for glucocorticoid
receptor activation would be consistent with data in Chapter III showing that the negative
effects of FPP accumulation were not prevented by inhibition of farnesylation(84).
Glucocorticoids have long been known to have negative effects on the skeleton, therefore
the potential role for FPP accumulation in glucocorticoid receptor activation and
regulation of skeletal homeostasis is very intriguing. Although not tested in this study, it
also remains possible that FPP activates other nuclear hormone receptors in osteoblasts to
influence proliferation, differentiation and matrix mineralization.
Consistent with previous findings that GGPPS expression decreases during
MC3T3-E1 pre-osteoblast differentiation, intracellular FPP and GGPP levels were found
to decrease during the differentiation of both MC3T3-E1 pre-osteoblasts and primary rat
calvarial osteoblasts. In primary calvarial cells this was associated with decreased
expression of HMGCR and FPPS. In support of decreased isoprenoid pathway activity
during osteoblast differentiation, a study by Takase, et al. reported that the anabolic agent
PTH negatively regulates the expression of mevalonate kinase (56). As noted previously,
our finding of increased GGPPS expression with differentiation is in contrast to those of
Yoshida, et al, who demonstrated that GGPPS decreased during MC3T3-E1 pre-
osteoblast differentiation (55). It is possible that this difference is due to the use of a cell
line in contrast to primary cells. It is important to note, however, that our study and that
90
by Yoshida, et al. are in agreement that GGPP levels decrease during osteoblast
differentiation.
We also demonstrate here the negative effects of exogenous GGPP on primary
calvarial osteoblast differentiation. As mentioned previously, Yoshida, et al. published
the negative effect of GGOH on MC3T3-E1 pre-osteoblast differentiation (55). In
contrast to their results, GGOH did not affect osteoblast differentiation in our study. This
may be due to fact that GGOH must be phosphorylated by intracellular kinases, whose
activity and expression we speculate may be regulated by the presence of GGPP.
Therefore, in the absence of GGPP-depleting agents, GGOH may not be converted to
GGPP in primary osteoblasts.
Because GGPPS expression has previously been shown to increase during
adipogenesis (60) and adipogenesis is impaired by GGPP depletion (42, 59), we tested
the effect of GGPP on the expression of PPARγ, a dominant regulator of adipogenic
differentiation. Interestingly, PPARγ expression was significantly increased by GGPP in
both primary calvarial osteoblast and BMSC cultures. We found that expression of
PPARγ2, the splice variant expressed predominantly be adipocytes, was also significantly
increased by GGPP. GGPP-stimulated PPARγ expression resulted in the increased
formation of lipid droplet containing cells, a classic marker of adipocyte formation, as
well as increased the expression of adiponectin and UCP1. UCP1 is a marker of brown
adipose tissue (BAT). In contrast, GGPP treatment led to a slight decrease in the
expression of Glut4, a marker of white adipose tissue (WAT). This suggests a potential
role for GGPP levels in the regulation of BAT formation. Consistent with a role for
GGPP to enhance PPARγ expression and adipocyte differentiation, specific depletion of
91
GGPP with DGBP inhibited the formation of lipid droplet-containing cells and
expression of the adipogenic genes PPARγ and adiponectin. In determining the
mechanism by which GGPP inhibits osteoblast differentiation, we first sought to
determine whether its effects were due to activation of PPARγ transcriptional activity,
which has been noted to negatively regulate osteoblast differentiation. Activators of
PPARγ are known inhibitors of osteoblast differentiation and reduce bone mass in in vivo
models(2, 35, 58). GW9662 covalently binds cysteine 285 of PPARγ resulting in loss of
its ligand binding and transcriptional activity(95). While GW9662 enhanced the matrix
mineralization of primary calvarial cells alone, co-treatment with GGPP did not prevent
the negative effects of GGPP on the inhibition of matrix mineralization. This suggests
that the effect of GGPP to inhibit osteoblast differentiation is independent of the effect of
GGPP on PPARγ activity. However, it cannot be ruled out that PPARγ may inhibit
osteoblast differentiation through a non-transcriptional mechanism.
There has been much interest recently in the role of InsR signaling in osteoblasts.
Ferron, et al. and Fulzele, et al. both demonstrated that osteoblasts deficient for the InsR
exhibit decreased differentiation and matrix mineralization(92, 93). In contrast, murine
osteoblasts deficient for osteotesticular (OST)-PTPase, the murine homolog of PTPase-
1B, exhibit enhanced osteoblast differentiation(96). Ferron, et al. show that the InsR is a
substrate for OST-PTP and PTPase-1B in osteoblasts, and OST-PTP knockout
osteoblasts exhibit higher levels of active, phosphorylated InsR (92). Interestingly,
PTPase-1B has been shown to be activated in vitro by GGPP(91), leading to enhanced
dephosphorylation of the InsR substrate. In our experiments, MC3T3-E1 pre-osteoblast
cultures pre-treated with GGPP displayed decreased phosphorylation of the InsR in
92
response to insulin treatment. Fulzele, et al. demonstrated that InsR signaling negatively
regulated the expression of twist1 and twist2, two negative regulators of Runx2 activity
(93). Consistent with a role for GGPP to negatively regulate the InsR in osteoblasts,
primary calvarial osteoblasts treated with GGPP exhibited increased expression of twist2
and decreased expression of Runx2. This suggests that GGPP may be inhibiting
osteoblast differentiation through the inhibition of InsR signaling.
A recent publication by Shen, et al. noted a correlation between GGPPS
expression, Erk activity, and insulin signaling. In their study, the authors demonstrated
that GGPPS expression led to increased Erk activation and subsequent inhibition of IRS-
1, a mediator of InsR signaling, suggesting a second mechanism by which GGPP
negatively regulates InsR signaling(94). Consistent with their work, we demonstrate
increased Erk1/2 activation in GGPP-treated osteoblasts. We also noted a slight increase
in phosphorylation of IRS-1 at serine 612, which negatively regulates IRS-1 signaling.
However in contrast to what would be expected, glucose uptake was increased by GGPP
treatment. One potential explanation for this effect may be antagonism of LXR by GGPP.
LXR has been reported to be involved in hepatic insulin signaling(98, 99), and LXR
knockout mice exhibit enhanced glucose uptake in response to insulin treatment(99).
Consistent with this as a potential mechanism explaining our results in osteoblasts, LXR
agonists stimulate osteoblast differentiation and inhibit adipogenesis in vitro. Altogether,
our results demonstrating decreased InsR phosphorylation, increased Erk activation, and
increased glucose uptake have important implications for skeletal bone formation as well
as energy homeostasis.
93
Future Studies
The work presented in this thesis presents many questions and potential future
directions. One question that is especially interesting is the potential role for GGPP to
enhancing the activity of PTPase-1B. First and foremost, it needs to be confirmed that the
effect of GGPP in decreasing InsR phosphorylation is indeed due to increased PTPase-1B
activity. This may be done by knocking down PTPase-1B in osteoblasts prior to the
GGPP and insulin treatments or a co-treatment with a PTPase-1B inhibitor. PTPase-1B
inhibitors are being developed for the treatment of diabetes, but are not currently
commercially available(103). If these studies confirm a role for GGPP in preventing InsR
phosphorylation through enhanced PTPase1B activity, experiments should be done to
confirm whether the mechanism of inhibiting osteoblast differentiation is through
negative regulation of InsR signaling. PTPase-1B regulates the activity of the InsR in
many tissues. It has been shown that mice deficient for PTPase1B exhibit enhanced
insulin sensitivity, whereas mice overexpressing PTPase1B display decreased insulin
sensitivity(97). Additionally, it should be determined whether activation of Erk by
exogenous GGPP leads to inhibition of IRS-1, which also may contribute to reduced InsR
signaling in osteoblasts. The role of GGPP to activate PTPase1B and Erk activity,
resulting in altered insulin sensitivity may potentially contribute to the pathogenesis of
diabetes and other metabolic disorders. It is also very important to further investigate the
role of LXR in the effects of GGPP on the osteoblast and adipocyte fate decision.
Potential experiments to confirm LXR inhibition as a mechanism for the negative effects
of GGPP on osteoblast differentiation and the enhanced glucose uptake include
overexpression of LXR.
94
While this study has shown very interesting roles for the isoprenoids FPP and
GGPP in regulating osteoblast differentiation, one is left wondering whether either of
these isoprenoids exists at concentrations necessary to exert the effects noted herein in
either physiological or pathological conditions. Several recent studies have reported
SNPs that affect the skeleton. Levy, et al. demonstrated that individuals with an AA
genotype at the FPPS SNP (rs2297480) displayed a significant increase in BMD at
several sites(61). These patients also exhibited an enhanced response to BP therapy(62).
A more recent study by Choi, et al. identified a deletion SNP in GGPPS (rs3840452)
which correlated with increased BMD at the femoral head. Patients with this genotype
had a greater chance of non-response to BP therapy(63). It is possible that these
polymorphisms may lead to higher or lower endogenous levels of FPP or GGPP.
Determining the functionality of these SNPs would be of great interest in determining
whether altered levels of FPP or GGPP contribute to the skeletal phenotypes observed in
these individuals.
Another interesting question lies in the field of aging. Age related bone loss is
associated with an increase in marrow adiposity(2, 6, 58). As mentioned previously,
osteoblasts and adipocytes are derived from mesenchymal stem cells(2, 6, 57).
Differentiation into either cell type is controlled by lineage specific transcription factor
expression(57). Interestingly, signals that promote osteoblastogenesis inhibit
adipogenesis, and vice versa. For example, agonists of PPARγ, such as the
thiazolidinediones, have been shown to inhibit osteoblast differentiation and bone
formation(6, 57, 58). Interestingly, the age-associated increase in marrow adiposity
correlates with increased PPARγ expression in the bone marrow(86), suggesting a shift in
95
differentiation potential with age (35). Together with data presented in this thesis, it
would be very interesting to investigate whether GGPP, which we have shown herein
increases PPARγ expression, may also increase during aging. This may also be
interesting in investigating other aging-related diseases, such as diabetes, in which cells
display an aging phenotype.
Conclusion
Altogether, the data presented in this thesis demonstrate roles for the isoprenoids
FPP and GGPP to negatively regulate osteoblast differentiation. This is consistent with
data from two cell models that show that these isoprenoids decrease during osteoblast
differentiation. The ability of FPP to activate nuclear hormone receptors in physiological
and pathological skeletal conditions should be further investigated. Additionally, in the
case of GGPP, we demonstrate that this isoprenoid plays a role in the osteoblast and
adipocyte fate decision through inhibition of osteoblast differentiation and the resulting
upregulation of the adipocytic transcription factor PPARγ. Therefore the potential role for
GGPP in metabolic physiology may be of great importance.
96
REFERENCES
1. Chau, J. F., Leong, W.F., Li, B., Signaling pathways governing osteoblast proliferation, differentiation and function. Histol Histopathol 2009, 24 (12), 1593-1606.
2. Muruganandan, S., Roman, A.A., Sinal, C.J, Adipocyte differentiation of bone marrow-derived mesenchymal stem cells: Cross talk with the osteoblastic program. Cell Mol Life Sci 2009, 66 236-253.
3. Canalis, E., Update in new anabolic therapies for osteoporosis. J Clin Endo Metab 2010, 95 (4), 1496-1504.
4. Gallagher, J. C., Sai, A.J., Molecular biology of bone remodeling: implications for new therapeutic targets for osteoporosis. Maturitas 2010, 65 301-307.
5. Baron, R., Ferrari, S., Russell, R.G.G., Denosumab and bisphosphonates: Different mechanisms of action and effects. Bone 2010,
6. de Paula, F., Horowitz, MC, Rosen, CJ, Novel insights into the relationship between diabetes and osteoporosis. Diabetes Metab Res Rev 2010, 26 622-630.
7. Kanis, J., WHO Study Group, Assessment of fracture risk and its application to screening for postmenopausal osteoporosis: synopsis of a WHO report. WHO Study Group. Osteoporosis Int 1994, 4 (6), 368-381.
8. Compston, J., Osteoporosis: social and economic impact. Radiol Clin N Am 2010, 48 (3), 477-482.
9. Clarke, B., Khosla, S, Physiology of bone loss. Radiol Clin N Am 2010, 48 (3), 483-495.
10. Burge, R., Dawson-Hughes, B, Solomon, DH, Wong, JB, King, A, Tosteson, A,
Incidence and economic burden of osteoporosis-related fractures in the United States, 2005-2025. J Bone Miner Res 2007, 22 (3), 465-75.
11. Close, P., Neuprez, A., Reginster, J.Y., Developments in the pharmacotherapeutic management of osteoporosis. Expert Opin Pharmacother 2006, 7 (12), 1603-1615.
12. Gong, L. A., R.B., Klein, T.E, Bisphosphonates pathway. Pharmacogenet Genomics 2010, 21 (1), 50-53.
13. Bergstrom, J., Bostedor, RG, Masarachia, PJ, Reszka, AA, Rodan, G, Alendronate is a specific, nanomolar inhibitor of farnesyl diphosphate synthase. Arch Biochem Biophys 2000, 373 (1), 231-41.
97
14. van Beek, E., Pieterman, E, Cohen, L, Lowik, C, Papapoulos, S, Farnesyl Pyrophosphate Synthase Is the Molecular Target of Nitrogen-Containing Bisphosphonates. Biochem Biophys Res Comm 1999, 264 (1), 108-111.
15. Luckman, S., Hughes, DE, Coxon, FP, Graham, R, Russell, G, Rogers, MJ, Nitrogen-containing bisphosphonates inhibit the mevalonate pathway and prevent post-translational prenylation of GTP-binding proteins, including Ras. J Bone Miner Res 1998, 13 (4), 581-589.
16. Monkkonen, H., Auriola, S, Lehenkari, P, Kellinsalmi, M, Hassinen, IE, Vepsalainen, J, Monkkonen, J , A new endogenous ATP analog (ApppI) inhibits the mitochondrial adenine nucleotide translocase (ANT) and is responsible for the apoptosis induced by nitrogen-containing bisphosphonates. Brit J Pharm 2006, 147 437-445.
17. Matsumoto, T., Nagase, Y, Yasui, T, Masuda, H, Nakamura, K, Tanaka, S, Segregation of Pro-apoptotic and Anti-resorptive Functions of Risedronate In Vivo. In J Bone Miner Res, Toronto, CA, 2010; Vol. 25.
18. Coleman, R., McCloskey, EV, Bisphosphonates in oncology. Bone 2011,
19. Girotra, M., Rubin, MR, Bilezikian, JP, Anabolic skeletal therapy for osteoporosis. Arq Bras Endocrinol Metab 2006, 50 (4), 745-754.
20. Goldstein, J., Brown, MS, Regulation of the mevalonate pathway. Nature 1990, 343 (6257), 425-430.
21. Holstein, S., Hohl, RJ, Isoprenoids: remarkable diversity of form and function. Lipids 2004, 39 (4), 293-309.
22. Perez-Sala, D., Protein isoprenylation in biology and disease: general overview and perspectives from studies with genetically engineered animals . Frontiers Biosci 2007 , 12 4456-4472.
23. Zhang, F. L., Casey, P.J., Protein Prenylation: Molecular Mechanisms and Functional Consequences. Annual Reviews Biochem 1996, 65 241-69.
24. Sebti, S., Protein farnesylation: Implications for normal physiology, malignant transformation, and cancer therapy. Cancer Cell 2005, 7 297-300.
25. Forman, B., Goode, E, Chen, J, Oro, AE, Bradley, DJ, Perlmann, T, Noonan, DJ, Burka, LT, McMorris, T, Lamph, WW, Evans, RM, Weinberger, C, Identification of a nuclear receptor that is activated by farnesol metabolites. Cell 1995, 81 (5), 687-693.
26. Forman, B., Ruan, B, Chen, J, Schroepfer, GJ Jr, Evans, RM, The orphan nuclear
receptor LXRalpha is positively and negatively regulated by distinct products of mevalonate metabolism. PNAS 1997, 94 (20), 10588-10593.
98
27. Das, S., Schapira, M, Tomic-Canic, M, Goyanka, R, Cardoza, T, Samuels, HH, Farnesyl pyrophosphate is a novel transcriptional activator for a subset of nuclear hormone receptors. Mol Endocrinology 2007, 21 (11), 2672-2686.
28. Vukelic, S., Stojadinovic, O, Pastar, I, Vouthounis, C, Krzyzanowska, A, Das, S,
Samuels, HH, Tomic-Canic, M, Farnesyl pyrophosphate inhibits epithelialization and wound healing through the glucocorticoid receptor. J Biol Chem 2010, 285 (3), 1980-1988.
29. Oh, D., Yoon, JM, Moon, MJ, Hwang, JI, Choe, H, Lee, JY, Kim, JI, Kim, S, Rhim, H, O'Dell, DK, Walker, JM, Na, HS, Lee, MG, Kwon, HB, Kim, K, Seong, JY, Identification of farnesyl pyrophosphate and N-arachidonylglycine as endogenous ligands for GPR92. J Biol Chem 2008, 283 (30), 21054-21064.
30. Liliom, K., Tsukahara, T, Tsukahara, R, Zelman-Femiak, M, Swiezewska, E, Tigyi, G, Farnesyl phosphates are endogenous ligands of lysophosphatidic acid receptors: inhibition of LPA GPCR and activation of PPARs. Biochimica et Biophysica Acta 2006, 1761 (12), 1506-1514.
31. Bang, S., Yoo, S, Yang, TJ, Cho, H, Hwang, SW, Farnesyl pyrophosphate is a novel pain-producing molecule via specific activation of TRPV3. J Biol Chem 2010, 285 (25), 19352-19371.
32. Zhou, Q., Liao, JK, Pleiotropic effects of statins. - Basic research and clinical perspectives-. Circ J 2010, 74 (5), 818-826.
33. Endo, A., Tsujita, Y, Kuroda, M, Tanzawa, K, Inhibition of cholesterol synthesis in vitro and in vivo by ML-236A and ML-236B, competitive inhibitors of 3-hydroxy-3-methylglutaryl-coenzyme A reductase. Eur J Biochem 1977, 77 (1), 31-6.
34. Toutouzas, K., Drakopoulou, M, Skoumas, I, Stefanadis, C, Advancing therapy for hypercholesterolemia. Expert Opin Pharmacother 2010, 11 (10), 1659-1672.
35. Moerman, E., Teng, K, Lipschitz, DA, Lecka-Czernik, B , Aging activates adipogenic and suppresses osteogenic programs in mesenchymal marrow stroma/stem cells: the role of PPAR gamma2 transcription factor and TGF-beta/BMP signaling pathways. Aging Cell 2004, 3 379-389.
36. Mundy, G., Garrett R, Harris, S, Chan, J, Chen, D, Rossini, G, Boyce, B, Zhao, M, Gutierrez, G, Stimulation of Bone Formation in Vitro and in Rodents by Statins. Science 1999, 286 (5446), 1946-1949.
37. Ruiz-Gaspa, S., Nogues, X, Enjuanes, A, Monllau, JC, Blanch, J, Carreras, R, Mellibovsky, L, Grinberg, D, Balcells, S, Diez-Perez, A, Pedro-Botet, J, Simvastatin and atorvastatin enhance gene expression of collagen type 1 and osteocalcin in primary human osteoblasts and MG-63 cultures. J Cell Biochem 2007, 101 (6), 1430-1438.
99
38. Chen, P., Sun, JS, Tsuang, YH, Chen, MH, Weng, PW, Lin, FH, Simvastatin promotes osteoblast viability and differentiation via Ras/Smad/Erk/BMP-2 signaling pathway. Nutrition Research 2010, 30 (3), 191-199.
39. Maeda, T., Matsunuma, A, Kawane, T, Horiuchi, N, Simvastatin promotes
osteoblast differentiation and mineralization in MC3T3-E1 cells. Biochem Biophys Research Comm 2001, 280 (3), 874-877.
40. Maeda, T., Kawane, T, Horiuchi, N, Statins augment vascular endothelial growth factor expression in osteoblastic cells via inhibition of protein prenylation. Endocrinology 2003, 144 (2), 681-692.
41. Maeda, T., Matsunuma, A, Kurahashi, I, Yanagawa, T, Yoshida, H, Horiuchi, N, Induction of osteoblast differentiation indices by statins in MC3T3-E1 cells. J Cell Biochem 2004, 92 (3), 458-471.
42. Li, X., Cui, Q, Kao, C, Wang, GJ, Balian, G, Lovastatin inhibits adipogenic and
stimulates osteogenic differentiation by suppressing PPARgamma2 and increasing Cbfa1/Runx2 expression in bone marrow mesenchymal cell cultures. Bone 2003, 33 (4), 652-659.
43. Ohnaka, K., Shimoda, S, Nawata, H, Shimokawa, H, Kaibuchi, K, Iwamoto, Y, Takayanagi, R, Pitavastatin enhanced BMP-2 and osteocalcin expression by inhibition of Rho-associated kinase in human osteoblasts. Biochem Biophys Res Comm 2001, 287 (2), 337-342.
44. Pagkalos J, C. J., Kang Y, Heliotis M, Tsiridis E, Mantalaris A, Simvastatin induces osteogenic differentiation of murine embryonic stem cells. J Bone Miner Res 2010,
45. Gutierrez GE, E. J., Garrett IR, Nyman JS, McCluskey B, Rossini G, Flores A, Neidre DB, Mundy GR, Transdermal lovastatin enhances fracture repair in rats. J Bone Miner Res 2008, 23 (11), 1722-30.
46. Skoglund B, F. C., Aspenberg P, Simvastatin improves fracture healing in mice. J Bone Miner Res 2002, 17 (11), 2004-8.
47. Chuengsamarn, S., Rattanamongkoulgul, S, Suwanwalaikorn, S, Wattanasirichaigoon, S, Kaufman, L, Effects of statins vs. non-statin lipid-lowering therapy on bone formation and bone mineral density biomarkers in patients with hyperlipidemia. Bone 2010, 46 (4), 1011-1015.
48. Tang, Q., Tran, GT, Gamie, Z, Graham, S, Tsialogiannis, E, Tsiridis, E, Linder, T, Tsiridis, E, Statins: under investigation for increasing bone mineral density and augmenting fracture healing. Expert Opin Investig Drugs 2008, 17 (10), 1435-1463.
100
49. Wang, P. S., Solomon, D.H., Mogun, H., Avorn, J., HMG-CoA reductase inhibitors and the risk of hip fractures in elderly patients. JAMA 2000, 283 (24), 3211-3216.
50. Uzzan, B., Cohen, R, Nicolas, P, Cucherat, M, Perret, GY, Effects of statins on
bone mineral density: a meta-analysis of clinical studies. Bone 2007, 40 (6), 1581-1587.
51. Duque, G., Rivas, D, Alendronate has an anabolic effect on bone through the
differentiation of mesenchymal stem cells. J Bone Miner Res 2007, 22 (10), 1603-1611.
52. Ebert, R., Zeck, S, Krug, R, Meissner-Weigl, J, Schneider, D, Seefried, L, Eulert, J, Jakob, F, Pulse treatment with zoledronic acid causes sustained commitment of bone marrow derived mesenchymal stem cells for osteogenic differentiation. Bone 2009, 44 (5), 858-864.
53. Orriss, I., Key, ML, Colston, KW, Arnett, TR, Inhibition of osteoblast function in vitro by aminobisphosphonates. J Cell Biochem 2009, 106 (1), 109-118.
54. Idris, A., Rojas, J, Greig, IR, Van't Hof, RJ, Ralston, SH, Aminobisphosphonates cause osteoblast apoptosis and inhibit bone nodule formation in vitro. Calcif Tissue Int 2008, 82 (3), 191-201.
55. Yoshida, T., Asanuma, M, Grossmann, L, Fuse, M, Shibata, T, Yonekawa, T, Tanaka, T, Ueno, K, Yasuda, T, Saito, Y, Tatsuno, I, Geranylgeranyl-pyrophosphate (GGPP) synthase is down-regulated during differentiation of osteoblastic cell line MC3T3-E1. FEBS Letters 2006, 580 (22), 5203-5207.
56. Takase, H., Yano, S, Yamaguchi, T, Kanazawa, I, Hayashi, K, Yamamoto, M, Yamauchi, M, Sugimoto, T, Parathyroid hormone upregulates BMP-2 mRNA expression through mevalonate kinase and Rho kinase inhibition in osteoblastic MC3T3-E1 cells. Horm Metab Res 2009, 41 (12), 861-865.
57. Tontonoz, P., Spiegelman, B.M, Fat and Beyond: The Diverse Biology of PPARgamma. Annu Rev Biochem 2008, 77 289-312.
58. Nuttall, M. E., Gimble, J.M., Controlling the balance between osteoblastogenesis and adipogenesis and the consequent therapeutic implications. Curr Op Pharm 2004, 4 290-294.
59. Song, C., Guo, Z, Ma, Q, Chen, Z, Liu, Z, Jia, H, Dang, G, Simvastatin induces osteoblastic differentiation and inhibits adipocytic differentiation in mouse bone marrow stromal cells. Biochem Biophys Res Comm 2003, 308 458-62.
101
60. Vicent, D., Maratos-Flier, E, Kahn, CR, The branch point enzyme of the mevalonate pathway for protein prenylation is overexpressed in the ob/ob mouse and induced by adipogenesis. Molecular and Cellular Biology 2000, 20 (6), 2158-2166.
61. Levy, M., Parker, RA, Ferrell, RE, Zmuda, JM, Greenspan, SL, Farnesyl diphosphate synthase: a novel genotype association with bone mineral density in elderly women. Maturitas 2007, 57 (3), 247-52.
62. Marini, F., Falchetti, A, Silvestri, S, Bagger, Y, Luzi, E, Tanini, A, Christiansen,
C, Brandi, ML, Modulatory effect of farnesyl pyrophosphate synthase (FDPS) rs2297480 polymorphism on the response to long-term amino-bisphosphonate treatment in postmenopausal osteoporosis. Current Medical Research and Opinion 2008, 24 (9), 2609-2615.
63. Choi, H., Choi, JY, Cho, SW, Kang, D, Han, KO, Kim, SW, Kim, WY, Chung, YS, Shin, CS , Genetic polymorphism of geranylgeranyl diphosphate synthase (GGSP1) predicts bone density response to bisphosphonate therapy in Korean women. Yonsei Med J 2010, 51 (2), 231-238.
64. Wiemer, A. J., Tong, H, Swanson, K.M., Hohl, R.J., Digeranyl bisphosphonate inhibits geranylgeranyl pyrophosphate synthase. Biochem Biophys Res Comm 2007, 353 (4), 921-925.
65. Shull, L., Wiemer, AJ, Hohl, RJ, Wiemer, DF, Synthesis and biological activity of isoprenoid bisphosphonates. Bioorg Med Chem 2006, 14 (12), 4130-4136.
66. Gutierrez, G., Lalka, D, Garrett, IR, Rossini, G, Mundy, GR, Transdermal
application of lovastatin to rats causes profound increases in bone formation and plasma concentrations. Osteoporosis Int 2006, 17 1033-42.
67. Skoglund, B., Forslund, C, Aspenberg, P, Simvastatin improves fracture healing in mice. J Bone Miner Res 2002, 17 (11), 2004-8.
68. Hayashi, K., Yamaguchi, T, Yano, S, Kanazawa, I, Yamauchi, M, Yamamoto, M, Sugimoto, T, BMP/Wnt antagonists are upregulated by dexamethasone in osteoblasts and reversed by alendronate and PTH: Potential therapeutic targets for glucocorticoid-induced osteoporosis. Biochem Biophys Res Comm 2009, 379 261-66.
69. Tong, H., Holstein, SA, Hohl, RJ, Simultaneous determination of farnesyl and geranylgeranyl pyrophosphate levels in cultured cells. Anal Biochem 2005, 336 (1), 51-59.
70. Gregory, C., Gunn, WG, Peister, A, Prockop, DJ, An Alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction. Anal Biochem 2004, 329 (1), 77-84.
102
71. Nancollas, G., Tang, R, Phipps, RJ, Henneman, Z, Gulde, S, Wu, W, Mangood, A, Russell, RGG, Ebetino, FH, Novel insights into actions of bisphosphonates on bone: Differences in interactions with hydroxyapatite. Bone 2006, 38 617-27.
72. Canalis, E., Mazziotti, G, Giustina, A, Bilezikian, JP, Glucocorticoid-induced osteoporosis: pathophysiology and therapy. Osteoporos Int 2007, 18 1319-1328.
73. Sher, L., Harrison, JR, Adams, DJ, Kream, BE, Impaired cortical bone acquisition and osteoblast differentiation in mice with osteoblast-targeted disruption of glucocorticoid signaling. Calcif Tissue Int 2006, 79 (2), 118-125.
74. Endo, A., The discovery and development of HMG-CoA reductase inhibitors. J Lipid Res 1992, 33 (11), 1569-82.
75. vanBeek, Farnesyl Pyrophosphate Synthase Is the Molecular Target of Nitrogen-Containing Bisphosphonates. Biochem and Biophys Res Comm 1999, 264 (1), 108-111.
76. Reinholz, G., Getz, B, Pederson, L, Sanders, ES, Subramaniam, M, Ingle, JN,
Spelsberg, TC, Bisphosphonates Directly Regulate Cell Proliferation, Differentiation, and Gene Expression in Human Osteoblasts. Cancer Research 2000, 60 (21), 6001-6007.
77. Im, G., Qureshi, SA, Kenney, J, Rubash, HE, Shanbhag, AS, Osteoblast proliferation and maturation by bisphosphonates. Biomaterials 2004, 25 (18), 4105-15.
78. Kim, H., Kim, JH, Abbas, AA, Yoon, TR, Alendronate enhances osteogenic differentiation of bone marrow stromal cells: a preliminary study. Clin Orthop Relat Res 2009, 467 (12), 3121-3128.
79. Panzavolta, S., Torricelli, P, Bracci, B, Fini, M, Bigi, A, Alendronate and Pamidronate calcium phosphate bone cements: setting properties and in vitro response of osteoblast and osteoclast cells. Journal of Inorganic Biochem 2009, 103 (1), 101-106.
80. Fu, L., Tang, T, Miao, Y, Zhang, S, Qu, Z, Dai, K, Stimulation of osteogenic differentiation and inhibition of adipogenic differentiation in bone marrow stromal cells by alendronate via ERK and JNK activation. Bone 2008, 43 (1), 40-47.
81. Pozzi, S., Vallet, S, Mukherjee, S, Cirstea, D, Vaghela, N, Santo, L, Rosen, E, et al, High-dose zoledronic acid impacts bone remodeling with effects on osteoblastic lineage and bone mechanical properties. Clin Cancer Res 2009, 15 (18), 5829-39.
103
82. Kellinsalmi, M., Monkkonen, H, Monkkonen, J, Leskela, HV, Parikka, V, Hamalainen, M, Lehenkari, P, In vitro comparison of clodronate, pamidronate and zoledronic acid effects on rat osteoclasts and human stem cell-derived osteoblasts. Basic and Clinical Pharmacology and Toxicology 2005, 97 (6), 382-391.
83. Yoshida T, A. M., Grossmann L, Fuse M, Shibata T, Yonekawa T, Tanaka T,
Ueno K, Yasuda T, Saito Y, Tatsuno I, Geranylgeranyl-pyrophosphate (GGPP) synthase is down-regulated during differentiation of osteoblastic cell line MC3T3-E1. FEBS Letters 2006, 580 (22), 5203-5207.
84. Weivoda, M., Hohl, RJ, The Effects of Farnesyl Pyrophosphate Accumulation on
Calvarial Osteoblast Differentiation. Endocrinology 2011, In press
85. Weivoda, M., Hohl, RJ, The effects of direct inhibition of geranylgeranyl pyrophosphate synthase on osteoblast differentiation. J Cell Biochem 2011, 1506-1513.
86. Lecka-Czernik, B., Rosen, CJ, Kawai, M, Skeletal aging and the adipocyte program: New insights from an "old" molecule. Cell Cycle 2010, 9 (18), 3648-3654.
87. Kawai, M., Rosen, CJ, PPARgamma: a circadian transcription factor in adipogenesis and osteogenesis. Nat Rev Endocrinol 2010, 6 629-636.
88. Lecka-Czernik, B., Gubrij, I, Moerman, EJ, Kajkenova, O, Lipschitz, DA, Manolagas, SC, Jilka, RL, Inhibition of Osf2/Cbfa1 Expression and Terminal Osteoblast Differentiation by PPARgamma2. J Cell Biochem 1999, 74 357-371.
89. Bordier, C., Phase separation of integral membrane proteins in triton X-114 solution. J Biol Chem 1981, 256 1604-1607.
90. Zoidis, E., Ghirlanda-Keller, C, Schmid, C, Stimulation of glucose transport in osteoblastic cells by parathyroid hormone and insulin-like growth factor I. Mol Cell Biochem 2011, 348 33-42.
91. Chen, H., Chen, CH, Chuang, NN, Differential effects of prenyl pyrophosphates on the phosphatase activity of phosphotyrosyl protein phosphatase. J Exp Zool A Comp Exp Biol 2004, 301 (4), 307-316.
92. Ferron, M., Wei, J, Yoshizawa, T, Del Fattore, A, DePinho, RA, Teti, A, Ducy, P, Karsenty, G, Insulin signaling in osteoblasts integrates bone remodeling and energy metabolism. Cell 2010, 142 296-308.
93. Fulzele, K., Riddle, RC, DiGirolamo, DJ, Cao, X, Wan, C, Chen, D, Faugere, M, Aja, S, Hussain, MA, Bruning, JC, CLemens, TL, Insulin receptor signaling in osteoblasts regulates postnatal bone acquisition and body composition. Cell 2010, 142 309-319.
104
94. Shen, N., Yu, X, Pan, FY, Gao, X, Xue, B, Li, CJ, An early response transcription factor, Egr-1, enhances insulin resistance in type 2 diabetes with chronic hyperinsulinism. J Biol Chem 2011,
95. Leesnitzer, L., Parks, DJ, Bledsoe, RK, Cobb, JE, Collins, JL, Consler, TG, Davis, RG, Hull-Ryde, EA, Lenhard, JM, Patel, L, :lunket, KD, Shenk, JL, Stimmel, JB, Therapontos, C, Willson, TM, Blanchard, SG, Functional consequences of cysteine modification in the ligand binding sites of perxoisome proliferator activated receptors by GW9662. Biochem 2002, 41 6640-6650.
96. Lee, N., Sowa, H, Hinoi, E, Ferron, M, Ahn, JD, Confavreux, C, Dacquin, R, Mee, PJ, McKee, MD, Jung, DY, Zhang, Z, Kim, JK, Mauvais-Jarvis, F, Ducy, P, Karsenty, G, Endocrine Regulation of Energy Metabolism by the Skeleton. Cell 2008, 130 456-469.
97. Julien, S., Tremblay, ML, Insulin Receptor PTP:PTP1B. In Handbook of Cell Signaling, Elsevier: 2010; Vol. II, pp 811-815.
98. Basciano, H., Miller, A, Baker, C, Naples, M, Adeli, K, LXRalpha activation perturbs hepatic insulin signaling and stimulates production of apolipoprotein B-containing lipoproteins. Am J Physiol Gastrointest Liver Physiol 2009, 297 G323-G332.
99. Risan Tobin, K., Ulven, SM, Schuster, GU, Hermansen Steineger, H, Maehle Andresen, S, Gustafsson, J, Nebb, HI, Liver X Receptors as Insulin-mediating Factors in Fatty Acid and Cholesterol Biosynthesis. J Biol Chem 2002, 277 (12), 10691-10697.
100. Kha, H., Basseri, B, Shouhed, D, Richardson, J, Tetradis, S, Hahn, TJ, Parhami, F, Oxysterols Regulate Differentiation of Mesenchymal Stem Cells: Pro-Bone and Anti-Fat. J Bone Miner Res 2004, 19 (5), 830-840.
101. Pagkalos, J., Cha, JM, Kang, Y, Heliotis, M, Tsiridis, E, Mantalaris, A, Simvastatin induces osteogenic differentiation of murine embryonic stem cells. J Bone Miner Res 2010,
102. Gutierrez, G., Edwards, JR, Garrett, IR, Nyman, JS, McCluskey, B, Rossini, G, Flores, A, Neidre, DB, Mundy, GR, Transdermal lovastatin enhances fracture repair in rats. J Bone Miner Res 2008, 23 (11), 1722-30.
103. Mattila, E., Ivaska, J, High-Througput methods in identification of protein tyrosine phosphatase inhibitors and activators. Anticancer Agents Med Chem 2011.