Role of penicillin-binding protein 1b in competitive stationary-phase survival of Escherichia coli

Role of penicillin-binding protein1b in competitive stationary-phase survival ofEscherichia coliEvan D. Pepper, Michael J. Farrell & Steven E. Finkel

Molecular and Computational Biology Program, Department of Biological Sciences, University of Southern California, Los Angeles, CA, USA

Correspondence: Steven E. Finkel,

Molecular and Computational Biology

Program, MCB 201, University of Southern

California, Los Angeles, CA 90089-2910,

USA. Tel.: 11 213 821 1498; fax: 11 213 740

8631; e-mail: [email protected]

Received 4 May 2006; revised 7 July 2006;

accepted 10 July 2006.

First published online 15 August 2006.

DOI:10.1111/j.1574-6968.2006.00418.x

Editor: Robert Gunsalus

Keywords

penicillin-binding proteins; stationary phase-

specific competition defect; osmotic stress.

Abstract

The penicillin-binding proteins (PBPs) catalyze the synthesis and modification of

bacterial cell wall peptidoglycan. Although the biochemical activities of these

proteins have been determined in Escherichia coli, the physiological roles of many

PBPs remain enigmatic. Previous studies have cast doubt on the individual

importance of the majority of PBPs during log phase growth. We show here that

PBP1b is vital for competitive survival of E. coli during extended stationary phase,

but the other nine PBPs studied are dispensable. Loss of PBP1b leads to the

stationary phase-specific competition defective phenotype and causes cells to

become more sensitive to osmotic stress. Additionally, we present evidence that this

protein, as well as AmpC, may assist in cellular resistance to b-lactam antibiotics.

Introduction

Twelve penicillin-binding proteins (PBPs) have been identi-

fied in Escherichia coli: five high molecular weight PBPs (1a,

1b, 1c, 2, and 3) and seven low molecular weight PBPs (4, 5,

6, 7, AmpC, AmpH, and DacD). Two of these proteins,

PBP2 (mrdA) and PBP3 (ftsI), are essential for normal

growth (Spratt, 1975) and are not further characterized in

this study. Although the physiological functions of PBPs 1a,

1b, and 5 are fairly well understood (Denome et al., 1999;

Nelson & Young, 2000), the biological roles of the remaining

PBPs are not fully determined, even though most of their

specific in vitro biochemical activities have been elucidated.

Briefly, PBPs 1a (mrcA) and 1b (mrcB) are transglycosylases

and transpeptidases (Ghuysen & Dive, 1994); PBP1c is a

close homolog to PBPs 1a and 1b but has not been

completely characterized (Schiffer & Holtje, 1999); PBPs 4,

5, 6, and DacD are carboxypeptidases (Matsuhashi et al.,

1979; Amanuma & Strominger, 1980; Korat et al., 1991;

Baquero et al., 1996); PBPs 4 and 7 are endopeptidases

(Korat et al., 1991; Romeis & Holtje, 1994); AmpC is a

b-lactamase, and AmpH binds many b-lactams, though it

has not been shown to possess demonstrable b-lactamase

activity (Henderson et al., 1997).

PBPs are found in all free-living bacteria. Their ubiquity

suggests an important role in cell physiology. They are known

to synthesize and remodel cell wall peptidoglycan, which gives

the cell its rigidity and shape, prevents osmotic lysis and resists

toxins. PBPs are also the target of many antibiotics. Although

E. coli maintains 12 PBP genes, many of the gene products have

overlapping biochemical functions and seem to be nonessential

for exponential phase growth. In fact, an E. coli mutant lacking

eight of 12 PBPs is viable (Denome et al., 1999). Perhaps

individual PBPs play more important roles in natural environ-

ments, where cells compete for limited carbon and energy

sources, encounter antimicrobial agents, and are subjected to a

variety of other stresses. Escherichia coli faces similarly stressful

environmental challenges during long-term stationary-phase

batch culture incubation, where nutrients are depleted and the

cells encounter alkaline and oxidative stress conditions (Farrell

& Finkel, 2003; Finkel, 2006). Thus, in light of previous

experiments casting doubt on their importance during log

phase, we sought to broaden the understanding of the physio-

logical functions of the PBPs using stationary-phase survival

assays conducted under a variety of laboratory conditions.

Materials and methods

Bacterial strains

Strains used in this study are derived from E. coli K-12 strain

ZK126 (W3110 DlacU169 tna-2) and are listed in Table 1.

FEMS Microbiol Lett 263 (2006) 61–67 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

Mutants of 10 PBP genes were constructed by homologous

recombination and gene replacement with a chlorampheni-

col-resistance cassette (CamR) flanked by FLP recombinase

(FRT) sites (see Datsenko & Wanner, 2000). A tnaA mutant

was also constructed in the same manner to serve as a

control strain. This strain shows the same growth, survival,

and competition phenotypes as the parent strain. The CamR

mutations were transduced by bacteriophage P1 into the

genetically marked strain ZK1142 (NalR) (see Zambrano

et al., 1993; Finkel & Kolter, 1999). Removal of CamR

resistance cassettes was achieved by transformation of each

strain with a temperature-sensitive plasmid expressing FLP

recombinase (Datsenko & Wanner, 2000). For complemen-

tation experiments, PBP mutant SF2341 (mrcB) was trans-

formed with plasmid pSAD426-11, which expresses mrcB, or

the plasmid pSAD444-1, which carries a mutant variant of

mrcB (Denome et al., 1999).

Culture conditions and titering assays

Five milliliter cultures were grown in 18� 150 mm test tubes

at 37 1C with aeration in a TC-7 roller drum (New Bruns-

wick Scientific, Edison, NJ). Luria–Bertani (LB) medium

was prepared according to manufacturer’s instructions (Dif-

co). For all titering assays, viable counts were determined by

serial dilution of cells removed periodically from the cul-

tures, followed by plating on LB agar containing appropriate

antibiotics at the following concentrations: nalidixic acid

(20 mg mL�1), streptomycin (25mg mL�1), or chlorampheni-

col (30mg mL�1). To measure long-term survival of indivi-

dual strains in monoculture, 5 mL cultures were inoculated

1 : 1000 (v/v) from fresh overnight cultures started from

frozen LB–glycerol stocks. To ascertain the relative fitness of

mutant strains, wild-type and PBP mutants were either

coinoculated 1 : 1000 as described above, or 2.5 mL of each

strain from overnight cultures were mixed, followed by

periodic sampling, serial dilution, and plating on selective

media that allowed quantification of individual subpopula-

tions. Where appropriate, cultures were buffered at pH 5

with 100 mM MES, pH 7 with 100 mM HEPES, or at pH 9

with 100 mM TAPS (Sigma, Aldrich). To determine dou-

bling time, c. 103 CFU mL�1 from overnight cultures were

inoculated into either fresh LB or conditioned medium and

quantified hourly during exponential growth phase.

Table 1. Strains used in this study

Strain Relevant phenotype Gene Sequence of knockout primer pair� or Reference

ZK126 Wild type – Zambrano et al. (1993); Finkel & Kolter (1999).

ZK1142 ZK126 NalR – Zambrano et al. (1993); Finkel & Kolter (1999).

ZK1143 ZK126 StrR – Finkel & Kolter (1999).

SF2338 PBP1a�NalR mrcA H1P1: gcctataccgctacatcgagccacaactgccggatggtgtaggctggagctgcttc

H2P2: ctgacgtaagcgaattggaccagcatactgcggtggcatatgaatatcctcctta

SF2341 PBP1b�NalR mrcB H1P1: gacgattatgatgactatgaggatgaagaaccgatggtgtaggctggagctgcttc

H2P2: catatccttgatccaaccggctacaccgtcgctgtccatatgaatatcctccttag

SF2365 PBP1c�NalR pbpC H1P1: cactgtcgcgatttgccccacgtcatccatcaccaggtgtaggctggagctgcttc

H2P2: gagcagataaactctggcctctaccgctgcatgaagcatatgaatatcctcctta

SF2344 PBP4�NalR dacB H1P1: gatttatcatcggattgaccagctgtatagcgttcagtgtgtaggctggagctgcttc

H2P2: gctttcaaaacgcactaacggaatacggcgattacgctgcatatgaatatcctccttag

SF2347 PBP5�NalR dacA H1P1: cgctcaccacggctctttgcacagcctttatctctggtgtaggctggagctgcttc

H2P2: cacaaccagcgggcgttgctcgatcgttttgccatccatatgaatatcctccttag

SF2350 PBP6�NalR dacC H1P1: ctcctctctccttcgtggtcttgcagcgggttctgcgtgtaggctggagctgcttc

H2P2: gaaatcccacacccgaccaaagaatccgccctcttccatatgaatatcctccttag

SF2362 PBP6b�NalR dacD H1P1: ggtcagatcctcaccgcgggtaatgagcatcaacaggtgtaggctggagctgcttc

H2P2: cactcaggcgagaaaacatgctgccttccccgacagcatatgaatatcctcctta

SF2353 PBP7�NalR pbpG H1P1: gcctggccctgatgctggctgtgccttttgcaccgcgtgtaggctggagctgcttc

H2P2: cgttctgtgccgtctgccccgccgccgccatttgggcatatgaatatcctccttag

SF2356 AmpC�NalR ampC H1P1: ccacatttgctgcccctcaacaaatcaacgatattggtgtaggctggagctgcttc

H2P2: cgttaagaatctgccaggcggcgtcgactctcgctgcatatgaatatcctccttag

SF2359 AmpH�NalR ampH H1P1: ccgatcactgaaccggagtttgcctctgatattgtcgtgtaggctggagctgcttc

H2P2: caacggtttattcccgcttagctcggtcaccaggtccatatgaatatcctccttag

SF2336 TnaA�NalR tnaA H1P1: actttaaacatctccctgaaccgttccgcattcgtgtgtgtaggctggagctgcttc

H2P2: acttctttaagttttgcggtgaagtgacgcaatactttcatatgaatatcctcctta

SF2370 SF2341 pSAD426-11 mrcB1 This strain carries a plasmid expressing PBP1b. Denome et al. (1999)

SF2371 SF2341 pSAD444-1 mrcB This is the vector-only control strain for SF2370. Denome et al. (1999)

�The sequences of P1 and P2 are the same for each primer, corresponding to regions flanking the chloramphenicol-resistance cassette used to replace

each gene (Datsenko & Wanner, 2000). H1 and H2 correspond to sequences near the beginning (H1) or end (H2) of each gene.

FEMS Microbiol Lett 263 (2006) 61–67c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

62 E.D. Pepper et al.

Antibiotic sensitivity assays

In these experiments, 200mL of cells from overnight cultures

were spread onto 25 mL LB agar (in standard 15 cm dia-

meter Petri dishes). Sterile filter discs (13 mm diameter)

infused with 50 mL of antibiotic solution [ampicillin, cefox-

itin, moxalactam, kanamycin, chloramphenicol, or strepto-

mycin (Sigma-Aldrich) at either 1.5 or 7.5 mg mL�1] were

then placed on the inoculated agar. After 16–20 h of incuba-

tion at 37 1C, the diameter of the zone of inhibition was

measured. For minimum inhibitory concentration (MIC)

assays, overnight cultures were inoculated 1 : 1000 into fresh

LB broth containing an appropriate range of antibiotic

concentrations (see Results), then incubated for 18–20 h

and quantified to determine the lowest concentration that

inhibited the growth of microorganisms.

Osmotic stress assays

For osmotic stress experiments, LB medium was supple-

mented with sucrose to a final concentration of 0.5–2 M.

Hypertonic cultures were incubated as described above and

viable counts were determined periodically.

Conditioned medium assays

To prepare conditioned medium, cultures were inoculated

with either wild-type or mutant bacteria and incubated for

1–5 days, followed by filter sterilization (0.22mm filters;

Nalgene) to remove bacterial cells from the medium. Cells

from freshly grown overnight cultures were then inoculated

1 : 1000 into conditioned media and monoculture assays

were performed as described to quantify viable cells. For

long-term survival assays, conditioned medium from 1- or

5-day-old cultures was used. For outgrowth experiments

used to determine doubling time in conditioned medium,

medium from 3-day-old cultures was used.

Results and discussion

Cultured in LB under standard laboratory conditions, single

mutations in each PBP gene tested had no statistically

significant effect on bacterial growth yields (Fig. 1a). How-

ever, PBP1b� strains show an increase in average doubling

time during exponential phase compared with wild-type cells

(discussed below). All PBP mutants were viable during long-

term monoculture for more than 10 days, exhibiting similar

survival patterns to the parent and control strains (Fig. 1a).

To determine whether any PBP mutants display the

stationary phase-specific competition defective (SPCD)

phenotype (Finkel & Kolter, 2001; R. Yalamanchili and

S. Finkel, manuscript in preparation), we competed PBP

mutants against wild-type strains in LB batch cultures. The

SPCD phenotype is defined by the inability of a mutant

strain to coexist with its parental strain during long-term

14121086420

4

6

8

10

PBP1B−

log

CF

U m

L−1

*

1086420

*

4

6

8

10

2

PBP1B−

Day

4

6

8

10

21086420

***

PBP1B−

(a)

(b)

(c)

Fig. 1. Long-term survival and competition of wild-type and PBP mutant

strains. (a) Composite of representative long-term survival patterns when

wild-type or PBP mutant strains are grown individually in monoculture:

wild-type and control strains (&), the PBP1b� strain (n), and all other

PBP mutant strains (�). (b) Composite of representative survival patterns

when strains are co-inoculated (1 : 1000) in competition with the wild-

type ZK1143, the StrR wild-type parent (—). The squares and triangles

indicate competition pairs: ZK1143 ( ) vs. either the Tna� control

strain ( ) or the PBP1b� mutant strain ( ). (c) Composite of

survival patterns when wild-type (—) and PBP1b�mutant strains (- - - -)

are mixed at a 1 : 1 ratio from overnight cultures. Circles and squares

indicate competition pairs. Asterisks indicate cell titers are below the limit

of detection (o 1000 CFU mL�1). PBP1b� strains are indicated. Represen-

tative data is shown (nZ3 for all experiments).


63PBP1b is required for competitive stationary-phase survival

coculture in stationary phase. In contrast, when cultured

alone, the mutant strain shows no long-term growth or

survival defects. In competition assays, only the PBP1b

mutant showed a significant SPCD phenotype (Fig. 1b).

The competitive fitness of this mutant is sharply reduced,

leading to its extinction from the population within 1 week

of coculture. When transformed with a plasmid expressing

mrcB (pSAD426-11), long-term fitness of PBP1b mutants

increased by at least two orders-of-magnitude over a 10-day

period compared with strains transformed with the vector

plasmid pSAD444-1 (data not shown). None of the other

PBP mutant strains tested showed a significant decrease in

fitness or viability compared with the tna control strain

(data not shown). The SPCD phenotype is also apparent

when mrcB mutants are competed against parental strains in

conditioned media (data not shown) or when both strains

are grown individually to stationary phase and then mixed

such that the initial population of both strains is approxi-

mately equal (initial density �109 CFU mL�1; see Fig. 1c).

Thus, even though mrcA mrcB double mutants, lacking both

PBP1a and PBP1b, are lethal (Suzuki et al., 1977) and single

mutations in either gene are not (indicating overlapping

function), the PBP1b mutant displayed the SPCD pheno-

type (Fig. 1b), whereas the PBP1a mutant exhibited normal

competitive ability. This suggests that PBP1b plays an

important role in E. coli during stationary phase and

correlates well with previous studies proposing that PBP1b

possesses a greater biosynthetic capacity than PBP1a (Garcia

del Portillo & de Pedro, 1990), in spite of the fact that both

proteins are transglycosylases and transpeptidases. It is also

in agreement with studies that conclude that PBP1b is the

major high-molecular PBP in E. coli (Chalut et al., 2001).

Possessing multiple PBPs may also assist the cell in

resisting the effects of certain antibiotics that target cell wall

synthesis. PBPs interact with b-lactam antibiotics, such as

ampicillin, in differing manners. Some form stable serine

esters, while others have weak to strong b-lactam hydrolyz-

ing activity (Livermore, 1995). Thus we expected that

individual PBP mutants might display differential sensitivity

and/or resistance to b-lactams. The wild-type and all PBP

mutant strains were tested for b-lactam sensitivity using

zone of inhibition and MIC assays. Our results indicate that

mutations in mrcB cause E. coli to become more sensitive to

ampicillin (Fig. 2) as well as the b-lactams cefoxitin and

moxalactam (data not shown). In zone of inhibition assays,

this effect was completely reversed by complementation

with a plasmid carrying mrcB1 (Fig. 2). Importantly, PBP1b

mutants were not more sensitive than wild-type cells to

other antibiotics that target protein synthesis, including

kanamycin, chloramphenicol, and streptomycin (data not

shown). Mutations in ampC, as expected, also increased

ampicillin sensitivity (Fig 2; also see Henderson et al., 1997),

though mutants of ampH, a b-lactamase homolog, and all

other PBP mutants tested had responses similar to the wild-

type (data not shown). In MIC assays, mrcB mutants were

also more susceptible than wild-type strains to the effects of

ampicillin (MIC = 3.0 mg mL�1 for mrcB vs. 6.0mg mL�1 for

wild-type), cefoxitin (1.5 vs. 2.5mg mL�1), and moxalactam

(0.15 vs. 0.30 mg mL�1).

The cell wall is important for survival under conditions of

osmotic stress that bacteria often encounter in natural

environments, including soil and the intestinal tract. The

loss of PBP1b causes cells to become more sensitive to a

hypertonic culture medium; wild-type cells survive 2 M

sucrose for at least 72 h, while mutants lose viability (Fig. 3;

20.0

22.0

24.0

26.0

28.0

30.0

32.0

34.0

Wild

type tn

a∆1b ∆1b

∆1b+p

1b

∆1b+p

1b

∆1b+v

ec

∆1b+v

ecam

pCam

pC

Wild

type tn

a

Strains

Fig. 2. Ampicillin zone of inhibition assay. Cells grown overnight in LB

medium were spread onto LB-agar plates containing filter discs infused

with ampicillin at 1.5 or 7.5 mg mL�1. The zone of inhibition is the diameter

(measured in mm) of the clear area surrounding the filter disc where

bacteria do not grow. Wild-type strain (ZK1143), tna control (SF2336),

DPBP1b (SF2341), DPBP1b1p1b (PBP1b expression plasmid; SF2370),

DPBP1b1vec (vector control; SF2371) and ampC (SF2356) were used.

The average of three experiments is shown with standard error indicated.

Day

log

CF

U m

L−1

3210

3

5

7

9

PBP1b−*

Fig. 3. Sensitivity to osmotic stress. Survival patterns of cells inoculated

individually into LB medium containing 2 M sucrose. Wild-type (ZK126),

&; TnaA� control strain (SF2336),�; PBP1b� strain (SF2341), n. Asterisk

indicates cell titers are below the limit of detection (o1000 CFU mL�1).

Experiments were performed three times; representative data is shown.



compare with Fig 1a). At concentrations below 2 M sucrose

both wild-type and mrcB cells have similar survival character-

istics (data not shown). All other PBP mutants survived

osmotic stress as well as the parent and control strains (data

not shown). The sensitivity of the PBP1b mutant to osmotic

stress under laboratory conditions suggests that PBP1b may less

efficiently build or maintain its cell wall, a factor that may

contribute to the SPCD phenotype displayed by the mutant.

The SPCD phenotype of mrcB mutants is affected by the

pH of the medium. In unbuffered LB, the SPCD phenotype

is evident within 10 days (Fig. 1b). During long-term batch

culture the medium begins at pH �7, becomes basic (pH

�8.5) after 24 h, and remains at this pH or greater for at

least 10 days (data not shown). Basification occurs primarily

due to the use of amino acids as the primary source of

carbon and energy after exhaustion of the initial carbohy-

drates in the medium (Farrell & Finkel, 2003). Therefore, we

decided to test the competition phenotype of mrcB mutants

as a function of environmental pH. In LB buffered to acidic

(pH �5) or neutral (pH �7) conditions, mrcB mutants are

more fit than at basic pH, although they still show a fitness

defect compared with wild-type cells (Fig. 4a and b). In LB

buffered to alkaline pH, the competitive ‘defect’ of the

mutant is immediately apparent in the reduced overnight

yield, after which the mutant subpopulation steadily de-

clines until no cells can be detected by day 10 (Fig. 4c). Thus,

the competitive ability of the mutant is more highly

compromised in basic medium when compared with what

is observed in unbuffered medium (compare Fig. 4c with

Fig. 1b). The reason(s) for the dramatic effect of pH are not

clear at present. However, it has been reported that the

activity of a high molecular weight PBP in Streptococcus

pneumoniae, homologous to E. coli transpeptidases PBPs 2

and 3, is sensitive to extremes of pH (Laible et al., 1989;

Thomas et al., 2001). Therefore, it is possible that as the pH

increases during batch culture (see Farrell & Finkel, 2003)

PBP1b’s transpeptidase activity becomes critical as the

activity of the other PBPs may be compromised.

Another explanation for the SPCD phenotype displayed by

mrcB strains is increased sensitivity to extracellular factors,

such as toxins or degradative enzymes produced by the parent

cell line but not by the mrcB mutant. To investigate this

possibility, conditioned medium experiments were performed

(see Materials and methods) in which mrcB mutant cells were

inoculated into cell-free medium comprised of the filtrate of

previously cultured wild-type or PBP1b mutant bacteria. As

no difference in the long-term survival kinetics of wild-type

or mutant strains was observed over a 10-day period (data not

shown), it seems unlikely that toxin production plays a direct

role in the observed SPCD phenotype. However, conditioned

media experiments did reveal a significant effect on doubling

time during outgrowth (see below).

We propose that PBP1b mutants display the SPCD

phenotype for several reasons. First, mutants may less

efficiently construct or maintain their cell walls, leaving the

bacterium more susceptible to osmotic and alkaline stress;

consequently, a greater proportion of mutant cells may die

per unit time when compared with the parental strain

during stationary phase. Also, assays performed in both LB

and conditioned media indicate that average doubling times

increase for PBP1b mutants compared with wild-type cells

(Fig. 5). In LB medium, mrcB mutant doubling times are

increased by c. 36% (compare 28 vs. 38 min for the mutant;

Fig. 5a). In conditioned medium, with limited nutrients and

alkaline pH equivalent to that of stationary phase, the

average doubling time of the PBP1b mutant is �42% longer

(85 min for the mutant strain compared with 60 min for the

log

CF

U m

L−1

3

5

7

9

3

5

7

9

3

5

7

9

Day

0 7 14 21

0 7 14 21

0 7 14 21

(a)

(b)

(c)

Fig. 4. Representative competitions between wild-type (ZK1143, solid

lines) and PBP1b mutant strains (dotted lines) in LB medium under (a)

acidic, pH 5, (b) neutral, pH 7, or (c) basic, pH 9, conditions. Three

representative competitions are shown for each experiment. The limit of

detection is o 1000 CFU mL�1.



wild-type). If extracellular toxin production were contribut-

ing to the SPCD phenotype of mrcB mutants, we would

expect a greater difference in relative growth rates in condi-

tioned medium as compared with fresh LB due to accumu-

lation of potentially toxic extracellular compounds during

long-term stationary-phase incubation. However, in both

LB and conditioned media the PBP1b mutant strain shows

an �40% increase in doubling time compared with wild-

type cells, suggesting no such role for extracellular factors.

Both a decreased rate of cell division (especially during

stationary phase) and an increased death rate due to altered

sensitivity to environmental stressors can affect the ability of

cells to compete and may lead to the eventual extinction of

PBP1b mutants when cocultured with wild-type strains. In

general, functional redundancy may be a reason that most

PBP mutants display no obvious phenotype (Young, 2001).

A physiological function for PBP5 was realized only when

other PBP genes had also been deleted (Nelson & Young,

2000). Additional studies employing strains harboring mul-

tiple PBP mutations may reveal other in vivo functions of

this important group of bacterial proteins.

Acknowledgements

We thank Vyacheslav Palchevskiy, Sudha Nair, and Gary

Nord for technical assistance, Alison Alcott and two re-

viewers for comments on the manuscript, and Dr Kevin

Young for generously providing plasmids. This research was

supported in part by the USC/Norris Comprehensive Can-

cer Center. E.D.P. is a recipient of a Fletcher Jones Founda-

tion Fellowship in the Biological Sciences and a National

Institute on Aging Predoctoral Training Grant

(#5T32AG00093-22).

References

Amanuma H & Strominger JL (1980) Purification and properties

of penicillin-binding proteins 5 and 6 from Escherichia coli

membranes. J Biol Chem 255: 11173–11180.

Baquero MR, Bouzon M, Quintela JC, Ayala JA & Moreno F

(1996) dacD, an Escherichia coli gene encoding a novel

penicillin-binding protein (PBP6b) with DD-

carboxypeptidase activity. J Bacteriol 178: 7106–7111.

Chalut C, Charpentier X, Remy MH & Masson JM (2001)

Differential responses of Escherichia coli cells expressing

cytoplasmic domain mutants of penicillin-binding protein 1b

after impairment of penicillin-binding proteins 1a and 3.

J Bacteriol 183: 200–206.

Datsenko KA & Wanner BL (2000) One-step inactivation of

chromosomal genes in Escherichia coli K-12 using PCR

products. Proc Natl Acad Sci USA 97: 6640–6645.

Denome SA, Elf PK, Henderson TA, Nelson DE & Young KD

(1999) Escherichia coli mutants lacking all possible

combinations of eight penicillin binding proteins: viability,

characteristics, and implications for peptidoglycan synthesis.

J Bacteriol 181: 3981–3993.

Farrell MJ & Finkel SE (2003) The growth advantage in

stationary-phase phenotype conferred by rpoS mutations is

dependent on the pH and nutrient environment. J Bacteriol

185: 7044–7052.

Finkel SE (2006) Long-term survival during stationary phase:

evolution and the GASP phenotype. Nat Rev Microbiol 4:

113–120.

Finkel SE & Kolter R (1999) Evolution of microbial diversity

during prolonged starvation. Proc Natl Acad Sci USA 96:

4023–4027.

Finkel SE & Kolter R (2001) DNA as a nutrient: novel role for

bacterial competence gene homologs. J Bacteriol 183: 6288–6293.

Garcia del Portillo F & de Pedro MA (1990) Differential effect of

mutational impairment of penicillin-binding-proteins 1A and

1B on Escherichia coli strains harboring thermosensitive

mutations in the cell division genes ftsA, ftsQ, ftsZ, pbpB.

J Bacteriol 172: 5863–5870.

Ghuysen JM & Dive G (1994) Biochemistry of the penicilloyl

serine transferases. Bacterial Cell Wall (Ghuysen JM &

Hakenbeck R, eds), pp. 103–129. Elsevier Science B.V.,

Amsterdam.

Henderson TA, Young KD, Denome SA & Elf PK (1997) AmpC

and AmpH, proteins related to the class C b-lactamases, bind

penicillin and contribute to the normal morphology of

Escherichia coli. J Bacteriol 179: 6112–6121.

Korat B, Mottl H & Keck W (1991) Penicillin-binding protein 4 of

Escherichia coli: molecular cloning of the dacB gene, controlled

overexpression, and alterations in murein composition. Mol

Microbiol 5: 675–684.

Laible G, Hakenbeck R, Sicard MA, Joris B & Ghuysen JM (1989)

Nucleotide sequences of the pbpX genes encoding the

penicillin-binding-proteins 2x from Streptococcus pneumoniae

R6 and a cefotaxime-resistant mutant, C506. Mol Microbiol 3:

1337–1348.

Livermore DM (1995) b-Lactamases in laboratory and clinical

resistance. Clin Microbiol Rev 8: 557–584.

Matsuhashi M, Tamaki S, Curtis SJ & Strominger JL (1979)

Mutational evidence for identity of penicillin-binding protein

Outgrowth

20.00

30.00

40.00

50.00

60.00

70.00

80.00

90.00

100.00

WT/LB PBP1b−/LB WT/C.M. PBP1b−/C.M.

Strain/Media

Fig. 5. Comparison of wild-type (ZK1143) and PBP1b mutant growth

rates (measured in min) in LB or 3-day-old conditioned medium (CM).

The average of six trials is shown with standard error indicated.



5 in Escherichia coli with the major D-alanine carboxypeptidase

IA activity. J Bacteriol 137: 644–647.

Nelson DE & Young KD (2000) Penicillin binding protein 5

affects cell diameter, contour, and morphology of Escherichia

coli. J Bacteriol 182: 1714–1721.

Romeis T & Holtje JV (1994) Penicillin-binding protein 7/8 of

Escherichia coli is a DD-endopeptidase. Eur J Biochem 224:

597–604.

Schiffer G & Holtje JV (1999) Cloning and characterization of

PBP 1C, a third member of the multimodular class A

penicillin-binding proteins of Escherichia coli. J Biol Chem 274:

32031–32039.

Spratt BG (1975) Distinct penicillin binding proteins involved in

the division, elongation, and shape of Escherichia coli K12. Proc

Natl Acad Sci USA 72: 2999–3003.

Suzuki H, Nishimura Y & Hirota Y (1977) On the process of

cellular division in Escherichia coli: a series of mutants of E. coli

altered in the penicillin-binding proteins. Proc Natl Acad Sci

USA 75: 664–668.

Thomas B, Wang Y & Stein RL (2001) Kinetic and

mechanistic studies of penicillin-binding protein 2x

from Streptococcus pneumoniae. Biochemistry 40:

15811–15823.

Young KD (2001) Approaching the physiological functions of

penicillin-binding proteins in Escherichia coli. Biochimie 83:

9–102.

Zambrano MM, Siegele DA, Almiron M, Tormo A & Kolter R

(1993) Microbial competition: Escherichia coli mutants

that take over stationary phase cultures. Science 259:

1757–1760.



Documents

Role of penicillin-binding protein 1b in competitive stationary-phase survival of Escherichia coli