30
1 Supplemental Data. Perera et al., (2008). Transgenic Arabidopsis plants expressing the type 1 inositol 5-phosphatase exhibit increased drought tolerance and altered ABA signaling Dry weight of roots (mg) Supplemental Figure 1. Comparison of root growth in drought stressed plants. Six week old plants grown in soil were subject to drought stress by withholding water for 8 days. At the end of the experiment, the roots were removed from the soil, dried and the dry weight was recorded. Data presented are the average ± SE of three independent experiments with 2-3 plants/line for each experiment. WT, wild type; C2, vector control; T6 and T8, two independent transgenic lines expressing InsP 5-ptase. 0 5 10 15 20 25 30 35 WT C2 T6 T8

Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

  • Upload
    others

  • View
    1

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

1

Supplemental Data. Perera et al., (2008). Transgenic Arabidopsis plants expressing the type 1 inositol 5-phosphatase exhibit increased drought tolerance and altered ABA signaling

Dry

wei

ght o

f roo

ts (m

g)

Supplemental Figure 1. Comparison of root growth in drought stressed plants. Six week old plants grown in soil were subject to drought stress by withholding water for 8 days. At the end of the experiment, the roots were removed from the soil, dried and the dry weight was recorded. Data presented are the average ± SE of three independent experiments with 2-3 plants/line for each experiment. WT, wild type; C2, vector control; T6 and T8, two independent transgenic lines expressing InsP 5-ptase.

0

5

10

15

20

25

30

35

WT C2 T6 T8

Page 2: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

2

Supplemental Figure 2: Detection of InsP 5-ptase protein in epidermal peels. Total protein was extracted from whole leaves or epidermal peel fragments and analyzed by SDS-PAGE and immunoblotting using an Anti-His tag antibody (Qiagen) as described previously (Perera et al., 2006).

Stained gel Immunoblot

L = whole leaf

P = epidermal peel

L P L P L P L PWT Tr WT Tr

75 KDa

37 KDa

50 KDa 45 KDa

Page 3: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

3

Supplemental Figure 3: Basal ABA levels in wild type and transgenic plants. ABA levels were measured in control unstressed leaf samples (Day 0 of the RWC time course shown in Figure 5). Data presented are the average ±

SE of 3 independent biological replicates/line. WT, wild type; C2, vector control and T6 and T8, two independent transgenic lines expressing InsP 5-ptase.

Basal ABA levels

00.5

11.5

22.5

33.5

44.5

5

WT C2 T6 T8

AB

A n

g/g

FW

Page 4: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

4

Supplemental Figure 4: Recovery of transgenic plants after re-watering. A. Wild type and InsP 5-ptase plants were photographed at different times during a RWC time course. After harvesting samples for measuring RWC and for RNA isolation, plants were re-watered and observed several days later (day 14) . B. RT-PCR of samples harvested during the RWC time course, using primers specific for RAB18, ERD1 and UBQ10.

UBQ10

ERD1

RAB18

Wild type Transgenic

Day 0 4 7 8 14 0 4 7 8 14

re-water re-water

B

A

Day 0 Day 7

Day 14Day 8

Day 0 Day 7

Day 14Day 8

Page 5: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

5

4A: Common all up > 2 fold

Supplemental Figure 5: Gene Ontology (GO) annotation for transcripts commonly up and down regulated (> 2 fold) with drought. GO annotation for the commonly up and down regulated transcripts was generated using the Gene Ontology at TAIR function at http://www.arabidopsis.org/tools/bulk/go/index.jsp

4B: Common all down > 2 fold

Page 6: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

Supplemental Table 1: Transcripts showing reduced basal expression in InsP 5-ptase plants compared to wild type and C2 (62 transcripts). Locus ID Fold

change p value Predicted function and gene name

At2g14610 -9.43 0.00120 pathogenesis-related protein 1 (PR-1) At2g26400 -9.17 0.00680 acireductone dioxygenase (ARD/ARD') family protein At2g18660 -9.15 0.01710 expansin family protein (EXPR3) At4g10500 -8.69 0.01430 "oxidoreductase, 2OG-Fe(II) oxygenase family protein" At1g75040 -6.54 0.00280 pathogenesis-related protein 5 (PR-5) At4g23150 -6.44 0.01060 protein kinase family protein At5g64000 -6.28 0.01340 "3'(2'),5'-bisphosphate nucleotidase, putative " At2g43570 -5.87 0.00100 "chitinase, putative" At1g14870 -5.51 0.02100 expressed protein At4g23310 -5.23 0.00320 "receptor-like protein kinase, putative" At3g57260 -5.23 0.00280 glycosyl hydrolase family 17 protein At4g21830 -4.67 0.00950 methionine sulfoxide reductase domain-containing protein / SeIR

domain-containing protein At4g00700 -4.66 0.01780 C2 domain-containing protein At4g04500 -4.53 0.04390 protein kinase family protein At1g35230 -4.53 0.01600 arabinogalactan-protein (AGP5) At4g23140 -4.28 0.00670 protein kinase family protein /// receptor-like protein kinase 5 (RLK5) At3g47480 -4.12 0.02440 calcium-binding EF hand family protein At1g33960 -4.12 0.02810 avirulence-responsive protein / avirulence induced gene (AIG1) At3g25010 -4.08 0.01230 disease resistance family protein At5g60800 -3.91 0.00890 heavy-metal-associated domain-containing protein At1g09080 -3.87 0.00640 luminal binding protein 3 (BiP-3) At5g64510 -3.82 0.00850 expressed protein At4g11890 -3.76 0.01000 protein kinase family protein At5g24530 -3.76 0.00980 "oxidoreductase, 2OG-Fe(II) oxygenase family protein" At3g60540 -3.57 0.00710 sec61beta family protein At4g21850 -3.44 0.00630 methionine sulfoxide reductase domain-containing protein / SeIR

domain-containing protein At2g32680 -3.32 0.01040 disease resistance family protein At3g09940 -3.31 0.01640 "monodehydroascorbate reductase, putative" At4g29520 -3.24 0.02910 expressed protein At5g46050 -3.13 0.02460 proton-dependent oligopeptide transport (POT) family protein At5g52740 -3.11 0.04310 heavy-metal-associated domain-containing protein At3g22600 -3.10 0.00910 protease inhibitor/seed storage/lipid transfer protein (LTP) family

protein At1g77510 -3.09 0.00350 "protein disulfide isomerase, putative" At2g04430 -3.00 0.00830 MutT/nudix family protein At1g66960 -2.81 0.00240 "lupeol synthase, putative / 2,3-oxidosqualene-triterpenoid cyclase,

putative" At2g30770 -2.75 0.02020 "cytochrome P450 71A13, putative (CYP71A13)" At5g55450 -2.72 0.04310 protease inhibitor/seed storage/lipid transfer protein (LTP) family

protein At4g25000 -2.70 0.00360 "alpha-amylase, putative / 1,4-alpha-D-glucan glucanohydrolase,

putative" At4g21120 -2.68 0.00720 amino acid permease family protein At2g30140 -2.67 0.00740 UDP-glucoronosyl/UDP-glucosyl transferase family protein At5g60950 -2.67 0.00180 phytochelatin synthetase-related At1g51890 -2.65 0.03740 "leucine-rich repeat protein kinase, putative" At1g61780 -2.58 0.03160 postsynaptic protein-related At4g16660 -2.57 0.01040 "heat shock protein 70, putative / HSP70, putative"

6

Page 7: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

7

At1g08050 -2.57 0.03860 zinc finger (C3HC4-type RING finger) family protein At3g54960 -2.50 0.00960 thioredoxin family protein At1g30900 -2.46 0.00280 "vacuolar sorting receptor, putative" At2g04450 -2.46 0.01480 MutT/nudix family protein At4g24920 -2.43 0.01090 "protein transport protein SEC61 gamma subunit, putative" At1g08450 -2.40 0.00530 calreticulin 3 (CRT3) At3g51860 -2.35 0.00090 "cation exchanger, putative (CAX3)" At3g11010 -2.34 0.01080 disease resistance family protein / LRR family protein At5g50200 -2.33 0.03090 expressed protein At3g18250 -2.32 0.00450 expressed protein At4g30500 -2.30 0.03180 expressed protein At4g39950 -2.25 0.02360 "cytochrome P450 79B2, putative (CYP79B2)" At5g10760 -2.23 0.02030 aspartyl protease family protein At3g49340 -2.18 0.02260 "cysteine proteinase, putative" At3g13790 -2.17 0.00000 beta-fructosidase (BFRUCT1) / beta-fructofuranosidase / cell wall

invertase At4g24190 -2.16 0.01730 "shepherd protein (SHD) / clavata formation protein, putative" At1g32960 -2.13 0.01550 subtilase family protein At5g50460 -2.07 0.00900 "protein transport protein SEC61 gamma subunit, putative"

Page 8: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

Supplemental Table 2: Transcripts showing increased basal expression in InsP 5-ptase plants compared to wild type and C2 (20 transcripts). Locus ID Fold

change P value Predicted function and gene name

At5g05410 3.20 0.0001 DRE-binding protein (DREB2A) At3g55940 2.47 0.0012 phosphoinositide-specific phospholipase C, putative (PLC7) At4g01080 2.46 0.0182 expressed protein At4g36010 2.46 0.0238 pathogenesis-related thaumatin family protein At4g17550 2.43 0.0291 transporter-related At4g35300 2.42 0.0634 transporter-related At2g36220 2.37 0.0188 expressed protein At1g09350 2.36 0.0231 galactinol synthase, putative (GolS3) At4g23600 2.25 0.0757 coronatine-responsive tyrosine aminotransferase / tyrosine

transaminase At1g56600 2.24 0.0857 galactinol synthase, putative (GolS2) At1g27200 2.22 0.0085 expressed protein At1g62570 2.13 0.0159 flavin-containing monooxygenase family protein / FMO family

protein At3g24520 2.10 0.0937 heat shock transcription factor family protein At1g60190 2.10 0.0805 armadillo/beta-catenin repeat family protein / U-box domain-

containing protein At1g76790 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing protein At3g50970 2.05 0.0756 dehydrin xero2 (XERO2) / low-temperature-induced protein

LTI30 (LTI30) At5g17170 2.03 0.0268 rubredoxin family protein At2g21940 2.03 0.0368 shikimate kinase, putative At2g45850 2.01 0.0356 DNA-binding family protein

8

Page 9: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

Supplemental Table 3: Transcripts up regulated (> 2 fold) with drought in WT and C2 only (244 trancripts).

Locus ID Fold change

p-value Predicted function and gene name

At2g36770 22.03 0.0008 UDP-glucoronosyl/UDP-glucosyl transferase family protein At3g60140 17.16 0.0039 glycosyl hydrolase family 1 protein At2g42560 15.06 0.0047 LEA domain-containing protein At4g19810 13.73 0.0182 glycosyl hydrolase family 18 protein At5g44310 10.05 0.0002 LEA domain-containing protein At5g66780 9.70 0.0074 expressed protein At1g01480 9.31 0.0019 1-aminocyclopropane-1-carboxylate synthase 2 (ACS2)

(ACC1) At4g31830 9.07 0.008 expressed protein At1g80160 8.90 0.0251 lactoylglutathione lyase family protein At2g37770 8.69 0.0193 aldo/keto reductase family protein At5g05220 8.43 0.001 expressed protein At2g01890 8.17 0.0034 "purple acid phosphatase, putative" At3g57020 8.14 0.0014 strictosidine synthase family protein At1g24600 7.64 0.0002 expressed protein At5g64310 6.71 0.042 arabinogalactan-protein (AGP1) At3g15760 6.43 0.0129 expressed protein At5g11520 6.36 0.001 aspartate aminotransferase (ASP3) (YLS4) At3g46230 6.22 0.0053 17.4 kDa class I heat shock protein (HSP17.4-CI) At5g51760 6.18 0.0011 "protein phosphatase 2C (PP2C), putative" At2g35300 6.17 0.0025 LEA group 1 domain-containing protein At2g36750 6.08 0.0006 UDP-glucoronosyl/UDP-glucosyl transferase family protein At2g29380 5.94 0.0321 "protein phosphatase 2C (PP2C), putative" At5g06370 5.73 0.0104 NC domain-containing protein At5g51680 5.72 0.0004 hydroxyproline-rich glycoprotein family protein At2g22470 5.39 0.0003 arabinogalactan-protein (AGP2) At3g49160 5.20 0.0273 pyruvate kinase family protein At4g00440 5.16 0.0113 expressed protein At2g03760 5.08 0.0173 "steroid sulfotransferase, putative" At2g33080 5.05 0.0007 leucine-rich repeat family protein At5g27520 4.98 0.005 mitochondrial substrate carrier family protein At1g44800 4.47 0.0005 nodulin MtN21 family protein At3g17810 4.44 0.0033 dihydroorotate dehydrogenase family protein / dihydroorotate

oxidase family protein At5g19855 4.39 0.0007 expressed protein At5g13360 4.38 0.0004 auxin-responsive GH3 family protein At4g20320 4.35 0.004 "CTP synthase, putative / UTP--ammonia ligase, putative" At5g67300 4.26 0.0215 myb family transcription factor At2g29450 4.21 0.0052 glutathione S-transferase (103-1A) At3g05890 4.20 0.006 low temperature and salt responsive protein (LTI6B) (RCI2B) At5g15240 4.18 0.0135 amino acid transporter family protein At3g46660 4.17 0.0218 UDP-glucoronosyl/UDP-glucosyl transferase family protein At4g21320 4.13 0.0374 (2R)-phospho-3-sulfolactate synthase-related At4g10040 4.07 0.0041 "cytochrome c, putative" At4g39140 4.01 0.0013 expressed protein At3g58570 4.00 0.0005 "DEAD box RNA helicase, putative" At1g53580 3.99 0.0013 "hydroxyacylglutathione hydrolase, putative " At3g09350 3.96 0.0148 armadillo/beta-catenin repeat family protein At5g13330 3.94 0.0026 AP2 domain-containing transcription factor family protein

Page 10: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At1g73220 3.93 0.0033 sugar transporter family protein At4g24220 3.86 0.0081 expressed protein At3g51130 3.85 0.0007 expressed protein At4g19040 3.84 0.0001 pleckstrin homology (PH) domain-containing protein At5g57910 3.83 0.0093 expressed protein At3g07700 3.82 0.0026 ABC1 family protein At1g06430 3.82 0.002 "FtsH protease, putative" At3g46670 3.76 0.0248 UDP-glucoronosyl/UDP-glucosyl transferase family protein At5g24080 3.75 0.0406 protein kinase family protein At1g68820 3.67 0.0021 "membrane protein, putative" At5g20000 3.65 0.0098 26S proteasome AAA-ATPase subunit (RPT6a) At4g36600 3.62 0.0012 LEA domain-containing protein At1g02390 3.59 0.0152 phospholipid/glycerol acyltransferase family protein At4g32870 3.59 0.0029 expressed protein At1g73880 3.58 0.0005 expressed protein At1g74740 3.57 0.0007 "calcium-dependent protein kinase, putative ( CDPK)" At4g25700 3.54 0.0006 beta-carotene hydroxylase At1g54130 3.52 0.0016 "RelA/SpoT protein, putative (RSH3)" At5g61810 3.51 0.0001 mitochondrial substrate carrier family protein At2g01850 3.49 0.0014 endo-xyloglucan transferase (EXGT-A3) At5g19440 3.48 0.0006 "cinnamyl-alcohol dehydrogenase, putative (CAD)" At4g19230 3.45 0.001 cytochrome P450 family protein At5g40390 3.41 0.0068 raffinose synthase family protein At3g27380 3.40 0.0084 succinate dehydrogenase (SDH2-1) At5g24030 3.36 0.0078 C4-dicarboxylate transporter/malic acid transport family

protein At2g14110 3.36 0.0053 expressed protein At4g21580 3.35 0.0049 "oxidoreductase, zinc-binding dehydrogenase family protein" At4g22260 3.33 0.0002 immutans protein (IM) At3g14660 3.32 0.0014 "cytochrome P450, putative" At3g06810 3.29 0.0005 acyl-CoA dehydrogenase-related At2g35730 3.28 0.0148 heavy-metal-associated domain-containing protein At5g43450 3.28 0.0099 "2-oxoglutarate-dependent dioxygenase, putative" At5g05110 3.26 0.0074 "cysteine protease inhibitor, putative " At5g26940 3.25 0.0003 exonuclease family protein At5g65210 3.24 0.003 bZIP family transcription factor (TGA1) At1g47128 3.24 0.0014 cysteine proteinase (RD21A) At1g76130 3.23 0.0166 "alpha-amylase, putative" At5g27150 3.23 0.0009 sodium proton exchanger / Na+/H+ antiporter (NHX1) At5g20910 3.21 0.0018 zinc finger (C3HC4-type RING finger) family protein At1g30620 3.19 0.0214 "UDP-D-xylose 4-epimerase, putative (MUR4)" At5g20380 3.18 0.0047 transporter-related At1g68140 3.17 0.0081 expressed protein At2g26830 3.15 0.0025 choline/ethanolamine kinase family protein At2g38820 3.15 0.0083 expressed protein At3g21790 3.14 0.0034 UDP-glucoronosyl/UDP-glucosyl transferase family protein At3g03620 3.13 0.0094 MATE efflux family protein At5g22470 3.13 0.0021 poly (ADP-ribose) polymerase family protein At4g31290 3.13 0.0005 ChaC-like family protein At1g30360 3.09 0.0124 early-responsive to dehydration stress protein (ERD4) At2g17680 3.08 0.0005 expressed protein At3g55840 3.07 0.0038 expressed protein At5g59290 3.06 0.0304 UDP-glucuronic acid decarboxylase (UXS3) At3g10370 3.05 0.0009 "glycerol-3-phosphate dehydrogenase, putative" At4g30200 3.04 0.0015 expressed protein At3g21670 3.02 0.002 nitrate transporter (NTP3)

Page 11: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At5g23540 3.01 0.0015 "26S proteasome regulatory subunit, putative" At1g54830 2.99 0.0046 "CCAAT-box binding transcription factor Hap5a, putative" At3g16800 2.99 0.0187 "protein phosphatase 2C (PP2C), putative" At2g21620 2.98 0.0006 universal stress protein (USP) family protein At2g45600 2.98 0 expressed protein At4g15490 2.98 0.0174 UDP-glucoronosyl/UDP-glucosyl transferase family protein At5g16760 2.95 0.0012 "inositol 1,3,4-trisphosphate 5/6-kinase" At5g13750 2.95 0.0221 transporter-related At5g22850 2.92 0.0002 aspartyl protease family protein At4g31750 2.92 0.0002 "protein phosphatase 2C (PP2C), putative" At1g31750 2.89 0.0486 proline-rich family protein At4g29380 2.88 0.0023 protein kinase family protein / WD-40 repeat family protein At4g35510 2.88 0.0032 expressed protein At1g02816 2.87 0.0086 expressed protein At1g69360 2.86 0.0002 expressed protein At2g31570 2.86 0.0083 "glutathione peroxidase, putative" At1g32400 2.84 0.002 senescence-associated family protein At3g05580 2.83 0.0491 "serine/threonine protein phosphatase, putative" At4g37790 2.82 0.0011 homeobox-leucine zipper protein 22 (HAT22) At2g35940 2.81 0.0067 homeodomain-containing protein At2g26150 2.80 0.0025 heat shock transcription factor family protein At1g32450 2.80 0.0035 proton-dependent oligopeptide transport (POT) family protein At1g21450 2.78 0.0159 scarecrow-like transcription factor 1 (SCL1) At1g08940 2.78 0.0009 phosphoglycerate/bisphosphoglycerate mutase family protein At3g05290 2.77 0.0132 mitochondrial substrate carrier family protein At3g07090 2.76 0.0048 expressed protein At5g07080 2.75 0.0253 transferase family protein At5g50100 2.75 0.0076 expressed protein At3g23000 2.75 0.0004 CBL-interacting protein kinase 7 (CIPK7) At3g11270 2.74 0.0015 "26S proteasome non-ATPase regulatory subunit 7, putative " At3g13784 2.73 0.0008 "beta-fructosidase, putative " At2g38480 2.73 0.0028 "integral membrane protein, putative" At3g17800 2.72 0.0081 expressed protein At3g54140 2.72 0.0047 proton-dependent oligopeptide transport (POT) family protein At2g02870 2.72 0.0033 kelch repeat-containing F-box family protein At3g47080 2.71 0.0065 expressed protein At3g53960 2.70 0.0138 proton-dependent oligopeptide transport (POT) family protein At1g15310 2.70 0.0092 signal recognition particle 54 kDa protein 1 (SRP-54) At3g51250 2.69 0.0004 senescence/dehydration-associated protein-related At4g13180 2.69 0.0098 short-chain dehydrogenase/reductase (SDR) family protein At4g03200 2.67 0.0004 expressed protein At2g38465 2.67 0.0103 expressed protein At5g54930 2.67 0.009 AT hook motif-containing protein At1g63010 2.66 0.0031 SPX (SYG1/Pho81/XPR1) domain-containing protein At3g14690 2.65 0.0012 "cytochrome P450, putative" At5g22510 2.64 0.0027 "beta-fructofuranosidase, putative " At5g16840 2.63 0.0002 RNA recognition motif (RRM)-containing protein At5g63880 2.63 0.002 SNF7 family protein At2g22420 2.63 0.0014 peroxidase 17 (PER17/P17) At2g40300 2.61 0.0075 "ferritin, putative" At4g12000 2.61 0.0079 expressed protein At1g33270 2.61 0.0012 patatin-related At1g50020 2.60 0.0027 expressed protein At5g62540 2.60 0.0048 ubiquitin-conjugating enzyme 3 (UBC3) At5g04850 2.60 0.0037 SNF7 family protein At2g47890 2.60 0.0004 zinc finger (B-box type) family protein

Page 12: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At1g79260 2.58 0.0019 expressed protein At3g14270 2.57 0.0031 phosphatidylinositol-4-phosphate 5-kinase family protein At1g60140 2.55 0.0369 glycosyl transferase family 20 protein / trehalose-phosphatase

family protein At1g69800 2.55 0.0061 CBS domain-containing protein At5g67180 2.54 0.022 "AP2 domain-containing transcription factor, putative (RAP2)" At3g21430 2.53 0.012 expressed protein At1g04780 2.53 0.0034 ankyrin repeat family protein At4g03430 2.52 0.0093 pre-mRNA splicing factor-related At5g05930 2.52 0.019 guanylyl cyclase-related (GC1) At1g54270 2.52 0.0005 eukaryotic translation initiation factor 4A-2 (eIF-4A-2) At4g24400 2.51 0.0055 CBL-interacting protein kinase 8 (CIPK8) At1g32100 2.50 0.0028 "pinoresinol-lariciresinol reductase, putative" At3g52850 2.50 0.0035 "vacuolar sorting receptor, putative (AtELP1)" At1g43620 2.50 0.0003 "UDP-glucose:sterol glucosyltransferase, putative" At5g01990 2.50 0.0036 auxin efflux carrier family protein At5g17190 2.49 0.0002 expressed protein At1g45150 2.49 0.0238 expressed protein At4g37320 2.49 0.0312 cytochrome P450 family protein At3g51960 2.49 0.0304 bZIP family transcription factor At4g13250 2.48 0.0008 short-chain dehydrogenase/reductase (SDR) family protein At1g44170 2.47 0.0014 "aldehyde dehydrogenase, putative (ALDH)" At5g58730 2.44 0.0459 pfkB-type carbohydrate kinase family protein At5g59845 2.44 0.001 gibberellin-regulated family protein At1g50630 2.44 0.0153 expressed protein At2g26740 2.44 0.002 "epoxide hydrolase, soluble (ATsEH) " At3g51895 2.43 0.0004 sulfate transporter (ST1) At3g56090 2.42 0.0115 "ferritin, putative" At5g04830 2.42 0.0042 expressed protein At3g03870 2.42 0.0106 expressed protein At4g11570 2.40 0.0171 haloacid dehalogenase-like hydrolase family protein At3g21760 2.40 0.0028 UDP-glucoronosyl/UDP-glucosyl transferase family protein At1g68490 2.39 0.0004 expressed protein At2g42540 2.38 0.0018 cold-responsive protein (cor15a) At3g50360 2.37 0.0008 caltractin / centrin At2g17560 2.36 0.0236 high mobility group protein gamma (HMGgamma) At5g58700 2.36 0.0009 phosphoinositide-specific phospholipase C family protein At1g01240 2.36 0.0173 expressed protein At3g03320 2.36 0.0161 expressed protein At4g33940 2.35 0.0114 zinc finger (C3HC4-type RING finger) family protein At5g62040 2.34 0.0006 brother of FT and TFL1 protein (BFT) At5g24800 2.34 0.0141 bZIP transcription factor family protein At1g16860 2.33 0.0035 merozoite surface protein-related At2g17530 2.33 0.0061 protein kinase family protein At3g11330 2.33 0.0004 leucine-rich repeat family protein At4g02940 2.33 0.0091 "oxidoreductase, 2OG-Fe(II) oxygenase family protein" At4g08290 2.32 0.0177 nodulin MtN21 family protein At1g28200 2.31 0.0191 GRAM domain-containing protein / ABA-responsive protein-

related At5g02420 2.30 0.0122 expressed protein At4g29070 2.29 0.0075 expressed protein At5g51740 2.29 0.0093 peptidase M48 family protein At4g37470 2.29 0.0319 "hydrolase, alpha/beta fold family protein" At5g58070 2.28 0 "lipocalin, putative" At5g15160 2.28 0.0057 bHLH family protein At4g09030 2.28 0.0082 arabinogalactan-protein (AGP10)

Page 13: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At3g19260 2.28 0.012 longevity-assurance (LAG1) family protein At2g16790 2.25 0.005 shikimate kinase family protein At4g01960 2.25 0.0112 expressed protein At2g03270 2.25 0.0005 "DNA-binding protein, putative" At5g49710 2.25 0.0181 expressed protein At3g11880 2.23 0.0009 expressed protein At3g62190 2.23 0.0278 DNAJ heat shock N-terminal domain-containing protein At5g57040 2.21 0.007 lactoylglutathione lyase family protein At1g14530 2.18 0.0119 "tobamovirus multiplication protein 3 (TOM3), putative

(THH1)" At1g58032 2.17 0.0008 amino acid permease family protein At5g09640 2.16 0.0185 sinapoylglucose:choline sinapoyltransferase (SNG2) At2g27830 2.16 0.0156 expressed protein At1g04960 2.16 0.0102 expressed protein At2g23980 2.16 0.0099 cyclic nucleotide-regulated ion channel (CNGC6) At3g53990 2.16 0.0023 universal stress protein (USP) family protein At2g38740 2.16 0.0054 haloacid dehalogenase-like hydrolase family protein At2g20320 2.15 0.0003 DENN (AEX-3) domain-containing protein At5g57350 2.14 0.0092 "ATPase 3, plasma membrane-type " At1g29760 2.13 0.0417 expressed protein At1g27385 2.12 0.0042 expressed protein At3g18280 2.09 0.0078 lipid transfer protein (LTP) family protein At1g54290 2.06 0.0199 "eukaryotic translation initiation factor SUI1, putative" At3g15790 2.06 0.0025 methyl-CpG-binding domain-containing protein At1g72820 2.05 0.0212 mitochondrial substrate carrier family protein At4g25450 2.05 0.0011 ABC transporter family protein At5g56190 2.04 0.0027 WD-40 repeat family protein At3g48000 2.03 0.0078 aldehyde dehydrogenase (ALDH2) At4g08180 2.03 0.0018 oxysterol-binding family protein At4g27780 2.03 0.0187 acyl-CoA binding protein 2 (ACBP2) At5g60160 2.02 0.0014 "aspartyl aminopeptidase, putative" At3g45300 2.02 0.0171 isovaleryl-CoA-dehydrogenase (IVD) At1g53590 2.01 0.0087 C2 domain-containing protein

Page 14: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

Supplemental Table 4: Transcripts up regulated with drought (>2 fold) in InsP 5-ptase plants only (4 transcripts).

Locus ID Fold change

p value predicted function and gene name

At5g52390 3.63 0.0337 photoassimilate-responsive protein, putative

At1g78000 2.26 0.001 sulfate transporter (Sultr1;2) At1g28400 2.23 0.0278 expressed protein At4g21910 2.05 0.019 MATE efflux family protein

14

Page 15: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

Supplemental Table 5: Trancripts down regulated (> 2 fold) with drought in WT and C2 only (183 trancripts).

Locus ID Fold change

p-value Predicted function and gene name

At5g60800 -5.19 0.0031 heavy-metal-associated domain-containing protein At4g14540 -5.14 0.0073 CCAAT-box binding transcription factor subunit B (NF-YB) (HAP3 )

(AHAP3) family At5g42070 -4.78 0.0007 expressed protein At4g12390 -4.65 0.0183 invertase/pectin methylesterase inhibitor family protein At1g68590 -4.64 0.0133 "plastid-specific 30S ribosomal protein 3, putative " At1g65190 -4.62 0.0036 protein kinase family protein At1g29910 -4.46 0.0178 chlorophyll A-B binding protein 2 (CAB2) At3g15530 -4.45 0.0086 expressed protein At2g41950 -4.42 0.0325 expressed protein At1g33960 -4.12 0.0084 avirulence-responsive protein (AIG1) At2g07180 -4.11 0.0031 "protein kinase, putative" At2g04450 -4.11 0.0038 MutT/nudix family protein At1g29430 -4.04 0.0023 auxin-responsive family protein At4g23400 -4.02 0.0052 major intrinsic family protein At3g48730 -3.99 0.0047 "glutamate-1-semialdehyde 2,1-aminomutase 2 (GSA 2) " At5g17870 -3.97 0.0256 plastid-specific ribosomal protein-related At5g53880 -3.97 0.0139 expressed protein At4g29060 -3.90 0.0067 elongation factor Ts family protein At2g32400 -3.90 0.0084 glutamate receptor family protein (GLR3.7) (GLR5) At1g21590 -3.87 0.017 protein kinase family protein At3g18920 -3.83 0.0119 zinc finger (C3HC4-type RING finger) family protein At1g13750 -3.82 0.0095 calcineurin-like phosphoesterase family protein At4g04890 -3.73 0.006 homeobox-leucine zipper protein protodermal factor 2 (PDF2) At5g62840 -3.69 0.0123 phosphoglycerate/bisphosphoglycerate mutase family protein At1g05570 -3.67 0.0004 callose synthase 1 (CALS1) At3g19400 -3.60 0.011 "cysteine proteinase, putative" At3g59760 -3.59 0.0004 "cysteine synthase, putative " At4g34090 -3.56 0.0036 expressed protein At5g10380 -3.54 0.0053 zinc finger (C3HC4-type RING finger) family protein At1g23360 -3.52 0.0049 UbiE/COQ5 methyltransferase family protein At1g67090 -3.50 0.0259 ribulose bisphosphate carboxylase small chain 1A (RBCS-1A)

(ATS1A) At2g30150 -3.50 0.0013 UDP-glucoronosyl/UDP-glucosyl transferase family protein At4g09550 -3.50 0.0102 expressed protein At3g24570 -3.49 0 peroxisomal membrane 22 kDa family protein At3g02180 -3.45 0.0127 expressed protein At1g50900 -3.39 0.022 expressed protein At3g62110 -3.39 0.0022 glycoside hydrolase family 28 protein At2g37860 -3.38 0.0057 expressed protein At3g51450 -3.38 0.0166 strictosidine synthase family protein At5g18170 -3.38 0.0023 glutamate dehydrogenase 1 (GDH1) At5g61660 -3.37 0.0056 glycine-rich protein At5g44520 -3.33 0.0174 ribose 5-phosphate isomerase-related At1g21050 -3.31 0.0071 expressed protein At2g17830 -3.31 0.0042 F-box family protein At5g16150 -3.30 0.0032 "hexose transporter, putative" At1g11440 -3.30 0.0027 expressed protein At1g55670 -3.28 0.0155 photosystem I reaction center subunit V (PSAG) At4g36150 -3.21 0.011 "disease resistance protein (TIR-NBS-LRR class), putative"

Page 16: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At2g24060 -3.19 0.0059 translation initiation factor 3 (IF-3) family protein At2g27810 -3.18 0.0123 xanthine/uracil permease family protein At1g77210 -3.15 0.001 "sugar transporter, putative" At3g14220 -3.15 0.023 GDSL-motif lipase/hydrolase family protein At2g26730 -3.15 0.0156 "leucine-rich repeat transmembrane protein kinase, putative" At4g01150 -3.14 0.0105 expressed protein At1g78210 -3.14 0.0003 "hydrolase, alpha/beta fold family protein" At2g37660 -3.14 0.003 expressed protein At2g33530 -3.11 0.0076 serine carboxypeptidase S10 family protein At1g08380 -3.11 0.0205 expressed protein At5g48220 -3.09 0.0056 "indole-3-glycerol phosphate synthase, putative (IGPS)" At4g28706 -3.09 0.0025 pfkB-type carbohydrate kinase family protein At5g32450 -3.08 0.0119 RNA recognition motif (RRM)-containing protein At1g66920 -3.07 0.0153 "serine/threonine protein kinase, putative" At3g21950 -3.07 0.0115 S-adenosyl-L-methionine:carboxyl methyltransferase family protein At5g64460 -3.06 0.0226 expressed protein At3g11500 -3.05 0.0008 "small nuclear ribonucleoprotein G, putative" At2g35780 -3.04 0.0108 serine carboxypeptidase S10 family protein At1g19710 -3.03 0.014 glycosyl transferase family 1 protein At3g23700 -3.03 0.0212 S1 RNA-binding domain-containing protein At3g61820 -3.02 0.0221 aspartyl protease family protein At4g20360 -3.00 0.0131 elongation factor Tu (TUFA) At2g04430 -3.00 0.0041 MutT/nudix family protein At1g70660 -2.98 0.0138 ubiquitin-conjugating enzyme family protein At3g54960 -2.97 0.0013 thioredoxin family protein At5g49555 -2.97 0.0141 amine oxidase-related At2g34680 -2.96 0.0133 leucine-rich repeat family protein At5g10450 -2.96 0.0018 14-3-3 protein GF14 lambda (GRF6) (AFT1) At1g60660 -2.92 0.0022 cytochrome b5 domain-containing protein At1g11300 -2.92 0.0068 S-locus lectin protein kinase family protein At2g37130 -2.92 0.0041 peroxidase 21 (PER21) (P21) (PRXR5) (ATP2a) At2g29180 -2.90 0.0012 expressed protein At5g67280 -2.89 0.0309 "leucine-rich repeat transmembrane protein kinase, putative" At1g70760 -2.89 0.0206 inorganic carbon transport protein-related At2g26240 -2.86 0.0126 expressed protein At3g50920 -2.85 0.0048 phosphatidic acid phosphatase-related At5g55230 -2.85 0.026 microtubule associated protein (MAP65/ASE1) family protein At3g10525 -2.85 0.0233 expressed protein At3g66658 -2.84 0.0098 "betaine-aldehyde dehydrogenase, putative" At1g27480 -2.83 0.0403 lecithin:cholesterol acyltransferase family protein At5g16130 -2.82 0.0149 40S ribosomal protein S7 (RPS7C) At4g19540 -2.81 0.0089 expressed protein At1g74430 -2.80 0.0109 myb family transcription factor (MYB95) At2g35880 -2.80 0.0355 expressed protein At1g72500 -2.78 0.0201 inter-alpha-trypsin inhibitor heavy chain-related At3g25530 -2.78 0.0065 6-phosphogluconate dehydrogenase NAD-binding domain-containing

protein At2g41770 -2.77 0.0101 expressed protein At3g12290 -2.76 0.0124 "tetrahydrofolate dehydrogenase/cyclohydrolase, putative" At5g65020 -2.75 0.0405 annexin 2 (ANN2) At1g09210 -2.75 0.008 calreticulin 2 (CRT2) At4g22756 -2.75 0.0235 sterol desaturase family protein At3g19930 -2.73 0.001 sugar transport protein (STP4) At3g63410 -2.70 0.0062 "chloroplast inner envelope membrane protein, putative (APG1)" At5g42240 -2.69 0.0271 serine carboxypeptidase S10 family protein At5g18650 -2.67 0.0078 zinc finger (C3HC4-type RING finger) family protein

Page 17: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At1g18910 -2.67 0.0034 zinc finger (C3HC4-type RING finger) family protein At4g23570 -2.66 0.006 phosphatase-related At2g32520 -2.66 0.0008 dienelactone hydrolase family protein At3g17040 -2.66 0.0178 tetratricopeptide repeat (TPR)-containing protein At5g12860 -2.66 0.0076 "oxoglutarate/malate translocator, putative" At1g26150 -2.65 0.0085 protein kinase family protein At4g28750 -2.65 0.0079 photosystem I reaction center subunit IV (PSAE1) At2g33860 -2.62 0.0295 auxin-responsive factor (ARF3) / ETTIN protein (ETT) At2g38330 -2.62 0.0085 MATE efflux family protein At4g26900 -2.61 0.0054 imidazole glycerol phosphate synthase hisHF At5g57930 -2.60 0.0035 expressed protein At5g02410 -2.60 0.0093 DIE2/ALG10 family At1g05385 -2.60 0.0103 photosystem II 11 kDa protein-related At2g41560 -2.59 0.008 calcium-transporting ATPase 4 (ACA4) At1g62750 -2.59 0.0266 elongation factor Tu family protein At2g44050 -2.58 0.0194 riboflavin synthase At1g15930 -2.57 0.0144 40S ribosomal protein S12 (RPS12A) At2g42770 -2.56 0.0042 peroxisomal membrane 22 kDa family protein At5g13000 -2.56 0.0362 glycosyl transferase family 48 protein At2g40600 -2.55 0.0056 appr-1-p processing enzyme family protein At2g27040 -2.54 0.0043 PAZ domain-containing protein At3g13110 -2.54 0.0087 serine O-acetyltransferase (SAT-1) At4g22890 -2.53 0.0216 expressed protein At5g19930 -2.53 0.0008 integral membrane family protein At1g58080 -2.51 0.0173 ATP phosphoribosyl transferase 1 (ATP-PRT1) At5g07360 -2.50 0.0025 amidase family protein At5g13980 -2.48 0.0157 glycosyl hydrolase family 38 protein At3g54890 -2.48 0.0039 chlorophyll A-B binding protein (CAB) At1g14380 -2.48 0.0024 calmodulin-binding family protein At1g66980 -2.47 0.0325 protein kinase family protein At3g25660 -2.45 0.0083 "glutamyl-tRNA(Gln) amidotransferase, putative" At1g20840 -2.45 0.0202 transporter-related At1g28440 -2.45 0.0367 "leucine-rich repeat transmembrane protein kinase, putative" At5g48830 -2.45 0.0165 expressed protein At1g56505 -2.44 0.015 haloacid dehalogenase-like hydrolase family protein At5g62670 -2.43 0.0134 "ATPase, plasma membrane-type, putative" At3g26320 -2.42 0.0001 "cytochrome P450 71B36, putative (CYP71B36)" At5g65700 -2.40 0.0149 "leucine-rich repeat transmembrane protein kinase, putative" At1g56340 -2.39 0.0105 calreticulin 1 (CRT1) At3g58700 -2.39 0.0271 60S ribosomal protein L11 (RPL11B) At3g19480 -2.38 0.0439 D-3-phosphoglycerate dehydrogenase At3g48420 -2.37 0.0073 haloacid dehalogenase-like hydrolase family protein At5g52650 -2.37 0.0178 40S ribosomal protein S10 (RPS10C) At1g78290 -2.37 0.0036 "serine/threonine protein kinase, putative" At4g11010 -2.35 0.0307 nucleoside diphosphate kinase 3 (NDK3) At5g15050 -2.35 0.0439 glycosyltransferase family 14 protein At1g01630 -2.35 0.0124 "SEC14 cytosolic factor, putative" At4g12800 -2.34 0.0036 photosystem I reaction center subunit XI (PSI-L) At5g07460 -2.34 0.0078 "peptide methionine sulfoxide reductase, putative" At1g57660 -2.33 0.0127 60S ribosomal protein L21 (RPL21E) At2g43920 -2.33 0.0322 "thiol methyltransferase, putative " At2g33600 -2.31 0.0314 cinnamoyl-CoA reductase family At5g27400 -2.31 0.0406 expressed protein At2g42320 -2.31 0.0214 nucleolar protein gar2-related At4g28100 -2.30 0.0151 expressed protein At5g06610 -2.29 0.0401 expressed protein

Page 18: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At4g30930 -2.28 0.0223 "50S ribosomal protein L21, mitochondrial (RPL21M)" At2g20930 -2.26 0.0074 expressed protein At3g52430 -2.25 0.0174 phytoalexin-deficient 4 protein (PAD4) At3g62750 -2.25 0.0024 glycosyl hydrolase family 1 protein At5g35630 -2.24 0.005 glutamine synthetase (GS2) At3g59980 -2.23 0.0202 tRNA-binding region domain-containing protein At1g13250 -2.23 0.0194 glycosyl transferase family 8 protein At5g16070 -2.22 0.0262 "chaperonin, putative" At1g80640 -2.22 0.0413 protein kinase family protein At5g57490 -2.22 0.0045 "porin, putative" At1g31420 -2.20 0.0349 "leucine-rich repeat transmembrane protein kinase, putative" At5g10290 -2.19 0.0002 leucine-rich repeat family protein / protein kinase family protein At4g19710 -2.17 0.0396 "bifunctional aspartate kinase/homoserine dehydrogenase, putative" At3g57030 -2.17 0.0468 strictosidine synthase family protein At1g26100 -2.16 0.0141 cytochrome B561 family protein At4g00150 -2.15 0.0101 scarecrow-like transcription factor 6 (SCL6) At3g12780 -2.15 0.0067 "phosphoglycerate kinase, putative" At5g17670 -2.14 0.0107 expressed protein At5g28500 -2.13 0.0054 expressed protein At4g25960 -2.13 0.0389 "multidrug resistance P-glycoprotein, putative" At4g30400 -2.13 0.0362 zinc finger (C3HC4-type RING finger) family protein At1g71920 -2.12 0.0208 "histidinol-phosphate aminotransferase, putative" At5g65440 -2.12 0.0058 expressed protein At1g56500 -2.11 0.0049 haloacid dehalogenase-like hydrolase family protein

Page 19: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

Supplemental Table 6: Trancripts down regulated with drought (>2 fold) in InsP 5-ptase plants only (22 transcripts).

Locus ID Fold change

p value Predicted function and gene name

At4g16260 -4.68 0.01160 glycosyl hydrolase family 17 protein At3g26210 -4.55 0.00810 cytochrome P450 71B23, putative (CYP71B23) At5g26920 -3.87 0.02920 calmodulin-binding protein At1g17420 -3.58 0.01300 lipoxygenase, putative At1g01560 -2.99 0.03560 mitogen-activated protein kinase, putative / MAPK, putative

(MPK11) At1g01390 -2.78 0.00210 UDP-glucoronosyl/UDP-glucosyl transferase family protein At4g02420 -2.75 0.01200 lectin protein kinase, putative At1g19450 -2.58 0.01730 integral membrane protein, putative / sugar transporter family

protein At1g18740 -2.52 0.02870 expressed protein At1g18010 -2.48 0.00480 expressed protein At3g15570 -2.47 0.01950 phototropic-responsive NPH3 family protein At3g46600 -2.39 0.03920 scarecrow transcription factor family protein At2g39650 -2.34 0.04640 expressed protein At4g32800 -2.32 0.04440 AP2 domain-containing transcription factor TINY, putative At5g58120 -2.27 0.04090 disease resistance protein (TIR-NBS-LRR class), putative At5g04930 -2.22 0.00050 phospholipid-transporting ATPase 1 / aminophospholipid flippase

1 / magnesium-ATPase 1 (ALA1) At4g27652 -2.19 0.04920 expressed protein At5g14120 -2.19 0.01690 nodulin family protein At5g37770 -2.19 0.01250 touch-responsive protein / calmodulin-related protein 2, touch-

induced (TCH2) At2g22500 -2.18 0.02380 mitochondrial substrate carrier family protein At4g23820 -2.16 0.01970 glycoside hydrolase family 28 protein / polygalacturonase

(pectinase) family protein At1g20823 -2.14 0.04610 zinc finger (C3HC4-type RING finger) family protein

19

Page 20: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

Supplemental Table 7: Trancripts commonly up regulated (> 2fold) with drought (219 trancripts).

Locus ID Wt fold change

p-value T8 fold change

p-value Predicted function and gene name

At1g52690 318.71 0.0019 106.05 0.0024 "late embryogenesis abundant protein, putative" At5g52300 166.23 0.0002 125.81 0.0003 desiccation-responsive protein 29B

(RD29B)(LTI65) At2g47770 107.36 0.0009 44.23 0.0015 benzodiazepine receptor-related At5g59310 83.57 0.0003 25.12 0.0074 lipid transfer protein 4 (LTP4) At5g59220 82.81 0.0009 38.01 0.0004 "protein phosphatase 2C, putative " At5g66400 70.81 0.0000 41.38 0.0005 dehydrin (RAB18) At1g22990 64.80 0.0016 6.47 0.0124 heavy-metal-associated domain-containing

protein At4g33150 60.51 0.0001 33.22 0.0031 lysine-ketoglutarate reductase/saccharopine

dehydrogenase bifunctional enzyme At5g06760 55.54 0.0002 26.38 0.0011 late embryogenesis abundant group 1 domain-

containing protein At4g15910 50.58 0.0001 34.16 0.0025 drought-responsive protein (Di21) At5g01300 44.63 0.0009 24.35 0.0046 phosphatidylethanolamine-binding family

protein At1g64110 39.42 0.0001 20.36 0.0021 AAA-type ATPase family protein At3g53980 39.18 0.0077 20.37 0.0006 lipid transfer protein (LTP) family protein At3g22840 38.87 0.0023 8.46 0.0372 chlorophyll A-B binding family protein (ELIP) At3g12580 37.35 0.0002 12.07 0.0096 "heat shock protein 70, putative " At1g77120 36.36 0.0000 18.48 0.0079 alcohol dehydrogenase (ADH) At3g57520 34.58 0.0002 9.81 0.0025 "alkaline alpha galactosidase, putative" At5g22460 34.04 0.0137 6.66 0.0132 esterase/lipase/thioesterase family protein At2g41190 33.21 0.0004 15.22 0.0065 amino acid transporter family protein At1g02310 30.51 0.0021 12.54 0.0119 "glycosyl hydrolase family protein 5, putative" At5g50360 28.98 0.0001 16.06 0.0006 expressed protein At2g21590 28.08 0.0000 19.78 0.0025 "glucose-1-phosphate adenylyltransferase large

subunit, putative " At1g69260 26.49 0.0008 17.19 0.0007 expressed protein At2g21820 26.43 0.0041 14.89 0.0014 expressed protein At4g24000 24.65 0.0005 10.18 0.0044 cellulose synthase family protein At2g37870 24.27 0.0004 19.24 0.0020 lipid transfer protein (LTP) family protein At1g64660 24.13 0.0009 22.48 0.0008 Cys/Met metabolism pyridoxal-phosphate-

dependent enzyme family protein At3g13672 24.00 0.0005 14.24 0.0002 seven in absentia (SINA) family protein At5g53870 23.34 0.0002 15.00 0.0013 plastocyanin-like domain-containing protein At5g13170 23.26 0.0041 8.74 0.0017 nodulin MtN3 family protein At1g68500 22.96 0.0002 13.36 0.0026 expressed protein At4g17030 21.08 0.0008 16.23 0.0015 expansin-related At1g17020 20.91 0.0001 6.63 0.0352 "oxidoreductase, 2OG-Fe(II) oxygenase family

protein" At2g29460 20.82 0.0026 10.60 0.0262 "glutathione S-transferase, putative" At5g15190 20.80 0.0001 16.05 0.0006 expressed protein At1g17870 20.08 0.0005 8.20 0.0096 expressed protein At5g37540 19.63 0.0001 5.97 0.0061 aspartyl protease family protein At1g07430 18.67 0.0008 7.60 0.0025 "protein phosphatase 2C (PP2C), putative" At1g52890 17.38 0.0026 8.80 0.0052 no apical meristem (NAM) family protein At1g16850 16.71 0.0001 9.08 0.0028 expressed protein At4g33905 16.68 0.0009 7.89 0.0071 "peroxisomal membrane protein 22 kDa,

putative" At3g28007 16.43 0.0003 8.38 0.0050 nodulin MtN3 family protein

Page 21: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At2g46680 16.17 0.0033 12.94 0.0008 homeobox-leucine zipper protein 7 (HB-7) At4g33550 15.57 0.0000 7.40 0.0044 lipid transfer protein (LTP) family protein At1g77450 15.18 0.0011 8.39 0.0083 no apical meristem (NAM) family protein At3g24520 14.18 0.0013 6.50 0.0005 heat shock transcription factor family protein At3g55910 13.96 0.0016 6.32 0.0046 expressed protein At1g74020 13.88 0.0038 3.12 0.0411 strictosidine synthase family protein At4g03820 13.71 0.0020 4.54 0.0016 expressed protein At1g72770 13.40 0.0000 6.41 0.0002 protein phosphatase 2C P2C-HA (P2C-HA) At4g27410 13.33 0.0025 6.63 0.0258 no apical meristem (NAM) family protein

(RD26) At3g23920 13.02 0.0013 3.24 0.0000 "beta-amylase, putative " At2g20560 12.56 0.0004 5.06 0.0062 DNAJ heat shock family protein At3g61890 12.42 0.0002 7.50 0.0006 homeobox-leucine zipper protein 12 (HB-12) At2g34810 12.37 0.0002 4.91 0.0088 FAD-binding domain-containing protein At3g05400 12.31 0.0009 8.69 0.0027 "sugar transporter, putative" At1g71000 12.26 0.0054 6.91 0.0260 DNAJ heat shock N-terminal domain-

containing protein At2g34850 12.07 0.0006 5.38 0.0021 NAD-dependent epimerase/dehydratase family

protein At3g53230 12.03 0.0000 5.51 0.0073 "cell division cycle protein 48, putative " At1g62570 11.97 0.0002 4.84 0.0007 flavin-containing monooxygenase family

protein At5g04250 11.84 0.0006 4.82 0.0029 OTU-like cysteine protease family protein At4g35560 11.56 0.0002 6.23 0.0012 expressed protein At3g20300 11.53 0.0018 3.97 0.0040 expressed protein At5g25110 11.42 0.0024 5.26 0.0088 CBL-interacting protein kinase 25 (CIPK25) At3g50970 11.40 0.0008 5.47 0.0040 dehydrin xero2 (XERO2) (LTI30) At1g07720 10.88 0.0000 3.41 0.0087 beta-ketoacyl-CoA synthase family protein At5g39610 10.68 0.0192 5.97 0.0176 no apical meristem (NAM) family protein At2g39050 10.58 0.0023 3.88 0.0022 hydroxyproline-rich glycoprotein family

protein At5g11110 10.55 0.0008 4.90 0.0112 "sucrose-phosphate synthase, putative" At2g37040 10.54 0.0045 6.22 0.0143 phenylalanine ammonia-lyase 1 (PAL1) At3g49210 10.32 0.0022 6.62 0.0050 expressed protein At1g07500 10.23 0.0053 4.43 0.0171 expressed protein At5g57050 10.19 0.0002 5.32 0.0054 protein phosphatase 2C (PP2C) (ABI2) At4g03320 9.88 0.0012 4.99 0.0402 chloroplast protein import component-related At3g55940 9.60 0.0001 3.10 0.0004 "phosphoinositide-specific phospholipase C,

putative" At1g51140 9.48 0.0000 3.56 0.0063 basic helix-loop-helix (bHLH) family protein At1g79900 9.37 0.0170 5.56 0.0057 mitochondrial substrate carrier family protein At5g47550 9.32 0.0007 8.48 0.0002 "cysteine protease inhibitor, putative " At4g34710 9.19 0.0001 3.70 0.0127 arginine decarboxylase 2 (SPE2) At5g10300 9.11 0.0090 4.67 0.0213 "hydrolase, alpha/beta fold family protein" At4g32250 9.05 0.0002 3.04 0.0054 protein kinase family protein At5g01600 9.01 0.0071 4.31 0.0045 ferritin 1 (FER1) At5g53710 8.97 0.0025 7.01 0.0006 expressed protein At1g60190 8.92 0.0022 3.62 0.0009 armadillo/beta-catenin repeat family protein At5g01520 8.86 0.0006 3.80 0.0009 zinc finger (C3HC4-type RING finger) family

protein At5g62150 8.79 0.0293 6.53 0.0014 peptidoglycan-binding LysM domain-

containing protein At4g34230 8.78 0.0003 5.49 0.0039 "cinnamyl-alcohol dehydrogenase, putative" At1g09530 8.65 0.0004 5.83 0.0019 phytochrome interacting factor 3 (PIF3) At3g11410 8.49 0.0000 4.28 0.0006 "protein phosphatase 2C, putative " At2g33590 8.23 0.0008 4.42 0.0032 cinnamoyl-CoA reductase family

Page 22: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At2g47780 8.23 0.0001 8.07 0.0001 rubber elongation factor (REF) protein-related At2g33380 8.16 0.0009 2.49 0.0083 calcium-binding RD20 protein (RD20) At5g65280 7.96 0.0023 6.56 0.0010 lanthionine synthetase C-like family protein At4g32920 7.92 0.0011 4.71 0.0033 glycine-rich protein At5g20830 7.90 0.0020 3.12 0.0180 sucrose synthase (SUS1) At4g22820 7.88 0.0002 4.23 0.0032 zinc finger (AN1-like) family protein At1g04220 7.81 0.0015 5.31 0.0004 "beta-ketoacyl-CoA synthase, putative" At1g52080 7.77 0.0004 3.14 0.0049 actin binding protein family At2g30490 7.73 0.0019 3.38 0.0206 cytochrome P450 73 (CYP73) (CYP73A5) At3g14360 7.52 0.0023 4.06 0.0048 lipase class 3 family protein At4g30490 7.51 0.0014 3.99 0.0100 AFG1-like ATPase family protein At3g17000 7.38 0.0002 2.67 0.0033 "ubiquitin-conjugating enzyme, putative" At1g58360 7.27 0.0062 2.86 0.0062 amino acid permease I (AAP1) At1g28330 7.24 0.0045 5.94 0.0043 "dormancy-associated protein, putative

(DRM1)" At1g58270 7.22 0.0000 4.94 0.0001 meprin and TRAF homology domain-

containing protein At1g07040 7.17 0.0000 3.56 0.0104 expressed protein At1g08630 7.14 0.0010 5.46 0.0103 L-allo-threonine aldolase-related At2g25620 7.14 0.0038 3.91 0.0137 "protein phosphatase 2C, putative " At2g28400 7.11 0.0010 3.31 0.0371 expressed protein At1g53910 6.81 0.0034 2.59 0.0091 AP2 domain-containing protein RAP2.12

(RAP2.12) At5g24120 6.80 0.0006 2.40 0.0022 RNA polymerase sigma subunit SigE (sigE) /

sigma-like factor (SIG5) At5g47560 6.78 0.0002 4.02 0.0014 "sodium/dicarboxylate cotransporter, putative" At4g10960 6.78 0.0007 2.86 0.0101 "UDP-glucose 4-epimerase, putative" At1g21790 6.74 0.0027 2.90 0.0043 expressed protein At5g64080 6.72 0.0007 4.80 0.0209 lipid transfer protein (LTP) family protein At3g48020 6.53 0.0037 3.99 0.0042 expressed protein At5g23750 6.35 0.0029 4.14 0.0043 remorin family protein At3g29575 6.35 0.0003 4.90 0.0011 expressed protein At3g20250 6.17 0.0001 3.82 0.0037 pumilio/Puf RNA-binding domain-containing

protein At5g48180 6.17 0.0016 2.43 0.0089 kelch repeat-containing protein At5g66760 6.17 0.0003 2.90 0.0482 succinate dehydrogenase (ubiquinone)

flavoprotein subunit At1g78610 6.11 0.0010 4.39 0.0016 mechanosensitive ion channel domain-

containing protein At5g47020 5.97 0.0002 3.51 0.0102 glycine-rich protein At2g42790 5.94 0.0012 3.03 0.0030 "citrate synthase, glyoxysomal, putative" At1g57590 5.94 0.0002 2.84 0.0014 "pectinacetylesterase, putative" At4g24960 5.94 0.0002 2.79 0.0008 ABA-responsive protein (HVA22d) At1g11170 5.87 0.0007 3.32 0.0082 expressed protein At1g76590 5.85 0.0009 2.56 0.0038 zinc-binding family protein At1g70300 5.83 0.0005 3.68 0.0037 "potassium transporter, putative" At2g04240 5.82 0.0003 5.98 0.0003 zinc finger (C3HC4-type RING finger) family

protein At5g54160 5.80 0.0002 3.45 0.0037 quercetin 3-O-methyltransferase 1 (OMT1) At3g03170 5.79 0.0315 4.31 0.0069 expressed protein At4g04020 5.79 0.0066 2.01 0.0018 "plastid-lipid associated protein PAP, putative " At1g54100 5.74 0.0043 4.26 0.0018 "aldehyde dehydrogenase, putative" At4g35790 5.72 0.0000 3.39 0.0028 phospholipase D delta (PLDDELTA) At5g59320 5.67 0.0106 4.08 0.0247 lipid transfer protein 3 (LTP3) At3g25290 5.65 0.0019 2.66 0.0183 auxin-responsive family protein At3g44880 5.62 0.0001 2.72 0.0084 Rieske (2Fe-2S) domain-containing protein

Page 23: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At4g23450 5.43 0.0063 3.27 0.0125 zinc finger (C3HC4-type RING finger) family protein

At4g30460 5.40 0.0086 2.93 0.0021 glycine-rich protein At1g21410 5.35 0.0005 2.03 0.0124 F-box family protein At2g23000 5.32 0.0034 4.18 0.0101 serine carboxypeptidase S10 family protein At1g69610 5.32 0.0012 2.53 0.0230 expressed protein At5g65110 5.32 0.0027 3.47 0.0109 acyl-CoA oxidase (ACX2) At5g51070 5.29 0.0015 2.78 0.0075 "ATP-dependent Clp protease ATP-binding

subunit (ClpD), (ERD1)" At3g54680 5.27 0.0023 3.11 0.0047 proteophosphoglycan-related At1g68050 5.23 0.0005 4.55 0.0108 F-box family protein (FKF1) / adagio 3

(ADO3) At3g62590 5.21 0.0090 3.24 0.0005 lipase class 3 family protein At4g17550 5.21 0.0062 2.42 0.0002 transporter-related At1g27200 5.17 0.0007 2.68 0.0010 expressed protein At5g11090 5.15 0.0005 3.08 0.0170 serine-rich protein-related At3g15350 5.13 0.0000 3.49 0.0028 glycosyltransferase family 14 protein At2g35070 5.12 0.0072 2.76 0.0034 expressed protein At1g21400 5.11 0.0020 3.44 0.0022 dehydrogenase E1 component family protein At1g62620 5.07 0.0004 2.92 0.0033 flavin-containing monooxygenase family

protein At5g23050 5.04 0.0036 5.64 0.0010 acyl-activating enzyme 17 (AAE17) At1g54160 5.03 0.0000 2.97 0.0023 CCAAT-binding transcription factor (CBF-

B/NF-YA) family protein At3g62660 4.97 0.0002 2.90 0.0075 glycosyl transferase family 8 protein At2g46270 4.97 0.0029 4.01 0.0023 G-box binding factor 3 (GBF3) At3g14560 4.95 0.0062 4.40 0.0003 expressed protein At1g21460 4.85 0.0111 4.67 0.0015 nodulin MtN3 family protein At5g44670 4.80 0.0015 5.09 0.0006 expressed protein At1g28260 4.75 0.0017 3.65 0.0065 expressed protein At5g09620 4.63 0.0002 3.16 0.0091 octicosapeptide/Phox/Bem1p (PB1) domain-

containing protein At1g22370 4.56 0.0042 4.22 0.0050 UDP-glucoronosyl/UDP-glucosyl transferase

family protein At4g22270 4.54 0.0004 2.56 0.0158 expressed protein At2g12400 4.38 0.0012 2.38 0.0046 expressed protein At4g22920 4.38 0.0143 2.61 0.0031 expressed protein At1g78600 4.37 0.0000 2.91 0.0050 zinc finger (B-box type) family protein At2g41210 4.37 0.0008 2.26 0.0091 phosphatidylinositol-4-phosphate 5-kinase

family protein At1g73040 4.36 0.0030 3.93 0.0121 jacalin lectin family protein At1g30220 4.36 0.0029 3.57 0.0251 sugar transporter family protein At1g32870 4.29 0.0003 2.41 0.0084 no apical meristem (NAM) family protein At3g62090 4.27 0.0043 4.41 0.0062 "basic helix-loop-helix (bHLH) protein,

putative" At3g03470 4.26 0.0038 3.31 0.0034 "cytochrome P450, putative" At4g16760 4.25 0.0001 2.34 0.0176 acyl-CoA oxidase (ACX1) At3g01100 4.24 0.0011 2.29 0.0151 early-responsive to dehydration protein-related At5g13490 4.23 0.0008 3.79 0.0225 ADP/ATP translocase 2 (ANT2) At4g27520 4.22 0.0020 2.52 0.0163 plastocyanin-like domain-containing protein At5g03190 4.18 0.0026 2.71 0.0021 expressed protein At1g73390 4.12 0.0006 2.91 0.0020 expressed protein At4g19390 4.12 0.0011 2.91 0.0012 expressed protein At2g43570 4.10 0.0021 3.90 0.0126 "chitinase, putative" At1g29330 4.09 0.0011 2.34 0.0341 ER lumen protein retaining receptor (ERD2) At1g69295 4.09 0.0001 2.29 0.0229 "beta-1,3-glucanase-related"

Page 24: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At4g01120 4.02 0.0005 2.85 0.0022 G-box binding factor 2 (GBF2) At1g79520 3.95 0.0087 3.72 0.0002 cation efflux family protein At1g17550 3.90 0.0055 2.19 0.0027 protein phosphatase 2C-related At1g13990 3.89 0.0012 2.80 0.0041 expressed protein At4g01550 3.77 0.0000 2.95 0.0022 no apical meristem (NAM) family protein At4g13800 3.73 0.0009 2.08 0.0100 permease-related At1g47960 3.72 0.0013 4.27 0.0018 invertase/pectin methylesterase inhibitor family

protein At4g23920 3.72 0.0005 2.35 0.0083 "UDP-glucose 4-epimerase, putative " At1g76580 3.68 0.0030 2.32 0.0031 SPL1-Related3 protein (SPL1R3) At1g80110 3.65 0.0037 3.41 0.0014 expressed protein At2g04350 3.58 0.0004 2.04 0.0090 long-chain-fatty-acid--CoA ligase family

protein (LACS8) At1g67300 3.37 0.0004 3.26 0.0009 "hexose transporter, putative" At1g48370 3.28 0.0171 2.23 0.0172 oligopeptide transporter OPT family protein At4g22950 3.24 0.0011 2.83 0.0025 MADS-box protein (AGL19) At4g16750 3.11 0.0003 2.89 0.0031 "DRE-binding transcription factor, putative" At3g17790 3.03 0.0185 2.91 0.0324 acid phosphatase type 5 (ACP5) At1g66830 3.03 0.0015 2.59 0.0083 "leucine-rich repeat transmembrane protein

kinase, putative" At5g53590 2.98 0.0069 2.86 0.0473 auxin-responsive family protein At5g10930 2.95 0.0001 3.22 0.0054 CBL-interacting protein kinase 5 (CIPK5) At2g43800 2.89 0.0054 3.72 0.0032 formin homology 2 domain-containing protein At3g11690 2.87 0.0017 2.27 0.0015 expressed protein At3g10410 2.76 0.0083 2.08 0.0052 "serine carboxypeptidase III, putative" At2g16720 2.72 0.0180 2.04 0.0137 myb family transcription factor At4g11350 2.71 0.0004 2.89 0.0006 fringe-related protein At3g16390 2.61 0.0305 3.63 0.0267 jacalin lectin family protein At4g12080 2.53 0.0095 2.01 0.0138 DNA-binding family protein At1g10140 2.48 0.0465 2.17 0.0025 expressed protein At4g25480 2.33 0.0002 2.18 0.0504 DRE-binding protein (DREB1A) / CRT/DRE-

binding factor 3 (CBF3) At5g47060 2.20 0.0088 2.31 0.0080 senescence-associated protein-related At1g09180 2.18 0.0432 2.12 0.0220 "GTP-binding protein, putative" At2g18050 2.11 0.0359 2.46 0.0013 histone H1-3 (HIS1-3) At1g23960 2.07 0.0392 2.18 0.0085 expressed protein At2g18170 2.04 0.0060 2.10 0.0006 "mitogen-activated protein kinase, putative

(MPK7)"

Page 25: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

Supplemental Table 8: Transcripts commonly down regulated (> 2 fold) with drought (161 transcripts). Locus ID Wt fold

change p-value

T8 fold change

p-value

Predicted function and gene name

At3g27690 -69.63 0.0004 -33.88 0.0063 chlorophyll A-B binding protein (LHCB2:4) At5g03350 -42.91 0.0033 -115.05 0.0299 legume lectin family protein At5g22580 -39.23 0.0070 -15.54 0.0237 expressed protein At1g72610 -31.12 0.0022 -11.24 0.0171 germin-like protein (GER1) At5g16030 -30.16 0.0026 -11.44 0.0040 expressed protein At5g59670 -22.07 0.0236 -8.72 0.0263 "leucine-rich repeat protein kinase, putative" At1g10340 -20.64 0.0094 -9.15 0.0082 ankyrin repeat family protein At5g63180 -20.54 0.0015 -18.12 0.0213 pectate lyase family protein At1g65490 -18.43 0.0155 -7.54 0.0311 expressed protein At4g04540 -15.53 0.0028 -5.71 0.0081 protein kinase family protein At4g23290 -15.20 0.0138 -12.46 0.0061 protein kinase family protein At1g73600 -14.90 0.0038 -8.15 0.0240 "phosphoethanolamine N-methyltransferase 3,

putative (NMT3)" At3g01500 -14.37 0.0103 -11.07 0.0067 carbonic anhydrase 1 (CA1) At4g39940 -14.11 0.0017 -10.01 0.0026 adenylylsulfate kinase 2 (AKN2) At3g45860 -14.09 0.0066 -5.34 0.0368 "receptor-like protein kinase, putative" At5g35490 -13.87 0.0013 -2.64 0.0093 expressed protein (MRU1) At1g29660 -13.48 0.0150 -11.08 0.0077 GDSL-motif lipase/hydrolase family protein At1g11330 -13.37 0.0004 -10.47 0.0042 S-locus lectin protein kinase family protein At4g24570 -13.23 0.0272 -7.87 0.0456 mitochondrial substrate carrier family protein At3g08920 -12.40 0.0168 -8.03 0.0116 rhodanese-like domain-containing protein At4g24340 -11.96 0.0061 -5.78 0.0067 phosphorylase family protein At3g04210 -11.59 0.0024 -8.10 0.0113 "disease resistance protein (TIR-NBS class),

putative" At1g76100 -11.31 0.0129 -3.71 0.0312 plastocyanin At5g14740 -11.16 0.0207 -8.67 0.0039 carbonic anhydrase 2 (CA2) (CA18) At1g19150 -11.10 0.0031 -5.88 0.0080 "chlorophyll A-B binding protein, putative " At4g31500 -11.05 0.0164 -9.90 0.0118 cytochrome P450 83B1 (CYP83B1) At5g22570 -11.00 0.0073 -5.08 0.0347 WRKY family transcription factor At4g13770 -10.12 0.0037 -7.02 0.0182 cytochrome P450 family protein At2g17040 -10.07 0.0155 -6.99 0.0359 no apical meristem (NAM) family protein At3g23550 -10.03 0.0008 -7.69 0.0011 MATE efflux family protein At1g15820 -9.89 0.0085 -4.48 0.0331 "chlorophyll A-B binding protein, chloroplast

(LHCB6)" At1g12900 -9.87 0.0043 -5.19 0.0207 "glyceraldehyde 3-phosphate dehydrogenase," At1g04530 -9.80 0.0020 -4.28 0.0074 expressed protein At2g23200 -9.45 0.0003 -2.98 0.0034 protein kinase family protein At4g21280 -9.43 0.0070 -4.00 0.0178 "oxygen-evolving enhancer protein 3, putative

(PSBQ1) (PSBQ)" At5g49630 -9.35 0.0130 -3.80 0.0274 amino acid permease 6 (AAP6) At2g42690 -9.08 0.0167 -5.32 0.0396 "lipase, putative" At3g14840 -8.96 0.0027 -4.43 0.0212 leucine-rich repeat family protein At4g26530 -8.61 0.0200 -5.78 0.0063 "fructose-bisphosphate aldolase, putative" At5g39020 -8.55 0.0020 -3.24 0.0373 protein kinase family protein At3g48720 -8.55 0.0017 -6.26 0.0189 transferase family protein At1g78460 -8.38 0.0026 -3.30 0.0302 SOUL heme-binding family protein At3g15850 -8.36 0.0015 -4.16 0.0124 fatty acid desaturase family protein At3g28040 -8.30 0.0063 -4.01 0.0235 "leucine-rich repeat transmembrane protein

kinase, putative" At4g25080 -8.05 0.0126 -6.24 0.0076 "magnesium-protoporphyrin O-

Page 26: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

methyltransferase, putative" At4g23130 -7.87 0.0034 -4.99 0.0099 receptor-like protein kinase 6 (RLK6) At5g49730 -7.87 0.0003 -6.36 0.0052 ferric reductase-like transmembrane component

family protein At5g40450 -7.70 0.0058 -4.27 0.0153 expressed protein At1g56430 -7.65 0.0036 -4.34 0.0018 "nicotianamine synthase, putative" At1g75820 -7.53 0.0047 -3.48 0.0340 CLAVATA1 receptor kinase (CLV1) At4g32280 -7.36 0.0186 -6.46 0.0053 auxin-responsive AUX/IAA family protein At3g10520 -7.28 0.0084 -3.81 0.0003 non-symbiotic hemoglobin 2 (HB2) (GLB2) At4g03450 -7.27 0.0038 -5.87 0.0048 ankyrin repeat family protein At4g38840 -7.22 0.0012 -4.38 0.0083 "auxin-responsive protein, putative" At1g11260 -7.20 0.0041 -2.65 0.0336 glucose transporter (STP1) At1g68585 -7.01 0.0026 -3.77 0.0400 expressed protein At1g22690 -6.89 0.0001 -5.29 0.0044 "gibberellin-responsive protein, putative" At3g16520 -6.89 0.0018 -3.97 0.0363 UDP-glucoronosyl/UDP-glucosyl transferase

family protein At2g26190 -6.86 0.0034 -4.07 0.0215 calmodulin-binding family protein At1g67740 -6.84 0.0051 -4.66 0.0119 photosystem II core complex proteins psbY

(PSBY) At5g59870 -6.75 0.0004 -5.80 0.0001 "histone H2A, putative" At2g36430 -6.70 0.0070 -2.62 0.0107 expressed protein At5g56850 -6.65 0.0005 -2.63 0.0286 expressed protein At5g23060 -6.58 0.0127 -3.05 0.0310 expressed protein At3g02020 -6.55 0.0084 -5.31 0.0162 "aspartate kinase, lysine-sensitive" At2g29290 -6.51 0.0076 -2.92 0.0166 "tropinone reductase, putative " At2g02930 -6.38 0.0211 -5.60 0.0404 "glutathione S-transferase, putative " At3g55130 -6.35 0.0008 -4.11 0.0229 ABC transporter family protein At5g13630 -6.27 0.0065 -5.34 0.0157 "magnesium-chelatase subunit chlH, putative

(CHLH)" At5g28020 -6.23 0.0008 -4.24 0.0439 "cysteine synthase, putative " At1g62780 -6.21 0.0451 -2.50 0.0308 expressed protein At4g33220 -6.20 0.0041 -3.50 0.0478 pectinesterase family protein At1g09415 -6.20 0.0018 -2.67 0.0410 NPR1/NIM1-interacting protein 3 (NIMIN-3) At2g23590 -6.15 0.0088 -3.20 0.0311 "hydrolase, alpha/beta fold family protein " At5g24210 -6.10 0.0014 -7.38 0.0175 lipase class 3 family protein At2g16660 -6.00 0.0074 -3.25 0.0406 nodulin family protein At1g44000 -5.93 0.0003 -3.25 0.0165 expressed protein At1g09750 -5.90 0.0060 -5.83 0.0043 chloroplast nucleoid DNA-binding protein-

related At3g57450 -5.88 0.0284 -5.42 0.0505 expressed protein At1g66940 -5.88 0.0002 -3.40 0.0041 protein kinase-related At5g54630 -5.85 0.0032 -3.58 0.0288 zinc finger protein-related At5g10760 -5.84 0.0034 -5.29 0.0128 aspartyl protease family protein At3g46780 -5.80 0.0482 -4.98 0.0127 expressed protein At4g08850 -5.79 0.0005 -3.94 0.0135 leucine-rich repeat family protein At2g32100 -5.77 0.0049 -4.49 0.0026 ovate protein-related At4g36540 -5.69 0.0092 -4.80 0.0002 basic helix-loop-helix (bHLH) family protein At5g12940 -5.68 0.0075 -2.72 0.0037 leucine-rich repeat family protein At2g44210 -5.68 0.0028 -3.75 0.0389 expressed protein At4g16985 -5.60 0.0032 -4.23 0.0022 arabinogalactan-protein family At4g09650 -5.46 0.0145 -5.45 0.0332 "ATP synthase delta chain, putative " At1g52290 -5.42 0.0018 -4.07 0.0214 protein kinase family protein At1g52230 -5.33 0.0014 -4.22 0.0153 photosystem I reaction center subunit VI

(PSAH2) At3g50270 -5.30 0.0033 -4.85 0.0123 transferase family protein At3g52750 -5.27 0.0148 -2.59 0.0365 "chloroplast division protein, putative"

Page 27: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At5g11420 -5.26 0.0127 -4.09 0.0066 expressed protein At2g45180 -5.25 0.0072 -2.67 0.0333 lipid transfer protein (LTP) family protein At1g11350 -5.19 0.0016 -2.30 0.0376 S-locus lectin protein kinase family protein At1g56120 -5.14 0.0002 -3.06 0.0070 leucine-rich repeat family protein At3g11170 -5.09 0.0016 -3.20 0.0138 omega-3 fatty acid desaturase (FAD8) At5g19250 -5.08 0.0046 -3.29 0.0232 expressed protein At4g18370 -5.08 0.0080 -2.57 0.0332 "protease HhoA, chloroplast (SPPA) (HHOA)" At3g47560 -5.07 0.0008 -2.94 0.0243 esterase/lipase/thioesterase family protein At1g74440 -5.07 0.0023 -4.02 0.0256 expressed protein At1g75500 -4.80 0.0188 -3.41 0.0241 nodulin MtN21 family protein At2g30510 -4.77 0.0134 -3.48 0.0432 signal transducer of phototropic response (RPT2) At5g47910 -4.74 0.0027 -3.45 0.0175 respiratory burst oxidase protein D (RbohD) /

NADPH oxidase At2g03750 -4.70 0.0006 -2.43 0.0030 sulfotransferase family protein At1g74930 -4.63 0.0135 -6.18 0.0182 "AP2 domain-containing transcription factor,

putative" At5g48540 -4.62 0.0061 -2.81 0.0124 33 kDa secretory protein-related At1g53440 -4.62 0.0331 -2.95 0.0348 leucine-rich repeat family protein / protein kinase

family protein At1g23390 -4.44 0.0036 -3.64 0.0334 kelch repeat-containing F-box family protein At4g12030 -4.43 0.0132 -4.38 0.0060 bile acid:sodium symporter family protein At1g67480 -4.41 0.0013 -2.64 0.0156 kelch repeat-containing F-box family protein At2g38310 -4.35 0.0014 -3.00 0.0083 expressed protein At2g39470 -4.27 0.0033 -3.09 0.0227 photosystem II reaction center PsbP family

protein At5g54490 -4.23 0.0151 -3.50 0.0252 "calcium-binding EF-hand protein, putative" At5g63780 -4.20 0.0354 -3.35 0.0013 zinc finger (C3HC4-type RING finger) family

protein At1g28110 -4.18 0.0103 -3.73 0.0117 serine carboxypeptidase S10 family protein At1g18570 -4.10 0.0137 -4.39 0.0327 myb family transcription factor (MYB51) At1g24100 -4.02 0.0095 -3.07 0.0008 UDP-glucoronosyl/UDP-glucosyl transferase

family protein At3g28180 -4.01 0.0031 -2.28 0.0026 glycosyl transferase family 2 protein At3g06470 -3.92 0.0009 -3.24 0.0047 GNS1/SUR4 membrane family protein At3g55630 -3.92 0.0110 -3.85 0.0007 dihydrofolate synthetase (DHFS/FPGS4) At1g80050 -3.91 0.0014 -3.18 0.0000 adenine phosphoribosyltransferase 2 (APT2) At5g13710 -3.90 0.0013 -2.29 0.0027 "sterol 24-C-methyltransferase, putative" At4g39970 -3.76 0.0236 -3.31 0.0022 haloacid dehalogenase-like hydrolase family

protein At3g58990 -3.70 0.0070 -3.13 0.0016 aconitase C-terminal domain-containing protein At1g51805 -3.65 0.0009 -2.53 0.0262 "leucine-rich repeat protein kinase, putative" At1g66150 -3.65 0.0191 -3.21 0.0224 "leucine-rich repeat protein kinase, putative

(TMK1)" At5g45650 -3.64 0.0087 -3.34 0.0074 subtilase family protein At3g10720 -3.62 0.0000 -2.28 0.0037 "pectinesterase, putative" At3g05730 -3.53 0.0171 -3.62 0.0124 expressed protein At5g23020 -3.52 0.0132 -3.12 0.0316 2-isopropylmalate synthase 2 (IMS2) At1g66200 -3.50 0.0017 -3.15 0.0023 "glutamine synthetase, putative" At4g14680 -3.50 0.0137 -2.44 0.0019 sulfate adenylyltransferase 3 (APS3) At1g55450 -3.49 0.0232 -4.15 0.0132 embryo-abundant protein-related At2g15090 -3.44 0.0026 -2.91 0.0011 "fatty acid elongase, putative" At3g04480 -3.44 0.0138 -2.33 0.0084 endoribonuclease L-PSP family protein At1g53430 -3.43 0.0015 -2.93 0.0426 leucine-rich repeat family protein / protein kinase

family protein At1g49230 -3.43 0.0063 -2.18 0.0067 zinc finger (C3HC4-type RING finger) family

protein

Page 28: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

At2g34510 -3.40 0.0098 -2.44 0.0080 expressed protein At3g54920 -3.33 0.0039 -3.03 0.0041 "pectate lyase, putative (PMR6)" At2g24160 -3.24 0.0206 -2.45 0.0092 "pseudogene, leucine rich repeat protein family" At4g29740 -3.24 0.0192 -2.91 0.0023 FAD-binding domain-containing protein At2g20610 -3.24 0.0147 -2.50 0.0035 "aminotransferase, putative" At1g13110 -3.16 0.0003 -2.63 0.0205 cytochrome P450 71B7 (CYP71B7) At3g45640 -3.09 0.0007 -2.62 0.0074 "mitogen-activated protein kinase, putative /

MAPK, putative (MPK3)" At5g25440 -3.06 0.0497 -2.36 0.0058 protein kinase family protein At1g09200 -2.97 0.0016 -2.41 0.0005 histone H3 At1g72940 -2.89 0.0338 -6.50 0.0244 "disease resistance protein (TIR-NBS class),

putative" At1g74100 -2.89 0.0011 -2.46 0.0321 sulfotransferase family protein At1g58290 -2.89 0.0177 -4.11 0.0033 glutamyl-tRNA reductase 1 / GluTR (HEMA1) At3g57330 -2.83 0.0032 -2.49 0.0035 calcium-transporting ATPase (ACA11) At4g34220 -2.82 0.0283 -2.45 0.0063 "leucine-rich repeat transmembrane protein

kinase, putative" At1g70410 -2.81 0.0088 -2.24 0.0181 "carbonic anhydrase, putative" At4g33000 -2.76 0.0337 -2.41 0.0278 calcineurin B-like protein 10 (CBL10) At3g13750 -2.73 0.0205 -2.79 0.0124 "beta-galactosidase, putative" At3g03990 -2.66 0.0375 -2.58 0.0014 esterase/lipase/thioesterase family protein At1g80850 -2.58 0.0015 -2.89 0.0007 methyladenine glycosylase family protein At3g21870 -2.51 0.0084 -2.91 0.0007 cyclin family protein At4g22710 -2.34 0.0078 -2.13 0.0340 cytochrome P450 family protein

Page 29: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

Supplemental Table 9: Comparison of basal levels of soluble sugars and inositol in wild type (WT) and transgenic (T8) plants. Data are the average of three independent biological replicates (day 0 of the RWC time course shown in Figure 5) ± SE for all samples except T8 sucrose which is the average of two independent replicates. Metabolites

WT T8

µg/mg fresh wt

fructose 0.356 ± 0.12 0.441 ± 0.16

glucose 1.468 ± 0.48 1.478 ± 0.50

sucrose 0.697 ± 0.13 0.766 ± 0.26

raffinose 0.549 ± 0.06 0.535 ± 0.05

inositol 0.070 ± 0.01 0.068 ± 0.01

29

Page 30: Supplemental Data. Perera et al., (2008). Transgenic ......2008/10/10  · 2.08 0.0877 O-methyltransferase family 2 protein At1g51090 2.07 0.0534 heavy-metal-associated domain-containing

Supplemental Table 10. Primers used for RT-PCR and qRT-PCR Gene AGI Forward Reverse RAB18 At5g66400 cgtcttaccagaaccgtcca ttcttctcgtggtgctcacc KIN2 At5g15970 atgtcagagaccaacaagaatgc attataactcccaaagttgactcgg COR15a At2g42540 ctctctcatggcgatgtctttctca tcgctttctcaccatctgctaatgc ERD1 At5g51070 gcacgaaacgagtctttgaagctg gaaccagcaattcgaccactagga ACTIN2 At3g18780 gcaagtcatcacgattggtgc gcaacgaccttaatcttcatgctg UBQ10 At4g05320 tcaaatggaccgctcttatc cacagactgaagcgtccaag CRT3 At1g08450 aggagcatttcgaaggtggatgga gtgcttaaaggttccagctttgcc BiP3 At1g09080 aggcgagagaagcatgacgaaaga tttcacctgcaggatcccatttgc PR-1 At2g14610 aggtgctcttgttcttccctcgaa tcactttggcacatccgatgctca DREB2A At5g05410 cagtgttgccaacggttcat aaacggaggtattccgtagttgag Xero2 At3g50970 ctgccaggtcatcatggaactcac agcgactcaatgaaagaaagccacaGolS2 At1g56600 gacgagtctcttgattacaagaatgtt aaactgctgaagtgtctgttgc GolS3 At1g09350 gccaagcctccccacttattacaac tagcaccggctgcacagtaatga PLC7 At3g55940 tccgtagctcctgctgagatcaaa gaaagaggagagttggtaacagcg Thm At4g36010 cttgtggcggagctgattac ccttcgttgcactcttcaca LEA2g At2g42560 catcagggaggtgaggaagaaaagc gtgcctttttggtccatatccgaaga OXG2 At5g43450 caggatttcttgcgagcatttttga agcgtaacatatgcaaaacgcacaa ACS2 At1g01480 cctcattccctccccgtactatgc caaaccggaccaagttcgtgagtg AGP1 At5g64310 accggctccttcacctaagaagatg gaccaggagcttcagtcggagaat TCH4 At5g57560 ggacgctgatgattgggcaacg cccctgtttcgaggcattaggac

30