Plenary Lectures

P2.1

Transgenic crop plants: a new promising technology or threat to man and environment?

Andrzej Anioł

Department of Plant Biochemistry and Physiology, Plant Breeding and Acclimatization Institute, Radzików, 00-870 Błonie, Polande-mail: aaniol@ihar.edu.pl

Since the beginning of agriculture plants and animals used by man were genetically modified, sometimes very fundamentally. As a consequence cultivars of cultivated plants rarely can survive outside agriculture. Genetic modifications selected by man were those which in-creased the agricultural productivity of plants. The con-stant progress in the productivity of plant production was the basis for human advances in civilization. To meet the food demands of rising human populations was and still is the main challenge in agriculture, this is illustrated by the following fact: Had 1961 average world cereal yields still prevailed till now, nearly 850 million ha of addition-al land of the same quality would have been needed to equal 1999 harvest [1]. It is obvious that such surplus of good agricultural land is not available or would be taken by further deforestation.Practices of high-input crop production are meeting their limits due to economic and environmental constraints therefore the necessary increase in food production might be achieved by better utilization of biological potential of our crops [2]. The new technology emerging from ad-vances of molecular biology opens such possibilities.Crop cultivars developed with methods of molecular biology are named as transgenic cultivars. Transgenesis opens new possibilities for development of new combina-tion of genes, which were not possible to obtain in natural recombination processes. It, therefore, opens possibilities of creation of novel cultivars not only with improved agronomic characteristics and better quality as food and feed but also suitable for non-food use.These new possibilities of novel gene combinations which are so promising for plant breeders at the same time induced strong opposition to this technology based on potential fears of misuse and unpredictable hazards. In order to minimize the risk, the system of legal and administrative measures was elaborated for control and monitoring of utilization of modern biotechnology in food /feed production and other economic activities.In year 2005 transgenic cultivars were grown on almost 100 million ha around the world [3].

In this paper the present status of plant biotechnology (“green” biotech) will be described and possible develop-ments in near future will be indicated.Public concerns and objections connected with this new technology will be summarized and regulatory, admin-istrative and technical means to minimize possible risk involved will be discussed.1. Borlaug NE (2000) Plant Physiol. 124:487-490.2. Pinstrup-Andersen P, Pandya-Lorch R and Rosegrant MW (1999) World food Prospects: critical issues for the early twenty-first century. International Food Policy Research Institute, Wash-ington D.C., October 1999.3. James C (2005) ISAAA Brief 34.

P2.2

What determines public perception of agrobiotechnology?

Tomasz Twardowski

Institute of Biorganic Chemistry, Polish Academy of Sciences and Technical University of Łódź, Noskowskiego 12, 61-704 Poznań, Polande-mail: twardows@ibch.poznan.pl

Biotechnology has been identified as one of the key tech-nologies for the decades to come. The scientific society recognized the three key components of the „value added chain” represented by modern biotechnology: science + technology + public perception. Public perception is of key importance. Modern innova-tive technologies, e.g. genetic engineering, make a sig-nificant effect on the public opinion and reflect the public perception of the future prospects and the conversion of attitudes. The surveys of public perception have been con-ducted in Poland systematically since 1998. The opinions and attitudes of general public and farmers revealed in a representative national surveys show a lot of inconsisten-cies. The public in general takes biotechnology to be one of a key technology for the future. We have found a two fold decrease of trust in biotechnology and biotechnology products in 2005 in comparison to 1999. Up to 80 % of the society is against GM food. About 2/3 of farmers would like to have the right of choice between GM and non-GM plants. Should farmers have a possibility to use GM plants? Will be a farm more profitable with GM plants? We have different answers from general public and from farmers [as producers] and experts. There is significant difference between acceptance of bio-medicine/health-care and agribiotech [red vs green biotech].Unfortunately, the scientific data and facts presented by scientists are not the most important arguments in public debate. I am deeply convinced that is not possible to “run away” from green biotechnology as background for the development of white and red biotechnology. However, in the light of common opinion we can expect that the fu-

Section 2: Biotechnology in plant breeding and food production

22 2007Abstracts

ture of biotechnology depends on common opinion much more than on science and technology.

Panel I: Transgenic plants – applications in plant research and breeding practice

Oral presentations

O2.1.1

The experience with the transgenic plants – what they really are?

Stefan Malepszy, Marcin Filipecki, Grzegorz Bartoszewski

Department of Plant Genetics Breeding and Biotechnology, Warsaw University of Life Sciences, ul. Nowoursynowska 159; PL 02-776 Warsaw, Polande-mail: stefan_malepszy@sggw.pl

Transgenic plants are used for two major purposes: basic research and crop improvement. The first one is genetics where transgenic plants are used in gene function studies and second one is a production of genetically modified (GM) plant varieties for agriculture. The last one is called transgenic breeding. Transgenic breeding is almost 20 year old and it has began when the first GM plant varie-ties were released. Therefore transgenic breeding is very novel and characterized by some fundamental differenc-es when compared to its “older sister”, namely conven-tional breeding.In our group we obtain transgenic cucumbers for both purposes mentioned above. Our experiences with the introduction of more as a dozen gene constructs will be presented. Several issues related to cucumber transfor-mation will be discussed. The first one concerns advan-tages and disadvantages of two transformation systems – leaf microexplants and embryogenic suspension culture transformation. The second one concerning variation of the transgene expression level in different transgenic lines and the relationship between genetic background of transgene recipient and the transgenic plant phenotype. The results of improvement of cold resistance and fruit set without pollination (parthenocarpy) will be discussed in more detail.

O2.1.2

Genetic modification of barley and wheat for improved N and P utilization in livestock

Preben Bach Holm, Henrik Brinch-Pedersen, Giuseppe Dionisio, Mette Lange, Eva Vincze, Michael Hansen and Per Gregersen

University of Aarhus, Faculty of Agricultural Sciences, Institute of Genetics and Biotechnology, Research Centre Flakkebjerg, DK-4200 Slagelse, Denmarke-mail: prebenb.holm@agrsci.dk

Introduction: Barley and wheat are used extensively as feed for livestock, in particular pigs and chicken. How-ever, from a nutritional point of view the two cereals have a number of shortcomings. The primary storage form of phosphate in the cereal grain, phytic acid, is indigest-ible for monogastric animals. In consequence, inorganic phosphate, a non-renewable resource, has to be added to the feed and animal waste contains large amounts of phosphate and phytic acid that is transferred to the envi-ronment. Secondly, barley and wheat have a low amount of lysine, threonine and methionine requiring large-scale supplementation with soybean protein and amino ac-ids. At the same time there is an excess of proline and glutamine that is not utilized and thereby makes a signifi-cant contribution to the environmental N load. Aim of the study: The general objective of our research is to improve the phytase potential and the amino acid composition of the barley and wheat grain though ge-netic modification. Methods: Transformation of barley and wheat was per-formed by biolistics and Agrobacterium. For gene expres-sion profiling we used custom made cDNA or Affymetrix arrays. Results: In a series of experiments [1–4] we have shown that high level phytase activities can be achieved in the wheat and barley endosperm by transformation with microbial or synthetic phytase encoding genes. Lines expressing a synthetic heat stable phytase posses sub-stantial phytase activity even after prolonged heating [4]. Immuno-localization studies have revealed that phytas-es targeted to the apoplast are deposited in the storage protein vacuoles [4]. Profiling of gene expression dur-ing grain development revealed no changes compared to the mother cultivar [5]. Recently, we have cloned and characterized the endogenous phytase genes of barley and wheat [6] and are currently exploring inter- and in-traspecific differences in phytase activities among the ce-reals. Antisense mediated inhibition of the biosynthesis of an abundant barley storage protein, C-hordein, led to changes in the general storage protein profile and a nu-tritionally improved amino acid profile. Gene expression profiling revealed major changes in the transcription of genes in a range of biosynthetic pathways (Lange et al. in preparation, Hansen et al. in preparation). Conclusions: The studies described illustrate that genetic modification of barley and wheat for improved phosphate bioavailability and amino acid composition is feasible with potentially far reaching consequences for improving animal nutrition and reducing the environmental N and P load of livestock production.1. Brinch-Pedersen H, Olesen A, Rasmussen SK, Holm PB (2000) Mol. Breed. 6: 195-206.2. Brinch-Pedersen H, Sørensen LD Holm PB (2002) TIPS 7: 118-125.3. Brinch-Pedersen H, Hatzak F, Sørensen LD, Holm PB (2003) Transgen. Res. 12: 649-659.4. Brinch-Pedersen H, Hatzack F, Stöger E, Arcalis E, Pontopidan K, Holm PB (2006) J. Agr. Food Chem. 54: 4624-4632.5. Gregersen PL, Brinch-Pedersen H, Holm PB (2005) Transg. Res. 14: 887-905.6. Dionisio G, Holm PB, Brinch-Pedersen H (2006) Plant Biotech. J. in press.

Vol. 54 23EUROBIOTECH 2007

O2.1.3

Production of biopharmaceuticals in transgenic crop plants

Józef Kapusta

Institute of Biotechnology and Antibiotics, Warsaw and Institute of Plant Genetics, PAS, Poznan, Polande-mail: kapustaj@iba.waw.pl

For a number of reasons plants are considered as nearly ideal bioreactors for production of biopharmaceuticals for human and animal health protection and possibly for human therapy. The most significant characteristics of plants as carrier of medicinally-useful proteins is that they being eukaryo-tic organisms are able to efficiently produce native form both prokaryotic and eucaryotic-origin pharmaceuticals. Another important features of plants that it can be a safe producer of recombinant protein of highly pathogenic vi-ruses like HBV, HCV or HIV. Some of those plant-derived components are considered for vaccination or restore to health since specially a few crop plants are itself health beneficial and all are nominally free of health harmful components. It is believed that plant-derived vaccines and therapeutics will be widespread in the next decades. For more than 15 years, laboratories in the world have been successfully produce a vaccine components to combat with hepatitis B virus (HBV), human papillomavirus (HPV), rabies virus, Bacillus anthracis (anthrax), diarrhea disease caused by intestinal microbial infection and many others. To date, at last eight plant-derived antibodies or antibody deriva-tives have reached advanced stages of development. It is predicted that more than 80 therapeutic monoclonal anti-bodies (MAbs) could be on the market by 2010 requiring production of more than 10 metric tons of MAbs annu-ally. Today the 12 therapeutic MAbs that are approved for marketing are produced applying mammalian cell culture facilities. But in the future, a “plant bioreactor” can be employed as an efficient, cost effective, high capac-ity alternative to traditional methods.

O2.1.4

Improving carrot via genetic transformation

Rafał Barański

Department of Genetics, Plant Breeding and Seed Science, Faculty of Horticulture, Agricultural University of Krakow, Al. 29 Listopada 54, 31-425 Krakow, Polande-mail: baranski@ogr.ar.krakow.pl

Carrot (Daucus carota L.) is one of the model species used for research on plant tissue culture in vitro. The establish-ment of highly efficient systems that stimulate organo-genesis or embryogenesis and further conversion into plants has become crucial prerequisite for application of biotechnological methods for carrot genetic modifica-tions. Most of genetic transformation work done on carrot up till now can be classified as basic research, which have es-

sential impact on our understanding of the transgenesis. Carrot transformation using Agrobacterium tumefaciens was restricted mainly to work aiming to develop efficient protocols and thus several factors including plant geno-type, bacterial strain, tissue culture system and inoculum composition were compared. In contrast, carrot became a model plant when working with A. rhizogenes. Carrot root explants are susceptible to this bacteria and easily pro-duce neoplastic adventitious roots at wounding site. Vari-ous reaction of carrot explants to strains with modified Ri plasmids provided additional data on the process of T-DNA transfer from A. rhizogenes into the host genome. The effect of the series of rol genes has been verified and the regulation and involvement in plant development of rolB, the rol gene most important in root syndrome, have been described. Non-vector systems for DNA delivery were applied only occasionally.Despite carrot tissue culture is considered as straightfor-ward, the production of genetically modified plants is dif-ficult to achieve thus only restricted number of reports are available. The efforts are directed into three application areas: 1) enhanced tolerance, 2) improved quality and 3) production of edible vaccines. Most reports concern en-hancing carrot tolerance to pathogens by the introduc-tion of genes conferring pathogenesis related factors of plant non-specific response like chitinases, glucanase and thaumatin-like protein. Additionally, carrots with resist-ance to herbicides phosphinothricin and imidazolinone were obtained and recently, also carrots with enhanced salt tolerance. Improved quality is limited to the patented system for carrot with increased content of carotenoids. Carrot seems to be a potential source of edible vaccines; extracts from carrot expressing hemagglutinin protein neutralized measles virus. However, the available reports neither deal with aspects of commercial production of the transgenic carrot nor concern transgene stability over next progenies or their influence on other plant characters.

O2.1.5

GMO in plant protection – Polish experience

Stefan Pruszyński

Institute of Plant Protection, Poznań, Polande-mail: S.Pruszynski@ior.poznan.pl

In GM (genetically modified) crops cultivation the main role is played by varietes with the new qualities connect-ed to plant protection against pests and weeds. Introduc-ing into plants genes of bacterium Bacillus thuringiensis responsible for production of a protein that is toxic to various insects allowed to obtain pest resistant plants, while introducing into crops genes that enable them to degrade the active ingredient in an herbicide, leaving it harmless allowed to use environmental friendly although non-selective herbicides. Introduction of GMO into cul-tivation in many countries world-wide has brought to a total change in a system of plant protection programs ap-plied so far and to reduce in an amount of using chemical pesticides. In the Institute of Plant Protection in Poznań:

24 2007Abstracts

in the Experimental Station in Winna Góra near Środa Wielkopolska and in the Research Branch in Sośnicowice near Gliwice, on the basis of Environmental Ministry permission and agreement with Monsanto and AgroEvo (nowadays Bayer Crop Science), in the 1997-2001 research was conducted with: (a) potato varieties Atlantic and Su-perior – resistant to Colorado potato beetle (Leptinotarsa decemlineata Say); (b) rapeseed var. Liberty SL 18 – resist-ant to glufosinate and var. Roundup Ready to glyphosate; (c) sugar beet var. Liberty 200 SL and Roundup Ready – resistant to active ingredient mentioned above; (d) maize var. Liberty 200 SL – resistant to glufosinate; (e) fodder beet var. Roundup Ready – resistant to glyphosate. In a co-operation with the Agricultural University of Poznań and Institute of Bioorganic Chemistry, Polish Academy of Science in Poznań research was carried out on the useful-ness of silage produced from GMO maize. Lack of reg-istration possibility of GMO varieties in Poland as well as very high fees which are demanded by Environmental Ministry for approval for experiments with GMO led to the interruption of experiments. At the present EU de-cision and the increase of threat of Ostrinia nubilalis on maize caused the undertaking of experiments on GMO maize varieties resistant to that pest. Research was also conducted on assessment of unintentional influence of GMO maize on other plants which are not under control. Experiments performed by the Institute of Plant Protec-tion confirmed the usefulness of the examined GMO va-rieties for cultivation in Poland as well as their features recommended by the authors of those varieties. The full value and quality of tested silage produced from GM maize should be underline in a cattle nutrition.

O2.1.6

Utilization of doubled haploid technology in breeding new variety of winter oilseed rape (Brassica napus L.)

Teresa Cegielska-Taras1, Laurencja Szała1, Henryk Cichy2

1Plant Breeding and Acclimatization Institute, Research Division, 60-479 Poznań, Strzeszyńska 36, Poland,2Plant Breeding Strzelce Ltg.,Co., Division at Małyszyn, Polande-mail: tceg@nico.ihar.poznan.pl

Doubled haploids (DH) production is valuable technol-ogy in modern plant breeding create functional homoge-neity out of hybrids diversity. Doubled haploids can be produced from in vitro isolated and cultured microspores, which instead of forming pollen, develop into haploid embryos. Either spontaneously or after colchicine treat-ment the arising plants are diploid and fertile, and 100% homozygous for all genes.The presented doubled haploids method was elaborated in the Plant Tissue Culture Laboratory at the Plant Breed-ing and Acclimatization Institute in Poznań, (1).Factors affecting microspore embryogenesis of winter oilseed rape were evaluated including: donor plant grow-

ing, genotype, bud size, medium composition and in vitro culture conditions, doubling of chromosomes, conversion of embryos to plantlet.This method is routinely used in obtaining initial breed-ing material for breeding projects and DH lines for basis research. DH lines of winter oilseed rape have been suc-cessively tested in field trials at Plant Breeding Strzelce Ltd., Co., Division Małyszyn in years 2001–2006. Seeds from doubled haploid plants have sown at first multipli-cation plots and the next year they have been tested in preliminary trials. Selected best yielding DH lines were evaluated in replicated trials across Poland. The DH MA 103 was the best among the lines in the project. The lines is superior yield and performance when compared to the leading cultivars. This DH line is tested now in official trials to be registered as a new cultivar, Monolit, of winter oilseed rape in Poland. 1. Cegielska-Taras T (2004)Rośliny Oleiste-Oilseed Crops25:345-352.Online Available:www.ihar.edu.pl/biblioteka/oilseed-crops.php

O2.1.7

Evaluation of the hybrid character of plants obtained via interspecific crosses in the genus Allium

Alicja Chuda, Adela Adamus

Department of Genetics, Plant Breeding and Seed Science, Agricultural University, Al. 29 Listopada 54, 31-425 Kraków, Poland e-mail: achuda@ogr.ar.krakow.pl, kghn@ogr.ar.krakow.pl

With the aim of introgression to the bulb onion resistance to downy mildew (Peronospora destructor) interspecific hybrids within the genus Allium were obtained. In the years 2002–2003 Allium cepa × Allium fistulosum crosses were conducted, whereas in the years 2004–2006 Allium cepa × Allium roylei plants were obtained. Both A. fistu-losum and A. roylei, like bulb onion are diploids (2n=2x) and have the same chromosome number as A. cepa - 16. The amount of DNA that is characteristic of the bulb on-ion is 33.5 pg/2C, whereas this amount of A. fistulosum is lower and equals 22.5 pg/2C. A. roylei has an intermediate amount of DNA (28.5 pg/2C) as compared to both these species. Both A. cepa x A. fistulosum and A. cepa x A. roylei plants were obtained through in vitro cultures, via embryo rescue techniques. Verification of the hybrid character of obtained A. cepa × A. fistulosum plants was based on flow cytometry. The amount of DNA in the plants of A. cepa × A. fistulosum was evaluated in small fragments of their leaves. 93% of 71 of the obtained plants had the amount of DNA intermediate as related to both A. cepa and A. fis-tulosum, which confirmed their true hybrid character. Un-fortunately, it was impossible to verify the hybrid char-acter of A. cepa × A. roylei plants by flow cytometry, as a small difference in the amount of DNA between maternal and paternal forms could not be detected by the appara-tus. That is why the verification of the hybrid character of the plants was based on molecular techniques, using PCR reaction with ACS-F/ACS-R primers. The primers were designed for A. cepa anthocyanidin synthase gene. For all maternal, paternal and A. cepa × A. roylei plants,

Vol. 54 25EUROBIOTECH 2007

separation of PCR products on 1% agarose gel, revealed a monomorphic 750 bp product. After restriction digestion of the annealed DNA with Hin1II enzyme and resolving the products on polyacrylamide gel, polymorphisms dif-ferentiate A. cepa and A. roylei plants were obtained. Frag-ments specific both for maternal and paternal plants were found in 97% of over 1,000 of the obtained plants.

Posters

P2.1.1

Transformation of Brassica oleracea L. with Agrobacterium tumefaciens with NIb gene from turnip mosaic virus

Karol Gladysz, Maria Klein

Department of Genetics, Plant Breeding and Seed Science, Agricultural University of Krakow, Al. 29-Listopada 54, 31-425 Krakow, Polande-mail: karglad@bratek.ogr.ar.krakow.pl

White head cabbage is one of the most important veg-etables. Turnip mosaic virus (TuMV) is a member of the genus Potyvirus in the family Potyviridae. It has a world-wide distribution because of crucifer weeds being simul-taneously hosts for virus and transmitting aphids. Symp-toms of infection are necrotic spots on leafs, sometimes they cover whole leaf surface causing defoliation. In or-der to develop resistance to TuMV, we attempt to obtain transgenic plants of cabbage containing virus NIb gene. Agrobacterium tumefaciens strain EHA 105 containing plant transformation vector pLH9000 with NIb gene was used to inoculate hypocotyl parts of cabbage seedlings. Depending on plant transformation and culture condi-tions we obtained different number of putative transgen-ic plants were subjected to molecular analysis. Although there are several publications reporting transformation of cabbage, obtaining transgenic plants of Brassica oleracea L. var. capitata remains difficult task. To improve efficiency of transformation process we tested different cabbage va-rieties and several different conditions of transformation process. This was: length of preculture period, length of colcultivation with Agrobacterium, delay of introducing selection agent into culture medium, concentration of se-lection agent. The reducing of kanamycin concentration from 50 to 40 mg/l and shortening the selection time to 4 weeks were crucial to obtain transgenic plants.

P2.1.2

Test for RAT phenotype (resistant to Agrobacterium–mediated transformation) in Arabidopsis thaliana

M. Gwizdała1, W. Strzałka1, M. Plaminiak1, S. Gelvin2, A. Ziemienowicz1

1Department of Molecular Genetics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University,

Krakow, Poland; 2Department of Biological Sciences, Purdue University, West Lafayette IN, USAe-mail: alicja@mol.uj.edu.pl

Agrobacterium tumefaciens, a natural plant pathogen, was originally found to be responsible for crown gall disease on many dicotyledonous plants. During the infection process Agrobacterium transfers a fragment of its own pTi (tumor inducing) plasmid, T-DNA (transferred DNA), into the plant cells where T-DNA integrates into the host genome. This unique feature was used to establish a new method for efficient plant transformation, AMPT (Agrobac-terium-mediated plant transformation), since any gene(s) located between border sequences flanking T-DNA on the pTi plasmid will be transferred by Agrobacterium. Nowa-days, this method is widely used for creation of transgenic plants carrying new traits, such as resistance to diseases and environmental factors, improved plant architecture and photosynthetic effectiveness, phytoremediation, pro-duction of pharmaceuticals, etc. Although AMPT is in use since many years, its efficiency and host range are still not satisfactory. One of the ways for AMPT improvement is better understanding of this process. It can be achieved by identification of plant factors involved in the T-DNA transfer and integration. At least two approaches may be employed: isolation of plant proteins interacting with the bacterial proteins forming a complex with T-DNA, and testing for RAT phenotype (resistant to Agrobacterium-me-diated transformation). Using yeast two-hybrid system we have recently found that Arabidopsis thaliana Drt pro-teins may be involved in T-DNA integration into the host genome. On the other hand, testing for RAT phenotype of a large number of Arabidopsis mutants resulted in identi-fication of over 120 genes that may effect transformation [1]. They belong to the following categories: chromatin structure and remodeling genes, nuclear targeting genes, cytoskeleton genes, cell wall structure and metabolism genes as well as genes involved in signal transduction, gene expression and protein function. Overexpression or silencing of some of these genes resulted in a modulation of the AMPT efficiency. A strategy of RAT test, including the isolation of homozygous Arabidopsis mutant lines (us-ing Drt111 as an example), tumor formation assay, GUS and callus induction assays as well as molecular tests will be presented. The strategy of RAT test is a powerful tool that may help to develop new protocols for production of transgenic plants, especially in a context of monocotyledonous plant transformation, what will be the next mile step in plant biotechnology and modern agriculture.1. Zhu Y et al. (2003) Plant Physiol. 132: 494-505.

P2.1.3

Attempt to obtain hairy roots from carnivorous plants

Królicka A1, Szpitter A1, Gilgenast E2, Romanik G2, Kamiński M2, Łojkowska E1

1University of Gdańsk & Medical University of Gdańsk, Department of Plant Protection and Biotechnology, Kładki 24, 80-822 Gdańsk, Poland, 2Technical University of Gdańsk,

26 2007Abstracts

Chemical Faculty, Analytical Chemistry Department, Narutowicza 11/12, 80-952 Gdańsk, Polande-mail: krolicka@biotech.ug.gda.pl

Plants belonging to genus Droseraceae contain a variety of pharmacologically active secondary metabolites (naph-thoquinones: ramantaceone, plumbagin and flavonoids: quercetin and myricetin) [1]. Plant hairy root cultures obtained by transformation with Gram-negative bacteria Agrobacterium rhizogenes have been reported to produce elevated levels of secondary compounds as well as ex-hibit desirable rapid biomass accumulation in compari-son to untransformed plants [2]. The aim of the presented work was to establish hairy root cultures of Drosera cap-ensis ‘Broadleaf’, D. capensis ‘Alba’ and Dionaea muscipula. Three different protocols of infection with A. rhizogenes were applied.The explants of carnivorous plants were inoculated with A. rhizogenes strains (LBA9402, A4 and 15834) grown on medium with or without acetosyringone. After four months transformed tissues-teratomas were obtained in case of all three plant species but only after tissue inocula-tion with A. rhizogenes strain 15834 grown in the presence of acetosyringone. The transformation efficiency was rel-atively low (5% in case of D. muscipula and 10% in case of Drosera capensis). Initially teratomas were maintained on ½ Murashige Skoog (½ MS) medium supplemented with 500 mg/l claforan (Hoechst, M. Roussel) and 500 mg/l of carbenicillin (Polfa, Tarchomin) to eliminate bacteria. Bacteria-free cultures were then transferred on liquid ½ MS medium without antibiotics, in the dark at 22oC on a rotary shaker with 110 rpm. All teratomas grew 3–4 times faster than untransformed cultures. Growth of typical hairy roots was not observed. The transformation of tissue was confirmed using PCR (2) with primers based on the sequence of rolB and rolC genes of A. rhizogenes. In order to confirm that obtained products are not of bacterial origin a PCR with primers for one of virulence genes (virG) present on Ri plasmid beyond the transferred T-DNA fragment was performed.Additionally, PCR products obtained with the use of template DNA isolated from putative teratomas of car-nivorous plants were sequenced. The resulting sequenc-es were compared with NCBI database with the use of BLAST (www.ncbi.nlm.nih.gov/BLAST/). Sequence alig-ment allowed to confirm a 100% similarity between all obtained products and sequences of rolB-C genes depos-ited in the database.Furthermore preliminary HPLC analysis of ramenta-ceone content in teratomas from D. capensis „Broadleaf” indicated 30% higher level of this metabolite in compari-son to untransformed cultures.1. Juniper BE, Robins RJ, Joel DM (1989) The carnivorous plants. Academic Press, inc. Harcourt Brace Jovanovich, Publishers.2. Królicka A, Staniszewska I, Bielawski K, Maliński E, Szafranek J, Łojkowska E (2001) Plant Sci 160: 259-264.

P2.1.4

Nutritional quality of fat from the flaxseeds with enhanced synthesis of phenolic compounds

Anna Prescha1, Katarzyna Lorenc-Kukuła2, Jadwiga Biernat1, Jan Szopa2

1Chair and Department of Bromatology, Silesian Piasts University of Medicine, pl. Nankiera 1, 50-140 Wrocław, 2Institute of Biochemistry and Molecular Biology, Wroclaw University, Przybyszewskiego 63/77, 51-148 Wrocław, Poland

The low-linolenic oil from the flax variety Linola is more resistant to autooxidation in comparison with common high-linolenic flax oil, thus it is fit for consumption after storage. The enhanced synthesis of antioxidants in flax-seeds can additionally improve the resistance of flax oil in the oxidation process. The aim of this work was to study the fatty acid contents and the susceptibility to the oxidation of fat from the seeds of genetically modified flax obtained through clon-ing of three genes encoding key enzymes of anthocyanin synthesis (chalcone synthase, chalcone isomerase and di-hydroflavonol reductase) into the Linola genome. The flaxseeds of Linola and 2 transgenic lines W92/40 and W92/72 from field trials were investigated. The seeds were collected from vegetatively (F1) and generatively (F2) propagated plants. The analyses carried out were as followed: fat contents in seeds using the Soxhlet method, fatty acid composition using FAME gas chromatography, the peroxide value (PV) and anisidine value (AV) in fresh fat and after oxidation induced by atmospheric oxygen (for 7 and 15 days) or UV exposition (4 min). The line W92/40 accumulated up to 8.7% more fat in seeds in com-parison with Linola. No significant differences of the lipid contents between W92/72 and Linola seeds were observed. The fat from the transgenic seeds of both lines contained up to 22% and 23% more palmitic and stearic acid, re-spectively, and up to 9% less polyunsaturated fatty acids in comparison with the control line. The oleic acid was to a higher degree accumulated only in transgenic seeds F2 (up to 12%). The peroxide and aldehyde levels in the fresh fat of all of the investigated seeds were relatively low (PV < =2.5 and AV < 2). The PV of the oxidized fat from the transgenic seeds F1 were up to 20% lower after only 7 days of exposition. The extended time of oxidation caused comparable peroxide accumulation in the entire investigated lines F1. On the contrary, in the fat from F2 transgenic seeds, the PV was up to 32% lower in compari-son with the control only after 15 days of oxidation. The results of the AV determination in oxidized fats showed a lower (up to 50% in W92/40) susceptibility to the oxi-dation of fats from transgenic seeds F2. The fat from F1 seeds characterized the slighter differences between the control and transgenic lines in aldehyde accumulation after UV radiation.

Vol. 54 27EUROBIOTECH 2007

Panel II: Plant in vitro culture and secondary metabolite biosynthesis

Oral presentations

O2.2.1

Crop improvement by the application of in vitro culture techniques – selected aspects

Maciej Zenkteler

Department of General Botany, Institute of Experimental Biology, Adam Mickiewicz University, Umultowska 89, 61–614 Poznań, Polande-mail: maczen@amu.edu.pl

Plant tissue culture techniques are successfully used for a range of applications in plant improvement. The main achievements in those areas are: clonal propagation and disease elimination, production and isolation of mutants, culture of immature hybrid embryos, parasexual hybridi-sation, DNA manipulation and biochemical engineer-ing, in vitro fertilisation, production of secondary natural products, production of somatic embryos and artificial seeds.Excitement generated by recent development in the appli-cation of tissue culture techniques is justified because of their potential for crop improvement and also because of the speed with which such development has taken place.The method of in vitro pollination and fertilization can be applied to obtain hybrid embryos and plants. Those pro-cedures play in some cases an important role in the sexual reproductive processes as removal of the reproductive or-gans from plant enables to bypass pre- and post-fertili-sation barriers. For certain crosses e.g. among Solanaceae, Brassicaceae, Caryophyllaceae and Salicaceae species, in vitro pollination of pistils, ovaries and ovules allows the rais-ing of interspecific and intergeneric hybrids that cannot be obtained by conventional techniques. Increased production from renewable energy sources is a high priority in Europe in response to the growing need to replace fossil fuels. Among Salix (willow) species there are some selected clones of great value as biomass crops. Populus (poplar) wood is also used for the production of biomass. The interspecific hybrids between Salix genus and hybrids between Populus species exhibit a good bio-mass and a rapid growth, also resistance against pests. In nature there are no hybrid plants developed from the cross Salix × Populus. The central theme of this lecture will mainly concern the production of hybrid embryos and plants by the application of the techniques of in vitro pollination and fertilization in test tubes, particularly the latest achievements on obtaining hybrid plants between Salix viminalis and several Populus species.1. Ahman I and Larsson S (1994) Norvegian Journal of Agricultural Sciences 18: 47-66.2. Szczukowski S, Tworkowski J and Piechocki J (2001) Postępy Nauk Rolniczych 6: 11-19.3. Zenkteler M, Wojciechowicz M, Bagniewska-Zadworna A, Zenkteler M and Jeżowski S. (2005) Trees 19: 638-643.

O2.2.2

Biotechnology of medicinal plants

Dominique Laurain-Mattar

Groupe S.U.C.R.E.S., U.M.R. 7565 C.N.R.S. - Nancy-Université, BP 239, 54506 Nancy-Vandoeuvre, France e-mail: dominique.laurain-mattar@pharma.uhp-nancy.fr

Medicinal plants produce a broad variety of chemical compounds. Among them secondary metabolites rep-resent an important source of fine chemicals as drugs. Nowadays, about 25% of the molecules used for their pharmacological activities are of natural origin. For some of them, the availability of the plants are limited and prompted the search for an alternative way to obtain the valuable secondary metabolite using biotechnological processes. Several strategies for a biotechnological pro-duction have been extensively studied, such as plant cell cultures, transgenic plant or plant cell cultures or isolated enzymes. The technology for plant cell culture with a large-scale production is feasible. Now taxol is the latest success story in this field. Several examples are given to illustrate two different approaches: 1 – The undifferenti-ated cell cultures able to produce some secondary metab-olites. However, it is known that secondary metabolism is correlated with cellular differentiation. The establish-ment of tissue cultures showing various stages of differ-entiation controlled by various hormonal conditions is a possibility for the accumulation of morphinan alkaloids or galanthamine [1]. 2 – Hairy root cultures showing an extensive growth obtained from the transformation of medicinal plants with Agrobacterium rhizogenes as an in-teresting approach for alkaloid production, particularly tropane, morphinan and isoquinoline alkaloids. Moreo-ver the studies on secondary metabolite pathways and metabolomic engineering will lead to new possibilities for the production of fine chemicals. 1. Diop MF, Ptak A, Chrétien F, Henry M, Chapleur Y & Laurain-Mattar D (2006) Nat Prod Communications 1(6): 1249-1252.

O2.2.3

Doubled haploid breeding in cereals and oilseed rape – from basic science to commercial routine?

Jens Weyen

Saaten-Union Resistenzlabor GmbH, Hovedisser Str. 92, 33818 Leopoldshoehe, Germanye-mail: weyen@saaten-union-labor.de

Introduction: The first scientific reports about spontane-ous and induced haploidy of germ cells were published decades ago. In the 70s and 80s first results were reported in crop species. Today some of the technologies are ap-plied more or less as high throughput production of dou-bled haploid lines in rape seed, barley and wheat.Aim of the study: The comparison between first academic reports on haploidy and the industrial exploitation of this phenomenon in world wide breeding programs today. Recently COST 851 ended. In this COST Action it could

28 2007Abstracts

be shown how important “old fashioned” tissue culture research still is in variety development.Methods: Isolated barley and rapeseed microspore cul-ture could be improved in the last twenty years of plant breeding and plant biotechnology. This was possible by the optimization of donor plant growth, improvement of media in combination with innovative stress treatments, optimized culture conditions, improved chromosome doubling technologies and last but not least significantly modified logistics on the breeding stations. Unfortunate-ly isolated wheat microspore culture is still not a routine therefore the interspecific hybridization with corn is the method of choice. Nevertheless there are promising re-ports for soft and durum wheat.Results: The improvement of microspore isolation tech-nology and the variation of the culture conditions in com-bination with modified media makes it possible to receive 100 (or even more) green plantlets per spike in adapted winter barley breeding material. Although spring barley seems to be more sensitive to culture conditions and albi-nism it is also possible to use doubled haploids in spring barley.In rapeseed the major improvements in the last decade were done in the culture conditions, germination ability of embryos and chromosome doubling technologies. Cold treatment of embryos and in vitro doubling is a routine to-day and there are the first rapeseed breeding companies which converted their breeding programmes totally.While isolated microspore culture in wheat and rape-seed is a routine today this technology is not standard in wheat. Therefore in wheat breeding the interspecific hybridization with corn is routine, nevertheless this tech-nology is rather inefficient in comparison to isolated mi-crospore culture. 4–6 green plantlets per pollinated spike are possible. Some improvements in isolated microspore culture could be reported like the application of inducer chemicals and ovary co-culture. Conclusions: It took almost 30 years in barley and wheat and almost 20 years in rapeseed from the first prelimi-nary reports of cell division in single experiments. Fortu-nately plant breeders immediately recognized the poten-tial of such technologies and they were participating in the improvement of doubled haploid technologies. Today many plant breeding programmes are relying completely on doubled haploid technologies and major numbers of variety registrations were possible by the application of DH-lines.

O2.2.4

In vitro culture as a model in plant physiology and biochemistry

Franciszek Dubert1,2, Agnieszka Płażek1

1Department of Plant Physiology, Agricultural University of Krakow, Podłużna 3, 30-239 Kraków, Poland, 2Institute of Plant Physiology, Polish Academy of Sciences, Niezapominajek 21, 30-239 Kraków, Polande-mail: rrplazek@cyf-kr.edu.pl, dubert@ifr-pan.krakow.pl

An effort was made to estimate, which of plant physio-logical and biochemical processes might be studied using

in vitro culture as a model. The concept of “model” was defined and it was described its properties deciding why researchers choose that model for their investigations. The classification of processes taking place in plants was done depending on plant structure level, on which they proceed. Subcellular, cellular, so called “mixed” (cellular and systemic), systemic and plant population levels were distinguished. The processes taking place in cell organel-la (cell membranes, nucleus, plastids) and in cytoplasm were included into subcellular level. The processes in-volved in defense response of individual cells to various abiotic and biotic stresses (drought, frost, heavy metals, pathogens) as well as water and ion transport between cells were included into the cellular level. Such processes as the reactions to drought, frost, pathogens, apoptosis and hypersensitive response were mentioned as belong-ing to mixed (cellular and systemic) level. Thermo- and photoinduction of flowering, abundance of florescence, yielding, plant architecture, yield structure, seed dor-mancy and length of plant vegetative cycle were classi-fied to systemic processes. Finally, field crop productivity or water use efficiency (WUE) were included to processes of population character. The pros and cons related to in vitro culture used as a model in plant investigations have been listed. The comparison of development of somatic and gametic embryos, in vitro fertilization allowing to avoid the natural crossing barrier, cellular responses to heavy metals, herbicides and other stresses, influence of genome on phenotype specially in the case of haploids and double haploids may be studied in vitro conditions. Among processes that should not be investigated in vitro we mentioned crop yielding, symbio-sis between Rhizobium or Bradyrhizobium and Papilionaceae plants, heavy metal transport across barrier in root-stem distance and distribution of assimilates and ions between stem and fruits. Finally, the hypothesis about necessary accordance of organization level of physiological process and organization level of the model used to its study, was formulated.

O2.2.5

Plant tissue culture as a source of secondary metabolites with cytotoxic activity

Ewa Łojkowska, Anna Kawiak, Aleksandra Królicka

Department of Plant Protection and Biotechnology, Intercollegiate Faculty of Biotechnology, UG & AMG, Kładki 24, 80-822, Gdansk, Polande-mail: lojkowsk@biotech.univ.gda.pl

Plant tissues cultures are rich in secondary metabolites with potential use in medicine. Fresh or dried in vitro grown material of several species of plants (Dionea, Dros-era, Genista, Ruta, Salvia, Salix) were extracted using Soxh-let apparatus or sonication. Isolated secondary metabo-lites were analysed quantitatively by SPE and RP-HPLC. The purpose of this study was to select the extracts and compounds with the highest cytotoxic activity. Further examination was done to reveal whether their activities are apoptosis-mediated.

Vol. 54 29EUROBIOTECH 2007

Cytotoxic activity was determined on HeLa, HL-60, U937 cell lines by MTT test. In order to determine whether plant secondary metabolites have genotoxic activity and induce DNA strand breaks, the comet assay was employed. The comet assay reveals cellular DNA damage in cells in the form of a “comet” image. Mode of cell death induced by plant extracts has been also evaluated for HL-60 cell line by observing cellular morphological changes by light mi-croscopy and DNA laddering. Among all extracts examined, the extracts from Dionea binata, Drosera aliciae, Salvia sclarea and Genista tinctoria occurred to be the most effective with an IC50 value of 13.7, 14.4, 3.9 and 5 mg/l, respectively. The most active substances against various human tumour cell lines were plumbagine and ramentaceone; the highest activity was observed against leukemic lines HL-60 and U937 (IC50 1.5 mg/l). Typical morphological features (e.g. cell shrinkage, nuclear condensation and DNA fragmentation) of cells undergoing apoptosis were examined. The treatment of HL-60 cells with plumbagine or ramentaceone induced an increase in the sub-diploid DNA content. A loss in membrane phospholipid asymmetry determined by the externalization of phosphatidylserine as well as a loss in mitochondrial membrane potential were observed upon the treatment of cells with ramentaceone. Naphthoqui-nones are known redox cycling agents, therefore the gen-eration of ROS by this compounds was evaluated in HL-60 cells. To determine whether the induction of cell death by ramentaceone is mediated through the generation of ROS, cells were pretreated with a free radical scavenger N-acetylcysteine (NAC). NAC reversed the toxicity of ra-mentaceone as well as prevented the induction of DNA fragmentation in ramentaceone-treated cells pointing out to the involvement of ROS generation in the mechanism of cell death induced by ramentaceone.The results show the in vitro culture of endangered Dros-eraceae plants as a rich and convenient source of com-pounds with apoptosis induced activity.

O2.2.6

Microspore culture of Brassica napus cv Topas – suspensor-bearing embryos formation

Ewa Dubas1,2,3, Jan Custers2, Henk Kieft1, André A. M. van Lammeren1, Maria Wędzony3

1 Laboratory for Plant Cell Biology, Wageningen University and Research Centre, Arboretumlaan 4, 6703 BD Wageningen, The Netherlands, 2Plant Research International, Wageningen University and Research Centre, P.O. Box 16, 6700 AA Wageningen, The Netherlands, 3Institute of Plant Physiology Polish Academy of Sciences, ul. Niezapominajek 21, 30-239 Kraków, Polande-mail: edubas@o2.pl

Isolated microspores and pollen of Brassica napus cv Topas developed into embryos when cultured at 32°C, while the same population of cells continued gametophytic devel-opment into mature pollen when cultured at 18°C. Em-bryogenic development can be reproducibly initiated by a heat stress treatment for one or more days. As a result of the “strong” heat stress of 32°C for five days, microspores

and pollen enter sporophytic cell divisions, resulting in the formation of multinuclear or multicellular structures within the microspore exine walls.When isolated microspores and pollen subjected to a “mild” heat stress of 32°C for one day, development of-ten mimics zygotic embryogenesis: after a first division within the microspore wall, two-celled structures release from the microspore and uniseriate pro-embryos devel-op, consisting of a suspensor-like structure and an apical cell that forms the embryo proper. The culture procedure enables the simulation of zygotic-like development and the production of high numbers of haploid embryos to be used in developmental studies.The project was supported from funds of the COST-STSM-851-00537 and by QLAM-2001-00424.

Posters

P2.2.1

Mitotic activity of yellow lupin protoplasts

Alina Czura, Anna Pindel

Departament of Botany, Faculty of Horticulture, Cracow Agricultural University, Al. 29 Listopada 54, 31-425 Kraków, PolandYellow lupin (Lupinus luteus L.) is a crop plant rich in di-etary protein, oil and fibre. Like other Lupinus species, yellow lupin still remains recalcitrant in protoplasts cul-ture and morphogenesis has not been described to date. Because of numerous biological barriers, every mitotic division of cultured protoplasts is considered to be an important progress. In this study, protoplasts of three yel-low lupin cultivars were analyzed with reference to their mitotic activity during culture in modified K8P medium. Protoplasts were isolated with high yield and purity from hypocotyls, cotyledons and leaves of young seedlings and cultured in modified liquid K8P medium. Original types and concentrations of growth factors in medium were replaced according to protocol established earlier. Protoplasts were cultured in dark for three weeks. Cotyledon and hypocotyl-derived protoplasts of all three cultivars tested show their ability to elongation and early stages of first mitotic division were visible after 3 days of culture. Plating efficiency of protoplasts derived from all cultivars was comparable, as well as time period in which protoplasts remain viable. However, division frequency of cotyledon-derived protoplasts was significantly higher than hypocotyl-derived ones. Sustained cell division re-sulted in formation of cell clusters only for protoplasts isolated from cotyledons, therefore this source of explant seems to be more morphogenic than others. Hypocotyl protoplasts underwent only one mitosis, producing twin cells, which eventually died. Protoplasts isolated from young leaves remain viable during 3-week long culture, however they were not even changed in shape, so no mitosis was observed. This results report on fact, that yellow lupin protoplasts are able to divide in culture, on condition that culture pa-rameters are optimized. The most significant impact on protoplasts mitotic behaviour seems to have a type and concentration of growth regulators. This work allows a

30 2007Abstracts

further understanding of gaining totipotency during pro-toplasts culture in Lupinus genus.

P2.2.2

Growth and development of Clematis integrifolia and Clematis viticella microshoots in presence of activated charcoal

Marek Dąbski, Marzena Parzymies

Institute of Ornamental Plants and Landscape Architecture, University of Agriculture in Lublin, ul. Leszczyńskiego 58, 20-068 Lublin, Polande-mail: marzena.parzymies@ar.lublin.pl

Genus Clematis (Ranunculaceae) includes a few hundred species and cultivars of woody and perennial plants. Clematis is widely cultivated and very popular as an or-namental plant. It is mainly propagated through cutting but a lot of species and varieties are very difficult to root. Propagation in vitro is a good methods for obtaining a lot of healthy offsprings.The aim of undertaken experiment was evaluation if presence of an activated charcoal in the growing media influences growth and development of explants of Clema-tis integrifolia and Clematis viticella. The experimental objects were 15–20 mm shoots of Cle-matis integrifolia and Clematis viticella excised from asepti-cally grown shoot clusters. Explants were placed in MS medium supplemented with 2 mg 2iP dm–3, 0.2 mg IAA dm–3 and activated charcoal (AC) in concentration of 1 or 5 g dm–3. As a control the medium without AC was used. The cultures were incubated in a culture room at a tem-perature of 20–22°C and 16 h photoperiod with irradiance of 35 micromol m–2s–1. After four weeks the experiment was finished and a plant material was analyzed.It was found out that activated charcoal had a positive ef-fect on growth of microshoots of both Clematis species. In presence of this substance microshoots were longer, more heavy and had bigger leaves. The higher concentration of activated charcoal the smaller callusing was observed at the base of shoots. The presence of AC had also effect on branching of microshoots. Clematis viticella formed the most axillary shoots in presence of 1 g AC dm–3. Branch-ing of Clematis integrifolia was best promoted on the me-dia without activated charcoal, although the percentage of plants with axillary shoots was similar on the media supplemented with 5 g of charcoal. Presence of AC in the media caused rooting of Clematis integrifolia.

P2.2.3

A comparison of the regeneration abilities of Allium neapolitanum Cyr. and Allium roseum L. explants in in vitro culture

Danuta Kozak, Magdalena Stelmaszczuk

Institute of Ornamental Plants and Landscape Architecture, University of Agriculture in Lublin, ul. Leszczyńskiego 58, 20-068 Lublin, Polande-mail: dkozak@autograf.pl

The ornamental alliums acquire more and more popu-larity as garden plants and cut flowers. The natural en-vironmental of Allium neapolitanum Cyr. species is the Mediterranean region. The plants are 25–50 cm high. The inflorescence are loose umbels from 30–40 flowers, in clear white colour. In native conditions it blooms very early. On account of a very attractive colour of flowers it is perfect as a garden plants as well as a cut flower. Allium roseum L. originates from southern Europe. The height of plants is around 60 cm. There are from 5 to 25 pink flowers in one umbel. Allium roseum blooms from June to July. It is perfect as a cut flower. The reproduction of these plants is held at sparse plantations.A research was conducted which might contribute to development of micropropagation technology of Allium neapolitanum and Allium roseum. The bulbs of the 4–5 cm circumference were used in the experiment. The explants: inflorescence buds with leaf primordia and bulb scale fragments adjoing to basal plate, were isolated at the end of October from not cooled bulbs and at the be-ginning of February from bulbs cooled for four months. The explants were placed on the Murashige and Skoog (1962) modified medium completed with 2 mg dm–3 BA and 1 mg dm–3 NAA. The inflorescence buds with leaf primordia were placed in a natural position, while bulb scale fragments were placed in a natural position and up-side down. The cultures were incubated for 8 weeks at 20–22 °C, 16 h photoperiod and light intensity of 35 micro M m–2s–1.There were significant differences in regeneration abili-ties depending on genotype, type of explants and meth-ods of bulbs storage. There was no regeneration of adven-titious shoots observed from the explants of bulbs scale fragments. The inflorescence buds with leaf primordia of both studied species elongated, but only the inflorescence bud of A.neapolitanum regenerated 1–2 axillary shoots. The influence of bulbs cooling on number of regenerating shoots was not proved. The shoots obtained from inflo-rescence buds of A. neapolitanum showed a high ability to rooting, while A. roseum ones rarely formed roots. The better rhisogenesis was observed in case of explants origi-nating from not cooled bulbs.

P2.2.4

The effect of selected factors on in vitro anther culture of some Capsicum genotypes

Paweł Nowaczyk, Marta Orlińska, Anna Kisiała

University of Technology and Life Sciences, Department of Genetics and Plant Breeding, Kaliskiego 7, 85-789 Bydgoszcz, Polande-mail: anna3011@op.pl

The success of anther culture depends on numerous fac-tors, out of which the most important are donor plant genotype, developmental stage of flower buds and cul-ture media composition. The highest effectiveness of androgenic embryos production is observed in anther culture of C. annuum L., while wild species of Capsicum genus usually are less responsive. The aim of this work was to determine the effect of selected factors on the ef-

Vol. 54 31EUROBIOTECH 2007

fectiveness of androgenesis through anther culture of two forms of interspecific hybrids of C. frutescens L. × C. an-nuum L.: 32/3/4 and 34/4/6. Total amount of 1428 anthers were excised from flower buds when corolla was of the same length as calyx or slightly longer, and 334 anthers were isolated when corolla was almost twice as long as calyx. Anther culture was maintained according to Du-mas de Vaulx (1981), with modifications concerning ad-dition of activated carbon to the induction medium (0.5 g dm-3) and two levels of kinetin in the regeneration me-dium (0.1; 0.2 mg dm-3). The results of this study indicat-ed that anthers of the analysed genotypes gave different embryogenic response. The effectiveness of androgenesis of more responsive 34/4/6 genotype was 1.98%, while for 32/3/4 the frequency of embryo formation was only 0.6%. However, in both cases, embryo development was ob-served only in anthers isolated from the younger buds. In presented research no positive effect of activated carbon on androgenesis was observed, however, this component stimulated rhizogenesis in anther culture of 32/3/4. Ad-ditionally, the higher concentration of kinetin clearly in-creased embryo formation of both the genotypes. Flow cytometric analysis of normally developed androgenic regenerants revealed presence of 5 haploid, 8 diploid and 1 mixoploid plant. The tendency of callus tissue induc-tion was visibly higher in anther culture of the less re-sponsive genotype 32/3/4. Moreover, either the presence of activated carbon as well as the higher level of kinetin influenced process of callusogenesis in anther culture of this form.Dumas de Vaulx R, Chambonnet D, Pochard E (1981) Agronomie 1: 859-864.

P2.2.5

To the optimum plant treatment with phytohormones, defines by DPCA (Digital-Photo-Chrom-Analyse)

Wolfgang Nowick

Radostim Private Institute for Applied BiotechnologyHauptstraße 54; D-01561 Skäßchen, Germanye-mail: info@radostim.de, wnowick@t-online.de

The result of a treatment of plants with growth regulators on phytohormone basis is extremely variable in practice and seldom optimum. The cause is a distinctive depend-ence of the stimulative effect on the applied dose in many cases (dose-effect). Based on models to the simple and col-lective stimulation of the photosynthesis we have mod-eled the dose-effect. The optimum dose can be deduced from the so-called chlorophyll value - C* / % - which can be determined by means of DPCA (Digital-Photo-Chrom-Analyse) /1, 2/. The results are discussed by model calculations to the de-scription of the complicated effect from combinations of phytohormones and humic acids (RD project: Radostim A*B), in the cultures wheat, rape, maize, potatoes, aspar-agi, tobacco and orchids with the phytohormone prepa-rations: Emistim C, Agrostimulin, Ivin, Epin, EL-1 and the humic acids preparations: Humisol, Hydrohumat, Bigus, Biogumat, Lignohumat, Torfofit and BioLife. The

models show that the dose of both components according to culture, nutrigen-state and soil-parameters about 30 to 80 percent can be reduced by the complicated effect from phytohormones and humic acids.1. G.Jutinska, S. Ponomarenko, W.Nowick Studie zur biotech-nologischen Optimierung des Spargelanbaus mittels DPCA-Dig-ital-Photo-Chrom-Analyse (DPCA), Journal of the University of Applied Sciences Mittweida, Biotechnologie, Nr. 6 (2004),23-26.2. T.Lehnhardt, W.Nowick DPCA-Study on the effect of applica-tion with growth-stimulate mixtures in the early growth-state of orchids, (russ), Biotechnology in Agriculture, Special Issue of the State Agroecological University of Zhitomir, (2006),11-18.3. S.Ponomarenko, W.Nowick Proceedings of the Nanobiotech-nology-Seminar, Dec 2006, Kiew, (to be published).

P2.2.6

Callus cultures Ocimum basilicum L.

H. Olszak, A. Czubacka, M. Przybyś, M. Agacka, J. Krzyżanowska, T. Doroszewska, W. Oleszek

Institute of Soil Science and Plant Cultivation, State Research Institute, Polande-mail: holszak@iung.pulawy.pl

Basil (Ocimum basilicum L.) from Labiatae family is annual crop plant. Basil is a rich source a lot of compounds used in pharmacology and medecine such as: basil oil – about stimulating and painkilling activity, saponins which sup-port of absorbing process and increase of fat and tanning agent digesting, vitamins and mineral salts. Moreover basil is a rich source of flavonoids which displays an anti-oxidant, anti-inflamantory and anti-allergic, insecticides, and fungicides effects. Therefore flavonoids arouse inter-est of pharmaceutical and cosmetic industry as well as recently food one.The presented experiment was to work out a method of obtaining callus tissues which may be used for synthesis of flavonoids in basil. Material of the research were or-gans (hypocotyl and seed leaves) of basil plants coming from in vitro cultures. Fragments of the organs were put on media LS which was used in two variants: enriched by IBA with 2-iP and IBA with kinetin, each of the hormones was added in four concentrations (0 mg/l, 0.5 mg/l, 1 mg/l.2 mg/l), which gave us thirty two combinations in total. pH of the media used to obtaining basil callus tissue was 5.8. After 30 days callus induction was observed. On the medium with IBA and 2-iP, induction of callus from hy-pocotyl was more suitable at 2 mg/l IBA with 0.5 mg/l 2-iP concentration. Induction of callus from seed leaves was more suitable at 0.5 mg/l IBA with 2 mg/l 2-iP, 1 mg/l IBA with 1 mg/l 2-iP, and 0.5 mg/l IBA with 1 mg/l 2-iP con-centration. On the medium with IBA and kinetin induc-tion of callus from hypocotyl was more suitable at 2 mg/l IBA with 0.5 mg/l kinetin, while callus from seed leaves was more suitable at 0.5 mg/l IBA with 0.5 mg/l kinetin and 2 mg/l IBA with 0.5 mg/l kinetin. The callus tiussues formed on the optimal media were much more abundant than regenerated on the other media.

32 2007Abstracts

P2.2.7

The effect of kinetin level on androgenesis effectiveness of interspecific hybrids from Capsicum genus

Dorota Olszewska, Iwona Jędrzejczyk, Paweł Nowaczyk

University of Technology and Life Sciences, Department of Genetics and Plant Breeding, Kaliskiego 7, 85-789 Bydgoszcz, Polande-mail: anna3011@op.pl

The aim of the research was to estimate the effect of ki-netin level on androgenesis effectiveness of genotypes from Capsicum genus. Four interspecific hybrids: (C. an-nuum L. × C. frutescens L.)F1, (C. annuum L. × C. baccatum L. var. pendulum)F1, (C. frutescens L. × C. annuum L.)F1, and (C. frutescens L. × C. chinense Jacq.)F1 were investigated. Anther culture was maintained according to Dumas de Vaulx et al. (1981), with modifications concerning kinetin concentration in regeneration medium. Two levels of ki-netin: 0.2 and 0.3 mg dm–3 were applied. The evaluation of ploidy level was performed using a flow cytometer. The higher number of regenerated plants was observed when the concentration of kinetin was 0.2 mg dm–3. The effectiveness of androgenesis in this case ranged from 0.5% for (C. annuum L. × C. frutescens L.)F1 to 3.3% for (C. frutescens L. × C. chinense Jacq.)F1. Hybrids: (C. annuum L. × C. baccatum L. var. pendulum)F1 and (C. frutescens L. × C. annuum L.)F1 presented intermediate tendency to plant formation, which ranged from 1.82% to 1.56% respective-ly. Flow cytometry analysis showed that 59% of obtained plantlets were haploids. In anther culture callus tissue development was also observed. For interspecific hybrids with C. annuum L. as a maternal form the frequency of cal-lus induction was 2–3%, whereas for hybrids composed of C. frutescens L. as a maternal form callusogenesis was found with the frequency of 18–22%. While anthers were cultured on medium with 0.3 mg dm–3 of kinetin, plants development was observed occasionally and effective-ness of androgenesis did not exceed 1%. For most of the investigated genotypes these conditions also stimulated callus growth. The results showed that the frequency of embryo formation in anther culture of studied genotypes depended on kinetin concentration in regeneration me-dium.Dumas de Vaulx R, Chambonnet D, Pochard E (1981) Agronomie 1: 859-864.

P2.2.8

Optimization of a procedures to improve isolation efficiency of hyacinth protoplast cultures

Anna Pindel, Izabela Dragun, Justyna Wiśniowska

Department of Botany, Agricultural University, Krakow, Polande-mail: apindel@ogr.ar.krakow.pl

For the successful application of regeneration the avail-ability of an efficient procedure for protoplasts isolation is required. The protoplasts were isolated by enzymatic method using 1 % Cellulase (Onozuka) R-10, 0.5% Macero-zyme (Onozuka) R-10, 0.1 % Pectinase (Sigma). The enzy-matic mixture was supplemented with 0.1% MES and 8% sorbitol. Various types of hyacinth ‘Anna Lisa’ explants, light conditions as well the age of used explant were tested to obtain protoplasts and optimize the yield of vi-able protoplasts. That were: callus, bulbs and shoots from regenerated in aseptic cultures bulb scales respectively in the darkness and in a 16/8 h photoperiod cultured no more than six months (young) and more than six months (older). The maximum isolation efficiency was obtained from young shoots from darkness (1.48 106 cells per 1 g of tissue). The majority of the callus derived protoplasts, isolated with 1.05 106 protoplasts/1 g efficiency, regener-ated cell walls and underwent cell divisions. In case of bulb scales, high concentration of raphides had a negative influence on the yield and viability of protoplasts. These kind of contamination was difficult to eliminate during the process of purification. The high protoplasts yield from hyacinth explants give the hope to efficient proto-plast culture and in the consequence to regeneration of the whole plant in the future, even if regeneration in vitro of monocots Hyacinthus orientalis has proved difficult.

P2.2.9

Optimization of isolation conditions of mesophyll protoplasts from rose (Rosa hybrida) cv. ‘New Dawn’

Barbara Piwowarczyk, Anna Pindel

Department of Botany, Faculty of Horticulture, Cracow Agricultural University, Al. 29 Listopada 54, 31-425 Kraków, Polande-mail: baspiwo@op.pl

Narrow genetic base, sexual incompatibilities, which make impossible distant crosses, high degree of steril-ity and perennial nature of plant compel to look for new breeding methods of rose (Rosa sp.). The solution of these problems may be somatic hybridization. The application of this technology demands establishment of efficient protoplasts isolation protocol.In present study, protoplasts were isolated from meso-phyll of Rosa hybrida cv. ‘New Dawn’. Fully and newly ex-panded leaves originating from either glasshouse plants or axenic shoot culture were used. Different enzymes and their concentrations, as well as various time of incubation and osmoticum, were investigated. Leaf tissue were ei-ther plasmolysed for 1 hour prior enzyme incubation or placed directly in enzyme.

Vol. 54 33EUROBIOTECH 2007

P2.2.10

Callus cultures Fagophyrum esculentum Moench

M. Przybyś, A. Czubacka, H. Olszak, M. Agacka, J. Krzyżanowska, T. Doroszewska, W. Oleszek

Institute of Soil Science and Plant Cultivation, State Research Institute, Polande-mail: mprzybys@iung.pulawy.pl

Buckwheat (Fagophyrum esculentum) are found to include many flavonoid compounds which defuse free radicals, show anti-inflammatory as well as regenerating effect on cells of skin and other organs. Therefore flavonoids arouse interest of pharmaceutical and cosmetic industry as well as recently food one. The presented experiment was to work out a method of induction callus tissues which may be used for synthesis of rutin in buckwheat. Organs (roots, seed leaves, stems and leaves) of buckwheat plants coming from in vitro cul-tures were material of the research. Fragments of the or-gans were put on media LS, B5, White which were used in two variants: enriched by 5 mg l–1 2,4-dichlorophenoxy-acetic acid (2,4-D) and 0.2 mg l–1 6-benzylaminopurine (BAP) as well as the media with the addition of 0.5 mg l–1 indoleacetic acid (IAA) and 0.7 mg l–1 BAP. Simultane-ously pH of the media used to obtaining buckwheat cal-lus tissue was 5.8. After 3 weeks degree of callus induction from all organs was estimated. B5 medium enriched by IAA and BAP was the best for induction of calli from roots. More than 80% explantants showed induction of calli. LS medium containing IAA and BAP (100% of induction) was more suitable for calli induction from stem. The LS medium en-riched by 2,4-D and BAP showed more suitable for obtain-ing calli from the seed leaves (97%) and leaves (82%). The callus tissues formed on the optimal media were much more abundant than regenerated on the other media.Obtained results allowed selecting proper media compo-sition for regeneration of callus that will be an object of future studies.

P2.2.11

Influence of light on growth and development of wheat plants regenerated using meristematic shoot segments

Agnieszka Reszka, Ilona Czyczyło-Mysza, Edyta Skrzypek, Kinga Tobola, Izabela Marcińska

The F. Górski Institute of Plant Physiology, Polish Academy of Sciences, 30–239 Kraków, Niezapominajek 21, Polande-mail: reszka@ifr-pan.krakow.pl

A highly efficient in vitro regeneration system was used to study the influence of LED (light emitted diodes) treat-ment on meristematic shoot segments (MSSs) of spring wheat (Triticum aestivum L.) cultivars: Chinese Spring (CS) and cross Highbury x TW269/9/3/4 (SQ1). Clumps of multiple shoots were obtained from mature embryo-derived seedlings. LED treatment in four wavelength

(white, red, far red and blue) on MSSs after 7 days of seeds germination was continued during 3 weeks. MSSs were cultured on MS-based medium containing 2 mg/l picloram and 3 mg/l thidiazuron (TDZ) and differentiated up to multiple shoots with no or very little callus forma-tion. 3 weeks after LED treatment the number of clumps and regenerated multiple shoots were determined. After rooting on basal medium with 0.5 mg/l IBA the plants were transferred to soil and time for heading was deter-mined. The percentage of relative MSSs multiplication and plant regeneration was depended on the genotype and light wavelength. Both genotypes tested formed mul-tiple shoots and regenerated plants, however, SQ1 with higher frequency than CS. The highest number of clumps were observed on explants grown under white light (2.9 per explant). Under red and far red light explants formed respectively 2.03 and 2.23 clumps per explant. The lowest number of clumps were obtained under blue light. White and far red LEDs stimulated the plants regeneration in comparison to red and blue one. The LEDs had also an influence on plant development and time to heading. De-pendently of genotype plants after white and red light treatment formed spikes ca 10 days earlier than the far red and blue.

P2.2.12

Large scale in vitro propagation of Cordyline australis Hook

Marzena Warchoł1, Franciszek Dubert2, Tadeusz Kusibab3

1Department of Ornamental Plants, Agricultural University, 31-425 Kraków, Poland, 2Institute of Plant Physiology, Polish Academy of Sciences, 30-239 Kraków, Poland, 3Gospodarstwo Ogrodnicze Tadeusz Kusibab, 31- 979 Kraków, Polande-mail: mwarchol@bratek.ogr.ar.krakow.pl

The procedure of Cordyline australis Hook. „Red Star” in vitro propagation was the aim of investigation. Among other cordylines, australian cordyline is the most valu-able decorative plant. The plants of Cordyline australis Hook. used for this study were grown under greenhouse conditions. Apex shoots (about 1 cm long) and shoot slices (about 1 mm thick) were obtained and transferred to growing vessels. Explants were cultured on initial MS medium (Murashige & Skoog, 1962), consisted 3% su-crose and 0.7% agar, supplemented with various growth regulators for the study of multiplication in two sepatate experiments. The first experiment consisted of the com-bination of auxins NAA (0.5 µM) and cytokinins: BAP (5 µM) and zeatin (5 µM). The second experiment consisted of the combination of three auxins: Picloram 5, 25, 50 µM, Dicamba 20 µM, 2,4-D 4.5 µM, and cytokinins BAP 0.5–1 µM, and TDZ 0.5 µM. Shoot formation was stimulated by supplementing the media with 5 µM BAP or 5 µM zeatin combined with 0.5 µM NAA. Zeatin was more effective than BAP for multiple shoot formation. The highest fre-quency of explants forming shoots was 55% after 12 wk of culture. Shoot – tip necrosis occured simultaneously with their vitrification in the medium with BAP. Multi-ple shoots formed on auxillary branching. Callus was in-

34 2007Abstracts

duced from the shoot slices which were previously cut into 1 mm thick slices. The cultures were kept in the dark. All types of media induced callus. The highest persentage of explants forming callus was observed in medium con-taining 25 µM Pic and 0.5 µM BAP and the lowest in those with 4.5 µM Dicamba and 0.5 µM BAP. After the 8 wk initial callus was separated from the explants and trans-ferred onto the same fresh medium. The developed callus was proliferated on initial media, the optimum callusing response was noted in the case of medium supplemented with 25 µM Picloram and 0.5 µM BAP.As the culture proceeded the callus became nodular with white-yelowish nodules, which finaly produced embryo-genic mass. The embryogenic callus proliferated for 2 months on medium supplemented with 5 µM Picloram and 1 µM BAP. The addition of zeatin (5 µM) and NAA (0.5 µM) to the medium was found to be essential for the germination of embryos. Results obtained show that methods based on somatic embryogenesis can be used for large scale propagation of Cordyline australis. This opinion is based on more than 10.000 fully formed plants obtained in the experiment.1. Murashige T & Skoog F (1962) Physiol Plant 15:473-497.2. Shahid-Javed B (1999)Anadolu 9:56-59.3. Raghova S, Kumar S (2001)Journal of Ornamental Horticulture New Series 4:22-24.4. Nushat H, Nasreen Z, Shaista J, Javaid I (2001) Proceedings of the Estonian Academy of Sciences 50:22-23.

P2.2.13

Basil, soybean and mint callus tissues induction

A. Czubacka1, M. Przybyś1, J. Krzyżanowska1, L. Pistelli2, B. Ruffoni3, T. Doroszewska1, W. Oleszek1

1Institute of Soil Science and Plant Cultivation, State Research Institute, ul. Czartoryskich 8, Puławy, Poland 2Department of Bioorganic Chemistry and Biopharmaceutics, University of Pisa, Via Bonanno 33, I-56126 Pisa, Italy 3CRA Experimental Institute for Floriculture, corso Inglesi 508–18038 Sanremo, Italye-mail: annacz@iung.pulawy.pl

Basil (Ocimum basilicum L.), soybean (Glicyne max (L.) Merr.) and peppermint (Mentha piperita L.) are species rich in compounds used in pharmaceutical, food or even perfume-making industry. Basil contains among other things rosmarinic acid, soybean – isoflavonoids and pep-permint – menthol and flavonones. Developing a method of synthesizing these compounds in a laboratory scale seems to be interesting. The first stage of such a studies should be an increasing amount of plant material. Therefore, the aim of the experiment was to work out a method of obtaining callus tissues of three species mentioned above for synthesis of nutriceutics. Fragments of cotyledons and hypocotyls coming from in vitro cultures were put on media LS which was enriched by phytohormones: 1-naphthaleneacetic acid (NAA) and kinetin in concentrations: 0, 0.5, 1 and 2 mg/l. Thu, sixteen combinations of the medium were applied. Observations of the callus growth were made after three weeks.

In a case of basil the used medium showed to be more suitable for obtaining callus tissue from hypocotyls. The one containing NAA and kinetin in equal concentrations (0.5, as well as 1 mg/ml) caused the best induction of the callus. Soybean cotyledons maintained viability and formed abundant, green callus on the medium contain-ing 2 mg/l NAA and 0.5 mg/l kinetin. However, more ap-propriate for obtaining callus from soybean hypocotyls was a higher concentration of kinetin (2 mg/l kinetin and NAA). The tested medium caused organogenesis of both mint hypocotyls and cotyledons. Simultaneously, the cal-lus tissues were not abundant. The most abundant mint calli with the poorest organogenesis were formed on the medium enriched by 2 mg/l NAA (without kinetin). The effectiveness of callus induction will be tested using an-other cytokines and auxines, too.The work was performed under 6 FP EU NUTRA-SNACKS.

P2.2.14

Callus cultures Ocimum basilicum L.

A. Czubacka1, M. Przybyś1, J. Krzyżanowska1, L. Pistelli2, B. Ruffoni3, T. Doroszewska1, W. Oleszek1

1Institute of Soil Science and Plant Cultivation - State Research Institute, ul. Czartoryskich 8, Puławy, Poland, 2Department of Bioorganic Chemistry and Biopharmaceutics, University of Pisa, Via Bonanno 33, I-56126 Pisa, Italy, 3CRA Experimental Institute for Floriculture, corso Inglesi 508–18038 Sanremo, Italye-mail: annacz@iung.pulawy.pl

Basil (Ocimum basilicum L.) from Labiatae family is annual crop plant. Basil is a rich source a lot of compounds used in pharmacology and medicine such as: basil oil – about stimulating and painkilling activity, saponins which sup-port of absorbing process and increase of fat and tanning agent digesting, vitamins and mineral salts. Moreover basil is a rich source of flavonoids which displays an antioxidant, anti-inflammatory and anti-allergic, insecti-cides, and fungicides effects. Therefore flavonoids arouse interest of pharmaceutical and cosmetic industry as well as recently food one. The presented experiment was to work out a method of obtaining callus tissues which may be used for synthesis of flavonoids in basil. Material of the research were organs (hypocotyl and seed leaves) of basil plants coming from in vitro cultures. Fragments of the organs were put on media LS which was used in two variants: enriched by IBA with 2iP and IBA with kinetin, each of the hormones was added in four concentrations (0 mg/l, 0,5 mg/l, 1 mg/l, 2 mg/l) which gave us thirty two combinations in total. pH of the media used for obtaining basil callus tissue was 5.8. After 30 days callus induction was observed. On the medium with IBA and 2-iP, induc-tion of callus from hypocotyl was more suitable at 2 mg/l IBA with 0.5 mg/l 2-iP concentration . Induction of callus from seed leaves was more suitable at 0.5 mg/l IBA with 2 mg/l 2-iP, 1 mg/l IBA with 1 mg/l 2-iP, and 0.5 mg/l IBA with 1 mg/l 2-iP concentration. On the medium with IBA and kinetin induction of callus from hypocotyl was more suitable at 2 mg/l IBA with 0.5 mg/l kinetin, while callus

Vol. 54 35EUROBIOTECH 2007

from seed leaves was more suitable at 0.5 mg/l IBA with 0.5 mg/l kinetin and 2 mg/l IBA with 0.5 mg/l kinetin. The callus tissues formed on the optimal media were much more abundant than regenerated on the other media.The work was performed under 6 FP EU NUTRA-SNACKS

P2.2.15

Using of plant in vitro cultures for producing secondary metabolites

Filova Angelika, Rovna Katarina

Department of Plant Physiology, Slovak Agricultural University in Nitra, Tr. A. Hlinku 2, 949 76 Nitra, Slovakiae-mail: angela.filova@uniag.sk

Plants contain a large number of secondary metabolites that are synthetised and accumulated as a response of the organism to pathogen attack or abiotic stress. Second-ary metabolites possess multiple biological functions, that may be exploited in many ways in food processing, cosmetic and pharmaceutic industry. Moreover, second-ary metabolites with biocide properties can be applied instead of traditional agrochemicals. Occurence of sec-ondary metabolites in very low concentrations and often in endangered plant species has lead to attempts in de-veloping alternative systems for their production. Bio-technological methods of plant tissue cultures provide a renewable resource for the production of secondary metabolites. Different systems have been developed for production of secondary metabolites in callus culture, cell suspension culture, root culture or shoot cultures. Prereq-uisite for the commercial application of these systems is selection of highly productive lines as well as the opti-malization of chemical and physical culture environment of cells for maximum productivity. The research is orient-ed on use of biotechnological methods in propagation of important chemotypes of yew (Taxus baccata) and (Taxus brevifolia) for subsequent pharmacological processing and use in horticulture practise. The project goal is to quantify the basic physiological processes, growth-developmental changes on the level of cell, tissues and organs of explan-tate cultures of yew. To identify and localise anatomical- morphological changes of organs from the differentia-tion in in vitro conditions to adaptation of regenerants to modified conditions of cultivation. On the basis of gained knowledge, to characterise the effect of factors of environ-ment and ability of plant explants to adapt to conditions of cultivation. By the study of ecophysiological and pro-ductional parameters of yew, to determine conditions for optimization of preparation of quality biomass for horti-culture practise.

P2.2.16

Separation of betalains and a saponin from berries of Phytolacca americana by preparative high-speed countercurrent chromatography (HSCCC)

Gerold Jerz 1, Kathrin Fiege1, Tanja Skotzki1, Victor Wray2, Peter Winterhalter1, Slawomir Wybraniec3

1Insitute of Food Chemistry, Technical University of Braunschweig, Schleinitz-Strasse 20, 38106 Braunschweig, Germany, 2Department of Structural Biology, Helmholtz Centre for Infection Research (HZI), Inhoffenstrasse 7, 38124 Braunschweig, Germany, 3Faculty of Analytical Chemistry, Institute C-1, Department of Chemical Engineering and Technology, Cracow University of Technology, ul. Warszawska 24, Cracow 31-155, Polande-mail: g.jerz@tu-bs.de

High-speed countercurrent chromatography (HSCCC), an underused separation technique, has proven to be very useful for preparative isolation of natural com-pounds from plant extracts [1]. In this study a separation of two groups, betalains and saponins, from the extracts of dark violet pokeberry fruits, Phytolacca americana (Phy-tolaccaceae), is presented. Because of the high levels of sa-ponins, the Phytolacca species were proposed as biological molluscicides for the control of bilharziosis transmitting snails in Ethiopia [2,3]. In addition, betalains (usually abundant in betanin) have interesting antioxidant prop-erties and are present in the fruits in various glycosylated forms [4]. Some of these compounds have not been iden-tified as yet.Pigments of fresh berries (350 grams) of P. americana (Oct. 2006) were extracted with acidified water (0.7% TFA). Pigment clean-up was performed by solid phase extrac-tion on a C18 column with washing and elution with ACN/H2O (0.7% TFA). Separation of freeze-dried pig-ment extract (C18-extract, 900 mg) was carried out on a “high-speed countercurrent chromatograph” (HSCCC) model CCC-1000 (Pharma-Tech. Res. Corp., U.S.A.) ap-plying the biphasic solvent system n-BuOH : ACN : H2O (0.7% TFA) = 5:1:6 (v/v/v). The flow rate was 3 mL/min and the rotation velocity was set to 850 rpm [1]. The HSCCC system was operated in the “head-to-tail” mode [1]. The principal saponin (2) of the residual HSCCC-coil fraction was isolated by means of preparative C18-MPLC and C18-HPLC. The resulting fractions were analysed by LC-ESI-MS/MS and NMR spectroscopy.From the preparatively separated 900 mg of the pigment extract the eluting main pigment fraction consisted of pure 15R/15S-betanin (1) (~100 mg) in an equal ratio of epimers. The compound was pure enough for 1D-/2D-NMR structural studies. Further fractions contained minor concentrations of other betalains [4] and the coil residue of the HSCCC separation contained the lipophilic triterpene-saponin esculentoside R (2) (6 mg). Acknowledgements: The authors thank C. Kakoschke and B. Jas-chok-Kentner (HZI) for recording NMR data, and are grateful to Dr. M. Kraft and T. Marschall of the Botanical Garden (Techni-cal University Braunschweig) for supplying fruit material of P. americana.

36 2007Abstracts

1. Ito Y., Conway W.D. (1996) High-Speed Countercurrent Chro-matography, Wiley, New York, U.S.A.2. Strauss, A., Spengel, S.M, Schaffner, W. Saponins from root cultures of Phytolacca acinosa. Phytochem. 38, 861-865 (1995).3. Domon, B., Hostettmann, K., New saponins from Phytolacca dodecandra l’Herit. Helv. Chim. Acta 67, 1310-1315 (1984).4. Schliemann, W., Joy IV, R.W., Komamine, A., Metzger, J.W., Nimtz, M., Wray, V., Strack, D. Betacyanins from plants and cell cultures of Phytolacca americana. Phytochem. 42, 1039-1046 (1996).

P2.2.17

Effect of growth regulators on the callus induction of Glicine max (L.) Merr.

J. Krzyżanowska1, A. Czubacka1, M. Przybyś1, T. Doroszewska1, A. Stochmal1, L. Pistelli2, B. Ruffoni3, W. Oleszek1

1Institute of Soil Science and Plant Cultivation - State Research Institute, ul. Czartoryskich 8, Puławy, Poland, 2Department of Bioorganic Chemistry and Biopharmaceutics, University of Pisa, Via Bonanno 33, I-56126 Pisa, Italy, 3CRA Experimental Institute for Floriculture, corso Inglesi 508–18038 Sanremo, Italye-mail: jkrzyzanowska@iung.pulawy.pl

Soybean contains isoflavonoids which have been associ-ated with several health benefits. This compounds are a type of dietary phytoestrogens which play an important role in the prevention of some kind of cancer (breast and prostate cancer), a cardiovascular disease, an osteoporo-sis and posses antioxidant and free radical scavenging properties.The aim of the present study was to obtain an efficient system for the induction of callus tissue of Glicine max.The experimental material like cotyledons and hypocoty-ls, which were excised from 10-days old sterile seedlings, were used as a primary explants. These organs were cut into small fragments and transferred to the various media described below. In this experiment a various combina-tions and different concentrations of growth regulators in Linsmaier and Skoog (LS) basal medium were used. Explants were put on LS medium which was prepared in two combinations: the media supplemented with iso-penthenyladenine (2iP) and indole-3-butiric acid (IBA) as well as the media with the addition of zeatin (Z) and IBA at a concentration: 0; 0.5; 1 or 2 mg/l in sixteen combina-tions.First, single callus cell agglomerations were observed on explants surface after 5 days of culture (proliferation were connected with a surfaces of the cutting). All com-binations were tested after 30 days of culture. The callus obtained on both types of explant and hormone combina-tions showed differences in abundancy and morphology: the coloration, friability and the texture. The callus tissues were received almost in all applied combinations except the hormone free LS medium, and the media without cy-tokinins. Besides callus proliferation, a hairy root forma-tion and necrosis were observed in some cultivars. Hy-pocotyls and cotyledons showed different ability to form callus. The highest percentage of induction (87%) and the most abundant callus proliferation was obtained on the

hypocotyle explants. The cotyledon explants formed calli in 64%. The media containing zeatin were more suitable for obtaining calli from both organs. The callus tissues formed on it were much more abundant than those re-generated on the media with 2iP.The influence of some other cytokinins (kinetin, 6-ben-zylaminopurine) and auxins (2,4-dichlorophenoxyacetic acid, α-naphtaleneacetic acid) on proliferation of callus tissue of soybean is being studied. These results allowed selecting a proper media composition for callus tissue in-duction that will be an object of future studies.

P2.2.18

Betalains in callus cells during in vitro culture of Mesembryanthemum crystallinum L.

M. Libik1, E. Surówka1, E. Niewiadomska1, R. Konieczny2, S. Wybraniec3, Z. Miszalski1

1Institute of Plant Physiology, Polish Academy of Science ul. Niezapominajek 21 30-239 Kraków, Poland, 2Institute of Botany, Department of Plant Cytology and Embryology Jagiellonian University ul. Grodzka 52, Kraków 31-044, Poland, 3Faculty of Analytical Chemistry, Institute C-1, Department of Chemical Engineering and Technology, Kraków University of Technology, ul. Warszawska 24, Kraków 31-155, Polande-mail: libik@ifr-pan.krakow.pl

Mesembryanthemum crystallinum L. shares an unique fea-ture with members of most families of the plant order Caryophyllales with regard to tissue pigmentation: the ac-cumulation of betalains instead of anthocyanins (Voght et al. 1999). It is known that this nitrogen-containing pig-ments are highly hydrophilic and they are confined to vacuoles. Betalains comprise the red-violet betacyanins and the yellow betaxanthins. Interest of these molecules has grown since their antioxidant properties were char-acterised (Escribano et al. 1995). M. crystallinum plant has been already used as a model system to analyse UV-light induced betalain formation (Ibdah et al. 2002). In our ex-periments it was shown that synthesis of this pigment can also be performed by callus tissue achieved from in vitro cultured hypocotyls of M. crystallinum. Betalain synthesis has been observed in the callus cultured on MS (Murashige & Skoog, 1962) modified medium, without NaCl addition and independently on light irradiance. Biochemical analysis of some antioxidants revealed that production of betalain pigments correlated with high lev-el of endogenous hydrogen peroxide concentration. In or-der to investigate the involvement of high concentration of H2O2 in betalain production two inhibitors of antioxi-dant enzymes: aminotriazole (AT) and diethyldithiocar-bamate (DDC) for catalase (CAT) and superoxide dis-mutase (SOD), respectively, have been separately added into the culture media. In result, the decrease in betalain content was observed after culture of callus tissue on the medium with DDC as well as on the medium containing AT. Analysis of ascorbate peroxidase (APX) and guaiacol peroxidase (POD) allowed us to suspect that the action of peroxidases may compensate for the lack of CAT activity

Vol. 54 37EUROBIOTECH 2007

lowering the level of H2O2. Since it is known that beta-lains posses radical scavenging activities, it might be sug-gested that their induction could be an alternative way to cope with oxidative stress.1. Vogt T., Grimm R., Strack D. (1999). Plant J. 19: 509-519.2. Escribano J., Pedreño M.a., García-carmona F., Muñoz R. (1998). Phytochem Anal. 9: 124–127. 3. Ibdah M. A., Krins A., Seidlitz H.k., Heller W., Strack D., Vogt T. (2002). Plant Cell and Environm. 25: 1145-1154. 4. Murashige T. Skoog F. (1962). Physiol. Plant. 15:473–497.

P2.2.19

Accumulation of phenolic acids in in vitro cultures of Ruta graveolens L.

Piekoszewska Agata, Paprocki Michał, Ekiert Halina

Chair and Department of Pharmaceutical Botany, Jagiellonian University, Collegium Medicum, Medyczna 9, 30-688 Kraków, Polande-mail: mfekiert@cyf-kr.edu.pl

This study was designed to investigate the effect of growth regulators on the accumulation of free phenolic acids in stationary liquid cultures of Ruta graveolens L. This group of plant metabolites has valuable therapeutic properties, including immunostimulating, antiaggrega-tive, hypolipemic, cholagogic and spasmolytic activities. Cultures were maintained on 4 variants of Linsmaier-Skoog (LS) medium containing the following concentra-tions of an auxin (NAA) and cytokinin (BAP) [mg/l of medium]: 0.1/0.1; 1/1; 2/2 and 3/1. Eight phenolic acids were analyzed by HPLC in post-culture biomass extracts: caffeic, chlorogenic, ferulic, p-coumaric, p-hydroxyben-zoic, protocatechuic, syringic and vanillic acid. Ferulic and caffeic acid were not detected in biomass cultured on any tested LS variant. The remaining phenolic acids were accumulated at various amounts from 0.01 to 21.5 mg%. p-Coumaric and protocatechuic acid were the dominat-ing metabolites (max. 21.5 and 13.0 mg%, respectively). LS variant containing 0.1 mg/l NAA and 0.1 mg/l BAP was the best “production” medium. Total content of phe-nolic acids accumulated on this medium amounted to 36.42 mg%.

P2.2.20

Influence of growth regulators on accumulation of indole compounds in agitating shoot cultures of Hypericum perforatum L.

A. Piekoszewska, Sułkowska-Ziaja

Chair and Department of Pharmaceutical Botany, Jagiellonian University Collegium Medicum, Medyczna 9, 30-688 Cracow, Polande-mail: agatapie@interia.pl

The overground parts of St. John’s Wort (Hypericum per-foratum L.) contain e.g. hypericin, flavonoids, phenolic acids, and indol compounds such as melatonin.

The aim of this study was to specify influence of growth regulators on accumulation of indole compounds in in vitro cultures of H. perforatum L. Agitating cultures were maintained on liquid Murashige-Skoog (MS) medium supplemented with different growth regulators (BAP, NAA, GA3, picloram), under constant artificial light (900 lx) and in the darkness. Contents of indole compounds: melatonin, tryptophane, methyltryp-tophane and 3-indole-3-acetamide were determined by HPLC method. The biomass extracts were purified by SPE method. The largest quantities of melatonin (0.0164 mg/g d.w.) were accumulated in cultures on the medium with addition of BAP (1 mg/l), NAA (0.5 mg/l) and GA3 (0.25 mg/l) under constant artificial light, while tryptophane (0.3649 mg/g d.w.) was accumulated at the highest con-tent on the medium supplemented with BAP (0.1 mg/l) and NAA (0.1 mg/l) in the darkness. Methyltryptophane was detected in the cultures on the medium with addition of BAP (1 mg/l), NAA (0.5 mg/l) and GA3 (0.25 mg/l) in the darkness. 3-indole-3-acetamide was present in most cultures and the highest content (0.0256 mg/g d.w.) of this compound was found in the cultures on the medium sup-plemented with BAP (2 mg/l) and NAA (2 mg/l) under constant artificial light.The studies have indicated that the agitating shoot cul-tures on MS medium supplemented with BAP (0.1 mg/l) and NAA (0.1 mg/l) is the richest source of indole com-pounds. Moreover, the beneficial effect of light on mela-tonin accumulation and darkness on tryptophane accu-mulation was observed. The research revealed also that the highest index of growth biomass dry weight (Ig=(Wf- Ws)/ Ws, 20.51) was in the cultures on MS medium sup-plemented with BAP (0.1 mg/l) and NAA (0.1 mg/l) culti-vated in the darkness.

P2.2.21

Accumulation of phenolic acids in different type of Hypericum perforatum L. in vitro cultures.

A. Piekoszewska, M. Paprocki, H. Ekiert

Chair and Department of Pharmaceutical Botany, Jagiellonian University Collegium Medicum, 9 Medyczna St., 30-688 Kraków, Polande-mail: agatapie@interia.pl

The overground parts of St. John’s Wort (Hypericum perfo-ratum L.) along of anthracene derivatives, flavonoids, aro-matic oil and other compounds contain also the phenolic acids. Phenolic acids have very valuable biological prop-erties, including: spasmolytic, cholagogic, hypolipemic, antiaggregative and immunostimulating activities.The aim of this study was to specify the influence of growth regulators on qualitative and quantitative content of free phenolic acids in two types of H. perforatum in vitro cultures: stationary liquid and agar cultures. The cultures were maintained on Linsmaier- Skoog (LS) medium supplemented with growth regulators in the following propotions BAP/ NAA [mg/l]: 0.1/0.1; 1/1; 2/2 and 1/3. The phenolic acids (caffeic, chlorogenic, ferulic, p-coumaric, p-hydroxybenzoic, protocatechuic, syringic and vanillic acids) were determined by HPLC method

38 2007Abstracts

in biomass extracts. The highest contents of the phenolic acids (0.1957 mg/g d.w.) were observed in cultures from the LS liquid medium with addition of BAP (1 mg/l) and NAA (3 mg/l), and the lowest (0.0665 mg/ g d.w.) on the LS liquid medium supplemented with BAP 1 mg/l and NAA 1 mg/l. In agar cultures, the highest content of the phenolic acids (0.7407 mg/ g d.w.) was found on LS me-dium with BAP 0.1 mg/l and NAA 0.1 mg/l and the low-est (0.0965 mg/ g d.w.) on medium with addition of BAP 1 mg/l and NAA 3 mg/l.The qualitative and quantitative content of free phenolic acids in biomass depended on the quality of growth regu-lators and the type of in vitro cultures.

P2.2.22

Effect of growth regulators on somatic embryogenesis and alkaloid accumulation in in vitro cultures of Leucojum aestivum L.

Agata Ptak1, Aleksandra Bijok1, Mamadou F. Diop2, Françoise Chrétien2, Yves Chapleur2, Dominique Laurain-Mattar2

1Department of Plant Breeding and Seed Science, Agricultural University, 31-140 Kraków, Poland, 2Groupe S.U.C.R.E.S., UMR 7565 CNRS-Université Henri Poincaré-Nancy 1, BP 239, 54506 Nancy-Vandoeuvre, Francee-mail: mfptak@cyf-kr.edu.pl

Leucojum aestivum L. (summer snowflake) belongs to the Amaryllidaceae family. The Amaryllidaceae species have provided many new promising alkaloids. Galanthamine, an isoquinoline alkaloid common to this family, has been shown to possess cholinesterase inhibitory activity (AChE) and has undergone clinical trials for the treatment of Alzheimer’s disease. For medical application, galan-thamine is mainly isolated from plant material, especially from L. aestivum bulbs but the natural source is insuffi-cient and there is a risk of extinction of this species from its natural habitats in Bulgaria. Lycorine is another mem-ber of the Amaryllidaceae alkaloid group. This alkaloid has been reported to have anticancer and antiviral activities. Presently, studies aimed to clinical use of lycorine are also under way (1). Galanthamine and lycorine production using in vitro cultures of L. aestivum could be an alterna-tive way to obtain these valuable metabolites that could be isolated from plant materials obtained via somatic em-bryogenesis or organogenesis (2).The objective of the present study was to establish tissue cultures of L. aestivum controlled by various hormonal conditions. The effect of different growth regulators on galanthamine and lycorine accumulation was also test-ed. Thin leaves isolated from L. aestivum bulbs chilled at 5°C for 12 weeks were used as initial explants. After 6 weeks of culture on Murashige and Skoog (3) agar medium supplemented with auxins (Picloram, 2,4-D, Dicamba) at 25 or 50 µM and cytokinin (BA) at 0.5 µM, embryo-genic callus developed. Picloram and Dicamba elicited callus formation on the largest percent of explants. The multiplication of embryogenic callus and the formation of somatic embryos occurred on the initial media. Callus

developed on the medium containing 2,4-D (50 µM) was characterized by a higher multiplication index. Whereas the highest numbers of somatic embryos developed from callus cultured with Picloram (50 µM), 2,4-D (50 µM) or Dicamba (25 µM). Galanthamine and lycorine contents were determined in extracts from L. aestivum wild bulbs and calluses obtained from different in vitro conditions by using a RP-HPLC system. 1. Esameldin E, Elgorashi E, Stafford G, Staden J (2004) Planta Medica 70: 258-260.2. Diop MF, Ptak A, Chrétien F, Henry M, Chapleur Y, Laurain-Mattar D (2006) Natural Product Communication 1: 475-479.3. Murashige T, Skoog F (1962) Physiologia Plantarum 15: 473-479.

P2.2.23

Indole derivatives in mycelial cultures of Tricholoma equestre – testing of culture media

Sułkowska-Ziaja K., Muszyńska B., Piekoszewska A.

Chair and Department of Pharmaceutical Botany, Jagiellonian University, Collegium Medicum, Medyczna 9, 30-688 Krakow, Polande-mail: mfziaja@poczta.fm

The aim of this study was the qualification optimal cul-ture conditions for accumulation of indole derivatives. T. equestre in vitro culture was initiated from fruit bodies taken from natural state. Agitating culture served for op-timization of culture condition. Four culture media com-monly used for mycelial culture of Basidiomycetes (acc. Oddoux, acc. Pachlewski, MNM (Marx medium) and PDA (Potato Dextrose Medium) were tested. Efficiency of mycelial biomass testifies about usefulness tested me-dium. Different chromatographic techniques (HPLC, TLC) were used to identify and quantify indole derivatives. The high-est increment was noted on PDA medium (26.334 g/L).Mycelial culture on medium according to Oddoux and on PDA medium was revealed to contain the largest amount of indole compounds: tryptophan (1.036 mg/100 g d.w., 0.801 mg/100 g d.w., respectively), 5-hydroksytryptophan (0.344 mg/100 g d.w., 0.323 mg/100 g d.w.), serotonin (0.083 mg/100 g d.w., 0.598 mg/100 g d.w.), melatonin (0.0344 mg/100 g d.w., 0.322 mg/100 g d.w.). The presence of sero-tonin (0.111 mg/100 g d.w.) and melatonin (0.263 mg/100 g d.w.) was demonstrated on MNM medium, whereas no indole derivatives were quantified in mycelium cultured on medium according to Pachlewski. It was shown that chemical composition of culture media influenced the content of indole compounds produced by mycelia.The present studies have indicated that Tricholoma equestre mycelial culture can be a source of bioactive compounds and confirmed usefulness of in vitro culture for produc-tion of these active substances.

Vol. 54 39EUROBIOTECH 2007

P2.2.24

Optimization of the culture conditions of Sarcodon imbricatus for mycelial growth and nitrogen compounds production

Sułkowska-Ziaja K., Muszyńska B.

Chair and Department of Pharmaceutical Botany, Jagiellonian University, Collegium Medicum, Medyczna 9, 30-688 Krakow, Polande-mail: mfziaja@poczta.fm

Sarcodon imbricatus (L.P.Karst) belongs to Aphyllophorales (Basidiomycetes). This species is under legal protection in Poland. The aim of this study was to optimize of submerged cul-ture conditions for biomass increments and production of nitrogen compounds such as amino acids, indole deriva-tives and amine.S. imbricatus in vitro cultures was initialized from fruit bodies taken from natural state. The optimal medium composition for submerged culture was determined. To investigate the effect of carbon and nitrogen source on hyphal growth, the mycelium was cultivated on the me-dium containing various nitrogen (amonium nitrate, hy-drolizate of casein, yeast extract, malt extract, and sodium nitrate) and carbon (glucose, fructose, maltose, sucrose, lactose) sources. Additionally the optimum initial pH of culture was determined.The optimal medium composition for biomass incre-ments was 5%, glucose, 1% hydrolizate of caseine, 0.3% KH2PO4. Maximal growth of biomass was observed at initial pH 6.0.The presence and content of various amino acids, indole derivatives and amines was determined using HPLC and TLC methods. The largest contents of leucine, lysine, arginine, alanine, metionine, histidine were detected. Among indole derivatives high of contents of tryptophan and tryptamine and low content of melatonin was found in mycelial culture. Any amines were quantified in the culture.

P2.2.25

Chemical analysis of secondary metabolites in Ginkgo biloba L. in vitro cultures

Szewczyk Agnieszka, Piekoszewska Agata

Chair and Department of Pharmaceutical Botany, Jagiellonian University Collegium Medicum, PL 30-688 Kraków, Medyczna 9, Polande-mail: agniszew@yahoo.com

Ginkgo biloba L. leaves are a source of pharmacologically active lactones of di- and sesquiterpene groups and fla-vonoid compounds. Phytopharmaceuticals from ginkgo leaves are used in medicine mostly in disturbances of cer-ebral and peripheral circulation [1,2].The aim of this study was to compare content of biflavo-noids in G. biloba leaves, callus cultures and cell suspen-sions. Two lines (male and female) of callus and cell sus-

pension cultures of G. biloba were initiated. The cultures were maintained on Murashige-Skoog medium [3] sup-plemented with picloram (4 mg/l) and BA (2 mg/l). The analyses of chlorophorm extracts were conducted using HPLC method. Ginkgetin, bilobetin and trace amounts of amentoflavone were detected both in biomass from in vitro cultures and leaves. In contrast to ginkgo leaves, in vitro cultures accumulated biflavonoids in less amounts. 1. Beek T. A., 2000, Ginkgo biloba. Harwood Academic Publishers, Amsterdam.2.Wichtl M., 1997, Teedrogen und Phytopharmaka., Wissen-schaft. Verl., Stuttgart: 257-260.3. Murashige T., Skoog F., 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant 15: 473-497.

P2.2.26

The influence of endogenous phenolic compounds on protein and sugar content in field bean callus

Kinga Tobola, Edyta Skrzypek, Ilona Czyczyło-Mysza, Agnieszka Reszka, Izabela Marcińska

The F. Górski Institute of Plant Physiology, Polish Academy of Sciences, 30-239 Kraków, Niezapominajek 21, Polande-mail: tobola@ifr-pan.krakow.pl

Phenols are main antifeeding substances in field bean plants, which determined the nutritive value of fodder. They diminish sugars transport and coagulate proteins. Synthesis of phenols might be require, because they in-hibit unfavorable effects of stress and reduce reactive oxygen species. The aim of the experiment was to define the influence of endogenic phenols on proteins and sac-charides content in field bean callus obtained from se-lected cultivars and breeding forms. It was also checked if amount of phenols, proteins and sugars is correlated with their amount in plants, donors of explants. Analysis of phenols did not demonstrate differences in their con-centration between callus obtained from white flowering plants (with high tannin content) and callus obtained from colorful flowering plants (with low tannin content). Callus synthesize 4- fold more phenols than seed coat and cotyledons with embryo. In seeds and callus were identi-fied 10 phenolic acids. Chlorogenic, hydroxybenzoic, pro-tocatechuic and caffeic acids occurred in the highest con-centration. Amount of proteins and sugars in callus were uninfluenced by plant genotype and not correlated with amount of phenols. Sucrose was the main sugar identified in callus and seeds. In 10-fold lower concentration were also presented glucose, fructose and inositol. Base on car-ried experiment appeared that mainly seed coat decided about nutritive value of field bean seeds. The amount of phenols in seed coat is highly correlated with proteins content and partially with amount of sugars. Together with increase of phenols concentration, decrease amount of proteins and slightly increase amount of saccharides, mainly reducing one.

40 2007Abstracts

P2.2.27

Thermal stability of decarboxylated betacyanins

Slawomir Wybraniec

Faculty of Analytical Chemistry, Institute C-1, Department of Chemical Engineering and Technology, Cracow University of Technology, ul. Warszawska 24, Kraków 31-155, Polande-mail: swybran@chemia.pk.edu.pl

Thermolability of natural pigments is usually the most restrictive factor in their widespread application as food colorants. This is also true for betalains, a group of water soluble, nitrogenous pigments found in botanical species belonging to families of the order Caryophyllales. From these red-violet or yellow-orange pigments betanin and its C-15 isoform derived from red beet root (Beta vulgaris L.) are extensively used as food colorants in low tempera-ture products. Several studies reported on the structural elucidation and discovery of the new acylated betacyanin, hylocerenin, in fruits of purple pitaya (Hylocereus polyr-hizus) and other new domesticated species of Hylocereus cacti which together with betanin and another acylated betacyanin, phyllocactin, are the main pigments in the fruits. Until recent reports no studies on stability of purple pitaya betacyanins were performed nor were their degra-dation products analysed. Betalains are known to be very sensitive to several factors, including high and low pH, higher temperature or water activity. Some studies have already elaborated the conditions under which these pig-ments (mostly betanin) retain their attractive color and even discovered some of their degradation products. In this study the stability experiments on betacyanins and their decarboxylated derivatives were performed in aqueous solutions at different pH’s (in the range of 3.0-6.5) during 50 min period of thermostating at 85°C. The research was also performed in juice matrix obtained from the H. polyrhizus fruits. The samples were analysed by HPLC after 5 min of cooling and after 24 hours of in-cubation at 4°C.The betacyanins for research were extracted from the fruits of H. polyrhizus. The derivatives of betacyanins (2-decarboxy-betanin, 2,17-bidecarboxy-betanin, 2-decar-boxy-phyllocactin and 2,17-bidecarboxy-phyllocactin) were prepared by thermal decarboxylation of betacy-anins. 100 mL aqueous or ethanolic solutions of purified betanin or phyllocactin, acidified with 0.300 mL of glacial acetic acid, were heated at 85°C (aqueous solutions) and 70°C (ethanolic solutions) in a water bath for 60–180 min. At all experimental conditions the decarboxylated betacy-anins were more stabile in comparison to corresponding betacyanins. In aqueous solutions their highest thermal resistance was observed at pH 4.5–5.5. In the presence of juice matrix the best stability was noticed at higher pH (5.0–6.0). In addition, 2,17-bidecarboxy-betacyanins were always more stable than 2-bidecarboxy-betacyanins. At pH 4.5–5.5 the retention of the compounds in the aqueous solutions was 90–98% and 70–87%, respectively, whereas the retention of betacyanins was substantially lower (20–30%).

P2.2.28

Glucosylation of hydroquinone to arbutin in Ruta graveolens L. in vitro cultures – optimization of process conditions

Szymon Zubek, Agata Piekoszewska, Halina Ekiert

Chair and Department of Pharmaceutical Botany, Jagiellonian University Collegium Medicum, Medyczna 9, PL 30-688 Krakow, Polande-mail: zubek@cm-uj.krakow.pl

Arbutin, a hydroquinone β-D-glucoside, is a metabolite of plant origin used for medicinal and cosmetic purposes as a urinary tract disinfectant and skin whitener, respec-tively. Ruta graveolens L. (garden rue) in vitro cultures have been shown to perform the reaction of hydroqui-none glucosylation to arbutin. The aim of our studies was to optimize this biotransformation process.R. graveolens agitating shoot cultures were maintained on the Linsmaier-Skoog (LS) medium supplemented with 0.1 mg/l NAA and 0.1 mg/l BAP under continuous artificial light (900 lx). Fourteen days after inoculation hydroqui-none was added to the experimental flasks at five differ-ent concentrations (96, 144, 192, 288 and 384 mg/l) either as a single dose or divided into 2 and 3 portions. Arbutin content was determined in methanol extracts from dry biomass by HPLC method.High hydroquinone doses did not cause any damage to R. graveolens shoots. Elevation of precursor dose from 96 to 384 mg/l caused 2.7- and 5.6-fold rise in the product content (single dose and divided into 3 portions, respec-tively). Maximum arbutin content obtained in the shoots was 8 g% d.w. The maximum yield of hydroquinone con-version amounted to 57%.

P2.2.29

Improvement malt quality by biotechnology

Elżbieta Baca, Dorota Michałowska, Agnieszka Salamon

Institute of Agricultural and Food Biotechnology, Department of Beer and Malt Technology, Rakowiecka 36 Street, 02–532 Warsaw, Polande-mail: baca@ibprs.pl

The malting process condition favours the development of microorganisms, which produce the different products of metabolism, in this, dangerous for health of people and animals, e.g. toxin. Toxins cross to brewery wort and act harmfully on yeasts, they brake the fermentation process and remain in beer.The Institute of Agricultural and Food Biotechnology iso-lated three strains of Geotrichum candidum and it worked out the technology of Geotrichum candidum biomass pro-duction. Starter culture is adding to barley culture on steeping stage. These yeasts culture protects barley be-fore moulds development, it prevents creating harmfull mycotoxins, improve chemical quality of malt, improve the efficiency and speed of wort filtration, prevents beer

Vol. 54 41EUROBIOTECH 2007

gushing and reduces the beta-glucan content, which im-proves beer filterability. The Geotrichum candidum starter culture has been already produced and applied on indus-trial scale.

P2.2.30

Enzymatic hydrolysates of protein fraction of wheat grain

Eva Sendrejová, Magdalena Karamać, Agnieszka Kosińska, Ryszard Amarowicz, Dana Urminská

Department of Biochemistry and Biotechnology, Faculty of Biotechnology and Food Sciences, Slovak Agricultural University,Trieda Andreja Hlinku 2, 949 01 Nitra, Slovak Republice-mail: esendrejova@yahoo.com

Hydrolysates of plant proteins have a wide range of ap-plications as a substitute for proteins of animal origin. In-dividual protein fractions of wheat grain, albumins and globulins, gliadins, glutenins were enzymatically hydro-lyzed by endopeptidases from Bacillus subtilis. Enzymatic treatment of the wheat protein isolates was carried out at the temperature of 50°C, pH of 8.0 and for 120 minutes. Using pH-stat method and OPA method, the degree of hydrolysis of albumins and globulins hydrolysates was 5.59% and 7.66%, of gliadins hydrolysates was 2.61% and 2.84% and glutenins hydrolysates 4.95% and 5.12%, re-spectively. For the qualitative analysis of the final wheat hydrolysates, chromatographic methods SE-HPLC and RP-HPLC were used which showed that the best substrate for hydrolysis were albumins and globulins producing a great amount of small peptides and free aminoacids.

P2.2.31

The use of specific for fibre plants media for in vitro micropropagation of Cannabis sativa L.

Karolina Wielgus1, Aleksandra Luwańska1, Michał Pławuszewski1, Wojciech Lassociński2

1Department of Biotechnology and Molecular Biology, Institute of Natural Fibres, Wojska Polskiego 71b, 60–630 Poznan Poland, 2Department of Biochemistry and Biotechnology, Agricultural University, Wolynska 35, 60–637 Poznań, Polande-mail: wielgusk@inf.poznan.pl

Hemp (Cannabis sativa L.) is one of the earliest and most widely cultivated plants. Due to valuable fibre, oil and seeds hemp finds numerous applications as food and feed, in textile, pulp and paper industries and in produc-tion of ropes and bags (Wielgus K. et al., 2006). Further-more hemp is an important plant in medicine and phar-macy (Slusarkiewicz-Jarzina A. et al., 2005). Although industrial hemp cultivars posses very low content of the psychoactive substance: Δ9-tetrahydrocannabinol (THC), the confusion of hemp with marijuana varieties continues to hinder the widespread cultivation of this crop. Nowa-days the increasing interest in development of new hemp

cultivars with traits improved by the means of biotech-nological strategies is observed (Feeney M. & Punja K., 2003; Slusarkiewicz-Jarzina A. et al., 2005). The research has aimed to produce plants with resistance to pests, dis-eases and most recently with enhanced fibre elasticity. Transgenic cultivars of hemp can be used for synthesis of polyhydroxyalkanoates (PHA) and other biopolymers as an alternative to plastics for commercial production. De-velopment of a plant tissue culture regeneration system is required to develop transgenic plants. Most of studies concerning hemp tissue cultures were aimed at develop-ing a cell culture system to obtain secondary metabolites. Only a few reports have described tissue culture condi-tions intended for plant regeneration (Feeney M. & Punja K., 2003; Slusarkiewicz-Jarzina A. et al., 2005).The objective of this study was to determine the optional combination of plant growth regulators for callus induc-tion and plant regeneration of three Polish monoecious hemp cultivars (Beniko, Bialobrzeskie, Silesia), using dif-ferent types of explants.Callus was induced from different explant sources (frag-ments of cotyledons, stems and roots) on Daria ind+ me-dium. Although there was no considerable difference no-ticed in callus induction, callus obtained from different genotypes had different ability to plant regeneration. The statistical analysis indicated that the interaction between tested explant and cultivar has significant effect on the efficiency of plant regeneration. The highest potential to plant regeneration was observed for callus formed on cotyledon explant from Beniko cultivar.1. Feeney M, Punja ZK (2003) In vitro Cellular & Developmental Biology-Plant 39: 578–585.2. Slusarkiewicz-Jarzina A, Ponitka A, Kaczmarek Z (2005) Acta Biologica Cracoviensia Series Botanica 47/2: 145-151.3. Wielgus K, Pławuszewski M (2006) In Renewable Resources and Plant Biotechnology. Kozlowski R, Zaikov GE, Pudel F, eds, pp 135-140. Nova Science Publishers, New York, USA.

Panel III: Molecular markers in plant breeding

Oral presentations

O2.3.1

The impact of genomics on plant breeding

Antoni Rafalski, Bailin Li, Stan Luck, Petra Wolters and Scott Tingey

DuPont Crop Genetics, Experimental Station E353-118A, Route 141 and Henry Clay Road, Wilmington, DE19803, USAe-mail: j-antoni.rafalski@cgr.dupont.com

Introduction: Increased understanding of the organi-zation and DNA sequence of plant genomes, including model systems such as Arabidopsis thaliana, as well as of crop plants (rice, maize and others) led to the increased opportunities for the use of molecular information in plant breeding. Examples include access to high density SNP markers and rapid genotyping systems, identifica-

42 2007Abstracts

tion of loci associated with agronomic traits by genetic association mapping and accelerated gene identification by positional cloning, In this presentation I will review some of these opportunities and the methodologies used to generate this information.Aim of the study: The overall aim of our research is to understand the relationship between genetic diversity at the DNA sequence level and phenotypic diversity in maize and to identify genetic markers (SNPs) associated with traits of interest to the breeders. In many cased the genes involved are also identified.Methods: We genotype maize germplasm collections by either direct DNA sequencing of PCR products or SNP genotyping. This may be done at selected genetic loci (candidate genes), or at many loci distributed across the genome (whole genome scan) or SNP genotyping, in combination with phenotype information. Once loci associated with traits of interest are found we use high resolution genetic mapping in biparental population to identify candidate genes, which may then be tester fur-ther. SNP markers flanking confirmed genes or loci are used in plant breeding as diagnostic tools.Results: Maize is one of the most polymorphic species known, and SNP polymorphisms are very easy to iden-tify in low copy number regions of the genome, for exam-ple in genes [1]. In intergenic regions, even higher levels of genetic diversity are found [2,3]. High density SNP maps have been constructed and linked with a physical (contig) map of the genome. Such integrated maps have been used to identify genes such as anthracnose resist-ance gene Rcg1 (P. Wolters, personal communication). A different approach, genetic association mapping, in a pilot study, conducted using SNP markers distributed throughout the genome, correctly identified the p locus involved in the cob color trait. I will discuss the applica-tions and limitations of each of these approaches, and the applications in plant breeding.Conclusions: Developments in genome analysis already made a significant impact on plant breeding by providing new insights into the understanding of genetic diversity and by providing tools for marker-assisted breeding.Supported by: Pioneer Hi-Bred International, Inc. (Des Moines, IA, USA).1. Ching A et al.(2002) BMC Genet 3(1): 19.2. Morgante M et al. (2005) Nat Genet 37(9): 997-1002.3. Brunner S et al. (2005) Plant Cell 17(2): 343-60.

O2.3.2

Use of DNA markers for commercial plant breeding

Tuvesson Due Stine, Dayteg Christopher, Von Post Rebecka, Eklund Monica, Elmström Linda

Svalöf Weibull AB, SE-268 81 Svalöv, Swedene-mail: stine.tuvesson@swseed.com

Introduction: Molecular markers at SW are used for crop development of cereals, oilcrops and forage. Microsat-ellite markers (SSRs) and other PCR-based markers are used for three main purposes 1: To assist selection of im-portant agronomic traits replacing selection in the field

or glasshouse. 2: Fingerprinting of SW germplasm and 3: Quality assurance of SW products. Aim of the study: To develop and introduce markers in wheat, barley, rye, oat, pea, ryegrass, Brassica napus, B. rapa and B. oleraceae breeding programmes. To develop high-throughput methods for DNA-extraction and mark-er analysis.Methods: Barley SSRs from SCRI, wheat and pea SSRs from AgroGene, rye SSRs from BAZ, oat SSRs from OatLINK, Lolium SSRs from IGER, Brassica SSRs from Celera AgGen.Results: An automated set-up for PCR allowing 300-400 000 routine analysis to be performed per year at low costs per datapoint was developed [1]. Molecular markers are used to fix traits of interest early in a breeding process and for pyramiding of disease resist-ance genes. An example is improving Phoma resistance in oilseed rape.Wild germplasm are used for marker assisted gene intro-gression e.g. from barley Hordeum spontaneum to modern barley and at the same time marker assisted backcrossing speeds up the process. Based on markers dendrograms showing genetic relatedness helps breeders to plan future crosses, e.g. a wheat dendrogram with 300 breeding lines is updated with new advanced lines. Seed purity control including hybridity check of oilseed rape hybrids and synthetics as well as quality assurance of GMO and conventional seed are important activities in the laboratory.Conclusions: At low costs marker analysis can be per-formed and used for plant breeding [2]. This use is lim-ited by the access to trait linked markers.Supported by: The Swedish Farmer’s foundation for Agricultural Research and FORMAS are acknowledged for financial support.1. Dayteg C, Tuvesson S, Merker A, Jahoor A, Kolodinska Bran-testam, A (2006) Plant Breeding in press.2. Tuvesson S, Dayteg C, Hagberg P, Manninen O, Tanhuanpää P, Tenhola-Roininen T, Kiviharju K, Weyen J, Förster J, Schondel-maier J, Lafferty L, Marn M, Fleck A (2006) Euphytica in press.

O2.3.3

Molecular marker systems based on transposon insertion polymorphism

Dariusz Grzebelus

Department of Genetics, Plant Breeding and Seed Science, Agricultural University of Krakow, Al. 29 Listopada 54, 31-425 Krakow, Polande-mail: dgrzebel@ogr.ar.krakow.pl

Introduction: Transposable elements (TEs) are capa-ble of changing their genomic location, which results in generation of de novo variability. Advances in the field of structural genomics enabled a more systematic approach to identification, diversity and population dynamics of TE families in the genomes of model organisms. This, in turn, allowed development of molecular techniques for exploration of transposon insertion site variability, both for model and non-model species.Aim of the study: The overall aim of the study is to de-velop techniques for efficient identification of polymor-phisms resulting from transposon insertions.

Vol. 54 43EUROBIOTECH 2007

Methods: Several methods allowing identification of transposon insertion polymorphisms have been report-ed, from simple PCR amplification with a transposon-specific primer alone or in combination with a primer containing a microsatellite repeat [1], to modifications of the commonly used AFLP (Amplified Fragment Length Polymorphism) technique [2,3], to identification of poly-morphisms in sequence-characterized regions containing TE insertion sites [4].Results: TE insertion polymorphisms can be used, alone or together with other molecular marker systems, to con-struct genetic linkage maps, to characterize interspecific variability, and to fingerprint accessions collected in gene banks, breeding materials, and commercial cultivars. They can also provide means for experimental analysis of TE dynamics and identification of unique insertion sites, being a result of the present TE activity.Conclusions: TEs constitute a significant fraction of plant genomes, sometimes up to 80%. Variability resulting from TE insertions can be a source of numerous polymor-phisms. Large scale, hybridization-based techniques for identification of TE insertion polymorphisms have been developed [4], facilitating high throughput analysis.1. Kalendar R, Grob T, Regina M, Suoniemi A, Schulman A. (1999) IRAP and REMAP: two new retrotransposon-based DNA fingerprinting techniques. Theor. Appl. Genet. 98 704-11.2. Waugh R, McLean K, Flavell A, Pearce SR, Kumar A, Thomas BT, Powell W. (1997) Genetic distribution of BARE-1 retrotrans-posable elements in the barley genome revealed by sequence-specific amplification polymorphisms (S-SAP). Mol. Gen. Genom-ics 253 687-94.3. Casa AM, Brouwer C, Nagel A, Wang L, Zhang Q, Kresovich S, Wessler SR. (2000) The MITE family Heartbreaker (Hbr): molecu-lar markers in maize, Proc. Natl. Acad. Sci. USA 97 10083-9.4. Flavell AJ, Knox MR, Pearce SR, Ellis THN. (1998) Retrotrans-poson-based insertion polymorphisms (RBIP) for high through-put marker analysis. Plant J. 16 643-50.

O2.3.4

General and detailed considerations on marker preparation for MAS

Piotr Masojć

Department Genetics and Plant Breeding, University of Agriculture, 17 Słowackiego Str., 71-434 Szczecin, Polande-mail: pmasojc@agro.ar.szczecin.pl

Marker Assisted Selection (MAS) is becoming a powerful strategy of modern plant breeding. To reduce high po-tential costs of molecular breeding, marker preparation stage should lead to development of simple, robust and reliable method of detecting polymorphism. Generally, allele specific markers are preferable since they are co-dominant, reproducible and suitable for robotized pro-cedures. Two specific dominant markers, linked in repul-sion, and flanking a gene have also high discriminative power. Initial search for marker linked with a gene or valuable QTL can be carried out using powerful methods of marker generation (SSRs, RAPDs, AFLPs, DArTs) and bulked segregant analysis (BSA), near-isogenic lines (NIL) or interval mapping (IM) strategies. At this stage a tight linkage (≤1cM) with the gene of interest is the most im-portant characteristics of a useful marker. It is reasonable

to convert the tightly linked unspecific markers into spe-cific ones, determine their sequence and polymorphism and finally design primers or probes for allele specific PCR or hybridization methods, respectively. Majority of markers are useful within the studied cross or popula-tion, whereas in other breeding materials they may lack polymorphism, express different linkage phase or may be not associated with the trait variation due to loosening of linkage disequilibrium. Thus, there is a need for marker validation in a wider range of plant materials represent-ing variant phenotypes. Markers associated with the trait across different materials reveal polymorphism that is tightly linked with the functional difference in a gene se-quence. If marker itself detects functional polymorphism it enables identification of desirable allele in any breeding population. Further progress in molecular breeding will depend on new marker technologies and computer pro-grams facilitating marker identification and decreasing cost and labor of a large scale screening during MAS.

Posters

P2.3.1

Comparison of isolation DNA methods in the inbred line rye

Henryk Bujak, Kamila Nowosad, Ewa Aplas

Wroclaw University of Environmental and Life Sciences, Cathedral of Plant Breeding and Seed Production, Wrocław, Polande-mail: kamila-nowosad@o2.pl, ewa_aplas@o2.pl

Isolation of DNA is the first stage of molecular research. All the next stages of research are dependent on high quality of genetical material. The main aim of isolation is to get high concentration of high molecular weight DNA without protein and enzyme inhibit factor. The isolation methods can be devided into three groups: 1) isolation by using phenol and chloroform, 2) isolation conducted by protein salt precipitation, 3) isolation by binding of the DNA to the membrane, contaminactions are removed by washing, pure DNA is elueted in water or salt buffer.The study aimed at finding optimal method for rye plant DNA isolation, enabling to obtained large amounts of good quality DNA suitable for molecular markers based on PCR.Extraction methods by Junghans and Metzlaff, isolation of Total DNA from Plant Tissue Using the Dneasy Plant Mini Kit and CTAB method with a few modifications were compared. Concentration, quality and quantity of DNA were estimated by BioPhotometer. The absorbance was measured by A260/280, A260/230, A230, A260, A280, A320. Quality of DNA was also evaluated using agarose gel electrophoresis for all samples. All methods were compared in terms of economic and time-consuming as-pects.

44 2007Abstracts

P2.3.2

Identification of barley varieties by gel electrophoresis of grain proteins

Milan Chňapek, Zdenka Gálová, Martin Vívodík, Želmíra Gregáňová

Slovak Agricultural University in Nitra, Faculty of Biotechnology and Food Sciences, Department of Biochemistry and Biotechnology, Tr. A Hlinku 2, Nitra, 94901, Slovak Republice-mail: chnapek@afnet.uniag.sk

Barley (Hordeum vulgare L.) is an annual crop that is well adapted to growing under a wide range of condi-tions. It is cultivated throughout Europe and in parts of Asia, North America, Australia and New Zealand. Barley grain has become a very important commodity for ani-mal nutrition, mainly because of the high starch content and reasonably balanced protein composition. However, the main demand of the food industry for barley is as a source of malt and malt extract. The major use of malt is, of course, in the brewing of beers and lagers and because of that distinguishes among and identify varieties from the grain is vital to the malting industry. The gel electrophoresis is the most widely used and suc-cessful biochemical methods applied to barley variety identification from the grain. In particular, electrophore-sis of the alcohol-soluble seed storage protein fraction (hordeins) has been extensively researched. Therefore we focused our research on the analysis of the protein composition of individual genotypes. Polymor-phism analyses of the hordeins were conducted on 24 genotypes of Hordeum vulgare L. We used acid polyacryla-mide gel electrophoresis for detection of B and C hordein subunits encoded at Hor-1, Hor-2 and Hor-3 loci. Our in-vestigation shows, that all genotypes were homogenous and single line. There were observed 8 different electro-phoretical profiles for C hordein subunit and 18 electro-phoretical profiles for B hordein subunits. Twenty-one different hordein polypeptide bands were found in the varieties. A range of 6–12 bands was detected for each va-riety individually. The cluster analyses showed that col-lection of investigated barley genotypes can be divided into 4 groups on the basis of the presence of individual polypeptide band. This study of hordein variability points out that barley gliadins (hordein) are suitable markers for identification of barley varieties by acid polyakrylamide gel electro-phoresis.

P2.3.3

Application of RAPD markers in evaluation of genetic diversity of rhododendrons

Małgorzata Czernicka, Wojciech Czernicki, Dariusz Grzebelus, Maria Klein

Department of Genetics, Plant Breeding and Seed Science, Agricultural University of Krakow, Al. 29-Listopada 54, 31–425 Krakow, Polande-mail: czernickam@ogr.ar.krakow.pl

The aim of our study was to evaluate the genetic re-lationship of ten rhododendron taxa. Plant materials were leaves and leaf buds of three evergreen, wild East-ern Asiatic species: R. aureum, R. brachycarpum, R. pur-domii, six cultivars from Catawbiense-Hybridum group: R.’Catharine van Tol’, R.’Nova Zembla’, R.’Album Novum’, R.’Boursoult’, R.’Old Port’, R.’Hachmann’s Charmant’, and one cultivar from Yakushimanum-Hybridum group: R. ‘Koichiro Wada’. DNA was isolated by Ziegenhagen and Scholz [1998] protocol, dedicated to the difficult species in terms of high quality DNA extraction. After isolation DNA was amplified with 19 RAPD primers. We obtained 255 RAPD markers and worked out dendrogram, which illustrated the level of genetic diversity between tested plants. Credibility of obtained tree was confirmed by bootstrap analysis. Whole dendrogram consisted of three main clusters. All cultivars of Catawbiense-Hybridum group were in the same cluster as they are the most ge-netically similar rhododendrons. The bootstrap value for that cluster was 94%. Other two clusters included R. au-reum and R. purdomii as well as R. brachycarpum and R. ‘Koichiro Wada’. But the bootstrap values for these clusters were very low, 55% and 38%, respectively.At present results of that study are used during research on interspecific hybrids obtained from crossings between rhododendron taxa mentioned above. The breeding was undertaken in 1998 at the Agricultural University of Kra-kow in order to increase low temperature tolerance of R. yakushimanum and R. catawbiense group cultivars by cross-ing them with R. aureum, R. brachycarpum and R. purdomii. Asiatic species indicated high level of frost resistance and had very interesting morphological and physiological features.If all studies prove successful, interspecific hybrids of rhododendron will be introduced to the market.Ziegenhagen B., Scholz F. (1998) Methods for difficult plant spe-cies/tisues. Molecular tools for screening biodiversity. Karp A., Isaac P.G., Ingram D.S. (eds.). Chapman and Hall, London, 32-35.

Vol. 54 45EUROBIOTECH 2007

P2.3.4

Determination of genetic relationships among wheat genotypes by microsatellite markers

Želmíra Gregáňová, Martin Vivodík, Zdenka Gálová

Slovak University of Agriculture, Faculty of Biotechnology and Food Sciences, Department of Biochemistry and Biotechnology, Tr.A.Hlinku 2, 949 76 Nitra, Slovak Republic e-mail: Zelmira.Greganova@uniag.sk

For the detection of genetic diversity and for the discrimi-nation of the thirty bread wheat genotypes eight micros-atellite markers were used. Eight primer pairs amplified altogether 43 different polymorphic alleles with an aver-age number of 5.38 alleles per locus. All eight primer pairs were polymorphic and produced reproducible data. The diversity index (DI), the polymorphic information con-tent (PIC) and probability of identity (PI) of the tested SSR markers was calculated. The diversity index (DI) of the tested SSR markers ranged from 0.442 to 0.804 with an av-erage of 0.605 which is generally considered sufficient for this purpose. For the assessment of genetic diversity the dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared. The genotypes were grouped into clusters. It was not possible to distinguish 4 cultivars, cultivars Arida and Matador and also culti-vars Bety and Brea, respectively. For better differentiation it is necessary to use more polymorphic microsatellite markers. The results showed the utility of microsatellite markers for detection of genetic polymorphism leading to genotype identification and for estimation of genetic diversity of wheat genotypes.

P2.3.5

BAC clones as useful markers of Brachypodium distachyon chromosomes

Dominika Idziak1, Elżbieta Wolny1, Agnieszka Marasek2, Iain S. Donnison3, Ian Armstead3, Ann Thomas3, Ian P. King3, John Draper4, Glyn Jenkins4, Robert Hasterok1

1Department of Plant Anatomy and Cytology, Faculty of Biology and Environmental Protection, University of Silesia, 40-032, Katowice, Poland, 2Department of Plant Physiology and Biochemistry, Research Institute of Pomology and Floriculture, 96-100 Skierniewice, Poland, 3Institute of Grassland and Environmental Research, Plas Gogerddan, Aberystwyth SY23 3EB, Wales, United Kingdom, 4Institute of Biological Sciences, University of Wales Aberystwyth, Penglais, Aberystwyth, Ceredigion SY23 3DA, Wales, United Kingdome-mail: didziak@us.edu.pl

Brachypodium distachyon has been proposed as a species of choice for comparative genomic studies of temperate ce-reals and forage grasses. Such advantages as favourable phylogenetic position within the Pooideae subfamily and

a range of desirable biological features such as small and compact genome, low repetitive DNA content, short life-cycle, self-fertility, simple growth requirements as well as efficiency in mutagenesis and transformation make it a valuable model for this group of organisms.In order to facilitate structural analysis of B. distachyon genome and physical mapping of its chromosomes two genomic BAC libraries were constructed for two dip-loid ecotypes of B. distachyon, ABR1 and ABR5. The BAC clones were cytogenetically mapped by fluorescence in situ hybridisation with mitotic chromosomes of B. dis-tachyon ABR1 and related species ABR114 (2n = 20) and ABR113 (2n = 30). Among 39 clones used for cytogenetic mapping 15 were selected by PCR with primers designed on the base of known rice and Poaceae sequences, while 24 were randomly chosen from the libraries. As a result of homologous hybridisation of the selected BACs, chro-mosome-specific, single-loci signals were obtained for 32 of analysed clones. These clones allowed to distinguish individual arms of every chromosome in the complement thus proving their utility as cytogenetic markers. Several BACs did not hybridise to single loci but gave signals dis-persed in the whole genome. These clones probably con-tain highly repetitive DNA sequences. The ‘landing’ of BAC clones on Brachypodium chromosomes was achieved without customary blocking with either genomic or Cot-1 DNA. This fact along with observed small number of multi-loci clones indicate relatively low percentage of re-petitive DNA sequences in the B. distachyon genome.Heterologous mapping in ABR114 chromosomes revealed that some of the analysed clones did not gave any hybrid-isation signals, while the others mapped with relatively lower signal intensity. The number of BAC hybridisation signals in ABR113 chromosomes was a sum of signals ob-served in ABR1 and ABR114 chromosome complements. These results confirmed the hypothesis that ABR113 is an interspecific hybrid that comprises two genomes of 10 and 20 chromosomes, each bearing close similarity to ABR1 and ABR114, respectively.The obtained results proved usefulness of BAC clones as efficient markers of B. distachyon chromosomes and their potential in determination of phylogenetic relationships in the genus Brachypodium.D.I., E.W. and R.H. acknowledge financial support from Polish Ministry of Science and Higher Education (grant 2 PO4C 012 30).

P2.3.6

Application of DNA markers for selection in oilseed rape (Brassica napus L.) breeding programmes

Katarzyna Mikołajczyk

Plant Breeding and Acclimatization Institute, Poznań Branch, Strzeszyńska 36, 60-479 Poznań, Polande-mail: kamik@nico.ihar.poznan.pl

Oilseed rape (Brassica napus L.) is one of the most impor-tant oil crop of the moderate climate zone. Obtaining of double-low (00) varieties, i.e., with no erucic acid in seed oil and characterized by the very low seed meal glucosi-

46 2007Abstracts

nolates content has made oilseed rape even more worth-full plant oil source (Downey & Rakow, 1987) revealing a constant tendency of production increase (Bartkowiak-Broda et al., 2005). Further improvement of oil and seed meal quality as well as seed yield seems to be crucial for establishing of rapeseed as a strong member on the oil crops market. Significant progress has been achieved with the use of classical recombinant methods in rapeseed breeding ac-companied by biometric and biochemic traits analyses as well as classification of the obtained results based on quantity genetics methods. However, marker assisted selection (MAS) could be a useful tool for effective and environmentally independent selection of particular gen-otypes. Therefore, development of genetic markers for industrially important genotypes makes one of the main topics of research to be applied by oilseed rape breeders.At the Poznań Branch of the Plant Breeding and Acclima-tization Institute, a SCAR marker for the ogura cytoplas-mic male sterility (CMS) as well as an RAPD marker for the Rfo restorer gene for the ogura CMS have been adopt-ed and applied for routine analyses. They proved very useful for monitoring of ogura sterile cytoplasm and Rfo restorer gene in restored hybrids as well as for monitoring of restorer gene in new breeding programmes devoted to seed yield increase by hybrid breeding. Moreover, a time- and cost effective SCAR marker was developed for the Rfo restorer gene. Some RAPD markers have been adopted and applied for identifying of the low-linolenic doubled haploid lines developed from F1 hybrid (Cegielska et al., 2002) obtained from a cross of a 00 winter oilseed rape variety and the low-linolenic Canadian spring cultivar Apollo. In addition, allele-specific SNP markers for the low-linolenic mutant (LLMut) genotype of winter oilseed rape (Spasibionek, 2006) were developed lately and they will make a real progress in monitoring of the LLMut genotype in breeding programmes, as the low-linolenic trait is highly influenced by environment conditions (Bar-tkowiak-Broda and Krzymański, 1983). 1. Bartkowiak-Broda I., Krzymanski J. (1983) Inheritance of C18 fatty acid composition in seed oil of zero erucic winter rape Brassica napus L. Proc. Int. Rapeseed Conf. Paris, vol. 1, pp. 477-482.2. Bartkowiak-Broda I., Mikołajczyk K., Spasibionek S., Cegiel-ska-Taras T. (2005) Genetic and breeding research aiming at increasing the value of rapeseed oil as a source of renewable energy. Jeżowski S., Wojciechowicz K.M., Zenkteler E. (eds.), Al-ternative plants for sustainable agriculture, 129-139, 2006. Insti-tute of Plant Genetics PAS, Poznan, Poland.3. Downey R.K., Rakow G. (1987) Rapeseed and mustard. In: W.R. Fehr (editor), Principles of cultivar development, Vol. 2, Crop species, Macmillan Publishing Company, New York, pp. 437-486.4. Cegielska-Taras T., Tykarska T., Szala L., Kuraś L., Krzymański J. (2002) Direct plant development from microspore-derived em-bryos of winter oilseed rape Brassica napus L. ssp. oleifera (DC.) Metzger. Euphytica 124 (3): 341-347.5. Spasibionek S. (2006) New mutants of winter rapeseed (Brassi-ca napus L.) with changed fatty acid composition. Plant Breed. 125: 259-267.

P2.3.7

Detection of Leptosphaeria maculans mating types using PCR method

Anna Stachowiak, Małgorzata Jędryczka

Institute of Plant Genetics, Polish Academy of Sciences, Strzeszyńska 34, 60-479 Poznań, Polande-mail: mjed@igr.poznan.pl

Leptosphaeria maculans (Desm.) Ces. et de Not. is a causal agent of phoma leaf spot and stem canker (blackleg) – a damaging disease of oilseed rape worldwide. The disease is common in Australia, Canada and Europe, including Poland. The pathogen belongs to the order of Pleosporales, class Dothideomycetes and subphylum Ascomycotina. The most infective fungal propagules are ascospores pro-duced in pseudothecia, which are fruiting bodies of the generative stage of this fungus. The generative stage takes place in the presence of both mating types, called Mat 1.1 (mat+) and Mat 1.2 (mat–). Equal balance between both mating types enables the fungus to produce numerous fruiting bodies and spores and it reflects high capacity to infect plants. The aim of this study was to evaluate the proportion of both mating types in field populations of the pathogen obtained from hyphal tip cultures. Numer-ous attempts to cross the isolates were unsuccessful, but the PCR method proved its high usefulness. The material for the study was composed of 414 isolates obtained from field experiments established in Poland, Germany, Swe-den and the UK in autumn 2002 and 2003. DNA was isolat-ed from fungal isolates using DNeasy Plant Kit (Qiagen). A multiplex PCR was used to determine the distribution of the Mat 1.1 and Mat 1.2 alleles. The forward primers were (5’ to 3’) CTCGATGCAATGTACTTGG for mat+ and AGCCGGCGGTGAAGTTGAAGCCG for mat– and re-verse primer was TGGCGAATTAAGGGATTGCTG. Each primer pair generated a single product of either 441 bp (Mat 1.1) or 397 bp (Mat 1.2). The ratio between Mat 1.1 and Mat 1.2 in all isolates was almost 1:1 with a small variation within isolates from different countries. The method can be routinely used for big populations of the fungus and it allows to omit crossing of isolates in vitro, which is time consuming and not reproducible method. This robust multiplex assay for mating type of L. maculans will be very useful for population genetic studies aimed at characterizing the genetic diversity of this pathogen. High balance between both mating types produced in a field allows the fungus a successful propagation in natu-ral infection conditions. 1. Cozijnsen A.J, Howlett B.J: Characterisation of the mating-type locus of the plant pathogenic ascomycete Leptosphaeria maculans (2003) Current Genetics, 43: 351-357.2. Gout L, Eckert M, Rouxel T, Balesdent M-H: Genetic variabil-ity and distribution of mating type alleles in field populations of Leptosphaeria maculans from France (2006) Applied and Envi-ronmental Microbiology, vol.72, No.1, 185-191.

Vol. 54 47EUROBIOTECH 2007

P2.3.8

Utilization of DNA and protein markers in MAS selection of wheat

Martin Vivodík, Milan Chňapek, Zdenka Gálová, Želmíra Gregáňová

Slovak University of Agriculture Faculty of Biotechnology and Food Sciences, Department of Biochemistry and Biotechnology, Tr.A.Hlinku 2, 949 76, Nitra, Slovak Republice-mail: vivodik@afnet.uniag.sk

The main goal of our work was to determine the tech-nological quality of 25 new wheat genotypes and wheat genotypes (Triticum aestivum L.) on the base of the mo-lecular markers. Storage proteins and DNA were used as molecular markers. Storage proteins are the first products of gene expression and because of that they are usually used as markers for identification of cultivar and charac-terization of technological quality. HMW-GS were sepa-rated by SDS-PAGE and there were determined 10 elec-trophoretical profiles. Profile with HMW-GS composition 0, 7+9, 5+10 was the dominating one. There was also used separation of gliadins by A-PAGE for detection of seca-lin block, which was observed in 9 genotypes. At present, DNA markers have higher application in the detection of genes controlling important wheat properties. The same set of wheat genotypes was analyzed by DNA markers. They were analyzed for the presence of major HMW alle-les at A, B and D genome loci with multiplexed PCR assay and then compared with protein analysis done by SDS-PAGE. PCR analysis for gene controlling bread-making quality confirmed that used primers can be utilized for detection of wheat technological quality.

P2.3.9

Phytochemical researches on the toxic compounds of Gladiolus segetum L.

Dalila Abdessemed, Dominique Laurain-Mattar, Yves Chapleur, Amar Dibi, Max Henry

Groupe SUCRES, UMR 7565 CNRS – Nancy-Université, BP 239, 54506 Nancy-Vandoeuvre, Francee-mail: Dominique.laurain-mattar@pharma.uhp-nancy.fr

Gladiolus segetum is a toxic plant, lethal for livestock, well-known as harvest gladiolus, growing in wheat fields and cultures. It is well spread in highlands in Algeria.The aim of our study was to elucidate the structure of the toxic compounds responsible of the lethal effect of this plant. Former studies (Wasicky and Hoehne, 1951) reported the presence of saponins in different cultivars of gladiolus, 6.38% in leaves and 8.68% in dried bulbs. Saponins were also mentioned in gladiolus in 1959 in a paper of Chernov and Lytkina who tested their toxic ac-tivities on tumors. In 1962, Stanislas and Galaud proved that saponins are well responsible of the toxic effects.We performed an extractive protocol on 1.2 kg of dried shoots of Gladiolus segetum gathered it near Batna in May 2004. We used first petroleum ether, second chloro-

form and third and last methanol. The chloroform extract was purified on low pressure liquid chromatography with a gradient of ethanol. We obtained different com-pounds and especially a pink one with Rf 0.8 on reversed phase silica gel TLC showing a purity level giving rise to toxicological tests on tumour cells. This typical colour is generally characteristic of glycoalcaloids. So, now, we are planning to perform these tests on specific colon cells available in our research team.1. Chernov V.A. and Lytkina U.B. (1959) Voprossy onkol. 5: 552-560.2. Stanislas E. and Galaup J. (1962) Toulouse-pharmaceutique 9 (2): 27-28.3. Wasicky R. and Hoene W. (1951) Anais da facultade de Farm. E Odontol. Da Universitade de Soa Paulo 9: 17-26.

P2.3.10

Galanthamine from Leucojum aestivum L. tissue cultures and hairy roots

Mamadou Falilou Diop1, Alain Hehn2, Agata Ptak4, Françoise Chrétien1, Frédéric Bourgaud2, Max Henry3, Yves Chapleur1, Dominique Laurain-Mattar1

1Groupe S.U.C.R.E.S., UMR. 7565 CNRS-Université Henri Poincaré-Nancy 1, BP 239, 54506 Nancy-Vandoeuvre, France, 2Laboratoire Agronomie et Environnement, UMR INPL-INRA 1121, ENSAIA, 2 Avenue de forêt de Haye, F-54500 Vandoeuvre les Nancy, France, 3Laboratoire de Botanique, Faculté de Pharmacie, 5 rue Albert Lebrun, BP 403, 54001 Nancy, France, 4Department of Plant Breeding and Seed Science, Agricultural University, 31-140 Krakow, Polande-mail: dominique.laurain-mattar@pharma.uhp-nancy.fr fallou.diop@pharma.uhp-nancy.fr

Leucojum aestivum L. bulbous plant belonging to Ama-ryllidaceae family, contain galanthamine, an isoquinoleic alkaloid, which has shown cholinesterase inhibitor activ-ity and is currently undergoing clinical trials in the treat-ment of Alzheimer’s disease (1). Today, galanthamine used in therapeutics is obtained from Narcissus spp. and Leucojum aestivum bulbs (2). Facing the growing demand of the pharmaceutical market, the natural source would be insufficient. Galanthamine production using in vitro cultures could be an alternative way to obtain this valu-able metabolite.Different in vitro cultures (embryogenic callus, bulblets, roots) of Leucojum aestivum L. was established and Agro-bacterium rhizogenes has been tested for its capacity to induce hairy roots of this monocotyledonae plant (3) in view to produce similar or higher yields of galanthamine as compared with untransformed organs. Reversed phase HPLC system was used for qualitative and quantitative determination of galanthamine, coupled with different identification techniques (4). 1. Mustafa N.R., Rhee I.K. and Verpoorte R. Journal of Liquid Chromatography & Related technologies, 2003, 26, 3217-3233.2. Heinrich M. and Teoh H.L. Journal of Ethnopharmacology, 2004, 92, 147-162.3. Diop M.F., Hehn A., Ptak A., Chrétien F., Doerper S., Gontier E., Bourgaud F., Henry M., Chapleur Y., Laurain-Mattar D. Phy-tochemistry review, 2007, in press.

48 2007Abstracts

4. Diop M.F., Ptak A., Chrétien F., Henry M., Chapleur Y., Lau-rain-Mattar D.. Natural Product Communications, 2006, 1, 475-479.

P2.3.11

Utilization of molecular markers for identification of wheat genotypes

Martin Vivodík, Milan Chňapek, Zdenka Gálová, Želmíra Gregáňová

Ing. Martin vivodík, Department of Biochemistry and Biotechnology, Faculty of Biotechnology and Food Sciences, Slovak Agricultural University in Nitra, Slovak Republic, Tr. A. Hlinku 2,94976 Nitra, Slovak Republice-mail: vivodik@afnet.uniag.sk

The main goal of our work was to determine the tech-nological quality of 25 new wheat genotypes and wheat genotypes (Triticum aestivum L.) on the base of the mo-lecular markers. As molecular markers were used storage proteins and DNA. Storage proteins are the first products of gene expression and because of that, they are usually used as markers for identification of cultivar and charac-terization of technological quality. HMW-GS were sepa-rated by SDS-PAGE and there were determined 10 elec-trophoretical profiles. Profile with HMW-GS composition 0, 7+9, 5+10 was the dominating one. There was also used separation of gliadins by A-PAGE for detection of seca-lin block, which was observed in 9 genotypes. At present, DNA markers have now higher application in the detec-tion of genes controlling important wheat properties. We also analyzed the same set of wheat genotypes with protein markers. Wheat cultivars were analyzed for the presence of major HMW alleles at A, B and D genome loci with multiplexed PCR assay and then were compared with protein analysis done by SDS-PAGE. PCR analysis for gene controlling bread-making quality confirmed that used primers can be utilized for detection of wheat tech-nological quality.Key words: glutenin, gliadin, PAGE, PCR, wheat bread-making quality