View
256
Download
0
Tags:
Embed Size (px)
Citation preview
Sequence Motifs
Motifs
• Motifs represent a short common sequence– Regulatory motifs (TF binding sites) – Functional site in proteins (DNA binding motif)
Regulatory Motifs
• Transcription Factors bind to regulatory motifs – Motifs are 6 – 20 nucleotides long– Activators and repressors– Usually located near target gene, mostly
upstreamTranscription Start Site
SBFmotif
MCM1motif
Gene X
MCM1 SBF
E. Coli promoter sequences
DNA binding Motif Zn finger C2H2
Challenges
• How to recognize a regulatory motif?
• Can we identify new occurrences of known motifs in genome sequences?
• Can we discover new motifs within upstream sequences of genes?
1. Motif Representation
• Exact motif: CGGATATA• Consensus: represent only
deterministic nucleotides.– Example: HAP1 binding sites in 5
sequences.• consensus motif: CGGNNNTANCGG • N stands for any nucleotide.
• Representing only consensus loses information. How can this be avoided?
CGGATATACCGG
CGGTGATAGCGG
CGGTACTAACGG
CGGCGGTAACGG
CGGCCCTAACGG
------------
CGGNNNTANCGG
TTGACA
-35
TATAAT
-10
Transcription start site
Representing the motif as a profile
-35 -10
A
T
GC
1 2 3 4 5 6
A
T
GC
1 2 3 4 5 6
Based on ~450 known promoters
0.1 0.1 0.1 0.5 0.2 0.5
0.7 0.7 0.2 0.2 0.2 0.2
0.1 0.1 0.5 0.1 0.1 0.2
0.1 0.1 0.2 0.2 0.5 0.1
0.1 0.7 0.2 0.6 0.5 0.1
0.7 0.1 0.5 0.2 0.2 0.8
0.1 0.1 0.1 0.1 0.1 0.0
0.1 0.1 0.2 0.1 0.1 0.1
1 2 3 4 5
A 10 25 5 70 60
C 30 25 80 10 15
T 50 25 5 10 5
G 10 25 10 10 20
PSPM – Position Specific Probability Matrix
• Represents a motif of length k (5)• Count the number of occurrence of each nucleotide in
each position
1 2 3 4 5
A 0.1 0.25 0.05 0.7 0.6
C 0.3 0.25 0.8 0.1 0.15
T 0.5 0.25 0.05 0.1 0.05
G 0.1 0.25 0.1 0.1 0.2
PSPM – Position Specific Probability Matrix
• Defines Pi{A,C,G,T} for i={1,..,k}.
– Pi (A) – frequency of nucleotide A in position i.
Graphical Representation – Sequence Logo
• Horizontal axis: position of the base in the sequence.
• Vertical axis: amount of information.
• Letter stack: order indicates importance.
• Letter height: indicates frequency.
• Consensus can be read across the top of the letter columns.
Identification of Known Motifs within Genomic Sequences
• Motivation: – identification of new genes controlled by the same
TF.– Infer the function of these genes.– enable better understanding of the regulation
mechanism.
1 2 3 4 5
A 0.1 0.25 0.05 0.7 0.6
C 0.3 0.25 0.8 0.1 0.15
T 0.5 0.25 0.05 0.1 0.05
G 0.1 0.25 0.1 0.1 0.2
PSPM – Position Specific Probability Matrix
• Each k-mer is assigned a probability. – Example: P(TCCAG)=0.5*0.25*0.8*0.7*0.2
1 2 3 4 5
A 0.1 0.25 0.05 0.7 0.6
C 0.3 0.25 0.8 0.1 0.15
T 0.5 0.25 0.05 0.1 0.05
G 0.1 0.25 0.1 0.1 0.2
Detecting a Known Motif within a Sequence using PSPM
• The PSPM is moved along the query sequence.• At each position the sub-sequence is scored for a
match to the PSPM.• Example:
sequence = ATGCAAGTCT…
• The PSPM is moved along the query sequence.• At each position the sub-sequence is scored for a
match to the PSPM.• Example:
sequence = ATGCAAGTCT…• Position 1: ATGCA
0.1*0.25*0.1*0.1*0.6=1.5*10-4
1 2 3 4 5
A 0.1 0.25 0.05 0.7 0.6
C 0.3 0.25 0.8 0.1 0.15
T 0.5 0.25 0.05 0.1 0.05
G 0.1 0.25 0.1 0.1 0.2
Detecting a Known Motif within a Sequence using PSPM
• The PSPM is moved along the query sequence.• At each position the sub-sequence is scored for a match to
the PSPM.• Example:
sequence = ATGCAAGTCT…• Position 1: ATGCA
0.1*0.25*0.1*0.1*0.6=1.5*10-4
• Position 2: TGCAA 0.5*0.25*0.8*0.7*0.6=0.042
1 2 3 4 5
A 0.1 0.25 0.05 0.7 0.6
C 0.3 0.25 0.8 0.1 0.15
T 0.5 0.25 0.05 0.1 0.05
G 0.1 0.25 0.1 0.1 0.2
Detecting a Known Motif within a Sequence using PSPM
Detecting a Known Motif within a Sequence using PSSM
Is it a random match, or is it indeed an occurrence of the motif?
PSPM -> PSSM (Probability Specific Scoring Matrix)– odds score matrix: Oi(n) where n {A,C,G,T} for i={1,..,k}
– defined as Pi(n)/P(n), where P(n) is background frequency.
Oi(n) increases => higher odds that n at position i is part of a real motif.
1 2 3 4 5
A 0.1 0.25 0.05 0.7 0.6
1 2 3 4 5
A 0.4 1 0.2 2.8 2.4
1 2 3 4 5
A -1.322 0 -2.322 1.485
1.263
PSSM as Odds Score Matrix• Assumption: the background frequency of each
nucleotide is 0.25.
1. Original PSPM (Pi):
2. Odds Matrix (Oi):
3. Going to log scale we get an additive score,Log odds Matrix (log2Oi):
1 2 3 4 5
A -1.32 0 -2.32 1.48 1.26
C 0.26 0 1.68 -1.32 -0.74
T 1 0 -2.32 -1.32 -2.32
G -1.32 0 -1.32 -1.32 -0.32
Calculating using Log Odds Matrix• Odds 0 implies random match;
Odds > 0 implies real match (?).• Example: sequence = ATGCAAGTCT…• Position 1: ATGCA
-1.32+0-1.32-1.32+1.26=-2.7odds= 2-2.7=0.15
• Position 2: TGCAA1+0+1.68+1.48+1.26 =5.42odds=25.42=42.8
Calculating the probability of a Match
ATGCAAG
• Position 1 ATGCA = 0.15
Calculating the probability of a Match
ATGCAAG
• Position 1 ATGCA = 0.15
• Position 2 TGCAA = 42.3
Calculating the probability of a Match
ATGCAAG
• Position 1 ATGCA = 0.15
• Position 2 TGCAA = 42.3
• Position 3 GCAAG =0.18
Calculating the probability of a match
ATGCAAG
• Position 1 ATGCA = 0.15
• Position 2 TGCAA = 42.3
• Position 3 GCAAG =0.18
P (i) = S / (∑ S)Example 0.15 /(.15+42.8+.18)=0.003
P (1)= 0.003P (2)= 0.993P (3) =0.004
Building a PSSM
• Collect all known sequences that bind a certain TF.
• Align all sequences (using multiple sequence alignment).
• Compute the frequency of each nucleotide in each position (PSPM).
• Incorporate background frequency for each nucleotide (PSSM).
Finding new Motifs
• We are given a group of genes, which presumably contain a common regulatory motif.
• We know nothing of the TF that binds to the putative motif.
• The problem: discover the motif.
Example
Predicting the cAMP Receptor Protein (CRP) binding site motif
Extract experimentally defined CRP Binding Sites GGATAACAATTTCACAAGTGTGTGAGCGGATAACAAAAGGTGTGAGTTAGCTCACTCCCCTGTGATCTCTGTTACATAGACGTGCGAGGATGAGAACACAATGTGTGTGCTCGGTTTAGTTCACCTGTGACACAGTGCAAACGCGCCTGACGGAGTTCACAAATTGTGAGTGTCTATAATCACGATCGATTTGGAATATCCATCACATGCAAAGGACGTCACGATTTGGGAGCTGGCGACCTGGGTCATGTGTGATGTGTATCGAACCGTGTATTTATTTGAACCACATCGCAGGTGAGAGCCATCACAGGAGTGTGTAAGCTGTGCCACGTTTATTCCATGTCACGAGTGTTGTTATACACATCACTAGTGAAACGTGCTCCCACTCGCATGTGATTCGATTCACA
Create a Multiple Sequence Alignment GGATAACAATTTCACATGTGAGCGGATAACAATGTGAGTTAGCTCACTTGTGATCTCTGTTACACGAGGATGAGAACACACTCGGTTTAGTTCACCTGTGACACAGTGCAAACCTGACGGAGTTCACAAGTGTCTATAATCACGTGGAATATCCATCACATGCAAAGGACGTCACGGGCGACCTGGGTCATGTGTGATGTGTATCGAATTTGAACCACATCGCAGGTGAGAGCCATCACATGTAAGCTGTGCCACGTTTATTCCATGTCACGTGTTATACACATCACTCGTGCTCCCACTCGCATGTGATTCGATTCACA
A C G T
1 -0.43 0.1 -0.46 0.55
2 1.37 0.12 -1.59 -11.2
3 1.69 -1.28 -11.2 -1.43
4 -1.28 0.12 -11.2 1.32
5 0.91 -11.2 -0.46 0.47
6 1.53 -1.38 -1.48 -1.43
7 0.9 -0.48 -11.2 0.12
8 -1.37 -1.28 -11.2 1.68
9 -11.2 -11.2 1.73 -0.56
10 -11.2 -0.51 -11.2 1.72
11 -0.48 -11.2 1.72 -11.2
12 1.56 -1.59 -11.2 -0.46
13 -0.51 -0.38 -0.55 0.88
14 -11.2 0.5 0.57 0.13
15 0.17 -0.51 0.12 0.12
16 0.9 -11.2 0.5 -0.48
17 0.17 0.16 0.06 -0.48
18 -0.4 -0.38 0.82 -0.48
19 -1.38 -1.28 -11.2 1.68
20 -1.48 1.7 -11.2 -1.38
21 1.5 -1.38 -1.43 -1.28
Generate a PSSM
XXXXXTGTGAXXXXAXTCACAXXXXXXXXXXXXACACTXXXXTXGATGTXXXXXXX
PROBLEMS…
• When searching for a motif in a genome using PSSM or other methods – the motif is usually found all over the place
->The motif is considered real if found in the vicinity of a gene.
• Checking experimentally for the binding sites of a specific TF (location analysis) – the sites that bind the motif are in some cases similar to the PSSM and sometimes not!
Computational Methods• This problem has received a lot of attention from
CS people.• Methods include:
– Probabilistic methods – hidden Markov models (HMMs), expectation maximization (EM), Gibbs sampling, etc.
– Enumeration methods – problematic for inexact motifs of length k>10. …
• Current status: Problem is still open.
Tools on the Web• MEME – Multiple EM for Motif Elicitation.
http://meme.sdsc.edu/meme/website/• metaMEME- Uses HMM method
http://meme.sdsc.edu/meme• MAST-Motif Alignment and Search Tool
http://meme.sdsc.edu/meme
• TRANSFAC - database of eukaryotic cis-acting regulatory DNA elements and trans-acting factors. http://transfac.gbf.de/TRANSFAC/
• eMotif - allows to scan, make and search for motifs in the protein level. http://motif.stanford.edu/emotif/