Rapid DNA Extraction for Screening Soil

7/29/2019 Rapid DNA Extraction for Screening Soil

1/4

Po is Journa o Environmenta Stu ies Vo . 13, No. 3 2004 , 315-318

Rapid DNA Extraction for S reening SoilF lamentous F ngi Using PCR A plification

G. A. Paza *, R. Upchurch , R. L. Brigmon , W. B. Whitman , K. Ulfig

Institute for Ecology of Industrial Areas, Kossutha 6, 40-844 Katowice, Poland

Department of Microbiology, University of Georgia, Athens, Georgia, 30602-2605, USA

West ng ouse Savanna R ver Tec no ogy Center, A en, Sout Caro na, 29808, USA

Receive : 6 J ne 2003

Accepte : 10 Septem er 2003

Abstract

s mp e an rap proce ure or e c ent y so at ng ung su ta e or use as a temp ate or

PCR amplification and other molecular assays is described. The main advantages of the method are: (1)

the mycelium is directly recovered from Petri-dish cultures; (2) the technique is rapid and relatively easy

to per orm , an ) t a ows or process ng o aroun samp es ur ng a s ng e ay; ) t s nexpens ve;

) t e qua ty an quant ty o o ta ne are su ta e or mo ecu ar assays; ) t can e app e to

amentous ung rom so as we as rom a ung rom ot er env ronmenta sources; an ) t oes not

require the use of expensive and specialized equipment or hazardous reagents.

Keywords: NA isolation, soil fungi, PCR amplification

Introduction

Molecular methods are useful analytical tools for

eva uat ng t e m cro a commun t es structure an unc-

on, nc u ng ot t e cu t vate an non-cu t vate

parts. T ese tec n ques can e app e to ot pure an

ixed cultures. DNA analysis have been applied at dif-

ferent resolution levels for whole communities, bacterial,fungal, yeast isolates and clones of specific genes [1].

ere ore, n a t ese var ous samp es DNA extract on

proce ures are mportant parts o t e nvest gat ons.

hese procedures must provide DNA in sufficient quanti-

y and purity for molecular analyses. The DNA extraction

echniques can potentially remove inhibitory materials,

.e. po ysacc ar es, prote ns, m nera sa ts, etc., w c

m t t e sens t v ty o t e erent react ons n w c

so ate DNA s app e 1 .

Filamentous fungi have sturdy cell walls which are

esistant to standard DNA extraction procedures for yeast

and bacteria [2]. To reduce the cost, equipment, and timenvo ve n mo ecu ar exper ments, t s a so es ra e to

isolate fungal DNA from a plate rather than using conidia

and hyphal fragments from plate cultures to seed larger

volume broth cultures [2].

Nuc e c ac etect on met o s suc as PCR ave

ecome a common too or ent cat on an c arac-

ter zat on o m cro a commun t es. T e po ymerase

chain reaction (PCR) is increasingly being used as an

alternative to culture-based methods for the detectionand, in some cases, quantification of microorganisms

n var ous env ronmenta samp es nc u ng a r, so s,

an s, waters, etc. 3, 4 . A t oug PCR amp cat on

can be performed directly on various microbial cultures,

for filamentous fungi and yeast, prior isolation of DNA is

often preferred. The DNA extraction procedure eliminates

many nter er ng su stances e m nera sa ts, prote ns,

po ysacc ar es, an p ays an mportant ro e n ensur ng

cons stent resu ts. Cons era e e orts ave een ma e to

improve the preparation of DNA from fungi [5-10]. This

is a significant challenge, especially when dealing with a

large number of samples. However, many of the methodsare o ten a or ous, expens ve an t me consum ng. T ese

met o s o ten re y on us ng a gr n er w t or w t out q-

uid nitrogen) for initial breakage of the mycelia or require*Corresponding author; e-mail: [email protected]


2/4

Paza G. A. et al.316

spec a y roxyapat te co umns, spec c nstrumentat on

an matr ces 2, 5 .

T e o ect ve o t e stu y was to eve op a rap an

simple method for the direct extraction and purification

of DNA from filamentous soil fungi.

xperimental

Funga Cu tures

Pure cultures of 50 filamentous fungi were ob-

tained from soil contaminated by petroleum hydro-

car ons an now un er oreme at on treatment o r

env ronmenta restorat on 11 . T e so ate unga

cu tures were grown on MEA Ma t Extract Agar

DIFCO) supplemented with 100g/ml chloram-

phenicol (Sigma) for 7 days at room temperature prior

to DNA extraction.

NA Extract on or Funga Stra ns

The DNA extraction procedure was adopted with

some modifications from the methods of Tsai and

O son 12 an Fur ong t a 13 . Funga myce um

were rect y co ecte rom cu ture p ates an 200-500

mg o myce um mater a wet we g t was a e to 1.5

mL microcentrifuge tubes. Mycelium material from the

fungi were suspended in 500 l of a bead beating solu-

t on conta n ng: 0.1M NaC , 0.5M Tr s-HC , pH8.0 ,

an 5% so um o ecy su ate. Approx mate y 0.2 g

o m xe ameter 1.0mm 0.5mm 0.1mm g ass ea s

for crushing of cell walls were also added. The tubes

were then placed into a TurboMix adapter (Scientific

Industries, INC.) attachment for a Vortex Genie 2 (Fish-

er B o oc Sc ent c an omogen ze or 10 m n at

max mum spee . T en, t e tu es were centr uge or

10 min at 11,000 g. After centrifugation, the superna-

tants were decanted into new tubes and the extraction

procedure was repeated. An equal volume of phenol:

c oro orm: soamy a co o 25:24:1 Amresco was

a e to eac samp e; t e samp es were t en vortexe

r e y, an centr uge or 5 m n n a m crocentr uge.

he aqueous layer was transferred to a new tube and

extracted again with an equal volume of chloroform:soamyl alcohol (24:1). The tubes were mixed vigor-

ous y an centr uge or 5 m n at 10,000 g. T e super-

natant was trans erre to t e new Eppen or tu es, an

2.5 volumes of isopropanol was added for precipitation

of DNA. The tubes were incubated in a refrigerator for

1 hour, and centrifuged at 4C for 10 min at 14,000 g.

e pe ets were was e tw ce w t co 70% et ano ,

a r- r e , an t en resuspen e n ster e ou e e-

on se water. T e samp es were treate w t RNase

DNase ree Roc e Mo ecu ar Systems, INC. . T e

su sequent DNA y e s an qua ty were assesse y

standard electrophoresis through a 1% (w/v) ethidium

bromide-stained agarose gel.

PCR Amp cat on o rDNA

he PCR reaction for isolated fungal DNAs was

performed with puReTaq Ready-To-Go Poly-

merase Chain Reaction (PCR) beads (Amersham

B osc ences as prev ous y escr e 4 . Bea s are

prem xe an pre spense comp ete react ons or

per orm ng PCR amp cat ons. W t t e except on o

primers and template, the ambient temperature-stable

beads provide all the necessary reagents to perform 25

l polymerase chain reactions, e.g. stabilizers, BSA,

ATP, CTP, GTP, TTP, ~2.5 un ts o puReTaq DNApo ymerase an react on u er. W en a ea was re-

constituted to a 25l final volume, the concentration

of each dNTP was 200 mM in 10 mM Tris-HCl (pH

9.0), 50 mM KCl and 1.5 mM MgCl . A typical PCR

conta ns < 1g o temp ate DNA an pr mers at a con-

centrat on o 0.2-1 M. T e samp es were su ecte to

30 cyc es o 95C or 1 m n, 56C or 3 m n an 72C

for 2 min for denaturation, annealing and elongation

steps, respectively. An initial denaturation step (95C,

1 m n was use to ensure comp ete enaturat on o t e

temp ate DNA. PCR amp cat on was per orme n

a Mastercyc er gra ent mac ne Eppen or . T e

primers for the reactions were as follows: forward

primer: NS1 (GTAGTCATATGCTTGTCTC) and re-

verse primer: ITS4 (TCCTCCGCTTATTGATATGC)

14 . Loca zat on o t e pr mers to unga rDNA s

presente n F g.1. PCR pro ucts were rst ana yze

g. . c emat c representat on o pr mers pos t on on r

source: http://plantbio.berkeley.edu/-bruns/picts/results/map).

Nuc lear S mal l r DNA ( 18S ) N uc le ar L ar ge r DNA ( 28S )ITS ITS5.8S

rDNA

NS 1

ITS 4

Fig.2. Electrophoresis of DNAs isolated from filamentous soil

ung . were seperate on a agarose ge n x u er.anes - an anes - , , , , - num er o unga

cu tures rom w c s were so ate . - ae

ladder; bp - base pairs.


3/4

Rapi DNA Extraction or Screening Soi Fi amentous... 317

y e ectrop ores s n 1% wt v agarose ge s an et -

um rom e sta n ng. PCR pro ucts were pur e us-

ng a H g Pure PCR Pro uct Pur cat on K t Roc e

Molecular Systems, INC.) and then sequenced.

RFLP

Restr ct on enzyme gest ons o PCR amp cat on

products were performed according to the manufacturer

specifications. Approximately 2-5 l of PCR products

were digested with 1 U of Hae III (Boehringer Mannheim

Gm H n t e M u er supp e y t e manu acturer. To-

a vo ume o gest on react on was 10 . RE react ons

were per orme n 0.5 mL m cro uge tu es an ncu ate

for 2 hours at 37C, DNA samples were electrophoresed

n 2% (wt/v) agarose gel for 2 hours in 1xTAE buffer

(40mM Tris-acetate, 1mM EDTA). Fungal DNAs were

ewe on a UV trans um nator ox an p otograp e .s DNA mo ecu ar we g t mar ers X174 DNA HaeIII

(Promega, UK) and 1Kb DNA (Invitrogen Carlsbad,

CA) ladders were used.

esults and Discussion

T e met o presente n t s paper e m nates muc

of the laborious and time-consuming steps of most other

protocols [2, 5, 6]. DNA was isolated immediately from

yce um. In t s proce ure ce wa s are ro en y a

ea eat ng so ut on w t a m xture o g ass ea s w t

erent ameters. T e amount an qua ty o t e DNA

obtained by this procedure were suitable for PCR am-

plification and other molecular assays. Results of DNA

e ectrop ores s n 1% agarose ge are emonstrate n

F g. 2. PCR pro ucts e ore t e pur cat on step are pre-

sente n F g. 3. One o t e a vantages o t s proce ure

is that many samples can be simultaneously processed.

In our experiment, approximately 50 fungal strains iso-

lated from soil contaminated by petroleum hydrocarbonsan un er oreme at on were exam ne . O part cu ar

nterest s t e recovery o 28S RNA an 18S RNA as v -

sualised by electrophoresis in ethidium bromide-stained

gel (Fig. 2). The recovery of these single stranded RNAs

indicated that the procedure was relatively gentle. The

proce ure m n m z ng contam nat on r s s etween

samp es can e comp ete w t n 2 ours. It s app -

ca e to var ous amentous ung so ate rom verse

environment samples. The DNA yields were reasonably

high and compared with the literature data [2, 5, 7].

Nevertheless, genomic DNA extracted by the procedure

as een rea y amp e y PCR F g.3 , an PCR pro ucts ave een gest e w t restr ct on enzymes,

e.g. HaeIII (Fig.4).

It is likely that this procedure could be applied to

the examination of many other fungal cultures. It pro-

v es a rap , re a e, an ow-cost a ternat ve to t e

ex st ng DNA pur cat on protoco s use n researc

an c n ca a orator es 2, 5, 9, 15 . Use o t s pro-

cedure will allow researchers to obtained DNA from

fungi quickly and inexpensively for molecular assays

an rep aces expens ve an consum ng proce ures

5, 8, 16 .

Conclusions

he protocol is effective, easy, fast, and does not re-

qu re t e use o expens ve equ pment an reagents. DNA

extracte us ng t e met o was use to success u y am-

plify regions of interest. The amplicons were suitable for

further applications such as sequencing and PCR-RFLPs.

g. . garose ge e ectrop ores s o -amp e pro ucts.u react ons were run on agarose ge .

anes - an anes - , , , , - num er o unga

cultures, Lane M - DNA marker.

g. . ae restr ct on patterns o pro ucts.pro ucts were geste y ae an run on agarose ge .

anes , , , , , , , , , , , , - num er o unga

cultures, Lane M - DNA molecular weight marker - 1Kb DNA.


4/4

Paza G. A. et al.318

SIGNIFICANCE AND IMPACT OF THE STUDY:

e escr e met o can e app e n env ronmen-

ta m cro o og ca stu es or sens t ve screen ng o

filamentous fungi isolated from different environ-

ments. This technique could be used for rapid screen-

ng of different species, activity, and/or products forotec no ogy.

Acknowledgements

The authors would like to express their gratitude to

t e U.S. Department o Energys JCCES Program, t e

Inst tute or Internat ona Cooperat ve Env ronmenta

Researc o F or a State Un vers ty, t e US Department

of Energy, and Westinghouse Savannah River Technology

Center for their technical and financial support.

eferences

. ., . ., .: o ecu ar

c on ng: a oratory manua ., nd e . o pr ng ar or

a oratory o pr ng ar or, , .

. . ., . ., . .,

BOWDEN R.A., MYERSON D.: Comparison of six ex-

traction techniques for isolation of DNA from filamentous

fungi. Med.Mycol. , , .

3. MADIGAN M.T., MARTINKO J.M., PARKER J.: Biology

of microorganisms., 9t ed. by T.D. Brock, Prentice Hall Up-

per a e ver, , .

. . ., . .: o ymerase c a n reac-

t on: pp cat ons n nv ronmenta cro o ogy.

nnu. ev. cro o . , , .. . ., . ., . .: va -

uat on o erent met o s or t e extract on o rom

fungal conidia by quantitative competitive PCR analysis.

. cro o . et o s , , .

. AL-SAMARRAI T.H., SCHMID J.: A simple method for

extraction of fungal genomic DNA. Lett.Appl.Microbiol.

, , .

. ., .: ap met o s or nuc e c ac s

extract on rom etr s -grown myce a. urr. enet. ,

, .

8. GRIFFIN D.W., KELLOGG C.A., PEAK K.K., SHIN E.A.:

A rapid and efficient assay for extracting DNA from fungi.

ett. pp . cro o . , , .

. ., ., . .:

extract on met o or n mycorr za ung .

Lett.Appl.Microbiol. 33, 307, 001.

. ., ., .: ex-

tract on met o or screen ng yeast c ones y . otec -

n ques , , .

11. Bioremediation of petroleum hydrocarbon-contaminated

soils. Comprehensive Report, IETU, Savannah River

Technology Center, Lawrence Berkely National Labora-

tory, nst tute or nternat ona ooperat ve nv ronmentaesearc , or a tate n vers ty, .

12. TSAI Y.-L., OLSON B.H.: Rapid method for direct extraction

of DNA from soil and sediments. Appl.Environ.Microbiol.

, , .

. . ., . ., . .,

. .: o ecu ar an cu ture- ase ana yses

of prokaryotic communities from an agricultural soil and

the burrows and casts of the earthwormLumbricus rubellus.

pp . nv ron. cro o . , , .

. ttp: p ant o. er e ey.e u - urns pr mers. tm

15. CASSAGO A., PANEPUCCI R.A., TORTELLA BAIAO

A.M., HENRIQUE-SILVA F.: Cellophane based mini-prep

method for DNA extraction from the filamentous fungus

ric o erma reesei. cro o . , , .. ., ., ., .: ap

mini-preparation of fungal DNA for PCR. J.Clin.Microbiol.

, , .

Documents

Rapid DNA Extraction for Screening Soil