Supplementary Information Human P-selectin glycoprotein ligand … · 2010-02-12 · PSGL-1-dependent CVA16-G10 replication in PSGL-1-positive cells. (a) Development of CPE (Phase)

Supplementary Information

Human P-selectin glycoprotein ligand-1 is a functional receptor for enterovirus 71

Yorihiro Nishimura, Masayuki Shimojima, Yoshio Tano, Tatsuo Miyamura, Takaji Wakita,

and Hiroyuki Shimizu

Nature Medicine: doi:10.1038/nm.1961

Supplementary Figures

Supplementary Figure 1. PSGL-1-dependent and -independent infection of EV71. The EV71 strains tested can be classified into two distinct phenotypes according to their PSGL-1-binding capability: PSGL-1-binding (PB) strains (EV71–PB) and PSGL-1-nonbinding strains (EV71–non-PB). (a) EV71–PB infects PSGL-1-positive Jurkat T cells in a PSGL-1-dependent manner. (b) All EV71 strains may use alternative, unidentified receptor(s) to infect nonleukocyte cell lines expressing little or no PSGL-1 on the cell surface in a PSGL-1-independent manner. (c) EV71–non-PB may use alternative, unidentified receptor(s) to infect Jurkat T cells in a PSGL-1-independent manner. EV71-BrCr does not replicate in Jurkat T cells (Fig. 4b).


Supplementary Figure 2. EV71 does not bind to control human sialomucin proteins and mouse Psgl-1. 293T cells were transfected with the expression vectors as indicated. Left panels: The shaded and open areas represent staining with mAbs to the transduced molecules and isotype-control, respectively. Right panels: The shaded and open areas represent EV71-1095-binding assay and binding control with mock-infected culture supernatant, respectively. The percentage of CD34-, CD43-, mouse Psgl-1- or EV71-positive cells is indicated (mean ± SD, n = 3).


Supplementary Figure 3. EV71 binds to the N terminal region of human PSGL-1. (a) Schematic structure of hmPSGL-1. The KPL1-binding site is indicated. (b) Alignment of deduced aa sequences of human PSGL-1 and mouse Psgl-1 at the N terminus. (c) EV71-1095 binds to hmPSGL-1 expressed on 293T cells. Left panels: The shaded and open areas represent staining with PSGL-1-specific mAb (KPL1) and isotype-control, respectively. Right panels: The shaded and open areas represent an EV71-1095-binding assay and binding control with mock-infected culture supernatant, respectively. The percentage of hmPSGL-1- or EV71-positive cells is indicated (mean ± SD, n = 3).


Supplementary Figure 4. PSGL-1-dependent CVA16-G10 replication in PSGL-1-positive cells. (a) Development of CPE (Phase) and the corresponding CVA16 antigens (VP1) in infected L-PSGL-1.1 and L-bsd incubated with PSGL-1-specific (KPL1) and control mAbs. CVA16 antigens were detected by Alexa Fluor® 488-labeled EV71-specific mAb 10F0, which cross-reacts with CVA16. Scale bars indicate 100 µm. (b) Replication of CVA16-G10 in L-PSGL-1.1 and L-bsd cells incubated with PSGL-1-specific (KPL1) and control mAbs. Titers are expressed as the mean, and error bars indicate SD of triplicate analyses. (c) Replication of CVA16-G10 in Jurkat T cells incubated with PSGL-1-specific (KPL1 and PL2) and control mAbs. Titers are expressed as the mean, and error bars indicate SD of triplicate analyses.


Supplementary Tables

Supplementary Table 1. EV71 strains.

Strain Subgenogroup Major symptom Location Year Accession No.

BrCr1 A Meningitis USA 1970 U22521

Nagoya2 B1 HFMD Japan 1973 AB059813

SK-EV0063 B3 Encephalitis (fatal) Malaysia 1997 AB059819

C7/Osaka3 B4 Encephalitis (fatal) Japan 1997 AB059818

023634 C1 HFMD Thailand 2002 AB115495

KED0053* C1 HFMD Malaysia 1997

10954,5 C2 HFMD Japan 1997 AB059817

75-Yamagata6 C4 HFMD Japan 2003 AB177813

*The VP1 nucleotide sequence of KED005 is identical to that of the 03784-MAA-97 strain

(Accession no. AY207612) isolated in Malaysia7.


Supplementary Table 2. Cell lines.

Source Cell line

Animal Case or tissue (cell type)

P3X63Ag8U.1 Mouse Myeloma

L929 Mouse Connective tissue

293T Human Kidney

GP2-293 Human Kidney

Jurkat Human Leukemic T-cell lymphoblast (T lymphocyte)

U937 Human Histocytic lymphoma (monocyte-like)

MOLT-4 Human Acute lymphoblastic leukemia (T lymphocyte)

MT-2 Human Adult T-cell leukemia (T lymphocyte)

RD Human Rhabdomyosarcoma

HEp-2 Human Epidermoid carcinoma

SK-N-MC Human Neuroepithelioma

Vero African green monkey Kidney


Supplementary Table 3. ORF primers.

Construct S/A1) Sequence (5'—3')2)

Human PSGL-1 S tatcggtccgataaatATGCCTCTGCAACTCCTCC

A tagcggaccgctaAGGGAGGAAGCTGTGCA

Human CD34 S tatcggtccgataaatATGCTGGTCCGCAGGGGCG

A tgacggaccgtcaGGGTTCCAGCTCCAGCC

Human CD43 S tatcggtccgataaatATGGCCACGCTTCTCCTTC

A taacggaccgttaAGGGGCAGCCCCGTCTC

Mouse Psgl-1 S tatcggtccgataaatATGTCCCCAAGCTTCCTTG

A tagcggaccgctaAGGGAGGAAGCTGTGCAGGGTG 1) S, sense; A, antisense. 2) CpoI sites are underlined. Nucleotides corresponding to the ORF are indicated by

uppercase letters.


Supplementary Table 4. Primers for substitution and chimeric protein construction.

Construct S/A1) Sequence (5'—3')2)

SELPLG/G96A S aagccttAggtcccctgcttgcccgggacc

A ggggaccTaaggctttctcggcttcatctg

SELPLG/G1026A S tgctggcAgtccgcctctcccgcaagggcc

A ggcggacTgccagcaccacagtgcacacga

Selplg/G987A S ggtgctggcAgtccgtctgtcccgtaagac

A cagacggacTgccagcaccactgtgcacac

hmPSGL-1 S gcctccagaattgctgaaaaatgtcaccaa

A ttttcagcaattctggaggctccgtttctg 1) S, sense; A, antisense. 2) Substituted nucleotides are indicated by uppercase letters.


Supplementary Methods

Modification of plasmids. For directional cloning using a CpoI recognition site8, we

introduced a CpoI recognition-compatible (SanDI) site into the pEF6/V5-His-B plasmid

(Invitrogen). The BamHI-XmaI fragment of pcDNA3.1(+) (Invitrogen) was cloned into

pEF6/V5-His-B, followed by replacement of the BamHI-EcoRI fragment with an

oligonucleotide containing multiple cloning sites having the sequence 5'-

ggatcccggtccgggtcccggggaggtggaggtgactacaaggatgacgatgacaagtaacggtccggaattc-3'

(BamHI+CpoI+SanDI+gg+GGGG+Flag+Stop+CpoI+EcoRI) to produce pEF6-Flag-3S.

Because all cDNAs used in this study have a stop codon, a Flag tag was not fused to the

proteins.

Construction of expression plasmids. The SELPLG cDNA derived from Jurkat T cells

was amplified by polymerase chain reaction (PCR) from SELPLG-positive P3X63Ag8U.1

cells obtained from EV71-coated panning dishes. Following subcloning of SELPLG cDNA,

we introduced two substitutions (G96A and G1026A) that eliminate the internal SanDI and

CpoI sites, respectively. Then the SELPLG open reading frame (ORF) was cloned into

pEF6-Flag-3S to produce pEF-PSGL-1. The nucleotide sequence of the cloned SELPLG

ORF is identical to that of SELPLG in GenBank (Accession no. AY331789) except for the

G96A and G1026A substitutions.

The CD34 and SPN cDNAs, encoding the human hematopoietic progenitor cell

antigen CD34 and sialophorin (CD43), respectively, were amplified by PCR from the

cDNA of Jurkat T cells. The CD34 and SPN ORFs were cloned into pEF6-Flag-3S to

produce pEF-CD34 and pEF-CD43, respectively. The sequence of the cloned CD34 ORF is

same as that of the CD34 ORF (NM_001773). However, the sequence of the cloned SPN


ORF differs from the SPN ORF (NM_003123) at amino acid (aa) position 105, which

changes Val to Met. Although we cloned three SPN cDNAs by independent PCR, all the

clones had this mutation. Therefore, we used the SPN cDNA (V105M) for CD43

expression.

Mouse Selplg cDNA was amplified from the cDNA of P3X63Ag8U.1 cells. For

subcloning, we introduced a substitution (G987A) to eliminate an internal CpoI site. The

Selplg ORF was cloned into pEF6-Flag-3S to produce pEF-mPsgl-1. The sequence of the

cloned Selplg ORF is identical to that of Selplg (X91144) except for G987A. To produce

the chimeric PSGL-1, which contains aa 1–61 of human PSGL-1 and aa 63–397 of mouse

Psgl-1, we generated the chimeric cDNA by overlap extension PCR using pEF-PSGL-1 and

pEF-mPsgl-1 as templates. The chimeric ORF was cloned into pEF6-Flag-3S to produce

pEF-hmPSGL-1.


Supplementary Notes (References)

1. Schmidt, N.J., Lennette, E.H. & Ho, H.H. An apparently new enterovirus isolated from

patients with disease of the central nervous system. J. Infect. Dis. 129, 304–309 (1974).

2. Tagaya, I. & Tachibana, K. Epidemic of hand, foot and mouth disease in Japan,

1972–1973: difference in epidemiologic and virologic features from the previous one.

Jpn. J. Med. Sci. Biol. 28, 231–234 (1975).

3. Shimizu, H. et al. Enterovirus 71 from fatal and nonfatal cases of hand, foot and mouth

disease epidemics in Malaysia, Japan and Taiwan in 1997-1998. Jpn. J. Infect. Dis. 52,

12–15 (1999).

4. Shimizu, H. et al. Molecular epidemiology of enterovirus 71 infection in the Western

Pacific Region. Pediatr. Int. 46, 231–235 (2004).

5. Nagata, N. et al. Pyramidal and extrapyramidal involvement in experimental infection

of cynomolgus monkeys with enterovirus 71. J. Med. Virol. 67, 207–216 (2002).

6. Mizuta, K. et al. Frequent importation of enterovirus 71 from surrounding countries

into the local community of Yamagata, Japan, between 1998 and 2003. J. Clin.

Microbiol. 43, 6171–6175 (2005).

7. Herrero, L. J. et al. Molecular epidemiology of enterovirus 71 in peninsular Malaysia,

1997–2000. Arch. Virol. 148, 1369–1385 (2003).

8. Izumiya, Y. et al. Kaposi's sarcoma-associated herpesvirus K-bZIP is a coregulator of

K-Rta: physical association and promoter-dependent transcriptional repression. J. Virol.

77, 1441–1451 (2003).


Documents

Supplementary Information Human P-selectin glycoprotein ligand … · 2010-02-12 · PSGL-1-dependent CVA16-G10 replication in PSGL-1-positive cells. (a) Development of CPE (Phase)