Stim1 and Orai1 Mediate CRAC Currents and Store … · Stim1 and Orai1 Mediate CRAC Currents and Store-Operated Calcium Entry Important for Endothelial Cell Proliferation Iskandar

Stim1 and Orai1 Mediate CRAC Currents andStore-Operated Calcium Entry Important for Endothelial

Cell ProliferationIskandar F. Abdullaev,* Jonathan M. Bisaillon,* Marie Potier, Jose C. Gonzalez,

Rajender K. Motiani, Mohamed Trebak

Abstract—Recent breakthroughs in the store-operated calcium (Ca2�) entry (SOCE) pathway have identified Stim1 as theendoplasmic reticulum Ca2� sensor and Orai1 as the pore forming subunit of the highly Ca2�-selective CRAC channelexpressed in hematopoietic cells. Previous studies, however, have suggested that endothelial cell (EC) SOCE ismediated by the nonselective canonical transient receptor potential channel (TRPC) family, TRPC1 or TRPC4. Here,we show that passive store depletion by thapsigargin or receptor activation by either thrombin or the vascular endothelialgrowth factor activates the same pathway in primary ECs with classical SOCE pharmacological features. ECs possessthe archetypical Ca2� release-activated Ca2� current (ICRAC), albeit of a very small amplitude. Using a maneuver thatamplifies currents in divalent-free bath solutions, we show that EC CRAC has similar characteristics to that recordedfrom rat basophilic leukemia cells, namely a similar time course of activation, sensitivity to 2-aminoethoxydiphenylborate, and low concentrations of lanthanides, and large Na� currents displaying the typical depotentiation. RNAsilencing of either Stim1 or Orai1 essentially abolished SOCE and ICRAC in ECs, which were rescued by ectopicexpression of either Stim1 or Orai1, respectively. Surprisingly, knockdown of either TRPC1 or TRPC4 proteins had noeffect on SOCE and ICRAC. Ectopic expression of Stim1 in ECs increased their ICRAC to a size comparable to that in ratbasophilic leukemia cells. Knockdown of Stim1, Stim2, or Orai1 inhibited EC proliferation and caused cell cycle arrest at Sand G2/M phase, although Orai1 knockdown was more efficient than that of Stim proteins. These results are first to ourknowledge to establish the requirement of Stim1/Orai1 in the endothelial SOCE pathway. (Circ Res. 2008;23:1289-1299.)

Key Words: CRAC currents � endothelial cell � Orai1 � SOC channels � Stim1 proliferation

Store-operated calcium (Ca2�) entry (SOCE) is a commonand ubiquitous mechanism of regulating Ca2� influx into

cells. In virtually all cell types, depletion of endoplasmicreticulum (ER) Ca2� content using sarcoplasmic/ER Ca2�

ATPase inhibitors such as thapsigargin activates SOCE.1,2

Under physiological conditions SOCE is initiated by inosi-tol1,4,5 triphosphate (IP3)-mediated depletion of ER Ca2� inresponse to a plethora of stimuli acting through phospho-lipase C-coupled receptors. The best characterized SOCcurrent is the Ca2� release-activated Ca2� current (ICRAC),first recorded in rat basophilic leukemia (RBL) mast cells,3

and later described in other cell types.4 SOCE is necessary forthe replenishment of ER Ca2� content and is a key regulatorof many Ca2�-dependent physiological processes.4 Recently,high-throughput RNA silencing (siRNA) screens by severallaboratories have identified 2 molecules, Stim1 and Orai1, askey components of the ICRAC pathway in mast cells, lympho-cytes, and HEK293 cells.5–8 On ER Ca2� depletion, Ca2�-

sensing Stim1 proteins translocate to close proximity of theplasma membrane, where they aggregate into multiplepuncta. Strikingly, Orai1 molecules also translocate to thesame Stim1-containing structures on store depletion, wherethey open to mediate Ca2� influx.9–12

In endothelial cells (ECs), SOCE in response to passivestore depletion was reported for several EC types, includinghuman umbilical vein endothelial cells (HUVECs),13 bovine/rabbit aorta,14,15 and bovine pulmonary artery.16 The electro-physiological profile of the SOC conductance in ECs isunclear with an early study reporting small (�0.5 pA/pF at�80 mV) Ca2�-selective ICRAC-like currents,17 and othersdescribing larger currents (�5pA/pF at �80 mV).18,19 Studiesreporting endothelial ICRAC are very scarce, likely because ofextremely low current densities (�6- to 10-times lower thanthose reported in Jurkat or RBL cells17). The molecularcomposition of the SOC channels in many cell types, and inECs in particular, remains a highly controversial topic.

Original received June 16, 2008; revision received September 27, 2008; accepted September 30, 2008.From Cardiovascular Sciences, Albany Medical College, Albany, NY 12208, USA*Both authors contributed equally to this work.Correspondence to Mohamed Trebak, PhD, Cardiovascular Sciences, MC8, Albany Medical College, 47 New Scotland Avenue, MC-8, Albany, NY

12208. E-mail [email protected]. and J.M.B. contributed equally to this work.© 2008 American Heart Association, Inc.

Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/01.RES.0000338496.95579.56

1289 by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from

http://circres.ahajournals.org/



















Several studies have proposed members of the transientreceptor potential canonical (TRPC) family, eitherTRPC118–22 or TRPC4,23–25 to mediate SOCE in ECs. How-ever, it is not clear how nonselective TRPC channels can encodethe highly Ca2�-selective ICRAC. In the light of the recentdiscovery of Stim1 and Orai1 as key players in ICRAC in mastcells and lymphocytes, we evaluated their involvement inendothelial SOCE and their contribution to EC proliferation. Weshow that: (1) store depletion in ECs activates the highlyCa2�-selective SOC current, ICRAC, that displays similar elec-trophysiological characteristics to that recorded from RBL cells;(2) SOCE and ICRAC in ECs are inhibited by low concentrationsof lanthanides and by 2-aminoethoxydiphenyl borate (2-APB);(3) SOCE and ICRAC are mediated by Stim1 and Orai1, whereasTRPC1 and TRPC4 are not involved; (4) the small ICRAC in ECsis attributable to low levels of Stim1 in these cells, and Stim1overexpression generated ICRAC of similar amplitude to thatrecorded in RBL cells, demonstrating that Stim1 is limiting inECs and explaining the sporadic success in reliably recordingthese currents in the past; and (5) knockdown of Stim1 and Orai1markedly reduced EC proliferation by inducing cell cycle arrestat S and G2/M phase.

Materials and MethodsCell culture and transfections, Western blots, Ca2� imaging, andpatch clamp were performed as previously described,26–28 and theprotocols and compositions of various solutions and buffers are listedin the online supplementary material (http://circres.ahajournals.org). Allexperiments were performed using standard or slightly modified proto-cols as described. Details of these protocols along with concentrations ofreagents, drugs, compositions of media, and solutions are provided inthe online supplement. The list of primers, siRNA and shRNA se-quences, and antibodies is also provided.

ResultsHUVECs and Human Pulmonary Artery ECsExhibit Classical SOCETo characterize pharmacological properties of SOCE in ECs,we used Fura-2 Ca2� imaging and thapsigargin (2 �mol/L) toactivate SOCE. In the absence of extracellular Ca2�, thapsi-gargin induces a passive Ca2� leak from the ER (Figure 1).When Ca2� was restored to the bath, Ca2� entry through SOCchannels occurred. Thapsigargin-induced SOCE was com-pletely inhibited by low concentrations of lanthanides(10 �mol/L Gd3�) or by 30 �mol/L 2-APB, reminiscent ofSOCE in HEK29329 (Figure 1A and 1B).

Physiological stimuli acting through phospholipaseC-coupled receptors also activate SOCE in ECs. Thrombin,stimulating a G-protein-coupled receptor, and vascular endo-thelial growth factor, operating through a receptor tyrosinekinase, activate isoforms of phospholipase C and causeIP3-mediated Ca2� store depletion. Application of 100nmol/L thrombin elicited fast and transient cytosolic Ca2�

release from the ER (Figure 1C and 1D). Reintroduction ofextracellular Ca2� induced typical SOCE that was blocked byGd3� and 2-APB. Preincubation with the same concentra-tions of Gd3� and 2-APB induced a complete block of SOCE(Figure II; see supplementary figures at http://circres.ahajournals.org). Similar results were obtained whenHUVECs were stimulated by 100 ng/mL of vascular endo-thelial growth factor (Figure 1E and 1F). Similar results wereobtained with another primary EC type; SOCE in humanpulmonary artery ECs induced by either thrombin or thapsi-gargin had the same pharmacological profile (Figure III). Weconclude that thapsigargin and phospholipase C-coupledagonists activate SOCE with similar characteristics.

Figure 1. Thapsigargin activates SOCE in HUVECs. A and B, Store depletion by 2 �mol/L thapsigargin (TG) induces SOCE that isinhibited by 30 �mol/L 2-APB (A) and 10 �mol/L Gd3� (B). C and D, Thrombin (100 nmol/L) induces SOCE and is inhibited by similarconcentrations of 2-APB (C) and Gd3� (D). E and F, Similar results were obtained with vascular endothelial growth factor (100 ng/mL).Data in each panel are an average of 4 to 12 cells and representative of at least 3 independent experiments.

1290 Circulation Research November 21, 2008

by guest on March 13, 2015http://circres.ahajournals.org/Downloaded from


ICRAC in HUVECsICRAC have a unique set of electrophysiological features thatare easily distinguishable from other Ca2� currents.4 Thesecurrents are very inwardly rectifying, are inhibited by low

concentrations of lanthanides (1 to 10 �mol/L Gd3�), poten-tiated by low concentrations of 2-APB (5 �mol/L), andinhibited by higher concentrations (30 to 50 �mol/L 2-APB).ICRAC is highly Ca2�-selective and is negatively regulated by

Figure 2. ICRAC in HUVEC and RBL cells. A and C, ICRAC activationon intracellular dialysis with BAPTA in RBL and HUVEC, respectively.E, ICRAC activation on extracellular application of thapsigargin (TG;2 �mol/L). Ramps from �100 mV to �60 mV were taken every 3seconds, and data points from each ramp were taken at �100 mVand plotted. B, D, and F, Representative ramps taken at time pointsmarked by asterisks in A, C, and E, respectively. *Before applicationof Gd3�; *after application of 10 �mol/L Gd3�. G, Statistical analysisof maximal current values at �100 mV.

Abdullaev et al Stim1/Orai1 Mediate Endothelial SOC 1291



cytosolic Ca2�. A standard method for ICRAC activation inwhole-cell mode is intracellular dialysis by high concentra-tions of the pH-independent, fast Ca2� chelator BAPTA.30 Aspreviously shown,3 passive store depletion by BAPTA led tothe activation of typical ICRAC in RBL cells with a magnitudeof 1.25�0.25 pA/pF at �100 mV (n�5). This current wasinhibited by low concentrations of Gd3� (10 �mol/L; Figure2A and 2B). Similar inward currents, although of a muchsmaller magnitude, developed on intracellular dialysis ofHUVECs by BAPTA (0.26�0.04 pA/pF at �100 mV; n�5;Figure 2C and 2D), or extracellular application of thapsigar-gin (0.36�0.1 pA/pF at �100 mV; n�4; Figure 2E a nd 2F).These currents were also inhibited by Gd3� (Figure 2C and2E). Figure 2G shows a statistical comparison of the ampli-tudes of ICRAC in RBL and those in HUVECs.

Given the small size of ICRAC in HUVECs, we sought toamplify its magnitude by performing whole-cell patch clampin divalent-free (DVF) bath solutions. In DVF conditions,

ICRAC readily conducts Na�, mediating a significantly largerconductance.31–33 These large Na� currents exhibit the uniqueproperty of being fast-inactivating over the course of tens ofseconds, a process called depotentiation.34 Switching to DVFsolution in RBL cells induced large (9.5�1.3 pA/pF at �100mV; n�6), Gd3�-sensitive, 2-APB-sensitive, and rapidlyinactivating inward Na� currents (Figure 3A, 3B, and 3G).Using this protocol in HUVECs, we observed a relativelylarge (1.2�0.3 pA/pF at �100 mV; n�5) Na� inward-current with current voltage relationship typical of ICRAC

(Figure 3D and 3E). As expected, these Na� currents wereblocked by Gd3� and 2-APB (Figure 3D, 3E, and 3H). InHUVECs, however, we observed a small remaining linearcurrent (0.50 pA/pF �0.09 at �100 mV; n�9) that wasinsensitive to Gd3�, possibly representing a leak current (seeI/V relationship before and after subtraction in supplementaryFigure IV). In addition, Na� currents in both RBL andHUVECs showed the typical depotentiation characteristic of

Figure 3. ICRAC in DVF conditions. A and D, Na� currents recorded in response to repetitive pulses (approximately every min) of DVFbath solutions in RBL and HUVEC, respectively. After whole-cell mode, ramps from �100 mV to �60 mV were applied, and data pointstaken at �100 mV and plotted. 10 �mol/L Gd3� was added where indicated. B and E, Representative ramps of DVF-induced Na� cur-rents in RBL (B) and HUVEC (E). Ramps shown were taken at time points indicated by * in A and D, respectively. C and F, Close-up ofDVF-induced Na� currents (*A and *D) in RBL and HUVECs. G and H, Mean values of maximal Na� currents at �100 mV before, afterapplication of 10 �mol/L Gd3�, and 30 �mol/L 2-APB in RBL (G) and HUVECs (H).




ICRAC33 (Figure 3A and 3D; for close-ups see Figure 3C and

3F). We conclude that HUVECs display the archetypicalICRAC identical to that found in RBL but of a much smallerdensity (�6-fold smaller than RBL).

Molecular Players of SOCE in HUVECsRecent studies have identified 2 conserved genes that arerequired for SOCE in lymphocytes, mast cells, and HEK293cells, Stim1 and Orai1.5–8,35,36 Stim1 is the Ca2� sensor in theER that somehow signals the activation of Orai1, a pore-forming subunit of the SOC channel. However, most studieson ECs have suggested either TRPC1 or TRPC4 as SOCchannel components. We used siRNA to assess the involve-ment of Stim1, Orai1, TRPC1, and TRPC4 in endothelialSOC. Knockdown of either Stim1 or Orai1 in HUVECs wasachieved using 2 different shRNA and 2 different siRNAsequences (Table I) used individually. SiRNA sequencesinduced a marked decrease in their target mRNA levels(76.6%�2.09 for Stim1 #1 and 78.6%�3.63 for Orai1 #1;n�3; Figure 4A). SiRNA against either Stim1 or Orai1 leadto 74.2%�6.6 and 58.0%�5.7 decreases in Stim1 and Orai1proteins levels, respectively, as assessed by Western blotting

(Figure 4B). This is likely an underestimation of the knock-down at the single cell level because transfection efficiencyof siRNA in HUVECs is unlikely 100%. We assessed theoff-targets effect of Stim1 and Orai1 siRNA sequences on themRNA of TRPC1, TRPC4, Stim2, Orai2, and Orai3. Asexpected, siRNA targeting either Stim1 or Orai1 induced adecrease in their respective mRNA with no statisticallysignificant effect on other genes (Figure IVB and IVC).

Interestingly, downregulation of either Stim1 or Orai1using siRNA significantly suppressed both thapsigargin-induced (Figure 4C) and thrombin-induced (not shown, butsee Figure V, panel B in online supplement at http://circres.ahajournals.org) SOCE in HUVECs. SOCE was greatlyreduced when transfecting cells with siRNA against eitherStim1 or Orai1 (data shown for siStim1#1 and siOrai1#1;representative of 2 independent siRNA sequences) by com-parison to cells transfected with a scrambled control siRNA(Figure 4C). Similar results were obtained using 2 shRNAsequences used independently (supplementary Figure VA andVB). Similar results were obtained when knockdown of eitherStim1 or Orai1 was achieved in human pulmonary artery ECs(supplementary Figure VC). Furthermore, the effect of Stim1

Figure 4. SOCE in HUVECs is mediated by Stim1 and Orai1. A, Quantitative polymerase chain reaction data showing decreasedexpression of Orai1 and Stim1 mRNA in silenced cells compared to control cells (scrambled siRNA), 72 hours after transfection (n�3;1-way ANOVA, *P�0.05). B, Western blots and densitometry showing significant downregulation of Stim1 (left) and Orai1 (right) pro-teins 72 hours after siRNA transfection. C, Stim1 and Orai1 knockdown inhibits SOCE in response to thapsigargin. D, SOCE in Stim1-silenced and Orai1-silenced cells can be rescued by overexpression of eYFP-Stim1 and CFP-Orai1, respectively. All traces shown rep-resent average data from 7 to 25 cells from at least 3 independent experiments.




or Orai1 downregulation on SOCE was successfully rescuedby ectopic expression of either eYFP-Stim1 or CFP-Orai1,respectively (Figure 4D). Surprisingly, during this rescueexperiment, expression of eYFP-Stim1 yielded a muchgreater SOCE compared to CFP-Orai1. This result impliesthat in HUVECs the level of Stim1 proteins is limiting. Thisin fact turned out to be the case as described later.

We determined the effect of Stim1 and Orai1 siRNA onmembrane currents activated by store depletion using whole-cell patch clamp. As expected in scrambled control siRNA-transfected cells, store depletion activated ICRAC in DVFconditions that were sensitive to 10 �mol/L Gd3� (Figure5A). Either Stim1 or Orai1 silencing by siRNA led to adramatic reduction of ICRAC densities, although Orai1 wassomewhat more efficient (scrambled siRNA, 1.57�0.34 pA/pF; siStim1, 0.26�0.03 pA/pF; siOrai1, 0.11�0.1 pA/pF at�100 mV; n�3; Figure 5A and 5C). Figure 5B shows typicalI/V relationship of ICRAC recorded in DVF bath solutionsfrom control cells and from cells transfected with eithersiStim1 or siOrai1.

HUVECs also express mRNA encoding Orai2 and Orai3(Figure 5D), and it is therefore possible that these 2 proteinscontribute subunits to a heteromultimeric SOC channel inHUVECs. We found that thapsigargin-activated SOCE inHUVECs resembles that in HEK293 and RBL cells: it ispotentiated by low concentrations of 2-APB (5 �mol/L) andinhibited by high concentrations (50 �mol/L). Only Orai1

possess this peculiar characteristic,37 arguing against aninvolvement of Orai2 and Orai3.

Small SOCE and ICRAC in HUVECs Attributableto Limiting Stim1 LevelsFigure 4D suggested that the very small densities of ICRAC inHUVECs could be attributable to limiting levels of Stim1.Western blots analysis showed that Stim1 protein levels inHUVECs are �8-fold less than those of RBL cells (Figure6A), providing a possible explanation for the smaller ICRAC inHUVECs. Indeed, eYFP-Stim1 overexpression in HUVECswas verified by fluorescence microscopy showing typicalfibrillar staining (inset in Figure 6B) and by Western blotting(supplementary Figure VI) and shown to induce a largeincrease in SOCE and �5.7-fold increase in ICRAC densitiesat �100 mV (6.89�0.5 pA/pF, n�3 vs 1.2�0.3 pA/pF forcontrol, n�5; Figure 6C and 6D). These data strongly suggestthat Stim1 is the limiting factor for SOCE and ICRAC in ECs.

TRPC1 and TRPC4 Are not Involved in SOCEand ICRAC in ECsPrevious data suggested that SOC channels in ECs areencoded by either TRPC1 or TRPC4.21,25 Two siRNA se-quences against either TRPC1 or TRPC4 used separatelyinduced substantial decrease in their respective mRNA levels(56%�3.9 for siTRPC1 #1 and 83%�1.8 for siTRPC4#1;n�3; Figure 7A) and a drastic knockdown of protein levels(88%�1.7 for siTRPC1 and 91�3.2 for siTRPC4; n�3;

Figure 5. Stim1 and Orai1 mediate ICRAC in HUVECs. A, siRNA against either Stim1 or Orai1 in HUVECs greatly reduced ICRAC recordedunder DVF conditions compared to control scrambled siRNA-transfected cells. B, Representative ramps taken at time points indicatedby * in A. C, Summary of the whole-cell data recorded from control-siRNA, Stim-1#1-siRNA and Orai1#1-siRNA transfected HUVECs.D, mRNA expression of Stim and Orai isoforms in HUVECs. E, Ca2� imaging showing thapsigargin-activated SOCE, its potentiationwith 5 �mol/L 2-APB, and subsequent inhibition by 50 �mol/L 2-APB; trace is average of 22 cells and representative of 4 independentexperiments (1-way ANOVA, *P�0.05).




Figure 7B and 7C). The integral version of the Western blotsmembranes is shown in supplementary Figure VII, showingantibody recognition of specific bands at the expected mo-lecular weights. Given the previously published data regard-ing TRPC4 as SOC,23 and the controversy surrounding theantibodies from Alomone Labs, anti-TRPC4 antibody wasfurther validated by overexpression of human TRPC4 inHUVECs (Figure VIII). However, knockdown of eitherTRPC1 or TRPC4 failed to affect SOCE (Figure 7D) andICRAC (Figure 7E). Figure 7F summarizes data of the ampli-tude of Ca2� entry using Fura2 imaging (control, 0.57�0.03ratio units; siTRPC1, 0.61�0.05; siTRPC4, 0.63�0.04;based on 91, 62, and 77 total cells from control, siTRPC1,and siTRPC4, respectively; 12 independent recordings each)and ICRAC at �100 mV (control, 1.2�0.3 pA/pF; siTRPC1,1.5�0.5 pA/pF; siTRPC4, 1.4�0.4 pA/pF; n�5) showing nostatistical difference between control, siTRPC1, andsiTRPC4.

Stim1 and Orai1 Are Involved in EC ProliferationIn human lymphocytes, SOCE is believed to be the sole Ca2�

entry involved in response to antigen receptor stimulation and

is vital for lymphocyte proliferation.5 Therefore, we evalu-ated the involvement of Stim1 and Orai1 in EC proliferation.Protein knockdown of Stim1, Orai1, or both was achievedusing siRNA and EC proliferation in complete media wasevaluated by counting cells different days after transfectionafter trypan blue exclusion. Figure 8A and 8B show that at 96hours after knockdown, Stim1 inhibited cell proliferation by23.3%�5.39, whereas Orai1 had a much greater effect(68.8%�3.8); knockdown of both proteins caused a compa-rable inhibitory effect to that of Orai1 knockdown alone(75.5%�1.7). Propidium iodide staining on day 3 aftersilencing revealed that Orai1 knockdown increased the pro-portion of cells at the S and G2/M of the cell cycle (15.25%compared to 7.95% for control; Figure 8C and 8E). Stim1knockdown had a much smaller effect than Orai1 knockdown(10.53%; Figure 8D). Knockdown of both Stim1 and Orai1produced an effect similar to that seen with Orai1 knockdownalone (15.67%; Figure 8F).

Given the relatively smaller effect of Stim1 knockdown onEC proliferation compared to Orai1, we tested whether Stim2might mediate some of Orai1 actions on EC proliferation. Weused 2 siRNA sequences independently against Stim2 (Table

Figure 6. Small ICRAC in HUVECs are attributed to low expression levels of Stim1. A, Western blots showing low Stim1 protein levels inHUVECs compared with RBL cells. Ectopic expression of 1 �g of eYFP-Stim1 cDNA plasmid (B; see inset) in HUVECs dramaticallyincreased SOCE (B) and ICRAC (C). D, Representative ramps of ICRAC in wild-type (WT) and eYFP-Stim1–expressing HUVECs weretaken from C, when indicated by *.




I) that substantially decreased Stim2 mRNA levels as mea-sured by quantitative polymerase chain reaction (74.3%�6.0inhibition for Stim2 siRNA #1; Figure 8G). Figure 8H showsthat Stim2 knockdown induced a significant inhibition of ECproliferation 72 hours after transfection (28.8%�1.7 forsiStim2 compared to 19.4%�2.4 for siStim1). However,knockdown of both Stim proteins produced a smaller inhibi-tion compared to that of Orai1 knockdown (34.1%�2.3 forsiStim1 plus siStim2 compared to 47.7%�1.02 for siOrai1),suggesting that part of the role of Orai1 on EC proliferationis Stim-independent. Similar experiments were performed toassess the role of TRPC channels in EC proliferation. Asdepicted in Figure IX, Specific siRNA against TRPC1,TRPC4, or TRPC6 substantially inhibited EC proliferation(60.7%�1.2 for siTRPC1; 73.1%�1.21 for siTRPC4;51.1%�3.18 for siTRPC6), suggesting an important role forthese channels in EC proliferation.

DiscussionAlthough SOCE using Ca2� dyes was reported for several ECtypes, SOC currents, however, are not extensively character-ized because of technical difficulties in detecting extremelylow current densities in these cells.17 Here we report thatICRAC is functionally present in ECs and has similar kinetics,reminiscent of ICRAC in RBL cells. Although ICRAC in ECshas a very small density (�6-fold smaller than RBL cells), itcould be amplified in DVF solutions, as previously shown inother cell types.4,30,31 Rapid time-dependent inactivation ofinward Na� currents (termed depotentiation) on removal ofextracellular divalents, strong inward rectification, and inhi-bition by low concentrations of lanthanides and 2-APB aretypical properties of ICRAC

4. We propose that ICRAC ismediating SOCE in HUVECs.

We showed that Stim1 and Orai1 are required for ICRAC

and SOCE in ECs. Endothelial ICRAC and SOCE were

Figure 7. TRPC1 and TRPC4 knockdown has no effect on SOCE and ICRAC in HUVECs. A, Quantitative polymerase chain reactionshowing decreased expression of TRPC1 and TRPC4 mRNA in silenced cells compared to control cells (scrambled siRNA), 72 hoursafter transfection. B and C, Western blots and statistical analysis of densitometry on TRPC1 and TRPC4 protein knockdown. D, TRPC1and TRPC4 silencing has no effect on SOCE in response to thapsigargin in HUVECs. Data are representative of 12 independent experi-ments. E, ICRAC recorded in DVF conditions (from top to bottom) control-siRNA, TRPC1#1-siRNA, and TRPC4#1 siRNA transfectedHUVECs. F, Statistical analysis of Ca2� entry measured by Fura2 (top) and ICRAC (bottom) from control-siRNA, TRPC1-siRNA andTRPC4-siRNA transfected HUVECs (1-way ANOVA, *P�0.05).




drastically inhibited by silencing of Orai1 and Stim1. SOCEwas rescued by exogenous expression of Stim1 and Orai1.Stim1 rescue led to the development of an unusually biggerSOCE compared to Orai1 rescue. Similarly, overexpressionof eYFP-Stim1 in HUVECs generated a bigger SOCE andmarkedly increased ICRAC. Furthermore, Stim1 protein levelswere found much lower in HUVECs compared to RBL cells,strongly suggesting that Stim1 is limiting in the activation ofICRAC and SOCE in HUVECs.

In this study, we did not observe an involvement of TRPC1or TRPC4 in SOCE despite complete knockdown of theirprotein expression. Previous studies on endothelial SOCsuggested that TRPC channels can participate in endothelialSOCE.18–25 Nonselective TRPC1 and TRPC4 were reportedto play some role in an endothelial conductance that dis-played unusually large currents (�5 pA/pF at �80mV).18,19,25

In these and other studies, currents were activated by inclu-sion of either IP3,20, 21, 38 thapsigargin,19,25,39 EGTA,19,25,39

low concentrations of the chelator BAPTA (1 mmol/L)22 inthe patch pipette, or a combination of these. Whereas ICRAC isstrongly inhibited by intracellular Ca2�, TRPC channels areactivated downstream of phospholipase C and are positivelyregulated by IP3 and IP3 receptor.40 Although our datasuggest that endothelial SOC currents are ICRAC-like and arenot mediated by TRPC, we can speculate that under certainpatch clamp recording conditions, TRPC1, TRPC4, or bothmight mediate currents that are activated secondarily as aresult of phospholipase C activation in response to cytoplas-mic Ca2� increase or by IP3 included in the patch pipette inthe absence of a strong buffer, as suggested by Zarayskiy etal41 for IP3-mediated activation of TRPC1. Most of theevidence suggesting a role of TRPC in SOCE is either

Figure 8. Stim1, Stim2, and Orai1 knockdown inhibit proliferation in HUVECs. A, Four groups of cells were transfected with the follow-ing siRNA: control, Stim1, Orai1, and Stim1 plus Orai1. At time 0, �10 000 cells were seeded per well (9.6 cm2) in triplicate. At timesindicated, cells were detached and total number of cells per well counted after trypan blue exclusion. B, Data in (A) are represented asfold-increase of cell number compared to time 0. Cell cycle analysis was performed 3 days after transfection with siRNA using pro-pidium iodide staining with flow cytometry in control-siRNA (C), Stim1#1-siRNA (D), Orai1#1-siRNA (E), and Stim1#1 � Orai1#1-siRNA(F) transfected HUVECs. Control not stained with propidium iodide is shown in (C). G, Quantitative polymerase chain reaction showingStim2 mRNA knockdown, 72 hours after transfection with specific siRNA. H, EC proliferation at 72 hours after transfection with indi-cated siRNA using the same protocol described in (A). Data are representative of 4 independent experiments (1-way ANOVA, *P�0.05).




correlative or based on experiments with blocking peptides oranti-TRPC antibodies.19,21,22,25,38,39 Two recent studies onTRPC1 knockout mice have questioned the specificity ofanti-TRPC1 antibodies and the role of TRPC1 as a compo-nent of SOC channels in smooth muscle42 and platelets.43 Onestudy, however, showed that ECs from mice display a storedepletion-activated current similar to ICRAC, and that TRPC4knockout mice lack this CRAC current in ECs.23 The reasonfor the discrepancy between these data and ours is unknown.It is worthwhile to draw an analogy between the results onTRPC4�/� mice and the data by the Mori group44 obtainedwith DT40 B lymphocytes, where the TRPC1 gene wasgenetically disrupted. In these cells, SOCE and ICRAC werelost in the majority of cells (�80%). This result suggests thatperhaps in the long-term TRPC channels might play animportant role in maintaining the components of ICRAC.Alternatively, the discrepancy could be explained by differ-ences in the protocols or the type of cells used. The study onTRPC4�/� mice was performed in ECs from a differentvascular bed in a different species in which primary culturesof mouse aortic ECs were established using an explantmethod, with ECs growing out from small pieces of mouseaorta placed on growth factor-enriched Matrigel.45

Our results do not conflict with the conclusions of previousstudies18,19,22,25,46 reporting a role of TRPC1 or TRPC4 inendothelial permeability. Instead, we show that the Stim1/Orai1 pathway is important for cell proliferation. Orai1knockdown inhibits cell proliferation, reflecting growth arrestat S and G2/M phases. Stim1 and Stim2 knockdown yieldeda smaller effect as compared to Orai1 knockdown. This islikely a reflection of a Stim-independent role of Orai1 incontrolling EC proliferation. Clearly, further studies areneeded to understand the role of Stim, Orai, and TRPCproteins in EC function.

AcknowledgmentsThe authors gratefully acknowledge Meryem Zannagui for perform-ing the calcium imaging experiments depicted in Figure II.

Sources of FundingResearch in the authors’ laboratory is supported by an NIH earlycareer grant (K22ES014729) to Mohamed Trebak.

DisclosureNone.

References1. Putney JW Jr. A model for receptor-regulated calcium entry. Cell

Calcium. 1986;7:1–12.2. Smyth JT, Dehaven WI, Jones BF, Mercer JC, Trebak M, Vazquez G,

Putney JW, Jr. Emerging perspectives in store-operated Ca2� entry: rolesof Orai, Stim and TRP Biochim Biophys Acta. 2006;1763:1147–1160.

3. Hoth M, Penner R. Depletion of intracellular calcium stores activates acalcium current in mast cells. Nature. 1992;355:353–356.

4. Parekh AB, Putney JW Jr. Store-operated calcium channels. Physiol Rev.2005;85:757–810.

5. Feske S, Gwack Y, Prakriya M, Srikanth S, Puppel SH, Tanasa B, HoganPG, Lewis RS, Daly M, Rao A. A mutation in Orai1 causes immunedeficiency by abrogating CRAC channel function. Nature. 2006;441:179–185.

6. Liou J, Kim ML, Heo WD, Jones JT, Myers JW, Ferrell JE Jr, Meyer T.STIM is a Ca2� sensor essential for Ca2�-store-depletion-triggeredCa2� influx. Curr Biol. 2005;15:1235–1241.

7. Roos J, DiGregorio PJ, Yeromin AV, Ohlsen K, Lioudyno M, Zhang S,Safrina O, Kozak JA, Wagner SL, Cahalan MD, Velicelebi G, Stau-derman KA. STIM1, an essential and conserved component of store-operated Ca2� channel function. J Cell Biol. 2005;169:435–445.

8. Vig M, Peinelt C, Beck A, Koomoa DL, Rabah D, Koblan-Huberson M,Kraft S, Turner H, Fleig A, Penner R, Kinet JP. CRACM1 is a plasmamembrane protein essential for store-operated Ca2� entry. Science.2006;312:1220–1223.

9. Cahalan MD, Zhang SL, Yeromin AV, Ohlsen K, Roos J, StaudermanKA. Molecular basis of the CRAC channel. Cell Calcium. 2007;42:133–144.

10. Putney JW, Jr. Recent breakthroughs in the molecular mechanism ofcapacitative calcium entry (with thoughts on how we got here). CellCalcium. 2007;42:103–110.

11. Wu MM, Luik RM, Lewis RS. Some assembly required: constructing theelementary units of store-operated Ca2� entry. Cell Calcium. 2007;42:163–172.

12. Potier M, Trebak M. New developments in the signaling mechanisms ofthe store-operated calcium entry pathway. Pflugers Arch. 2008. Epubahead of print.

13. Oike M, Gericke M, Droogmans G, Nilius B. Calcium entry activated bystore depletion in human umbilical vein endothelial cells. Cell Calcium.1994;16:367–376.

14. Vaca L, Kunze DL. Depletion of intracellular Ca2� stores activates aCa(2�)-selective channel in vascular endothelium. Am J Physiol. 1994;267:C920–C925.

15. Sasajima H, Wang X, van Breemen C. Fractional Ca2� release from theendoplasmic reticulum activates Ca2� entry in freshly isolated rabbitaortic endothelial cells. Biochem Biophys Res Commun. 1997;241:471–475.

16. Pasyk E, Inazu M, Daniel EE. CPA enhances Ca2� entry in culturedbovine pulmonary arterial endothelial cells in an IP3-independentmanner. Am J Physiol. 1995;268:H138–H146.

17. Fasolato C, Nilius B. Store depletion triggers the calcium release-acti-vated calcium current (ICRAC) in macrovascular endothelial cells: acomparison with Jurkat and embryonic kidney cell lines. Pflugers Arch.1998;436:69–74.

18. Brough GH, Wu S, Cioffi D, Moore TM, Li M, Dean N, Stevens T.Contribution of endogenously expressed Trp1 to a Ca2�-selective, store-operated Ca2� entry pathway. Faseb J. 2001;15:1727–1738.

19. Moore TM, Brough GH, Babal P, Kelly JJ, Li M, Stevens T. Store-operated calcium entry promotes shape change in pulmonary endothelialcells expressing Trp1. Am J Physiol. 1998;275:L574–L582.

20. Mehta D, Ahmmed GU, Paria BC, Holinstat M, Voyno-Yasenetskaya T,Tiruppathi C, Minshall RD, Malik AB. RhoA interaction with inositol1,4,5-trisphosphate receptor and transient receptor potential channel-1regulates Ca2� entry. Role in signaling increased endothelial perme-ability. J Biol Chem. 2003;278:33492–33500.

21. Ahmmed GU, Mehta D, Vogel S, Holinstat M, Paria BC, Tiruppathi C,Malik AB. Protein kinase Calpha phosphorylates the TRPC1 channel andregulates store-operated Ca2� entry in endothelial cells. J Biol Chem.2004;279:20941–20949.

22. Paria BC, Vogel SM, Ahmmed GU, Alamgir S, Shroff J, Malik AB,Tiruppathi C. Tumor necrosis factor-alpha-induced TRPC1 expressionamplifies store-operated Ca2� influx and endothelial permeability. Am JPhysiol Lung Cell Mol Physiol. 2004;287:L1303–L1313.

23. Freichel M, Suh SH, Pfeifer A, Schweig U, Trost C, Weissgerber P, BielM, Philipp S, Freise D, Droogmans G, Hofmann F, Flockerzi V, Nilius B.Lack of an endothelial store-operated Ca2� current impairs agonist-dependent vasorelaxation in TRP4�/� mice. Nat Cell Biol. 2001;3:121–127.

24. Tiruppathi C, Freichel M, Vogel SM, Paria BC, Mehta D, Flockerzi V,Malik AB. Impairment of store-operated Ca2� entry in TRPC4(-/-) miceinterferes with increase in lung microvascular permeability. Circ Res.2002;91:70–76.

25. Cioffi DL, Wu S, Alexeyev M, Goodman SR, Zhu MX, Stevens T.Activation of the endothelial store-operated ISOC Ca2� channel requiresinteraction of protein 4.1 with TRPC4. Circ Res. 2005;97:1164–1172.

26. Trebak M, Hempel N, Wedel BJ, Smyth JT, Bird GS, Putney JW Jr.Negative regulation of TRPC3 channels by protein kinase C-mediatedphosphorylation of serine 712. Mol Pharmacol. 2005;67:558–563.

27. Trebak M, Lemonnier L, Dehaven WI, Wedel BJ, Bird GS, Putney JW,Jr. Complex functions of phosphatidylinositol 4,5-bisphosphate in regu-lation of TRPC5 cation channels. Pflugers Arch. 2008;Epub ahead ofprint.




28. Trebak M, St JBG, McKay RR, Birnbaumer L, Putney JW Jr. Signalingmechanism for receptor-activated canonical transient receptor potential 3(TRPC3) channels. J Biol Chem. 2003;278:16244–16252.

29. Trebak M, Bird GS, McKay RR, Putney JW Jr. Comparison of humanTRPC3 channels in receptor-activated and store-operated modes. Differ-ential sensitivity to channel blockers suggests fundamental differences inchannel composition. J Biol Chem. 2002;277:21617–21623.

30. Zweifach A, Lewis RS. Rapid inactivation of depletion-activated calciumcurrent (ICRAC) due to local calcium feedback. J Gen Physiol. 1995;105:209–226.

31. Bakowski D, Parekh AB. Permeation through store-operated CRACchannels in divalent-free solution: potential problems and implications forputative CRAC channel genes. Cell Calcium. 2002;32:379–391.

32. Hoth M, Penner R. Calcium release-activated calcium current in rat mastcells. J Physiol. 1993;465:359–386.

33. DeHaven WI, Smyth JT, Boyles RR, Putney JW, Jr. Calcium inhibitionand calcium potentiation of Orai1, Orai2, and Orai3 calcium release-ac-tivated calcium channels. J Biol Chem. 2007;282:17548–17556.

34. Prakriya M, Lewis RS. Separation and characterization of currentsthrough store-operated CRAC channels and Mg2�-inhibited cation(MIC) channels. J Gen Physiol. 2002;119:487–507.

35. Zhang SL, Yeromin AV, Zhang XH, Yu Y, Safrina O, Penna A, Roos J,Stauderman KA, Cahalan MD. Genome-wide RNAi screen of Ca(2�)influx identifies genes that regulate Ca(2�) release-activated Ca(2�)channel activity. Proc Natl Acad Sci U S A. 2006;103:9357–9362.

36. Vig M, DeHaven WI, Bird GS, Billingsley JM, Wang H, Rao PE,Hutchings AB, Jouvin MH, Putney JW, Kinet JP. Defective mast celleffector functions in mice lacking the CRACM1 pore subunit of store-operated calcium release-activated calcium channels. Nat Immunol. 2008;9:89–96.

37. Peinelt C, Lis A, Beck A, Fleig A, Penner R. 2-Aminoethoxydiphenylborate directly facilitates and indirectly inhibits STIM1-dependent gatingof CRAC channels. J Physiol. 2008;586:3061–3073.

38. Jho D, Mehta D, Ahmmed G, Gao XP, Tiruppathi C, Broman M, MalikAB. Angiopoietin-1 opposes vascular endothelial growth factor -inducedincrease in endothelial permeability by inhibiting TRPC1-dependent Ca2influx. Circ Res. 2005;96:1282–1290.

39. Wu S, Cioffi EA, Alvarez D, Sayner SL, Chen H, Cioffi DL, King J,Creighton JR, Townsley M, Goodman SR, Stevens T. Essential role of aCa2�-selective, store-operated current (ISOC) in endothelial cell perme-ability: determinants of the vascular leak site. Circ Res. 2005;96:856–863.

40. Boulay G, Brown DM, Qin N, Jiang M, Dietrich A, Zhu MX, Chen Z,Birnbaumer M, Mikoshiba K, Birnbaumer L. Modulation of Ca(2�) entryby polypeptides of the inositol 1,4, 5-trisphosphate receptor (IP3R) thatbind transient receptor potential (TRP): evidence for roles of TRP andIP3R in store depletion-activated Ca(2�) entry. Proc Natl Acad SciU S A. 1999;96:14955–14960.

41. Zarayskiy V, Monje F, Peter K, Csutora P, Khodorov B, Bolotina V.Store-operated Orai1 and IP3 receptor-operated TRPC1: separation ofSiamese twins. Channels. 2007;1:e1–e7.

42. Dietrich A, Kalwa H, Storch U, Mederos y Schnitzler M, Salanova B,Pinkenburg O, Dubrovska G, Essin K, Gollasch M, Birnbaumer L, Gud-ermann T. Pressure-induced and store-operated cation influx in vascularsmooth muscle cells is independent of TRPC1. Pflugers Arch. 2007;455:465–477.

43. Varga-Szabo D, Authi KS, Braun A, Bender M, Ambily A, Hassock SR,Gudermann T, Dietrich A, Nieswandt B. Store-operated Ca(2�) entry inplatelets occurs independently of transient receptor potential (TRP) C1.Pflugers Arch. 2008;Epub ahead of print.

44. Mori Y, Wakamori M, Miyakawa T, Hermosura M, Hara Y, Nishida M,Hirose K, Mizushima A, Kurosaki M, Mori E, Gotoh K, Okada T, FleigA, Penner R, Iino M, Kurosaki T. Transient receptor potential 1 regulatescapacitative Ca(2�) entry and Ca(2�) release from endoplasmicreticulum in B lymphocytes. J Exp Med. 2002;195:673–681.

45. Suh SH, Vennekens R, Manolopoulos VG, Freichel M, Schweig U,Prenen J, Flockerzi V, Droogmans G, Nilius B. Characterisation ofexplanted endothelial cells from mouse aorta: electrophysiology andCa2� signalling. Pflugers Arch. 1999;438:612–620.

46. Mehta D, Rahman A, Malik AB. Protein kinase C-alpha signals rho-guanine nucleotide dissociation inhibitor phosphorylation and rho acti-vation and regulates the endothelial cell barrier function. J Biol Chem.2001;276:22614–22620.




1

Supplementary Information

Material and Methods Supplement

Materials. Thapsigargin and 2-APB were purchased from Calbiochem, Fura-2AM was from Molecular Probes,

and GdCl3 was from Acros Organics. Thrombin and HE-EDTA were from Sigma. Cs BAPTA was from

Invitrogen. All other chemicals were from Fisher. eYFP (enhanced yellow fluorescent protein)-Stim1 was a gift

from Dr. Tobias Meyer (Stanford) and CFP (Cyan fluorescent protein)-Orai1 was from Dr. Jim Putney

(NIEHS/NIH). pRS Plasmids containing shRNAs were from OriGene and siRNAs purchased from Dharmacon

(Supplementary table).

Cell culture. Primary human umbilical vein endothelial cells (HUVECs) were obtained from Cascade

Biological (Portland, OR) and primary human pulmonary artery endothelial cells (HPAEC) obtained from

Cambrex Corporation. All ECs were maintained in EBM-2 supplemented with 2% fetal bovine serum (FBS)

and Bulletkit (Lonza, Switzerland). Rat basophilic leukemia (RBL-2H3) mast cells were obtained from ATCC

and cultured in EMEM with 2mmol/L L-glutamine and 10% FBS. All cell lines were maintained in a 37°C, 5%

CO2 humidified incubator.

Cell transfection. HUVECs were transfected using Amaxa Nucleofector II according to manufacturer’s

instructions. GFP cDNA (in pcDNA3, 0.5µg) was co-transfected as a marker for successful transfection. For

Orai1 and Stim1 RNA silencing experiments, cells were transfected with 10 µg of siRNA or 20µg of shRNA

(pRS vector backbone) per 1x106 cells, transferred to round coverslips and used after 72-96 hrs. Scrambled

siRNA sequences or empty pRS vector were used as controls for siRNA and shRNA transfections, respectively.

For overexpression experiments, cells were transfected with 1µg of plasmids containing eYFP-Stim1 or CFP--

Orai1, transferred to round coverslips and used within 24-48 hrs. For rescue experiments, 1x106 cells were

2

initially transfected with 10 µg siRNA against either Orai1 or Stim1. On day 4, cells were detached and divided

in 2 groups. Cells from the first group were seeded on coverslips, and cells in group 2 were ‘rescued’ by

transfection with 1µg CFP-Orai1 or eYFP-Stim1 before seeding on coverslips. Ca2+ imaging experiments were

conducted on the following day.

RT-PCR. Cultured cells were grown to ~ 80% confluence before RNA isolation. Total RNA was extracted

from cells using Qiagen RNeasy Mini Kit. cDNA was made from 0.5 µg RNA using oligo(dT) primers

(Invitrogen) and SuperScript III reverse transcriptase. PCR reactions were completed using illustra PuReTaq

Ready-To-Go PCR beads. Primer pairs used are listed in Supplementary table and PCR data of bands at

expected sizes, validating their use in real time PCR are shown in supplementary figure 1. The PCR

amplification included initial denaturation at 94°C for 5 minutes, then 40 cycles of denaturation at 94°C for 30

seconds, annealing at 54.3°C for 1 min, and extension at 72°C for 2 minutes. The PCR products were

visualized in a 1% agarose ethidium bromide gel.

Real-Time PCR. Quantitative PCR was done using a Bio-Rad iCycler and iCycler iQ Optical System

Software. The PCRs were performed using the Bio-Rad iQ SYBR Green Supermix. The PCR protocol started

with 5 minutes at 94°C followed by 45 cycles of 30 s at 94°C, 30 s at 54.3°C, and 45 s at 72°C. Expression of

mRNA were compared to the housekeeping gene GAPDH and were measured using comparative threshold

cycle values as previously described1.

Calcium measurements. Intracellular calcium measurements were performed as described previously2.

Briefly, cells were loaded in culture media with 4 µmol/L Fura-2AM for 30 min at 37°C and washed 3 times

with HBSS containing (mmol/L): NaCl, 140; KCl, 3; MgSO4, 1.2; HEPES, 10; Ca, 2; and glucose, 10 (pH was

adjusted to 7.4 with NaOH). Fluorescence experiments were recorded and analyzed using a digital fluorescence

imaging system (Intracellular imaging, OH).

3

Whole cell patch clamp electrophysiology. 2.5-4 MOhm patch pipettes were pulled from borosilicate glass

capillaries (World Precision Instruments) with P-97 flaming/brown micropipette puller (Sutter). Axopatch

200B and Digidata 1440A (Molecular Devices) with pCLAMP 10 software were used for data acquisition and

analysis. Immediately before the experiments, cells were washed with bath solution containing (mmol/L): NaCl,

140; KCl, 3; CsCl 10, MgSO4, 1.2; HEPES, 10; CaCl2, 10; and glucose, 10 (pH was adjusted to 7.4 with

NaOH). Pipette solution contained (in mmol/L): Cs-methanesulfonate, 145; Cs-BAPTA, 20; MgCl2, 8; HEPES,

10 (pH adjusted to 7.2 with CsOH). For thapsigargin-activated currents, the pipette solution was similar except

CaCl2 and Cs-BAPTA concentrations were 4 and 10 mmol/L respectively (calcium buffered at 98 nmol/L, using

the CaBuff software (G. Droogmans, Fysiologie, Leuven). Divalent-free bath solution contained (in mmol/L):

Na-methanesulfonate, 155; Na3HEDTA, 10; EDTA, 1; HEPES, 10 (pH=7.4, adjusted with HCl). Upon whole-

cell mode, cells were maintained at +30 mV holding potential during experiments and subjected to voltage

ramps from -100 mV to +60 mV lasting 250 ms every 3 s. Leak currents have been subtracted. Cell capacitance

were estimated by manual capacitance compensation immediately after break-in to whole cell mode and

recordings were initiated 30-45 s after break-in. Most of the cells have capacitances in the 40-80 pF range.

Liquid junction potentials were estimated using build-in plugin in Clampex and were found small, at 4.9 mV;

they were not corrected during experiments. However, representative traces were later corrected for liquid

junction potential.

Cell proliferation and cell-cycle analysis.

Cultured cells (1×106 cells) were treated with scrambled control, Stim1, Orai1 or Stim1 and Orai1 siRNA. Cell

viability was evaluated and quantified by cell counting following trypan blue exclusion. For cell cycle analysis,

cells were harvested for flow cytometry based propidium iodide assay.

Western Blots

4

Cells were lysed with buffer: 50 mmol/L Tris-HCl; 150 mmol/L NaCl; 1% triton X-100; 0.5% Sodium

deoxycholate; 0.1% SDS; 0.2 mmol/L EDTA; 1 mmol/L PMSF and complete protease inhibitors tablets

(Roche), pH 7.4. Proteins were subjected to SDS-PAGE (10%) blotted onto polyvinylidene fluoride

membranes. Membranes were blocked in 5% non fat dry milk (NFDM) dissolved in TBS with 0.1% Tween-20

(TTBS) for 2 h at room temperature, followed by overnight incubation (4 °C) with primary antibodies in TTBS,

2% NFDM, and 1 h at room temperature with a horseradish peroxidase–conjugated anti-mouse or anti-rabbit

IgG (1:20000; Jackson). A Monoclonal Anti-β-Actin antibody (1: 2000; Sigma) was used for loading control.

Detection was performed with the ECL reagent (Amersham). Bands were quantified using the Image J software.

The primary antibodies used: GOK/Stim1 (1:250, BD Biosciences); Orai1-NT (1: 1000, ProSci); TRPC1

(1:500, Alomone labs); TRPC4 (1:500, Alomone labs).

Statistical analysis.

Statistical analysis was performed using one way ANOVA. All values are reported as mean ± SE. Differences

between conditions were considered significant at P<0.05.

Legends to supplementary figures

Supplementary Figure 1. HUVECs express mRNA for TRPCs, Stim1 and Orai1. Primer pairs and

experimental conditions used in real time PCR were first validated using PCR; all primers recognize a single

band at the expected molecular weight.

Supplementary Figure 2. SOCE in response to thapsigargin (A) and thrombin (B) were completely

blocked when HUVECs were pre-incubated with either 10 μmol/L Gd3+ or 30 μmol/L 2-APB. Data are

representative of at least 3 independent experiments.

5

Supplementary Figure 3. Thapsigargin and thrombin activate SOCE in human pulmonary artery

endothelial cells (HPAEC). A and B, passive store depletion by 2 µmol/L thapsigargin (TG) induced SOCE

that was inhibited by 30 µmol/L 2-APB (A) and 10 µmol/L Gd3+ (B). C and D, thrombin (100 nmol/L)

induced SOCE that was inhibited by the same concentrations of 2-APB (C) and Gd3+ (D). Data in each

panel is an average of at 7-20 cells and are representative of 3 independent experiments.

Supplementary Figure 4. A, current voltage (I/V) relationship of the CRAC currents recorded under DVF

conditions before and after leak subtraction. The basal leak current ramp is also depicted. B and C, siStim1

(B) and siOrai1 (C) sequences were tested for their off-targets effects on the mRNA levels of TRPC1,

TRPC4, Stim2, Orai2 and Orai3. Data are representative of 3 independent experiments.

Supplementary Figure 5. A, shRNA against either Stim1 or Orai1 greatly inhibited SOCE in response to

thapsigargin. B, similar results were obtained when HUVECs were challenged with thrombin (100 nmol/L).

C, Stim1 and Orai1 mediate SOC in another EC type, HPAECs. Silencing of either Stim1 or Orai1 using

siRNA greatly inhibited thrombin-activated SOCE in HPAECs. Data are representative of 3 independent

experiments.

Supplementary Figure 6. Western blot showing native Stim1 and ectopically expressed eYFP-Stim1 in

HUVECs. Native Stim1 in RBL is also shown. Please note while Ca2+ imaging and patch clamp experiments

are performed on cells that show easily discernible eYFP fluorescence, the levels of eYFP-Stim1 revealed

by western blots reflect the total cell population where only a proportion of cells express eYFP-Stim1-

encoding plasmid. Data are representative of 3 independent experiments.

Supplementary Figure 7. The integral version of western blot membranes assaying for TRPC1 (A) and

TRPC4 (C) knockdown after specific siRNA transfection, using specific antibodies at the dilution reported

in the methods section. The westerns clearly show the antibodies recognizing bands at the expected

6

molecular weight (~110 KD for TRPC1 and ~ 100 KD for TRPC4; predicted molecular weights are: 87-

91KD for TRPC1 and 95-112KD for TRPC4 depending on processing; glycosylation can further increase

the molecular weight; http://www.uniprot.org/uniprot/). The same membrane were stripped and re-probed

with the anti-actin antibody (depicted in B and D for siTRPC1 and siTRPC4 respectively).

Supplementary Figure 8. Anti-TRPC4 antibody (Alomone Labs) was validated for specificity using

overexpression with 1 µg of human TRPC4 cloned in pCDNA3 (pcDNA3-hTRPC4) followed by western

blots. Overexpression caused an increase intensity of a ~ 100 KD band corresponding to human TRPC4.

Supplementary Figure 9. Role of TRPC1, TRPC4 and TRPC6 in EC proliferation. Proliferation assays

were performed as described in Figure 8. Four groups of cells were transfected with the following siRNA:

control, TRPC1, TRPC4, and TRPC6. At time 0, approximately 10,000 cells were seeded per well (9.6 cm2)

in triplicate. At times indicated, cells were detached and total number of cells per well counted after trypan

blue exclusion. Data are representative of three independent experiments (one way ANOVA, *p<0.05).

7

Supplementary Table PCR Primers

Forward (5'-3') Reverse (3'-5') Length (bp)

hGAPDH AACTGCTTAGCACCCCTGGC ATGACCTTGCCCACAGCCTT 199 hTRPC1 GATGCATTCCATCCTACACT TACACAGTCCTTCTGCTCCT 249 hTRPC3 CAAGAATGACTATCGGAAGC GCCACAAACTTTTTGACTTC 201 hTRPC4 GGACTTCAGGACTACATCCA ACGCAGAGAACTGAAGATGT 201 hOrai1 AGGTGATGAGCCTCAACGAG CTGATCATGAGCGCAAACAG 238 hOrai2 GCAGCTACCTGGAACTGGTC CGGGTACTGGTACTGCGTCT 176 hOrai3 AAGCTCAAAGCTTCCAGCCGC GGTGGGTACTCGTGGTCACTCT 100 hStim1 GCGGGAGGGTACTGAG TCCATGTCATCCACGTCGTCA 533 hStim2 CCCTCACCACCCGCAACA GATGTGTGGCGAGGTTAAGGC 461 siRNA Sequences Scrambled UAGCGACUAAACACAUCAA TRPC1-1 GAGAAATGCTGTTACCATA TRPC1-2 GCGACAAGGGTGACTATTA TRPC4-1 GGTCAGACTTGAACAGGCA TRPC4-2 GGCTCAGTTCTATTACAAA hStim1-1 AAGGCUCUGGAUACAGUGCUC hStim1-2 AAGGGAAGACCUCAAUUACCA hOrai1-1 CGUGCACAAUCUCAACUCG hOrai1-2 CUGUCCUCUAAGAGAAUAA hStim2-1 UGAGAAGAUCUGUGGCUUU hStim2-2 GGGACUGUUUUCACUUUUA

shRNA Sequences hOrai1-1 TGGATCGGCCAGAGTTACTCCGAGGTGAT hOrai1-2 GACCGACAGTTCCAGGAGCTCAACGAGCT hStim1-1 CTGAGCAGAGTCTGCATGACCTTCAGGAA hStim1-2 GATGATGCCAATGGTGATGTGGATGTGGA

Supplementary Table. Sequences of primers used in PCR and real time PCR. As a control, mRNA levels for TRPC3 were monitored in real time PCR experiments. GAPDH, TRPC1, TRPC3 and TRPC4 primers were described by Bergdahl et al3, and Orai3 primers by Gwack et al4; the other primers were designed using the primer3 software available from MIT. SiRNA and shRNA sequences used are also listed. SiRNA targeting Stim1#1 was described by Roos et al5 and Stim1 #2 by Peel et al6. Both siRNA against Orai1 were described previously by Vig et al7. The other siRNA sequences were designed using the siDESIGN CENTER on the Dharmacon website. All siRNA were purchased from Dharmacon while shRNA constructs were from Origene.

8

References

1. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. Dec 2001;25(4):402-408.

2. Trebak M, St JBG, McKay RR, Birnbaumer L, Putney JW, Jr. Signaling mechanism for receptor-activated canonical transient receptor potential 3 (TRPC3) channels. J Biol Chem. May 2 2003;278(18):16244-16252.

3. Bergdahl A, Gomez MF, Wihlborg AK, Erlinge D, Eyjolfson A, Xu SZ, Beech DJ, Dreja K, Hellstrand P. Plasticity of TRPC expression in arterial smooth muscle: correlation with store-operated Ca2+ entry. Am J Physiol Cell Physiol. Apr 2005;288(4):C872-880.

4. Gwack Y, Srikanth S, Feske S, Cruz-Guilloty F, Oh-hora M, Neems DS, Hogan PG, Rao A. Biochemical and functional characterization of Orai proteins. J Biol Chem. Jun 1 2007;282(22):16232-16243.

5. Roos J, DiGregorio PJ, Yeromin AV, Ohlsen K, Lioudyno M, Zhang S, Safrina O, Kozak JA, Wagner SL, Cahalan MD, Velicelebi G, Stauderman KA. STIM1, an essential and conserved component of store-operated Ca2+ channel function. J Cell Biol. May 9 2005;169(3):435-445.

6. Peel SE, Liu B, Hall IP. A key role for STIM1 in store operated calcium channel activation in airway smooth muscle. Respiratory research. 2006;7:119.

7. Vig M, Peinelt C, Beck A, Koomoa DL, Rabah D, Koblan-Huberson M, Kraft S, Turner H, Fleig A, Penner R, Kinet JP. CRACM1 is a plasma membrane protein essential for store-operated Ca2+ entry. Science. May 26 2006;312(5777):1220-1223.

300 bp

200 bp

GA

PD

H

TR

PC

1

TR

PC

3

TR

PC

4

600 bp

300 bp

200 bp

GA

PD

H

Ora

i1

Stim

1

Online Figure I

A

B

A

B

Online Figure II

100 200 300 400 500 6000.5

1.0

1.5

2.0

F340/F

380

Time, s

Ca2+

TG

Control

+Gd3+

+2-APB

200 400 6000.5

1.0

1.5

2.0

F340/F

380

Time, s

Ca2+

THR

+2-APB

+Gd3+

Control

0 400 800 1200 16000.6

0.8

1.0

1.2

1.4

1.6

1.8

Time, sec

Gd3+

Ca2+

THR

F340/F

380

0 600 1200 18000.6

0.8

1.0

1.2

1.4

1.6

1.8

2APB

TG

Ca2+

F340/F

380

Time, sec

0 400 800 1200 1600

0.6

0.8

1.0

1.2

1.4

1.6

1.8

2-APB

Ca2+

THR

F3

40

/F3

80

Time, sec

0 600 1200 18000.6

0.8

1.0

1.2

1.4

1.6

1.8

Gd3+

Ca2+

TG

F340/F

380

Time, sec

A

D

B

C

Online Figure III

0.0

0.5

1.0

1.5

2.0

TRP

C4

TRP

C1

Ora

i3

Ora

i2

Stim

2

Rela

tive

mR

NA

level

Ora

i1

siOrai1

0.0

0.5

1.0

1.5

2.0

Stim

1

Stim

2

Ora

i2

Ora

i3

TRP

C1

TRP

C4

Re

lative

mR

NA

leve

l

siStim1

C

Online Figure IV

B

-100 -80 -60 -40 -20 0 20 40 60

-2.0

-1.5

-1.0

-0.5

0.0

0.5

1.0

mV

pA

/pFleak

DVF

Subtracted

A

Online Figure V

A

C

B

0 200 400 600 800 1000 12000.0

0.5

1.0

1.5

2.0

2.5

Ca2+

THR

F340/F

380

Time, min

siSTIM1siORAI1

Control

0 200 400 600 800 1000 12000.0

0.5

1.0

1.5

2.0

2.5

F340/F

380

Time, s

Control

shSTIM1shORAI1

THR

Ca2+

400 600 800 1000 12000.0

0.5

1.0

1.5

2.0

2.5

Control

F3

40

/F3

80

Time, s

TGCa

2+

shSTIM1shORAI1

STIM1

Actin

RB

LR

BL

HU

VE

CW

T

HU

VE

CW

T

HU

VE

C

YH

UV

EC

FPS

tim1

STIM1~80 KD

Actin~ 45 KD

eYFP-STIM1~ 120 KD

Online Figure VI

A. Anti-TRPC1 C. Anti-TRPC4

B. Anti-Actin D. Anti-Actin

WT

Scr

am

ble

dS

iTR

PC

1

100

KD

WT

Scr

am

ble

dS

iTR

PC

4

——

150

100

KD

——

WT

Scr

am

ble

dS

iTR

PC

1

WT

Scr

am

ble

dS

iTR

PC

4

Online Figure VIIOnline Figure VII

50

KD

—

—37

50

KD

—

—37

150

Online Figure VIII

TRPC4~100 KD

Actin~45 KD

WT

1g

pcDNA3-

hTRPC

4

�

Control siTRPC1 siTRPC4 siTRPC60

10000

20000

30000

40000

50000

60000

Ce

lln

um

be

r

48 hrs

72 hrs

96 hrs

Time post transfection

Online Figure IX

HUVEC

**

** * *

Motiani and Mohamed TrebakIskandar F. Abdullaev, Jonathan M. Bisaillon, Marie Potier, Jose C. Gonzalez, Rajender K.

for Endothelial Cell ProliferationStim1 and Orai1 Mediate CRAC Currents and Store-Operated Calcium Entry Important

Print ISSN: 0009-7330. Online ISSN: 1524-4571 Copyright © 2008 American Heart Association, Inc. All rights reserved.is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Circulation Research

doi: 10.1161/01.RES.0000338496.95579.562008;103:1289-1299; originally published online October 9, 2008;Circ Res.

http://circres.ahajournals.org/content/103/11/1289World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circres.ahajournals.org/content/suppl/2008/10/10/01.RES.0000338496.95579.56.DC1.htmlData Supplement (unedited) at:

http://circres.ahajournals.org//subscriptions/

is online at: Circulation Research Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer about this process is available in the

located, click Request Permissions in the middle column of the Web page under Services. Further informationEditorial Office. Once the online version of the published article for which permission is being requested is

can be obtained via RightsLink, a service of the Copyright Clearance Center, not theCirculation Researchin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:


http://circres.ahajournals.org/content/103/11/1289

http://circres.ahajournals.org/content/suppl/2008/10/10/01.RES.0000338496.95579.56.DC1.html

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://circres.ahajournals.org//subscriptions/


Documents

Stim1 and Orai1 Mediate CRAC Currents and Store … · Stim1 and Orai1 Mediate CRAC Currents and Store-Operated Calcium Entry Important for Endothelial Cell Proliferation Iskandar