Post-transcriptional modulation of IL-6 and IL-8 responses · Post-transcriptional modulation of IL-6 and IL-8 responses in structural airway cells. ... Departments of Pulmonology

UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

Post-transcriptional modulation of IL-6 and IL-8 responses in structural airway cells

van den Berg, A.

Link to publication

Citation for published version (APA):van den Berg, A. (2006). Post-transcriptional modulation of IL-6 and IL-8 responses in structural airway cells.

General rightsIt is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s),other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulationsIf you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, statingyour reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Askthe Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam,The Netherlands. You will be contacted as soon as possible.

Download date: 12 Jul 2020

https://dare.uva.nl/personal/pure/en/publications/posttranscriptional-modulation-of-il6-and-il8-responses-in-structural-airway-cells(c2435e74-927d-4d14-b64f-cf6f5e5f96b2).html

Post-transcriptional modulation of IL-6 and IL-8 responses instructural airway cells.

Arjen van den Berg

Post-transcriptional modulation of IL-6 and IL-8 responses in structural airway cells.

Arjen van den Berg, Amsterdam, The Netherlands Printed by Ipskamp B.V.

The printing of this thesis was financially supported by: Nederlands Astma Fonds Universiteit van Amsterdam

Post-transcriptional modulation of IL-6 and IL-8 responses instructural airway cells.

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam op gezag van de Rector Magnificus

prof. mr. P.F. van der Heijden ten overstaan van een door het college voor promoties ingestelde commissie,

in het openbaar te verdedigen in de Aula der Universiteit op vrijdag 27 oktober 2006, te 12.00 uur

door

Arjen van den Berg

geboren te Ede

Promotiecommissie

Promotor: Prof. dr. H.M. Jansen

Co-promotor: Dr. R. Lutter

Overige leden: Prof. dr. L. Aarden Prof. dr. B. Berkhout Prof. dr. P.S. Hiemstra Prof. dr. W.H. Lamers Prof. dr. D.S. Postma Dr. A.A.M Thomas

Faculteit der Geneeskunde

Contents

Preface: 7

Chapter 1: Posttranscriptional regulation: a twist to inflammatory responses 9 Submitted

Chapter2 : E1A expression dysregulates IL-8 production and suppresses 23 IL-6 production by lung epithelial cells.

Respir Res. 2005 Sep 26;6:111.

Chapter 3: Interleukin-17 induces hyperresponsive interleukin-8 and 45 interleukin-6 production to tumor necrosis factor-alpha instructural lung cells. Am J Respir Cell Mol Biol. 2005 Jul;33(1):97-104

Chapter 4: Cytoskeletal architecture differentially controls post-transcriptional 63 processing of IL-6 and IL-8 mRNA in airway epithelial-like cells. Exp Cell Res. 2006 May 15;312(9):1496-506.

Chapter 5: Dexamethasone counteracts IL-17-induced IL-6 and IL-8 83 mRNA stabilization in structural lung cells. Manuscript in preparation

Chapter 6: IL-17 does not affect the ribosomal load on IL-6 mRNA in lung 97 epithelial cells.

Submitted

Chapter 7: Haemophilus influenzae and neutrophil defensins amplify 105 airway epithelial IL-8 release via mRNA stabilization Submitted

Chapter 8: General discussion 123

Chapter 9: Summary 141

Nederlandse samenvatting 147

Dankwoord 153

Preface

7

Outline of the thesis

Inflammation is initiated and controlled by the production of inflammatory mediators. This

thesis comprises reports on experimental studies as well as more theoretical considerations on

the control of inflammatory mediator production, particularly in view of that in asthma and

chronic obstructive pulmonary disease.

In chapter 1 we reviewed the processes that control inflammatory mediator

production with emphasis on post-transcriptional regulation, which have received relatively

little attention so far. That these processes may be relevant follows from the fact that

dysregulation of these post-transcriptional processes is achieved relatively easy and that it has

profound effects on inflammatory mediator production. Recent, exciting developments, such

as the implication of microRNAs in post-transcriptional regulation, may give a further

impetus to research in post-transcriptional regulation of inflammatory mediator production.

In chapter 2 we studied the putative role of the Adenoviral protein E1A in

inflammatory processes in COPD, as proposed by Hogg et al. This group found that lung

tissue from patients with COPD contained more E1A DNA and E1A protein than in lung

tissue from non-COPD smokers. Using E1A-expressing cells they found that E1A expression

increased IL-8 production after exposure to LPS, due to increased activation of NFκB. Our

data, obtained with another epithelial cell line, do not confirm a role of E1A in the increased

production of IL-8, warranting a critical re-appraisal of this hypothesis. However, as IL-6 in

association with the IL-6-receptor has been described to have anti-inflammatory properties in

the lung, E1A expression may contribute to inflammation in COPD by reducing IL-6

production.

The T-cell cytokine IL-17 stimulates pro-inflammatory mediator production and thus

IL-17 is seen as a link between the adaptive and innate immune response. IL-17 is detected at

elevated levels in airway secretions from patients with asthma. In Chapter 3 we show that IL-

17 by itself is not a very potent stimulus and that its main effect is to amplify IL-6 and IL-8

production to secondary stimuli such as TNF-α by reducing the degradation of the respective

mRNAs. Assessment of translational control by IL-17 (chapter 6) confirmed that the

enhanced mRNA stability was the main reason for this synergistic increase of IL-6 and IL-8

production. Furthermore, the TNF-α plus IL-17-induced IL-8 and IL-6 secretion was reduced

by dexamethasone (chapter 5), paralleled by a decreased stability of their respective mRNAs.

The structural integrity of airway epithelial cells can be affected by conditions such as

cell repair and viral infection, as occurs in asthma and COPD. We show in chapter 4 that the

Preface

8

cytoskeletal architecture is of paramount importance to a well-contained inflammatory

response, which involves post-transcriptional control.

Chronic bronchitis (CB) and chronic obstructive pulmonary disease (COPD) are

characterized by frequent and/or persistent infections with bacteria, such as Haemophilus

influenzae, and concomitant chronic neutrophilic inflammation of the airways. Neutrophils

contain a variety of antimicrobial peptides like neutrophil defensins, that can kill

microorganisms and induce IL-8 and IL-6 release by airway epithelial cells. The synergy

between Haemophilus influenzae and neutrophil defensins on IL-6 and IL-8 production is

described in chapter 7 and involves post-transcriptional regulation. Finally, in chapter 8 we

discuss the results presented in this thesis in the light of new developments and unpublished

observations.

Posttranscriptional regulation

9

1Posttranscriptional regulation: a twist to inflammatory

responsesSubmitted

Arjen van den Berg and René Lutter

Departments of Pulmonology and Experimental Immunology, Academic Medical Centre/University of Amsterdam

Chapter 1

10

Introduction

Mucosal sites such as the airways are continuously exposed to environmental challenges of a

broad variety. To meet these challenges, both innate and adaptive immune responses come

into play. Recognition of the challenge is elementary to the initiation of immune responses.

To that end, local structural cells such as epithelial cells, fibroblasts and smooth muscle cells,

and circulating cells such as monocytes and macrophages, display an array of receptors. Over

the last seven years a number of receptor families have been recognized and investigated in

depth, among which the Toll-like receptors [1,2], the nucleotide-binding oligomerisation

domain (NOD) proteins [3] and others [4], that recognize pathogen associated molecular

patterns (PAMP) and that can initiate an immune response. Besides microbial agents,

chemicals and oxidants constitute another major challenge to the airways [5,6]. An example

that is being studied more intensely now are air pollutants such as diesel exhaust particles [7],

which consists of small particulate matter with a diameter of in between 2.5 to 10 microns,

coated with adsorbed or condensed toxic air pollutants (oxidant gases, organic compounds,

transition metals; [7,8]). The basis for recognition of these chemical challenges by local

airway cells is less clear than for microbial agents, but may involve metal-ion based sensing

molecules [9] and metabolic changes [10]. In addition, the fine particulate material by itself

can trigger an immune response via mechano-sensing by structural cells [11,12].

Recognition of a challenge is relayed via intracellular pathways that may integrate

various other signals and that can lead to transcription of genes encoding inflammatory

mediators. All of the aforementioned cells can, upon appropriate activation, generate multiple

inflammatory mediators, that can give rise to the recruitment and activation of inflammatory

cells. The armamentarium of inflammatory cells allows these cells to deal with challenges, but

it is also detrimental to local tissue, and thus inflammation may lead to collateral tissue

damage. Therefore the production of inflammatory mediators is tightly controlled, to enable

adequate but limited inflammatory responses. The need for tight control is probably best

illustrated by experimental animal studies showing that overexpression of an inflammatory

mediator like interleukin(IL)-6 or IL-8 leads to extensive tissue damage and remodeling [13].

In inflammatory airway diseases such as asthma and chronic obstructive pulmonary disease

(COPD) there is also extensive tissue damage and remodeling, which is related to the ongoing

inflammatory processes. Whether these exaggerated inflammatory processes are due to a less-

controlled inflammatory mediator production or to the failure of other processes to dampen

inflammatory processes is as yet unknown. There have been, however, a number of studies


11

reported that at least suggest that inflammatory mediator production by airway epithelial cells

may be dysregulated. Early studies by Mattoli and colleagues [14-16], Devalia and Davies and

their coworkers [17-19], and more recently by Wark et al. [20], clearly indicated that

epithelial cells collected from the airways of asthmatics or COPD patients show aberrant

mediator production as compared to cells from healthy individuals. Even more so, the way in

which these experiments were carried out suggests that these altered productions are

preserved in passaged cells, suggestive of an intrinsic difference. Whether this apparent

intrinsic difference has arisen by epithelial cell selection or by imprinting due to e.g.

inflammatory stress, or otherwise, is unknown.

The regulation of inflammatory mediator production is complex, involving both

transcriptional and post-transcriptional processes. Although over the last couple of years

transcriptional regulation in asthma and COPD has been studied in greater detail [21-23],

virtually nothing is known about post-transcriptional regulation in asthma and COPD. This is

largely due to incomplete knowledge of the molecular machinery that controls post-

transcriptional regulation and therefore no parameters that would allow assessment of post-

transcriptional regulation in patient-derived material are available. Two recent ‘state of the

art’-reviews [24,25] recapitulated in detail a large number of molecules that are involved in

post-transcriptional regulation, and thus we will only touch upon these trying to provide an

integral view on post-transcriptional processes. Here we will focus on two other issues in

relation to post-transcriptional control. First, the impact of modulating post-transcriptional

regulation on inflammatory mediator expression is usually translated into terms of more or

less protein being produced. We like to argue that modulating post-transcriptional regulation

has a major pathophysiological impact, affecting the responsiveness of cells and, under

certain conditions, attenuating the inhibitory effect of corticosteroids. And secondly, we

provide an overview of conditions that modulate post-transcriptional regulation. In the last

paragraph we identify some topics of research that should help to clarify whether post-

transcriptional regulation contributes to inflammation in asthma and COPD.

Regulating inflammatory mediator expression

In response to an adequate stimulus, most if not all inflammatory mediators are expressed

transiently, ensuring that an inflammatory mediator response and thus an inflammatory

process is restricted. This transient expression is facilitated by both transcriptional and post-

transcriptional processes. Transcription factors such as nuclear factor kappa B (NFκB),

activating protein-1 (AP-1) and CCAAT/enhancer-binding protein (C/EBP) upon activation

Chapter 1

12

are translocated to the nucleus temporarily [26-28] and thus transcribe the gene for a limited

period only. To what extent the newly generated transcript (mRNA) or its processed (spliced)

mRNA is translated, really is determined by mRNA cytoplasmic transport [29,30], mRNA

degradation [31,32] and translational control [33,34]. Nuclear transcripts acquire cap- and

RNA-binding proteins giving rise to mature messenger ribonucleoproteins (mRNPs), which

allows entry into the cytoplasm by the mRNA and its targeted delivery [35,36]. Depending on

whether the protein encoded by the mRNA is destined to be secreted or remains cell bound, a

mRNA has to end up at distinct translational sites. After its productive translation, mRNAs

enroll a default pathway for mRNA degradation, which is guided by the length of the poly A

tail at the 3’-untranslated region (3’UTR) of the mRNA [37]. Notably, not all mRNAs will be

translated immediately and instead are targeted to intracellular structures such as stress

granules [38] and processing(P)-bodies [39], in anticipation of cues that call for their

translation or degradation [40]. Stress granules and P-bodies contain translationally silenced

mRNAs in association with proteins, some of which are common to both stress granules and

P-bodies. Several of these proteins, such as tristetraprolin (TTP) [41,42], AU- rich RNA

binding factor-1 (AUF-1) [43], the ELAV-like protein HuR [31,44], the translational

inhibitors TIA-1 and TIAR [45,46] have been identified to interact with AUUUA motif, also

referred to as AU-rich element (ARE), which are found in the 3’-untranslated region (3’UTR)

of many mRNAs encoding inflammatory mediators as well as in other regulatory proteins.

These AUUUA motifs were initially shown to facilitate degradation of mRNAs, which can

bring the half-life of a mRNA down to minutes rather than hours [47]. The number of

AUUUA motifs and their arrangement in the 3’UTR varies between mRNAs, which may

affect the kinetics of mRNA degradation [48,49]. These AUUUA motifs have now also been

implicated in cytoplasmic mRNA transport mediated by HuR [50], and in translational

inhibition by providing docking sites for TIA-1 and TIAR [45,51]. AUUUA motifs are not

present in all mRNAs that are subjected to facilitated degradation, such as RANTES mRNA

[52]. Thus, there are likely to be other RNA motifs that like the AUUUA motifs direct mRNA

processing.

How are mRNA degradation and translation regulated? The emerging concept is that

various proteins compete for binding to the AUUUA repeats and in that way determine the

fate of the targeted mRNA (see Figure 1). HuR is believed to transport and stabilize mRNA,

even more so in synergy with the translational inhibitors TIA-1 and TIAR [53]. TTP [25,54]

and another AUUUA-binding protein, AUF-1, promote degradation of AUUUA-containing

mRNAs. There are indications that TTP and AUF-1 are distributed differently which may


13

relate to cell type specific mechanisms [55,56], which may implicate that other proteins may

be involved too [57]. Furthermore, as multiple isoforms of both TTP and AUF-1 exist, the

actual competition with HuR for AUUUA-binding sites may be more complex [43,44,58,59].

Figure 1: Regulation of ARE mediated gene expression The expression level mRNA that contain ARE in their 3'UTR, is regulated by both proteins and specific microRNAs (miRs), that compete for binding to ARE. HuR is believed to be involved in nuclear export and stabilization of ARE containing mRNAs. In the cytoplasm, destabilizing proteins such as TTP and AUF-1 compete with HuR for binding to the ARE, a process thought to be facilitated by miRs that also bind to ARE. The outcome of this competition detemines whether the mRNA is targeted for rapid decay or stabilization (left part of the figure). miRs are also involved in translational silencing of gene expression in so-called stress-granules, possibly in conjunction with the proteins TIA-1 and TIAR, established translational silencers of ARE containing mRNAs. Whether miRs and HuR are direct competitors, or whether this also involves ARE-binding proteins like TTP. AUF-1, TIA-1 and TIAR remains to be elucidated. HuR can relieve miR-associated translational repression indicating that that part of the pathway is reversible. CDS: coding sequence.

Over the last year it has become apparent that small non-coding RNAs, microRNAs (miR),

too play an important role in post-transcriptional control. miR have been found associated

with the dicer-argonaute complex in P-bodies which facilitates mRNA degradation [60],

although argonaute with other proteins in P-bodies may also be implicated in translational

silencing [61]. In addition, miR have also been found in association with polysomes [62,63],

suggestive of a role in translation. miR16, which contains a sequence complementary to the

AUUUA motif, has been studied in relation to degradation of AUUUA-containing mRNAs.

Introduction of miR16 was shown to promote mRNA degradation [25,64] in a TTP-dependent

Chapter 1

14

manner [25], and which dampens the production of the encoded proteins [64], even at

conditions in which mRNA degradation was reduced (our unpublished data). This suggests

that miR16 may facilitate binding of TTP to ensure mRNA degradation. Whether miR16

affects secondary structures of AUUUA-containing mRNAs [65], and/or whether binding of

miR16 can be outcompeted by other miR that also bind AUUUA motifs or flanking regions

awaits further experimentation.

Post-transcriptional regulation modifies responses

Before discussing the impact of post-transcriptional regulation on e.g. IL-6 or IL-8 responses,

it is important to realize, that modulation of post-transcriptional processes exerts an effect

only when IL-6 or IL-8 mRNA is transcribed. So, transcriptional regulation is paramount to

post-transcriptional regulation, but modulation of post-transcriptional processes can occur

independent of transcriptional regulation (see below).

Cells in which mRNA degradation is reduced, as for example occurs in cells exposed

for 24 hrs to interferon gamma [66], produce more IL-6 and IL-8, and over a prolonged

period, when exposed to an adequate stimulus such as TNF-α. Comparing dose-response

curves for IL-6 and IL-8 in response to TNF-α for cells with a normal IL-6/8 mRNA

degradation versus that of cells with a reduced mRNA degradation show an amplified

response for cells with a reduced mRNA degradation (schematized in Figure 2). So, slowing

mRNA degradation does not only affect the extent by which the encoded mediator is

produced, it turns cells hyperresponsive. For cells exposed to interferon gamma, the IL-8 and

to a lesser extent the production IL-6 are particularly potentiated, i.e. the highest fold-

induction, at low doses of TNF-α (below 1 ng/ml). Exposure to IL-17 [67], which also

stabilizes IL-6 and IL-8 mRNA, gives the highest fold-inductions at high doses of TNF-α (5

ng/ml) for IL-8, whereas the effect on IL-6 production was similar over the tested range of

TNF-α. The reason for these differential effects is unclear as yet.


15

Corticosteroids are known to dampen inflammatory mediator production by several means,

ranging from preventing nuclear recruitment of transcription factors till increasing mRNA

degradation [68,69]. In airway epithelial cells, Wu and colleagues [70] and we for an

epithelial cell line (unpublished data) showed that corticosteroids reduce IL-8 and IL-6

production only by speeding up degradation of the encoding mRNAs, with no effect on gene

transcription. Cells in which the mRNA degradation is increased show a hyporesponsive IL-6

and IL-8 production, in line with our earlier notion that modulating mRNA degradation

modulates responsiveness. Interestingly, the increased mRNA degradation by corticosteroids

is dependent on transcription and de novo protein synthesis ([70], our unpublished data). This

indicates that at conditions that reduce overall protein synthesis, the remaining production of

e.g. IL-6 and IL-8 are not or less inhibited by corticosteroids. This becomes even more

evident as at conditions with a reduced protein synthesis mRNA degradation is reduced,

leading to hyperresponsive IL-6 and IL-8 production [26,27,71]. The reason as to why a

reduced protein synthesis fails to increase mRNA degradation is unknown, but may relate to a

increased degradation of TTP [72]. To maintain adequate levels of TTP for mRNA

degradation would require continuous de novo synthesis. As the TTP mRNA is a labile

mRNA [73] also containing ARE, also de novo transcription may be required.

Figure 2: Modification of responses by post-transcriptional regulation. Changing the half-life of mRNA results in altered amounts of inflammatory mediator being produced (y-axis) and, importantly, it also affects the steepness of the dose-response curve. Reduced mRNA degradation (shaded triangles) results in an increased steepness of the dose-response curve, whereas an increase in mRNA degradation (shaded squares) flattens the dose-response curve as compared to the normal response curve. The consequence of modulating responses is that a small dose of a stimulus (x-axis), that normally results in an adequate response, evokes an exaggerated, possibly more damaging response when mRNA degradation is reduced, or a suboptimal response when mRNA degradation is increased.

Chapter 1

16

Less is known about translational control. In a recent study [74] we found that distortion of

the cytoskeleton resulted in IL-6 and IL-8 mRNA stabilization. Nevertheless, IL-6 mRNA as

opposed to IL-8 mRNA was translated at reduced levels, as corroborated by a shift of IL-6

mRNA in the polysome profile to fractions containing smaller polysomes. This clearly

indicates that mRNA degradation and translation can be regulated independently, and that a

reduced mRNA degradation does not necessarily leads to hyperresponsive production.

The extent by which modulated post-transcriptional processes affect responsiveness,

may depend on the basal contribution of post-transcriptional processes to expression of the

encoded protein. This is probably best illustrated by our experiments with IL-17 on fibroblasts

[67]. IL-8 mRNA is quite stable in lung fibroblasts as opposed to IL-6 mRNA. Like in airway

epithelial cells, IL-17 reduces both IL-6 and IL-8 mRNA degradation, but relatively with the

largest impact on IL-6 mRNA and thus also IL-6 production. These differences in the basal

contribution of post-transcriptional processes to gene expression may explain differences

between cell types [75].

Conditions mediated by post-transcriptional regulation

Activation of the p38 MAPK pathway leads to the stabilization of ARE-containing mRNAs

[32]. TTP is one of the targets of p38, and its phosphorylation may prevent binding of TTP to

the AUUUA motifs and thus inhibits mRNA degradation [54,76]. There are a number of

inflammatory stimuli that activate the p38 MAPK pathway. IL-17, which profoundly

stabilizes IL-6 and IL-8 mRNA with little transcriptional activity at least in airway epithelial

cells, is one of these [77]. Some other inflammatory stimuli, combine the induction of

transcriptional activity with p38 activation, such as IL-1β and Lipopolysaccharide (LPS)

[76,78,79]. For others, like IL-4, that can stabilize 3’AUUUA-containing mRNAs, the

involvement of p38 is not clear [80,81].

The AUUUA-binding proteins TTP, HuR and AUF-1 are other potential targets for

modulating post-transcriptional processes. A large number of conditions that are associated

with metabolic stress, such as a reduced protein synthesis [71,82-85] or ATP depletion [84,86]

have been found to result in stabilization of ARE-containing mRNAs. TTP when

phosphorylated is a labile protein requiring continuous de novo synthesis and thus these stress

responses may be induced by reduced levels of TTP, although other possibilities can not be

excluded. A similar reasoning may apply to other stresses, such as viral replication [87,88]

and possibly cellular differentiation, which may in an indirect manner have an impact on

protein synthesis. For example, dsRNA, which is generated during viral replication


17

deactivates eukaryotic initiation factor 2α, which lead to inhibition of protein synthesis.

Extensive repair mechanisms or cellular differentiation may take some much of the resources

for protein synthesis, effectively reducing the capacity to synthesize TTP.

There are several indications that the localization and level of HuR may be affected by

cellular stress. In cytomegalovirus-infected fibroblasts, HuR was found to have aberrant

cytoplasmic localization which may be related to the enhanced degradation of IL-6 mRNA

[89]. UV irradiation and nutritional stress were found to stabilize ARE-containing mRNA,

which correlated with an enhanced shuttling of HuR [90,91]. A similar major role for HuR

has been implicated in LFA-1-dependent T-cell activation [92] and cell differentiation [93].

Concluding remarks

Given the capacity of post-transcriptional processes to affect gene expression, it may no

longer be ignored as a potential, relevant mechanism contributing to inflammation in asthma

and COPD, and indeed any inflammatory disease. This potential relevance is supported by the

many pathophysiological conditions that can give rise to modulation of post-transcriptional

processes. As direct functional assays to show modulation of post-transcriptional processes

are missing, we are stuck with surrogate markers. Given the intricate role of stress granules

and processing bodies in post-transcriptional processes, a quantitative analysis of these RNA

bodies in cells from patients and healthy individuals should be carried out.

It is clear that many components and pathways play a role in post-transcriptional

regulation, and that the complexity of post-transcriptional regulation is at least similar to that

for transcriptional regulation. Based on current knowledge, quantification of TTP/AUF-1 and

HuR levels, their isoforms, as well as analyses of miR profiles may be our best options to at

least get a hint that post-transcriptional processes are altered in cells from patients with

asthma or COPD. These studies would, however, be greatly helped by more fundamental

studies identifying the specific proteins and miR that play a role in post-transcriptional

processes in the various cell types directing inflammation in these diseases.

Acknowledgements

The authors acknowledge financial support by the Netherlands Asthma Foundation (grant

99.27) and express their gratitude to colleagues and students for discussions.

Chapter 1

18

References 1. T.Kaisho, S.Akira (2006). Toll-like receptor function and signaling. J.Allergy Clin.Immunol. 117, 979-

987. 2. L.A.O'Neill (2006). How Toll-like receptors signal: what we know and what we don't know.

Curr.Opin.Immunol. 18, 3-9. 3. W.Strober, P.J.Murray, A.Kitani, T.Watanabe (2006). Signalling pathways and molecular interactions

of NOD1 and NOD2. Nat.Rev.Immunol. 6, 9-20. 4. G.D.Brown (2006). Dectin-1: a signalling non-TLR pattern-recognition receptor. Nat.Rev.Immunol. 6,

33-43. 5. I.Rahman, S.K.Biswas, A.Kode (2006). Oxidant and antioxidant balance in the airways and airway

diseases. Eur.J.Pharmacol. 533, 222-239. 6. E.N.Schachter, E.Zuskin, M.Saric (2001). Occupational airway diseases. Rev.Environ.Health 16, 87-95. 7. C.Sioutas, R.J.Delfino, M.Singh (2005). Exposure assessment for atmospheric ultrafine particles (UFPs)

and implications in epidemiologic research. Environ.Health Perspect. 113, 947-955. 8. R.J.Delfino, C.Sioutas, S.Malik (2005). Potential role of ultrafine particles in associations between

airborne particle mass and cardiovascular health. Environ.Health Perspect. 113, 934-946. 9. J.J.Haddad, H.L.Harb (2005). L-gamma-Glutamyl-L-cysteinyl-glycine (glutathione; GSH) and GSH-

related enzymes in the regulation of pro- and anti-inflammatory cytokines: a signaling transcriptional scenario for redox(y) immunologic sensor(s)? Mol.Immunol. 42, 987-1014.

10. J.Y.Ma, J.K.Ma (2002). The dual effect of the particulate and organic components of diesel exhaust particles on the alteration of pulmonary immune/inflammatory responses and metabolic enzymes. J.Environ.Sci.Health C.Environ.Carcinog.Ecotoxicol.Rev. 20, 117-147.

11. B.Doornaert, V.Leblond, S.Galiacy, G.Gras, E.Planus, V.Laurent, D.Isabey, C.Lafuma (2003). Negative impact of DEP exposure on human airway epithelial cell adhesion, stiffness, and repair. Am.J.Physiol Lung Cell Mol.Physiol 284, L119-L132.

12. B.Doornaert, V.Leblond, E.Planus, S.Galiacy, V.M.Laurent, G.Gras, D.Isabey, C.Lafuma (2003). Time course of actin cytoskeleton stiffness and matrix adhesion molecules in human bronchial epithelial cell cultures. Exp.Cell Res. 287, 199-208.

13. B.F.DiCosmo, G.P.Geba, D.Picarella, J.A.Elias, J.A.Rankin, B.R.Stripp, J.A.Whitsett, R.A.Flavell (1994). Airway epithelial cell expression of interleukin-6 in transgenic mice. Uncoupling of airway inflammation and bronchial hyperreactivity. J.Clin.Invest 94, 2028-2035.

14. M.Marini, E.Vittori, J.Hollemborg, S.Mattoli (1992). Expression of the potent inflammatory cytokines, granulocyte-macrophage-colony-stimulating factor and interleukin-6 and interleukin-8, in bronchial epithelial cells of patients with asthma. J.Allergy Clin.Immunol. 89, 1001-1009.

15. M.Soloperto, V.L.Mattoso, A.Fasoli, S.Mattoli (1991). A bronchial epithelial cell-derived factor in asthma that promotes eosinophil activation and survival as GM-CSF. Am.J.Physiol 260, L530-L538.

16. E.Vittori, M.Marini, A.Fasoli, F.R.De, S.Mattoli (1992). Increased expression of endothelin in bronchial epithelial cells of asthmatic patients and effect of corticosteroids. Am.Rev.Respir.Dis. 146,1320-1325.

17. H.Bayram, J.L.Devalia, O.A.Khair, M.M.Abdelaziz, R.J.Sapsford, M.Sagai, R.J.Davies (1998). Comparison of ciliary activity and inflammatory mediator release from bronchial epithelial cells of nonatopic nonasthmatic subjects and atopic asthmatic patients and the effect of diesel exhaust particles in vitro. J.Allergy Clin.Immunol. 102, 771-782.

18. J.L.Devalia, H.Bayram, M.M.Abdelaziz, R.J.Sapsford, R.J.Davies (1999). Differences between cytokine release from bronchial epithelial cells of asthmatic patients and non-asthmatic subjects: effect of exposure to diesel exhaust particles. Int.Arch.Allergy Immunol. 118, 437-439.

19. C.Rusznak, P.R.Mills, J.L.Devalia, R.J.Sapsford, R.J.Davies, S.Lozewicz (2000). Effect of cigarette smoke on the permeability and IL-1beta and sICAM-1 release from cultured human bronchial epithelial cells of never-smokers, smokers, and patients with chronic obstructive pulmonary disease. Am.J.Respir.Cell Mol.Biol. 23, 530-536.

20. P.A.Wark, S.L.Johnston, F.Bucchieri, R.Powell, S.Puddicombe, V.Laza-Stanca, S.T.Holgate, D.E.Davies (2005). Asthmatic bronchial epithelial cells have a deficient innate immune response to infection with rhinovirus. J.Exp.Med. 201, 937-947.

21. P.J.Barnes, I.M.Adcock, K.Ito (2005). Histone acetylation and deacetylation: importance in inflammatory lung diseases. Eur.Respir.J. 25, 552-563.

22. S.A.Di, G.Caramori, T.Oates, A.Capelli, M.Lusuardi, I.Gnemmi, F.Ioli, K.F.Chung, C.F.Donner, P.J.Barnes, I.M.Adcock (2002). Increased expression of nuclear factor-kappaB in bronchial biopsies from smokers and patients with COPD. Eur.Respir.J. 20, 556-563.


19

23. K.Tomita, P.J.Barnes, I.M.Adcock (2003). The effect of oxidative stress on histone acetylation and IL-8 release. Biochem.Biophys.Res.Commun. 301, 572-577.

24. J.Fan, N.M.Heller, M.Gorospe, U.Atasoy, C.Stellato (2005). The role of post-transcriptional regulation in chemokine gene expression in inflammation and allergy. Eur.Respir.J. 26, 933-947.

25. Q.Jing, S.Huang, S.Guth, T.Zarubin, A.Motoyama, J.Chen, P.F.Di, S.C.Lin, H.Gram, J.Han (2005). Involvement of microRNA in AU-rich element-mediated mRNA instability. Cell 120, 623-634.

26. T.Roger, T.Out, N.Mukaida, K.Matsushima, H.Jansen, R.Lutter (1998). Enhanced AP-1 and NF-kappaB activities and stability of interleukin 8 (IL-8) transcripts are implicated in IL-8 mRNA superinduction in lung epithelial H292 cells. Biochem.J. 330 ( Pt 1), 429-435.

27. T.Roger, T.A.Out, H.M.Jansen, R.Lutter (1998). Superinduction of interleukin-6 mRNA in lung epithelial H292 cells depends on transiently increased C/EBP activity and durable increased mRNA stability. Biochim.Biophys.Acta 1398, 275-284.

28. U.Zabel, P.A.Baeuerle (1990). Purified human I kappa B can rapidly dissociate the complex of the NF-kappa B transcription factor with its cognate DNA. Cell 61, 255-265.

29. X.C.Fan, J.A.Steitz (1998). HNS, a nuclear-cytoplasmic shuttling sequence in HuR. Proc.Natl.Acad.Sci.U.S.A 95, 15293-15298.

30. K.Gantt, J.Cherry, R.Tenney, V.Karschner, P.H.Pekala (2005). An early event in adipogenesis, the nuclear selection of the CCAAT enhancer-binding protein {beta} (C/EBP{beta}) mRNA by HuR and its translocation to the cytosol. J.Biol.Chem. 280, 24768-24774.

31. C.M.Brennan, J.A.Steitz (2001). HuR and mRNA stability. Cell Mol.Life Sci. 58, 266-277. 32. J.Saklatvala, J.Dean, A.Clark (2003). Control of the expression of inflammatory response genes.

Biochem.Soc.Symp. 95-106. 33. S.J.Cok, A.R.Morrison (2001). The 3'-untranslated region of murine cyclooxygenase-2 contains

multiple regulatory elements that alter message stability and translational efficiency. J.Biol.Chem. 276,23179-23185.

34. M.J.Moore (2005). From birth to death: the complex lives of eukaryotic mRNAs. Science 309, 1514-1518.

35. C.N.Cole, J.J.Scarcelli (2006). Transport of messenger RNA from the nucleus to the cytoplasm. Curr.Opin.Cell Biol. 18, 299-306.

36. C.Saguez, J.R.Olesen, T.H.Jensen (2005). Formation of export-competent mRNP: escaping nuclear destruction. Curr.Opin.Cell Biol. 17, 287-293.

37. P.Bernstein, J.Ross (1989). Poly(A), poly(A) binding protein and the regulation of mRNA stability. Trends Biochem.Sci. 14, 373-377.

38. G.Stoecklin, T.Stubbs, N.Kedersha, S.Wax, W.F.Rigby, T.K.Blackwell, P.Anderson (2004). MK2-induced tristetraprolin:14-3-3 complexes prevent stress granule association and ARE-mRNA decay. EMBO J. 23, 1313-1324.

39. M.Brengues, D.Teixeira, R.Parker (2005). Movement of eukaryotic mRNAs between polysomes and cytoplasmic processing bodies. Science 310, 486-489.

40. A.Lal, K.Mazan-Mamczarz, T.Kawai, X.Yang, J.L.Martindale, M.Gorospe (2004). Concurrent versus individual binding of HuR and AUF1 to common labile target mRNAs. EMBO J. 23, 3092-3102.

41. P.Anderson, K.Phillips, G.Stoecklin, N.Kedersha (2004). Post-transcriptional regulation of proinflammatory proteins. J.Leukoc.Biol. 76, 42-47.

42. N.Kedersha, P.Anderson (2002). Stress granules: sites of mRNA triage that regulate mRNA stability and translatability. Biochem.Soc.Trans. 30, 963-969.

43. I.Raineri, D.Wegmueller, B.Gross, U.Certa, C.Moroni (2004). Roles of AUF1 isoforms, HuR and BRF1 in ARE-dependent mRNA turnover studied by RNA interference. Nucleic Acids Res. 32, 1279-1288.

44. S.S.Peng, C.Y.Chen, N.Xu, A.B.Shyu (1998). RNA stabilization by the AU-rich element binding protein, HuR, an ELAV protein. EMBO J. 17, 3461-3470.

45. C.Gueydan, L.Droogmans, P.Chalon, G.Huez, D.Caput, V.Kruys (1999). Identification of TIAR as a protein binding to the translational regulatory AU-rich element of tumor necrosis factor alpha mRNA. J.Biol.Chem. 274, 2322-2326.

46. M.Piecyk, S.Wax, A.R.Beck, N.Kedersha, M.Gupta, B.Maritim, S.Chen, C.Gueydan, V.Kruys, M.Streuli, P.Anderson (2000). TIA-1 is a translational silencer that selectively regulates the expression of TNF-alpha. EMBO J. 19, 4154-4163.

47. G.Shaw, R.Kamen (1986). A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46, 659-667.

48. R.Winzen, G.Gowrishankar, F.Bollig, N.Redich, K.Resch, H.Holtmann (2004). Distinct domains of AU-rich elements exert different functions in mRNA destabilization and stabilization by p38 mitogen-activated protein kinase or HuR. Mol.Cell Biol. 24, 4835-4847.

Chapter 1

20

49. N.Xu, C.Y.Chen, A.B.Shyu (1997). Modulation of the fate of cytoplasmic mRNA by AU-rich elements: key sequence features controlling mRNA deadenylation and decay. Mol.Cell Biol. 17, 4611-4621.

50. K.Nagaoka, T.Suzuki, T.Kawano, K.Imakawa, S.Sakai (2006). Stability of casein mRNA is ensured by structural interactions between the 3'-untranslated region and poly(A) tail via the HuR and poly(A)-binding protein complex. Biochim.Biophys.Acta 1759, 132-140.

51. D.A.Dixon, G.C.Balch, N.Kedersha, P.Anderson, G.A.Zimmerman, R.D.Beauchamp, S.M.Prescott (2003). Regulation of cyclooxygenase-2 expression by the translational silencer TIA-1. J.Exp.Med. 198,475-481.

52. T.Koga, E.Sardina, R.M.Tidwell, M.Pelletier, D.C.Look, M.J.Holtzman (1999). Virus-inducible expression of a host chemokine gene relies on replication-linked mRNA stabilization. Proc.Natl.Acad.Sci.U.S.A 96, 5680-5685.

53. V.Katsanou, O.Papadaki, S.Milatos, P.J.Blackshear, P.Anderson, G.Kollias, D.L.Kontoyiannis (2005). HuR as a negative posttranscriptional modulator in inflammation. Mol.Cell 19, 777-789.

54. E.Hitti, T.Iakovleva, M.Brook, S.Deppenmeier, A.D.Gruber, D.Radzioch, A.R.Clark, P.J.Blackshear, A.Kotlyarov, M.Gaestel (2006). Mitogen-activated protein kinase-activated protein kinase 2 regulates tumor necrosis factor mRNA stability and translation mainly by altering tristetraprolin expression, stability, and binding to adenine/uridine-rich element. Mol.Cell Biol. 26, 2399-2407.

55. C.Y.Chen, N.Xu, A.B.Shyu (2002). Highly selective actions of HuR in antagonizing AU-rich element-mediated mRNA destabilization. Mol.Cell Biol. 22, 7268-7278.

56. D.A.Dixon, N.D.Tolley, P.H.King, L.B.Nabors, T.M.McIntyre, G.A.Zimmerman, S.M.Prescott (2001). Altered expression of the mRNA stability factor HuR promotes cyclooxygenase-2 expression in colon cancer cells. J.Clin.Invest 108, 1657-1665.

57. G.Sully, J.L.Dean, R.Wait, L.Rawlinson, T.Santalucia, J.Saklatvala, A.R.Clark (2004). Structural and functional dissection of a conserved destabilizing element of cyclo-oxygenase-2 mRNA: evidence against the involvement of AUF-1 [AU-rich element/poly(U)-binding/degradation factor-1], AUF-2, tristetraprolin, HuR (Hu antigen R) or FBP1 (far-upstream-sequence-element-binding protein 1). Biochem.J. 377, 629-639.

58. X.C.Fan, J.A.Steitz (1998). Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J. 17, 3448-3460.

59. V.E.Myer, X.C.Fan, J.A.Steitz (1997). Identification of HuR as a protein implicated in AUUUA-mediated mRNA decay. EMBO J. 16, 2130-2139.

60. L.Ding, A.Spencer, K.Morita, M.Han (2005). The developmental timing regulator AIN-1 interacts with miRISCs and may target the argonaute protein ALG-1 to cytoplasmic P bodies in C. elegans. Mol.Cell19, 437-447.

61. C.Y.Chu, T.M.Rana (2006). Translation Repression in Human Cells by MicroRNA-Induced Gene Silencing Requires RCK/p54. PLoS.Biol. 4, e210.

62. J.Kim, A.Krichevsky, Y.Grad, G.D.Hayes, K.S.Kosik, G.M.Church, G.Ruvkun (2004). Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. Proc.Natl.Acad.Sci.U.S.A101, 360-365.

63. P.T.Nelson, A.G.Hatzigeorgiou, Z.Mourelatos (2004). miRNP:mRNA association in polyribosomes in a human neuronal cell line. RNA. 10, 387-394.

64. A.Cimmino, G.A.Calin, M.Fabbri, M.V.Iorio, M.Ferracin, M.Shimizu, S.E.Wojcik, R.I.Aqeilan, S.Zupo, M.Dono, L.Rassenti, H.Alder, S.Volinia, C.G.Liu, T.J.Kipps, M.Negrini, C.M.Croce (2005). miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc.Natl.Acad.Sci.U.S.A 102, 13944-13949.

65. E.J.Fialcowitz, B.Y.Brewer, B.P.Keenan, G.M.Wilson (2005). A hairpin-like structure within an AU-rich mRNA-destabilizing element regulates trans-factor binding selectivity and mRNA decay kinetics. J.Biol.Chem. 280, 22406-22417.

66. M.van Wissen, M.Snoek, B.Smids, H.M.Jansen, R.Lutter (2002). IFN-gamma amplifies IL-6 and IL-8 responses by airway epithelial-like cells via indoleamine 2,3-dioxygenase. J.Immunol. 169, 7039-7044.

67. A.van den Berg, M.Kuiper, M.Snoek, W.Timens, D.S.Postma, H.M.Jansen, R.Lutter (2005). Interleukin-17 induces hyperresponsive interleukin-8 and interleukin-6 production to tumor necrosis factor-alpha in structural lung cells. Am.J.Respir.Cell Mol.Biol. 33, 97-104.

68. M.Lasa, S.M.Abraham, C.Boucheron, J.Saklatvala, A.R.Clark (2002). Dexamethasone causes sustained expression of mitogen-activated protein kinase (MAPK) phosphatase 1 and phosphatase-mediated inhibition of MAPK p38. Mol.Cell Biol. 22, 7802-7811.

69. H.F.Yang-Yen, J.C.Chambard, Y.L.Sun, T.Smeal, T.J.Schmidt, J.Drouin, M.Karin (1990). Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to direct protein-protein interaction. Cell 62, 1205-1215.


21

70. M.M.Chang, M.Juarez, D.M.Hyde, R.Wu (2001). Mechanism of dexamethasone-mediated interleukin-8 gene suppression in cultured airway epithelial cells. Am.J.Physiol Lung Cell Mol.Physiol 280, L107-L115.

71. R.Lutter, S.Loman, M.Snoek, T.Roger, T.A.Out, H.M.Jansen (2000). IL-6 protein production by airway epithelial(-like) cells disabled in IL-6 mRNA degradation. Cytokine 12, 1275-1279.

72. M.Brook, C.R.Tchen, T.Santalucia, J.McIlrath, J.S.Arthur, J.Saklatvala, A.R.Clark (2006). Posttranslational regulation of tristetraprolin subcellular localization and protein stability by p38 mitogen-activated protein kinase and extracellular signal-regulated kinase pathways. Mol.Cell Biol. 26,2408-2418.

73. S.A.Brooks, J.E.Connolly, W.F.Rigby (2004). The role of mRNA turnover in the regulation of tristetraprolin expression: evidence for an extracellular signal-regulated kinase-specific, AU-rich element-dependent, autoregulatory pathway. J.Immunol. 172, 7263-7271.

74. A.van den Berg, J.Freitas, F.Keles, M.Snoek, M.J.van, H.M.Jansen, R.Lutter (2006). Cytoskeletal architecture differentially controls post-transcriptional processing of IL-6 and IL-8 mRNA in airway epithelial-like cells. Exp.Cell Res. 312, 1496-1506.

75. M.W.Bergmann, K.J.Staples, S.J.Smith, P.J.Barnes, R.Newton (2004). Glucocorticoid inhibition of granulocyte macrophage-colony-stimulating factor from T cells is independent of control by nuclear factor-kappaB and conserved lymphokine element 0. Am.J.Respir.Cell Mol.Biol. 30, 555-563.

76. Y.L.Chen, Y.L.Huang, N.Y.Lin, H.C.Chen, W.C.Chiu, C.J.Chang (2006). Differential regulation of ARE-mediated TNFalpha and IL-1beta mRNA stability by lipopolysaccharide in RAW264.7 cells. Biochem.Biophys.Res.Commun. 346, 160-168.

77. H.Tokuda, Y.Kanno, A.Ishisaki, M.Takenaka, A.Harada, O.Kozawa (2004). Interleukin (IL)-17 enhances tumor necrosis factor-alpha-stimulated IL-6 synthesis via p38 mitogen-activated protein kinase in osteoblasts. J.Cell Biochem. 91, 1053-1061.

78. H.Li, S.Park, B.Kilburn, M.A.Jelinek, A.Henschen-Edman, D.W.Aswad, M.R.Stallcup, I.A.Laird-Offringa (2002). Lipopolysaccharide-induced methylation of HuR, an mRNA-stabilizing protein, by CARM1. Coactivator-associated arginine methyltransferase. J.Biol.Chem. 277, 44623-44630.

79. O.T.MM, B.Mlecnik, Z.Trajanoski, R.Zechner, R.Zimmermann (2006). LPL-mediated lipolysis of VLDL induces an upregulation of AU-rich mRNAs and an activation of HuR in endothelial cells. Atherosclerosis.

80. U.Atasoy, S.L.Curry, d.S.Lopez, I, A.B.Shyu, V.Casolaro, M.Gorospe, C.Stellato (2003). Regulation of eotaxin gene expression by TNF-alpha and IL-4 through mRNA stabilization: involvement of the RNA-binding protein HuR. J.Immunol. 171, 4369-4378.

81. S.Canfield, Y.Lee, A.Schroder, P.Rothman (2005). Cutting edge: IL-4 induces suppressor of cytokine signaling-3 expression in B cells by a mechanism dependent on activation of p38 MAPK. J.Immunol.174, 2494-2498.

82. Y.J.Chung, H.R.Zhou, J.J.Pestka (2003). Transcriptional and posttranscriptional roles for p38 mitogen-activated protein kinase in upregulation of TNF-alpha expression by deoxynivalenol (vomitoxin). Toxicol.Appl.Pharmacol. 193, 188-201.

83. S.Jeyaraj, D.Dakhlallah, S.R.Hill, B.S.Lee (2005). HuR stabilizes vacuolar H+-translocating ATPase mRNA during cellular energy depletion. J.Biol.Chem. 280, 37957-37964.

84. Y.X.Pan, H.Chen, M.S.Kilberg (2005). Interaction of RNA-binding proteins HuR and AUF1 with the human ATF3 mRNA 3'-untranslated region regulates its amino acid limitation-induced stabilization. J.Biol.Chem. 280, 34609-34616.

85. J.J.Pestka, A.T.Smolinski (2005). Deoxynivalenol: toxicology and potential effects on humans. J.Toxicol.Environ.Health B Crit Rev. 8, 39-69.

86. A.Huwiler, e.Akool, A.Aschrafi, F.M.Hamada, J.Pfeilschifter, W.Eberhardt (2003). ATP potentiates interleukin-1 beta-induced MMP-9 expression in mesangial cells via recruitment of the ELAV protein HuR. J.Biol.Chem. 278, 51758-51769.

87. T.E.Dever, R.Sripriya, J.R.McLachlin, J.Lu, J.R.Fabian, S.R.Kimball, L.K.Miller (1998). Disruption of cellular translational control by a viral truncated eukaryotic translation initiation factor 2alpha kinase homolog. Proc.Natl.Acad.Sci.U.S.A 95, 4164-4169.

88. F.Zhang, P.R.Romano, T.Nagamura-Inoue, B.Tian, T.E.Dever, M.B.Mathews, K.Ozato, A.G.Hinnebusch (2001). Binding of double-stranded RNA to protein kinase PKR is required for dimerization and promotes critical autophosphorylation events in the activation loop. J.Biol.Chem. 276,24946-24958.

89. C.Gealy, M.Denson, C.Humphreys, B.McSharry, G.Wilkinson, R.Caswell (2005). Posttranscriptional suppression of interleukin-6 production by human cytomegalovirus. J.Virol. 79, 472-485.

90. C.J.Westmark, V.B.Bartleson, J.S.Malter (2005). RhoB mRNA is stabilized by HuR after UV light. Oncogene 24, 502-511.

Chapter 1

22

91. I.Yaman, J.Fernandez, B.Sarkar, R.J.Schneider, M.D.Snider, L.E.Nagy, M.Hatzoglou (2002). Nutritional control of mRNA stability is mediated by a conserved AU-rich element that binds the cytoplasmic shuttling protein HuR. J.Biol.Chem. 277, 41539-41546.

92. J.G.Wang, M.Collinge, V.Ramgolam, O.Ayalon, X.C.Fan, R.Pardi, J.R.Bender (2006). LFA-1-dependent HuR nuclear export and cytokine mRNA stabilization in T cell activation. J.Immunol. 176,2105-2113.

93. J.schenes-Furry, G.Belanger, J.Mwanjewe, J.A.Lunde, R.J.Parks, N.Perrone-Bizzozero, B.J.Jasmin (2005). The RNA-binding protein HuR binds to acetylcholinesterase transcripts and regulates their expression in differentiating skeletal muscle cells. J.Biol.Chem. 280, 25361-25368.

23

2E1A expression dysregulates IL-8 production and suppresses IL-6

production by lung epithelial cells Respiratory Research 2005, 6:111

Arjen van den Berg1, 2, Mieke Snoek1, 2, Henk M Jansen1 and René Lutter1, 2

1Department of Pulmonology, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands 2Department of Experimental Immunology, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands

Chapter 2

24

Abstract

Background: The adenoviral protein E1A has been proposed to play a role in the

pathophysiology of COPD, in particular by increasing IL-8 gene transcription of lung

epithelial cells in response to cigarette smoke-constituents such as LPS. As IL-8 production is

also under tight post-transcriptional control, we planned to study whether E1A affected IL-8

production post-transcriptionally. The production of IL-6 by E1A-positive cells had not been

addressed and was studied in parallel. Based on our previous work into the regulation of IL-8

and IL-6 production in airway epithelial cells, we used the lung epithelial-like cell line NCI-

H292 to generate stable transfectants expressing either E1A and/or E1B, which is known to

frequently co-integrate with E1A. We analyzed IL-8 and IL-6 production and the underlying

regulatory processes in response to LPS and TNF- . Methods: Stable transfectants were

generated and characterized with immunohistochemistry, western blot and flow cytometry.

IL-8 and IL-6 protein production was measured by ELISA. Levels of IL-8 and IL-6 mRNA

were measured using specific radiolabeled probes. EMSA was used to assess transcriptional

activation of relevant transcription factors. Post-transcriptional regulation of mRNA half-life

was measured by Actinomycin D chase experiments. Results: Most of the sixteen E1A-

expressing transfectants showed suppression of IL-6 production, indicative of biologically

active E1A. Significant but no uniform effects on IL-8 production, nor on transcriptional and

post-transcriptional regulation of IL-8 production, were observed in the panel of E1A-

expressing transfectants. E1B expression exerted similar effects as E1A on IL-8 production.

Conclusion: Our results indicate that integration of adenoviral DNA and expression of E1A

and E1B can either increase or decrease IL-8 production. Furthermore, we conclude that

expression of E1A suppresses IL-6 production. These findings question the unique role of

E1A protein in the pathophysiology of COPD, but do not exclude a role for adenoviral

E1A/E1B DNA in modulating inflammatory responses nor in the pathogenesis of COPD.

E1A does not enhance IL-8 responses

25

Background

Chronic obstructive pulmonary disease (COPD) is characterized by chronic inflammation and

irreversible airflow obstruction [1], and is associated with cigarette smoking. Not all smokers,

however, develop COPD. Hogg and co-workers have put forward the concept that the

presence of the adenoviral E1A DNA and protein in airway structural cells, leading to

enhanced IL-8 production in response to endotoxin exposure, may be related to the

development of COPD. First they showed by PCR analysis that lung tissue from COPD

patients contained more E1A DNA than lung tissue from matched non-COPD smokers [2].

Subsequently, and in line with the presence of E1A DNA, E1A protein was found to be

expressed in airway and alveolar epithelial cells from COPD patients [3]. Based on the model

of genomic integration of adenoviral DNA proposed by Graham [4], it is likely that a second

early adenoviral gene, E1B, is also integrated and possibly expressed, but this was not

investigated. As E1A interacts with a large number of regulatory proteins and as epithelial

cells express inflammatory proteins, it was postulated that E1A protein modifies the

expression of these inflammatory proteins. Stable E1A transfectants of alveolar type-II-like

A549 cells indeed showed increased IL-8 [5] and ICAM-1 [6] expression specifically in

response to LPS, which is a major constituent of cigarette smoke. Similar results were

obtained with E1A-transformed bronchial epithelial cells transfected with both the E1A and

E1B gene [7]. The in vivo relevance of E1A expression was illustrated with a guinea pig

model, showing an enhanced inflammatory response to cigarette smoke in animals with lung

tissue containing E1A DNA [8].

The increased in vitro production of IL-8 and ICAM-1 by E1A transfectants to LPS

appeared to be dependent on an enhanced transcriptional activity, involving activation of

NF B [5,7]. Our previous studies into the regulation of IL-8 and IL-6 production by lung

epithelial-like NCI-H292 cells indicated that, besides transcriptional regulation through

NF B, AP-1 and C/EBP activation, post-transcriptional regulation, exemplified by a modified

mRNA degradation, was a major means of regulating IL-8 and IL-6 responses [9-11]. Similar

findings were obtained with another lung epithelial cell line, Calu-3 cells, as well as primary

bronchial epithelial cells. In fact, lung epithelial cells with a decreased rate of mRNA

degradation displayed hyperresponsive IL-8 and IL-6 production, similar to that observed for

E1A-expressing A549 cells [5]. Therefore, we hypothesized that, expression of E1A in lung

epithelial-like cells may lead to stabilization of IL-8 mRNA paralleled by increased IL-8

Chapter 2

26

production in response to LPS and to TNF- . In parallel, we analyzed IL-6 production, which

was anticipated to be decreased, as E1A is known to inhibit IL-6 transcription [13].

To investigate this, we generated stable transfectants of NCI-H292 cells expressing

E1A. As the E1B gene is frequently co-integrated with that of E1A, and as E1B protein

modifies E1A functions, we also generated stable E1A- and E1B-transfectants. Stable

transfectants of E1B and of the empty vector expressing green fluorescent protein (GFP)-

tagged zeocin-resistance protein served as controls.

Materials and methods

Constructs

In order to construct pTracerSV40-ZeocinGFP vectors (Invitrogen, Paisley, UK) expressing

E1A, E1B, or both proteins, pAt153-Xho [14] (a kind gift from Dr. Robert Vries, LUMC,

Department of Molecular Cell Biology, Leiden, The Netherlands), containing the first 5789

bp of the Ad5 genome was used as donor construct. To construct the vector pTracer-E1A,

containing E1A only, pAt153-xho was digested with Sst1 and the 7K fragment, containing

E1A and vector sequence, was isolated and ends were blunted with T4 DNA polymerase.

Subsequently this fragment was digested with EcoR1 and the 1774 bp fragment was isolated

and ligated into EcoR1/EcoRV digested pTracer-SV40.

To construct the pTracer-E1B, containing only E1B (both 19K- and 55K-E1B

proteins), pAt153-Xho was digested with HPA1 and APA1 and the isolated fragment was

ligated into pTracer-SV40. The vector pTtracer-E1AB was constructed by digestion of

pAt153-Xho with EcoR1 and APA1 and subsequent ligation. All constructs were verified by

sequencing (BigDye sequencing kit, ABI, Foster City, CA) and restriction analysis.

Generation of stable clones

Human lung mucoepidermoid carcinoma derived NCI-H292 cells (CRL 1848; American Type

Culture Collection (ATCC), Manassas, VA) were grown to 90% confluency in a 75 cm2

culture flask, as described before [11]. Before transfection, growth medium was replaced with

10 ml medium without penicillin and streptomycin. Twenty-five g of vector DNA was

mixed with 60 l of Lipofectamine 2000 (Invitrogen) in a volume of 3 ml Optimem-1

(Invitrogen) and layered onto NCI-H292 cells resulting in 20–30% GFP-positive cells after 24

h. Stable clones were obtained by selection in medium containing 100 g/ml Zeocin


27

(Invitrogen), of which 250 l/well was plated in 48-wells plates at a concentration of 6

cells/ml. Medium was replaced twice a week. After formation of colonies, screening of clones

was initially performed by immunohistochemistry in 96-well plates. Clones positive for E1A

or E1B were selected and expression of E1A or E1B was confirmed by Western blot. Clones

negative for E1A or E1B as determined by immunohistochemistry were discontinued.

Monoclonality of clones was tested by flowcytometry analyzing both GFP and E1A.

Cell culture

Clones were cultured and propagated as described before for NCI-H292 cells [11], with the

exception that 100 g/ml Zeocin was added to the medium. Before experiments, cells were

cultured one week without Zeocin, and all experiments were performed in Zeocin-free

medium.

For cytokine release, 6 × 105 cells were plated and grown overnight in 500 l in 24-

well plates. For isolation of mRNA and nuclear extracts, 30 × 105 cells were plated and grown

overnight in 2.5 ml in 6-well plates.

Immunohistochemistry

Cells were fixed with 4% (v/v) paraformaldehyde/0.1% (w/v) Saponin and subsequently

incubated with ice-cold methanol for 1 min. To prevent non-specific signals, cells were

incubated for 1 h with 5% (w/v) BSA containing 0.1% (w/v) sodiumazide and 0.1% (v/v)

H2O2 and 0.1% Saponin. Then, the cells were incubated with primary antibody (M73 (Santa

Cruz Biotechnologies, Santa Cruz, CA) for E1A, 1G11 for E1B-19K or 9C10 E1B-55K [15],

both kind gifts from Dr. Robert Vries (LUMC, Leiden, Netherlands) diluted 1:500 in

PBS/0.5%BSA/0.1% Saponin (PBSAP) overnight at 4°C. Next, cells were washed 3× with

PBS/0.1% Saponin and incubated with 1:250 biotinylated goat-anti-mouse-IgG in PBSAP

(DakoCytomation Glostrup, Denmark) for 1 h followed by 3 wash steps. Finally, cells were

incubated with Streptavidin-Horseradish Peroxidase (HRP, DakoCytomation) (1:250 in

PBSAP) for 30 min, washed and developed with AEC staining solution (Vector Laboratories,

Burlingame, CA).

E1A FACS

Cells were trypsinized and fixed with 4% paraformaldehyde/0.1% Saponin. To prevent

aspecific binding, cells were incubated for 30 min with PBS/5% BSA/0.1% Saponin. Then,

cells were incubated with the primary antibody M73 (1:500 in PBSAP) for 30 min and

Chapter 2

28

subsequently with biotinylated goat anti-mouse IgG (1:250 in PBSAP) for 30 min. Next, cells

were labeled with Streptavidin-Allophycocyanin (DakoCytomation, 1:100 in PBSAP) and

analyzed by a FACSCalibur flow cytometer and CellQuest Pro software (BD Biosciences).

All incubations were performed at RT on a shaking platform. Between incubations, cells were

washed twice with PBSAP.

Western blot

Lysates were prepared by scraping cells (± 5 × 106) in lysis buffer (1% (w/v) NP40, 10 mM

Tris-HCl pH 7.4, 150 mM NaCl, 5 mM EDTA, 1 mM phenylmethylsulphonyl-fluoride

(PMSF)). Lysates were cleared by centrifugation at 13,000 g for 15 min. Protein contents in

cell lysates were determined using Coomassie Plus protein assay reagent (Pierce, Rockford,

IL, USA). Fifty g of protein/lane was separated by SDS-PAGE under reducing conditions.

After transfer to nitrocellulose (Hybond-C, Amersham, Buckinghamshire, UK), blots were

blocked with 5% (w/v) non-fat dry milk in TBST (10 mM Tris, 150 mM NaCl and 0.05%

(v/v) Tween-20, pH 8.0), and were probed overnight at 4°C with M73 antibody 1:1000 diluted

in TBST containing 2.5% non-fat dry milk. Immunoreactive proteins were visualized using

HRP-conjugated Ig (Goat-anti-mouse for M73 and 9C10 or Goat-anti-Rat for 1G11) and

enhanced chemiluminescence (ECL, Amersham).

Determination of IL-6 and IL-8 protein

Cells were exposed for 8 h to various doses of TNF- (rhTNF- , R&D Systems, Minneapolis,

MN, USA) or LPS derived from E.Coli K-235 (L2018, Sigma-Aldrich, St. Louis, MO) up to 5

ng/ml and 1 g, respectively. The amount of IL-6 and IL-8 in culture supernatants was

measured by sandwich ELISA, as described before [9,12].

mRNA half-life analysis

Cells were stimulated with TNF- (5 ng/ml) or LPS (0.1 g/ml) for one hour before 5 g/ml

actinomycin D (Sigma-Aldrich) was added to block further transcription. Total RNA was

extracted with TriZol (Invitrogen) at 0, 40 and 80 minutes after Actinomycin D addition. The

amount of IL-6, IL-8 and GAPDH mRNA was determined by dotblotting and hybridization

with specific 32P-labeled probes for IL-6, IL-8 and GAPDH, which have been extensively

validated for specificity in our samples by Northern blot as described [10,11]. Blots were

quantified using a phosphorimager and variable loading was corrected for by expressing


29

mRNA levels relative to that of the housekeeping gene GAPDH. mRNA half-life was

calculated using linear regression.

Isolation of nuclear extracts and electrophoretic mobility shift assay (EMSA)

Nuclear extracts were isolated after 1 h stimulation with 5 ng/ml TNF- and 0.1 g LPS as

described [10,11]. Protein concentrations were measured as described above. Five g of the

nuclear extracts were incubated with 32P-labeled oligonucleotides at 4°C for 1 h and separated

on a 4% non-reducing poly-acrylamide gel at slowly increasing voltages (60–220 V). Bands

were identified by supershift using 1 g of antibodies against p65 for NF- B, c-fos and c-jun

for AP-1, and C/EBP- for C/EBP (Santa Cruz Biotechnology Inc., Santa Cruz, CA) and by

competition with cold probe. The intensity of the bands was quantified using a

phosphorimager. The following oligonucleotides were used in the EMSA:

NF- B, 5'-TTGCAAATCGTGGAATTTCCTCTGACATAA-3';

AP-1, 5'-TTAAGTGTGATGACTCAGGTTTAA-3';

C/EBP, 5'-TTAAAGGACGTCACATTGCACAATCTTAATAA-3'.

Construction of siRNA

siRNAs directed against both 12S and 13S E1A mRNA were designed using the Ambion

siRNA target finder http://www.ambion.com/techlib/misc/siRNA_finder.html using accession

code AY147066.

The following sequences were selected:

AACTGTATGATTTAGACGTGA (Start position in sequence: 134)

AAGTGAAAATTATGGGCAGTG (Start position in sequence: 599)

AATGCAATAGTAGTACGGATA (Start position in sequence: 671)

AATTTTTACAGTTTTGTGGTT (Start position in sequence: 660)

AATGTATCGAGGACTTGCTTA (Start position in sequence: 800)

AAGATCCCAACGAGGAGGCGG (Start position in sequence: 723, published in [16])

Oligonucleotides were then designed using the Ambion siRNA Template Design Tool

http://www.ambion.com/techlib/misc/silencer_siRNA_template.html. siRNAs were

constructed with the Silencer™ siRNA Construction Kit (Ambion, Austin, TX) according to

the manufacturer's instructions. As a control for proper synthesis and transfection efficiency,

the GAPDH siRNA template included in the kit was used. One to 10 pmol of siRNA was

mixed with 0.5 l Lipofectamine 2000 (Invitrogen) in 50 l Optimem-1 medium (Invitrogen)

according to the manufacturer's instructions and transferred to a well of a 48-wells plate with

Chapter 2

30

cells at 30–50% confluency. Assessment of gene silencing was performed 24- or 48 post-

transfection by PCR and immunohistochemistry.

E1A and GAPDH PCR

Single strand cDNA was synthesized from total RNA isolated with Trizol (Invitrogen) using

500 ng of oligo(dT)15 and 100 units of Superscript II (Gibco/Brl) in a 50 l volume. One l of

cDNA was used in the PCR reaction (50 mM KCl, 2 mM MgCl2, 10 mM Tris-HCl (pH 9.0)

200 mM of each dNTP, 0.1% Triton X-100, 200 nM of each primer and 1.25 U of Taq DNA

polymerase (Promega, Madison, WI)). For E1A, the PCR conditions were 30 thermal cycles

at 94°C for 1 min, 59°C for 1 min and 72°C for 1 min, followed by a final extension at 72°C

for 10 min. The following primers were designed using primer 3 http://frodo.wi.mit.edu/cgi-

bin/primer3/primer3_www.cgi and accession code X02996:

5'-GTGACGACGAGGATGAAGA-3' (bp 395–413);

5'-ACGGCAACTGGTTTAATGG-3' (bp 614–632).

This primer set produces a 238 bp product for 12S E1A mRNA and a 375 bp product for 13S

E1A mRNA. Unspliced E1A mRNA yields a 495 bp product.

For GAPDH, the PCR conditions were 25 thermal cycles at 94°C for 1 min, 55°C for 1 min

and 72°C for 1 min, followed by a final extension at 72°C for 10 min. The following primers

were designed using primer 3 and accession code NM_002046:

5'-ATGAAGGTCGGAGTCAACG-3' (bp 86–103);

5'-TGAAGACGCCAGTGGACTC-3' (bp 364–382):

This primer set produces a 296 bp product.


31

ResultsGeneration of stable transfectants and expression of target proteins

Constructs of E1A, E1B and E1A plus E1B in the pTracerSV40-Zeo vector were used to

generate stable transfectants of NCI-H292 cells. Over 150 zeocin-resistant GFP-positive

clones transfected with the E1A construct were generated, but none of these clones expressed

E1A at a level detectable by immunohistochemistry (IHC). As expression of E1A leads to

apoptosis in non-ras-transformed cells [17,18], it is likely that NCI-H292 cells expressing

E1A protein underwent apoptosis. Transfection with E1A plus E1B yielded 144 zeocin-

resistant clones, 6 of which (designated AB-clones) were found to express E1A by IHC (Fig

1A). Western blot showed that both E1A gene products, the 289R and 243R E1A, were

expressed at equal levels (Fig 1B).

Figure 1: E1A expression in AB clones. IHC for clone AB96 and for other AB clones demonstrated a strict

nuclear localization of expressed E1A (A, left panel) in E1A-positive clones. The right panel is stained with a

control IgG (200 fold magnification). Expression of E1A by AB clones was confirmed by Western blot (B), with

HEK293 cells as positive control. Please note the equal expression of both the 289R- and the 243R-E1A

proteins.

The E1A-positive clones expressed low levels of either 19K or 55K E1B by Western blot

which was not detectable by IHC. Transfection with the E1B construct yielded 30 zeocin-

resistant clones, 6 of which (designated B-clones) were positive for the 55K E1B protein as

Chapter 2

32

determined by IHC. As controls, we generated 7 stable transfectants with the empty vector

expressing GFP (designated T clones).

Effect of E1A expression on IL-8 and IL-6 secretion in response to LPS and TNF-

We next evaluated the TNF- - and LPS-induced IL-8 and IL-6 responses of the various

clones. Hyperresponsive and hyporesponsive clones are defined respectively as clones with a

significant (p < 0.05) 2.5-fold increased or 2.5-fold decreased (i.e. 0.4 times) IL-8 or IL-6

production relative to the mean of the control (T) clones, for all tested doses of a stimulus.

Normoresponsive clones are those that stay within this 2.5-fold range. This definition is based

on the observation of Hogg and coworkers, who showed at least a 2.5-fold increase in IL-8

production in response to 0.01 g/ml LPS for an E1A-positive clone compared to an E1A-

negative clone [5].

Of the 6 AB clones tested, 2 clones (AB38 and AB96) showed a hyperresponsive IL-8

production in response to both LPS and TNF- , whereas the other 4 did not (Fig 2, Table 1).

One B-clone (B1) was hyperresponsive to TNF- but not to LPS, whereas two B-clones (B3

and B4) were hyporesponsive to both TNF- and LPS.

0

0005

00001

00051

00002

00052

00003

00053

00004

00054

751BA651BA69BA47BA66BA83BA6B5B4B3B2B1BT

0

100.0

10.0

1.0

1

*

****

***

***

***

*** ***

***

***

***

***

# ##

##

####

##

####

###

IL-8

(pg

/ml)

LPS

(μg

/ml)

Clone

A

0

0005

00001

00051

00002

00052

00003

00053

00004

00054

751BA651BA69BA47BA66BA83BA6B5B4B3B2B1BT

0

50.0

5.0

5

***

***

***

***

***

***

***

***

***

##

###### ###

IL-8

(pg

/ml)

Clone

TNF-

α(n

g/m

l)

B

Figure 2: IL-8 production by various

clones in response to exposure to LPS and

TNF- . Equal cell numbers from clones

were exposed to a concentration range of

LPS (see z-axis; 0–1 g/ml, A) or TNF-

(0–5 ng/ml, B) for 8 hrs. IL-8 in culture

supernatant was measured by ELISA. T

represents the mean IL-8 production (in

pg/ml; y-axis) of 7 T-clones. Individual B

and AB clones as designated on the x-axis.

Data are shown as the mean of two

independent experiments (triplicate

samples). Due to the representation as a 3D-

matrix, no standard deviation can be shown.

Asterisks indicates significant (* = p < 0.05,

** = p < 0.01, *** = p < 0.001)

hyperresponsiveness, # indicates significant

hyporesponsiveness (# = p < 0.05, ## = p <

0.01, ### = p < 0.001).


33

Table 1

Number of B- and AB-clones displaying hyper- or hyporesponsive IL-8 and IL-6 production to LPS or TNF- .

Clones transfected with E1A plus E1B are designated AB and clones transfected with E1B are designated B.

Hyperresponsive and hyporesponsive clones are defined respectively as clones with a significant (p < 0.05) 2.5-

fold increased or 2.5-fold decreased (i.e. 0.4 times) IL-8 or IL-6 production relative to the mean of the control

(T) clones, for all tested doses of a stimulus.

Hyperresponsive Hyporesponsive

LPS TNF- LPS TNF- Total

IL-8 B 0 1 2 2 6

AB 2 2 0 0 6

IL-6 B 0 0 2 2 6

AB 0 0 1 3 4

With respect to IL-6, none of the tested clones displayed a hyperresponsive IL-6 production in

response to LPS or TNF- (Fig 3, Table 1). In fact, one AB clone (AB157), and two B clones

(B4 and B5) displayed hyporesponsive IL-6 production to LPS. All AB clones except AB38

showed hyporesponsive IL-6 production to TNF- (Fig 3B, Table 1), and the same two B

clones (B4 and B5) that had a hyporesponsive IL-6 production to LPS also displayed a

hyporesponsive IL-6 production to TNF- .

Chapter 2

34

######

0

002

004

006

008

0001

0021

0041

751BA651BA69BA83BA6B5B4B3B2B1BT

0

100.0

10.0

1.0

1

######

###

##### ##

##

#

#### ###

##

###

###

IL-6

(pg

/ml)

Clone

LPS

(μg

/ml)

0

005

0001

0051

0002

0052

751BA651BA69BA83BA6B5B4B3B2B1BT

0

50.0

5.0

5

#####

## ##

## #####

######

### ###

## #

# #

IL-6

(pg

/ml)

TNF-

α(n

g/m

l)

Clone

A

B

Analysis of transcriptional activation by EMSA

Our previous studies showed that TNF- - and LPS-induced transcription of IL-8 in NCI-H292

cells is dependent mainly on the transcription factor NF B and to a lesser extent on AP-1

[11]. We compared activation of NF B in both AB clones with a hyperresponsive IL-8

production to LPS (AB96 and AB38) to that of a normoresponsive AB-clone (AB66), a T-

clone (T4) and a B-clone (B3) (Fig. 4A). We found no further upregulation of NF B

activation by E1A expression. Similar findings were observed upon stimulation with TNF- .

(Fig 4B).

Figure 3: IL-6 production in response

to exposure to LPS and TNF- . Equal

cell numbers from clones were exposed

to a concentration range of LPS (see z-

axis; 0–1 g/ml, A) or TNF- (0–5

ng/ml, B) for 8 hrs. IL-6 in culture

supernatant was measured by ELISA. T

represents the mean IL-6 production (in

pg/ml; y-axis) of 7 T-clones. Individual

B and AB clones as designated on the

x-axis. Statistics as described in figure

2.


35

T1 B3 AB38 AB66 AB960.0

0.5

1.0TNF-Basal

T4 B1 AB38 AB66 AB960.0

0.5

1.0LPSBasal

Sign

al (F

old

indu

ctio

n of

T c

lone

) A B

Figure 4: Analysis of nuclear NF B recruitment by EMSA. Equal cell numbers from clones, indicated on the

x-axis, were stimulated with 0.1 g/ml LPS (A) or 5 ng/ml TNF- (B) for one hour, before nuclear extracts were

prepared. Specific bands were identified by supershift using a p65 antibody for NF B and cold oligo

competition. Bands were quantified by phosphorimager and expressed relative to that of the stimulated T clone,

which was set at one. Data represent mean ± SEM from 2 independent experiments.

We also determined nuclear recruitment of transcription factors AP-1 and C/EBP; the latter is

involved in regulation of IL-6 gene transcription in NCI-H292 cells [10]. Again, we found no

altered upregulation of AP-1 or C/EBP recruitment in E1A-expressing clones to either TNF-

or LPS (data not shown).

Analysis of IL-8 and IL-6 mRNA half-life

An increased half-life of IL-8 and IL-6 mRNA can be accompanied by an enhanced

production of these cytokines [9,12]. Therefore, we tested whether the difference in

responsiveness to TNF- and LPS of the clones was paralleled by alterations in the half-life of

IL-8- and IL-6 mRNA. One hyperresponsive AB clone (AB96) tended to have an increased

half-life of IL-8 mRNA compared to the normoresponsive T clones (p= 0.06).

Chapter 2

36

T1 T3 AB38 AB66 AB74 AB96 B2 B60

50

100

150

Half-

life

of m

RNA

(min

)

T1 T3 AB38 AB66 AB74 AB96 B2 B60

50

100

150IL-8 IL-6

Figure 5: IL-8 and IL-6 mRNA half-life after exposure to TNF- . Equal cell numbers from clones, indicated

on the x-axis, were stimulated with 5 ng/ml TNF- for one hour before 5 g/ml Actinomycin D (ActD) was

added to block further transcription. At 0, 40 and 80 min after ActD addition, total RNA was extracted with

TriZol. RNA was dot blotted and hybridized with 32P-labelled IL-8, IL-6 and GAPDH probes. Signals were

quantified on a phosphorimager and IL-8 and IL-6 mRNA levels were normalized for variable loading using

GAPDH mRNA levels. Half-life of the mRNA in the clones was calculated using linear regression. Data

represent the mean ± SEM from 2 independent experiments (triplicate samples).

However, the normoresponsive clone B6 had a similarly increased IL-8 mRNA half-life (Fig.

5A). Moreover, clone AB96, that displayed hyporesponsive IL-6 production, had a relative

stable IL-6 mRNA (Fig. 5B). Similar heterogeneous results emerged when clones were

stimulated with LPS (data not shown), and thus differences in responsiveness between the

various clones did not parallel changes in the half-life of IL-8 and IL-6 mRNA.

Responses of E1A- and E1B-expressing NCI-H292 subclones

Together, these data indicated that expression of biologically active E1A did not

correlate with an enhanced IL-8 production, nor did E1A expression uniformly affect

mechanisms regulating IL-8 production. For IL-6, there was a similar heterogeneity, but E1A

expression appeared to inversely correlate with IL-6 production. To exclude that the observed

heterogeneity in responses was due solely to an intrinsic heterogeneity of the mother cell line,

we subcloned NCI-H292 cells and tested IL-6 responses to TNF- of 15 subclones. We found

up to a 15-fold difference in maximal IL-6 responses between clones (this response range is

calculated by dividing the maximal response by the minimal response at 5 ng/ml TNF- for a

group of clones; data not shown), which is similar to that for the T-clones (11-fold

difference), but less than that for B- and AB-clones, 30- and 40-fold difference, respectively.

This suggests that the larger response range in AB- and B-clones is caused by the presence of

E1A and E1B DNA, although part of the response range appears due to biological variation of


37

the motherline and/or results from the procedure of subcloning. To further test the latter we

cloned an earlier derived subclone and tested TNF- - and LPS-induced responses from 11

derived sub-subclones. This time, we found a 4-fold difference between clones in their

maximal IL-6 and also IL-8 responses, which indicates that there is some variation in the

NCI-H292 motherline.

0 1 2 3 4 5

0

5000

10000

15000

20000

c18-15c18-17

c18-64

c18-111

18c418c18

18c38

c18-41

1818c2

18c3

18c7

18c47

TNF- (ng/ml)0 1 2 3 4 5

0

1000

2000

3000

4000

c18-15

c18-17

c18-64

c18-111

18c4

18c18

18c38

c18-41

18

18c218c3

18c7

18c47

TNF- (ng/ml)

0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 1.1

0

1000

2000

3000

4000

5000

c18-15

c18-17

c18-64

c18-111

18c418c1818c38

c18-41

18

18c2

18c3

18c7

18c47

LPS ( g/ml)0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 1.1

0

500

1000

1500

2000

c18-15

c18-17

c18-64

c18-11118c4

18c18

18c38

c18-41

18

18c218c3

18c7

18c47

LPS ( g/ml)

IL-8 (pg/ml) IL-6 (pg/ml)

18c4 18c7 18c36 18c47 c18-15 c18-17 18c18 c18-41 c18-64 c18-1110

1

2

3

4

E1A

exp

ress

ion

(A.U

.)

A

B

C

D

E

###

##

##

##

##

###

#####

##

##

##

Figure 6: Expression levels of E1A protein and IL-8 and IL-6 responses of transfected NCI-H292

subclones. A) Transfection of a NCI-H292 subclone yielded 10 E1A-positive clones. Expression level of E1A in

the different clones was determined by Western blot. Exposed films were scanned and quantified. Signal is

expressed in arbitrary units. Even though E1A shows as a single band in the printed figure, close examination of

the electronic figure reveals both the 289R and the 243R E1A protein. Equal cell numbers from clones were

exposed to a concentration series of LPS (0, 0.01, 0.1 and 1 g/ml, 6B&D) or TNF- (0, 0.5 and 5 ng/ml, 6C&E)

for 8 hrs. IL-8 en IL-6 concentrations in culture supernatant were measured by ELISA. E1A-negative clones are

represented by dashed curves, E1A-positive clones by solid curves. For clarity, the clone numbers at the right are

ranked for IL-8 and IL-6 production, and hyporesponsive clones (p < 0.05) are marked with #. Data are from one

experiment (triplicate samples) out of two independent experiments with similar results.

Chapter 2

38

To confirm the effect of E1A and E1B expression on the response range, we transfected one

of the clones derived from subcloning the NCI-H292 motherline, with E1A plus E1B. Ten

E1A-positive clones differing in the level of E1A expression were obtained (Fig 6A) and

tested for IL-8 and IL-6 responses to LPS and TNF- (Fig 6B–E).

Compared to E1A-negative clones, nine out of ten clones showed a significant

hyporesponsive IL-6 production to LPS or TNF- ; the clone with the lowest E1A expression

having a normoresponsive IL-6 production. Even though the absolute IL-6 production was

much lower in E1A-positive clones, the range of IL-6 production was much larger in the E1A-

positive clones than E1A-negative clones, showing difference of upto 130- and 3-fold,

respectively.

None of the clones displayed significant hyperresponsive IL-8 production to LPS,

whereas 4 out of 10 E1A-positive clones showed hyporesponsive IL-8 production to LPS.

Similarly, none of the clones displayed a hyperresponsive IL-8 response to TNF- , and 3 out

of 10 clones showed a hyporesponsive IL-8 production. In line with our previous results, the

response range for IL-8 in the E1A-positive cells reached up to 48 for TNF- and 23 for LPS,

whereas the control clones displayed a response range of 3.

siRNA results

To provide ultimate proof of the role of E1A protein, we attempted to knock down

E1A expression using siRNA. Five different siRNA duplexes directed to both 12S and 13S

E1A mRNA, coding for the 243R and 289R E1A proteins [19], were generated and

transfected into 4 different AB clones. As a positive control, a GAPDH siRNA was used.

Transfection of GAPDH siRNA in a final concentration of 4 nM resulted in a specific

downregulation of more than 90% of GAPDH mRNA, 24 h and 48 h after transfection,

indicating that both siRNA synthesis and transfection protocols were functional. None of the

siRNAs directed to E1A downregulated E1A mRNA at a concentration of 4 nM. Transfection

of higher concentrations of E1A siRNA (up to 35 nM) resulted in aspecific silencing of both

E1A and GAPDH mRNA.

We next used the shRNA DNA vector pSP-E1A (a kind gift from Dr. David Hacker,

LBTC EPFL, Lausanne, Switzerland) that was shown to reduce E1A mRNA by 75% in

HEK293 cells [16], but due to either a low transfection efficiency of DNA vectors in our

clones (<30%) or incompatibility with the U6 promoter, we could not detect downregulation

of E1A expression. To circumvent the latter, an siRNA using the same sequence was

generated, which neither knocked down E1A mRNA expression in our clones.


39

DiscussionThe present study aimed to investigate and extend the hypothesis that E1A expression in lung

epithelial cells, contributes to increased IL-8 responses. We analyzed a panel of stable

transfectants expressing E1A, but we found no uniform effect on IL-8 protein production,

whereas the effect on IL-6 production was more uniform. If anything, clones expressing E1A

displayed a much larger response range for IL-8 than control clones, suggesting that

expression of E1A dysregulates IL-8 production, leading to either an increased or a

suppressed IL-8 production. Similar findings were obtained for E1B, indicating that the effect

is not specific for E1A.

These findings are in apparent contradiction with those reported by Hogg et al., who

described an increase in IL-8 production in E1A-expressing ras-transformed alveolar-type II-

like A549 cells as well as E1A/E1B-transformed primary bronchial epithelial cells [5,7]. In

the present studies we have used lung epithelial NCI-H292 cells, which have been studied

extensively in relation to IL-8 and IL-6 production [9-12] and showed regulation similar to

that of other lung epithelial cell lines and primary bronchial epithelial cells. For example,

effects of IL-17 on TNF- induced IL-8 and IL-6 secretion were similar and regulated in the

same way [20]. Most importantly, post-transcriptional regulation of IL-8 and IL-6 responses,

which is a major mode of regulating these responses, are directed by various conditions to a

similar extent in H292 cells and primary cells. As NCI-H292 cells are also susceptible to

infection by many strains of adenoviruses [21], including serotype 5, we considered NCI-

H292 cells a good model to study the effect of E1A on IL-8 and IL-6 production, although we

cannot exclude that the apparent contradictory results are due to the use epithelial cells from

different origin.

E1A protein expressed in our clones was biologically active as is evident from the

reduced IL-6 production by E1A-expressing clones (Fig 6), in line with the reported inhibition

of IL-6 gene transcription by the E1A protein [13]. Furthermore, immunohistochemical

staining of E1A protein was restricted to the nucleus in all clones, indicative of nuclear

recruitment which is essential for E1A protein to display its biological activity. Despite the

presence of active E1A protein, and the relation between IL-6 responses and the expression

levels of E1A, we found no correlation between the level of E1A protein expression and IL-8

production in the present clones. The E1A gene encodes two primary regulators of viral and

cellular gene expression, the E1A-243R and E1A-289R proteins [19]. Distinct biological

functions have been described for the 243R and 289R E1A products in mouse lung.

Preferential expression of the 243R E1A was associated with cellular hyperplasia and low

Chapter 2

40

level of p53-mediated apoptosis, whereas preferential 289R E1A expression led to pro-

apoptotic injury and acute pulmonary inflammation [22]. Our clones all expressed the 243R

and 289R in an apparent 1:1 ratio as detected by Western blot, however the E1A/E1B

transformed primary bronchial epithelial cells as described by Higashimoto et al. [7]

preferentially expressed the 13S transcript coding for the 289R E1A protein and hence may

explain the observed difference. As yet there is no data available on preferential expression of

either transcript in lung tissue of COPD patients, or in the A549 in vitro model used by Hogg

and coworkers. Other reasons for the observed differences may arise simply from the fact that

we analyzed a larger panel of clones which allowed us to identify the different effects or from

the cooperation of Ras with E1A in A549 cells.

Analysis of the transcriptional and post-transcriptional mechanisms of IL-8 and IL-6

production in the various E1A-expressing clones revealed marked heterogeneity. There was

no increased nuclear recruitment of the transcription factors NF B, AP-1 and C/EBP in E1A-

positive cells. Also, there was no change observed in the electrophoretic mobility of the

protein-DNA complexes that could indicate a change in the composition of the complex. In

fact, clone AB38 showed constitutive expression of high levels of C/EPB activation (data not

shown), and had a high basal IL-6 production, but was not hyperresponsive. The

normoresponsive clone T4 showed the highest nuclear recruitment of NF B, but there was no

correlation between the recruitment of NF B and the amount of IL-8 released upon LPS

stimulation. With respect to the half-life of IL-8 mRNA, there was a similar heterogeneity.

One of the hyperresponsive clones (AB96) had an increased stability of IL-8 mRNA,

however, IL-8 mRNA in another hyperresponsive clone (AB38) had a normal half-life. Taken

together, there was no uniform effect of E1A expression on the transcriptional and post-

transcriptional regulation of IL-8 mRNA. In fact, for some transfectants it is unclear why they

produce more IL-8 or less IL-6, as there is no apparent effect on transcription or mRNA

degradation. An alternative explanation not addressed in the current study is that translational

control may be affected in these transfectants.

Unexpectedly, some E1B transfectants showed similar effects on IL-8 and/or IL-6

production to TNF- and LPS as E1A transfectants. This may suggest that the mere presence

of adenoviral DNA or protein affects the regulation of IL-8 and IL-6 production. A possible

explanation is that integration of vector DNA in the genome (E1A and E1B normally co-

integrate), a poorly understood process, may affect the expression of a functional gene

involved in the cascade controlling IL-8 or IL-6 production, leading to an altered cytokine


41

production. The exact mechanism remains to be determined. An approach could be to

generate a panel of inducible transfectants.

The effect of E1A and E1B on the IL-8 production is probably best described by

increasing the response range. Subclones of the NCI-H292 mother line showed biological

variation in IL-6 and IL-8 production, giving a response range of 15. This variation is

comparable to that for NCI-H292 clones transfected with an empty vector, but markedly

smaller than that for E1A plus E1B or E1B-transfected clones. Similarly, E1A-expressing

clones generated from subclones of NCI-H292 showed an enhanced response range for IL-8,

which was at large due to reduced minimal IL-8 production.

Ultimate proof for, or against, a role of the E1A protein in increasing IL-8 production

in lung epithelial cells would be to knock down E1A expression using siRNA, allowed by the

short half-life (30–120 min) of the E1A protein [23]. We generated 6 different E1A siRNAs,

but none reduced E1A mRNA or protein. GAPDH, however, was readily downregulated by

our GAPDH siRNA, validating the method we used. The published shRNA vector driven by

the RNA polymerase-III U6 promotor, which reduced E1A expression by 75% in HEK293

cells [16], neither reduced E1A expression in our cells. The reason for this failure may be due

to incompatibility of the U6 promoter with our cells. Furthermore, steric hindrance by

proteins bound to E1A mRNA in NCI-H292 cells may have prevented the siRNA to bind.

Hence, it remains elusive whether the dysregulated IL-8 production comes about by the actual

viral proteins being expressed, or whether the incorporation of the DNA is sufficient.

The question arises whether there still is a role for E1A expression in the pathogenesis

of COPD as proposed by Hogg et al. From theirs and an other study [24] it follows that E1A

DNA and E1A protein is more abundantly expressed in epithelial cells from COPD patients,

though the reason for increased E1A expression in COPD patients remains elusive. Based

upon our findings it is doubtful that E1A expression per se contributes to the pathogenesis of

COPD by means of an increased IL-8 production. We cannot exclude, however, that E1A

DNA integration following adenoviral infection differs from that obtained with our

transfection approach. In addition, our transfection approach allowed us to analyze adenoviral

integrations that may be very rare events by adenoviral infection. Indeed we found large

differences in transfection efficiency for the various constructs. This difference may be

explained by the cellular effect of the gene that is expressed. As for transfection with E1A

alone, there were no viable clones expressing E1A, which we assume was due to apoptosis. In

a later study performed by Hogg et al it was also described that with primary bronchial cells,

it is not possible to obtain clones expressing only E1A, and that E1B expression is needed

Chapter 2

42

together with E1A to generate stable clones. The transfection efficiency was much higher with

the non-apoptotic E1B and empty vector. Second, the transfection efficiency may depend on

the size of the insert in the vector. The mechanism by which a vector integrates remains

largely elusive, but in order to integrate the vector needs to linearize, i.e. break open. The

point where the vector breaks is random, and the larger the insert is compared to the rest of the

vector, the larger the chance that it breaks in the gene of interest, leading to a reduction in

efficiency of inserting the full gene. This may underlie the lower efficiency of the E1A/E1B

clones, as this insert is of a similar size as the vector, and 2Kb larger than then E1B alone. The

much smaller empty vector containing the Zeocyn resistance GFP tagged protein showed the

highest transfection efficiency. Furthermore, incomplete insertion of the E1A/E1B sequence

may also lead to expression of E1A without E1B, leading again to cell death. As we observed

some clones transfected with E1A and E1B that were positive only for E1B, it is likely that

this also occurs.

The previously unrecognized decreased IL-6 production by the E1A- and E1B-

expressing clones, could contribute to increased inflammation. IL-6 is regarded a pro-

inflammatory mediator, but has also been shown to exert many anti-inflammatory and

immunosuppressive effects (see ref. [25] for review). Moreover, in several murine models for

pulmonary inflammation IL-6 was shown to protect against lung damage [26-29]. The

reduced IL-6 production from epithelial cells thus may play a role in the early pathogenesis of

COPD, as it is hypothesized that latent adenoviral infection, accompanied by expression of

E1A, is established in early childhood [2]. Even though in exhaled breath condensate of

patients diagnosed with COPD high levels of IL-6 are found [30], this IL-6 may be derived

from sources other than lung epithelial cells. Notably, the increased IL-6 levels are observed

in patients already diagnosed with COPD, and thus do not exclude a role for reduced IL-6

production from epithelial cells in the early pathogenesis of COPD. Whether E1A expression

affects the expression of other genes in these transfectants is unknown as yet.

ConclusionTaken together, our study does not provide support for an unique role of Ad5 E1A protein in

the enhanced IL-8 production. Expression of E1A and E1B, however, did affect the IL-8

response to LPS and TNF- , as was evident by the increased response ranges, in particular

due to a reduced IL-8 production of some clones. Both E1A and E1B reduced IL-6

production, which could play a role during the early pathogenesis of COPD. These results


43

warrant further research into the impact of integrated genomic viral sequences on

inflammatory responses.

AbbreviationsAP-1: Activator Protein-1

C/EBP: CAAT/Enhancer Binding Protein

IL: Interleukin

NF B: Nuclear Factor B

TNF: Tumor Necrosis Factor

Authors' contributions AB prepared DNA constructs, generated stable transfectants, performed all studies mentioned

and drafted the manuscript. MS assisted with ELISAs and carried out dotblot hybridizations.

HJ participated in the study design and coordination, and helped to draft the manuscript. RL

conceived the study, participated in its design and coordination, and revised the draft.

Acknowledgements We would like to thank Dr. Robert G. Vries (Department of Molecular Cell Biology, Leiden

University Medical Center, Leiden, Netherlands) for providing the pAt-153-Xho vector and

the antibodies against E1B, Dr. David Hacker (EPFL-SV-IGBB-LTC, Lausanne, Switzerland)

for providing the pSP-E1A vector, and Dr. T.A. Out and professor René van Lier for critical

reading of the manuscript. This study was supported financially by the Netherlands Asthma

Foundation, grant 99.27.

References

1. C.Fletcher, R.Peto (1977). The natural history of chronic airflow obstruction. Br.Med.J. 1, 1645-1648. 2. T.Matsuse, S.Hayashi, K.Kuwano, H.Keunecke, W.A.Jefferies, J.C.Hogg (1992). Latent adenoviral

infection in the pathogenesis of chronic airways obstruction. Am.Rev.Respir.Dis. 146, 177-184. 3. W.M.Elliott, S.Hayashi, J.C.Hogg (1995). Immunodetection of adenoviral E1A proteins in human lung

tissue. Am.J.Respir.Cell Mol.Biol. 12, 642-648. 4. F.L.Graham, D.T.Rowe, R.McKinnon, S.Bacchetti, M.Ruben, P.E.Branton (1984). Transformation by

human adenoviruses. J.Cell Physiol Suppl 3, 151-163. 5. N.Keicho, W.M.Elliott, J.C.Hogg, S.Hayashi (1997). Adenovirus E1A upregulates interleukin-8

expression induced by endotoxin in pulmonary epithelial cells. Am.J.Physiol 272, L1046-L1052. 6. N.Keicho, W.M.Elliott, J.C.Hogg, S.Hayashi (1997). Adenovirus E1A gene dysregulates ICAM-1

expression in transformed pulmonary epithelial cells. Am.J.Respir.Cell Mol.Biol. 16, 23-30. 7. Y.Higashimoto, W.M.Elliott, A.R.Behzad, E.G.Sedgwick, T.Takei, J.C.Hogg, S.Hayashi (2002).

Inflammatory mediator mRNA expression by adenovirus E1A-transfected bronchial epithelial cells. Am.J.Respir.Crit Care Med. 166, 200-207.

Chapter 2

44

8. T.Z.Vitalis, I.Kern, A.Croome, H.Behzad, S.Hayashi, J.C.Hogg (1998). The effect of latent adenovirus 5 infection on cigarette smoke-induced lung inflammation. Eur.Respir.J. 11, 664-669.




12. P.M.Janaswami, D.V.Kalvakolanu, Y.Zhang, G.C.Sen (1992). Transcriptional repression of interleukin-6 gene by adenoviral E1A proteins. J.Biol.Chem. 267, 24886-24891.

13. R.Bernards, P.I.Schrier, J.L.Bos, A.J.Van der Eb (1983). Role of adenovirus types 5 and 12 early region 1b tumor antigens in oncogenic transformation. Virology 127, 45-53.

14. A.Zantema, J.A.Fransen, A.Davis-Olivier, F.C.Ramaekers, G.P.Vooijs, B.DeLeys, A.J.Van der Eb (1985). Localization of the E1B proteins of adenovirus 5 in transformed cells, as revealed by interaction with monoclonal antibodies. Virology 142, 44-58.


16. D.L.Hacker, M.Bertschinger, L.Baldi, F.M.Wurm (2004). Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells. Gene341, 227-234.

17. H.J.Lin, V.Eviner, G.C.Prendergast, E.White (1995). Activated H-ras rescues E1A-induced apoptosis and cooperates with E1A to overcome p53-dependent growth arrest. Mol.Cell Biol. 15, 4536-4544.

18. L.Rao, M.Debbas, P.Sabbatini, D.Hockenbery, S.Korsmeyer, E.White (1992). The adenovirus E1A proteins induce apoptosis, which is inhibited by the E1B 19-kDa and Bcl-2 proteins. Proc.Natl.Acad.Sci.U.S.A 89, 7742-7746.

19. M.Perricaudet, G.Akusjarvi, A.Virtanen, U.Pettersson (1979). Structure of two spliced mRNAs from the transforming region of human subgroup C adenoviruses. Nature 281, 694-696.


21. J.C.Hierholzer, E.Castells, G.G.Banks, J.A.Bryan, C.T.McEwen (1993). Sensitivity of NCI-H292 human lung mucoepidermoid cells for respiratory and other human viruses. J.Clin.Microbiol. 31, 1504-1510.

22. Y.Yang, C.McKerlie, S.H.Borenstein, Z.Lu, M.Schito, J.W.Chamberlain, M.Buchwald (2002). Transgenic expression in mouse lung reveals distinct biological roles for the adenovirus type 5 E1A 243- and 289-amino-acid proteins. J.Virol. 76, 8910-8919.

23. K.R.Spindler, A.J.Berk (1984). Rapid intracellular turnover of adenovirus 5 early region 1A proteins. J.Virol. 52, 706-710.

24. B.He, M.Zhao, X.Li (2001). [Latent adenovirus infection in chronic obstructive pulmonary disease]. Zhonghua Jie.He.He.Hu Xi.Za Zhi. 24, 520-523.

25. H.Tilg, C.A.Dinarello, J.W.Mier (1997). IL-6 and APPs: anti-inflammatory and immunosuppressive mediators. Immunol.Today 18, 428-432.

26. W.Chen, E.A.Havell, F.Gigliotti, A.G.Harmsen (1993). Interleukin-6 production in a murine model of Pneumocystis carinii pneumonia: relation to resistance and inflammatory response. Infect.Immun. 61,97-102.

27. L.E.Bermudez, M.Wu, M.Petrofsky, L.S.Young (1992). Interleukin-6 antagonizes tumor necrosis factor-mediated mycobacteriostatic and mycobactericidal activities in macrophages. Infect.Immun. 60,4245-4252.

28. M.Denis (1992). Interleukin-6 in mouse hypersensitivity pneumonitis: changes in lung free cells following depletion of endogenous IL-6 or direct administration of IL-6. J.Leukoc.Biol. 52, 197-201.

29. T.R.Ulich, S.Yin, K.Guo, E.S.Yi, D.Remick, J.del Castillo (1991). Intratracheal injection of endotoxin and cytokines. II. Interleukin-6 and transforming growth factor beta inhibit acute inflammation. Am.J.Pathol. 138, 1097-1101.

30. W.Chen, E.A.Havell, F.Gigliotti, A.G.Harmsen (1993). Interleukin-6 production in a murine model of Pneumocystis carinii pneumonia: relation to resistance and inflammatory response. Infect.Immun. 61,97-102.

31. E.Bucchioni, S.A.Kharitonov, L.Allegra, P.J.Barnes (2003). High levels of interleukin-6 in the exhaled breath condensate of patients with COPD. Respir.Med. 97, 1299-1302.

45

3Interleukin-17 Induces Hyperresponsive Interleukin-8 and

Interleukin-6 Production to Tumor Necrosis Factor- in

Structural Lung Cells

Am J Respir Cell Mol Biol. 2005 Jul; 33(1):97-104

Arjen van den Berg*†, Mathys Kuiper*†, Mieke Snoek*†, Wim Timens‡, Dirkje S. Postma§,

Henk M. Jansen* and René Lutter*†

Department of Pulmonology* and Laboratory of Experimental Immunology†, Academic Medical Center, University of Amsterdam, Amsterdam, and Departments of Pathology‡ and Pulmonology§, University of Groningen, Groningen, The Netherlands

.

Chapter 3

46

AbstractLung epithelial cells contribute to local inflammation by the production of pro-inflammatory

mediators like interleukin (IL)-8 and IL-6. Although their production depends on gene

transcription, previous studies showed that post-transcriptional mechanisms modulate IL-8

and IL-6 production. Human lung epithelial cells turn from normoresponsive into

hyperresponsive IL-8- and IL-6-producing cells when their IL-8 and IL-6 mRNA degradation

is reduced. We hypothesized that IL-17, a mediator predominantly released by memory T

cells and present in airways of individuals with asthma, would modulate rather than induce

IL-8 and IL-6 production by both human lung epithelial cells and fibroblasts. We show here

for both cell types that IL-17 was a weak stimulus of IL-8 and IL-6 production, but markedly

enhanced IL-8 and IL-6 responses to another stimulus, such as tumor necrosis factor- . This

modulatory effect of IL-17 was paralleled by a reduced IL-8 and IL-6 mRNA degradation,

with no effect on IL-8 and IL-6 gene transcription. In conclusion, IL-17 particularly affects

post-transcriptional regulation of IL-8 and IL-6 expression leading to enhanced IL-8 and IL-6

responses to secondary stimuli, and is only a weak proinflammatory stimulus by itself. This

poses the interesting concept that by releasing IL-17 from memory T cells, the adaptive

immune system instructs lung structural cells as part of the innate immune system to respond

more vigorously.

IntroductionStructural cells in the lung, like epithelial cells and fibroblasts, can direct and perpetuate local

inflammation by the production of inflammatory mediators such as interleukin (IL)-8 and IL-

6. Previous studies into the production of IL-8 and IL-6 by lung epithelial cells have shown

that both gene transcription and mRNA degradation are important regulatory mechanisms (1,

2). Strikingly, the dose-response curves for IL-8 and IL-6 production as a function of the

concentration of tumor necrosis factor (TNF)- or other stimuli are significantly steeper for

cells with a reduced IL-8 and IL-6 mRNA degradation (3, 4). Thus reducing mRNA

degradation turns these cells from normoresponsive into hyperresponsive cells, which may

lead to a more pronounced inflammation.

Interleukin-17A (IL-17), the prototype of six related mediators comprising IL-25 (i.e.,

IL-17E) and IL-17B to IL-17F, is predominantly secreted by memory CD4+ and CD8+ T

cells (5). IL-17 acts as a proinflammatory mediator as it promotes the release of other

IL-17-enhanced IL-6 and IL-8 responses

47

proinflammatory mediators like the neutrophil chemoattractant IL-8 by epithelial cells and

fibroblasts (6). There is some clinical and experimental evidence now that IL-17 may be

implicated in the pathophysiology of inflammatory diseases (7). Increased local levels of

released IL-17 have been reported for a number of chronic inflammatory diseases such as

allergic asthma (8, 9), rheumatoid arthritis (10, 11) and inflammatory bowel disease (12). In

asthma, these findings pointed to a role for IL-17 in neutrophil influx, which is a prominent

feature of asthma exacerbations and of severe asthma. In support of this, recent studies with a

mouse model of allergic asthma showed that blocking-antibodies to IL-17 prevented the

ovalbumin-induced neutrophil influx in sensitized mice (13).

The mechanisms by which IL-17 induces the expression of proinflammatory mediators

may be cell type-dependent, and appear to involve gene transcription (14, 15), and possibly

modulation of mRNA processing (16, 17). We hypothesized that IL-17, by reducing mRNA

degradation, would modulate rather than induce IL-8 and IL-6 production by human lung

epithelial cells and possibly also that by fibroblasts. Relevant human lung epithelial and

fibroblast cell lines and primary cells were exposed to IL-17 alone or in combination with

other stimuli, addressing IL-8 and IL-6 production and the underlying mechanisms. Our

findings indicate that IL-17 in particular enhances IL-8 and IL-6 responses by these structural

cells to other proinflammatory stimuli.

Materials and Methods

Cell Culture

The human lung mucoepidermoid carcinoma derived cell line NCI-H292 (CRL 1848;

American Type Culture Collection [ATCC], Manassas, VA) and the human lung

adenocarcinoma-derived Calu-3 cells (HTB 55; ATCC), were cultured and propagated as

described before (2, 4). For IL-6 and IL-8 production, 3 x 105 cells were plated and grown

overnight in 500 μl in 24-wells plates. For isolation of mRNA and nuclear extracts, 15 x 105

cells were plated and grown overnight in 2.5 ml in 6-well plates. Primary bronchial epithelial

cells (NHBE; Cambrex Bio Science Verviers, Belgium) were cultured and propagated as

recommended by the supplier. Of these cells, 0.2 x 105 and 1 x 105 were plated in 48- and 12-

well plates for measurement of cytokine production and mRNA analyses, respectively. Cells

were used between passages 3 and 5.

Chapter 3

48

The human lung tissue derived fibroblast lines MRC-5 (ATCC CCL 171) and WI-38

(ATCC CCL 75) were cultured and propagated as recommended by the supplier. Primary lung

fibroblast were obtained from explants of noninvolved peripheral parenchymal lung tissue

from three patients undergoing resective surgery for pulmonary carcinoma (described in Ref.

18). The isolated cells were characterized as fibroblasts by morphologic appearance and

expression patterns of specific proteins investigated with immunocytochemistry. Fibroblasts

were spindle-shaped and elongated, with characteristic staining patterns for vimentin

(Dakopatts, Glostrup, Denmark). The cultures showed no immunoreactivity for keratin (Euro-

Diagnostica, Apeldoorn, The Netherlands). Cells were cultured in Ham's F12 medium

(BioWhittaker Europe BV, Verviers, Belgium) with 10% fetal calf serum, supplemented with

L-glutamine (2 mM; Gibco BRL), streptomycin (100 μg/ml; Bio Whittaker), and penicillin

(100 U/ml; BioWhittaker) and were used between passages 3 and 5.

For cytokine release and isolation of RNA, 2.5 x 105 cells/ml were plated and grown

overnight in 250 μl in 48-well plates or in 1 ml in 12-well plates, respectively.

Determination of IL-6 and IL-8 Protein

Cells were exposed for 18 h to doses of TNF- (rhTNF- ; R&D Systems, Minneapolis,

MN), lipopolysaccharide (LPS; Sigma, St. Louis, MO), IL-17 (rhIL-17; R&D Systems), and

IL-1 (rhIL-1 ; Genzyme Diagnostics, Cambridge, MA) up to 5 ng/ml, 1 μg/ml, 100 ng/ml,

and 100 U/ml, respectively.

The amount of IL-6 and IL-8 in culture supernatants was measured by sandwich

ELISA, as described previously (3).

mRNA Analysis

Cells were stimulated with IL-17 (10 ng/ml), TNF- (5 ng/ml), LPS (1 μg/ml), and IL-1 (1

U/ml). Total RNA was extracted with TriZol (Invitrogen, Paisley, UK) and the amount of IL-

6, IL-8, and GAPDH mRNA was determined by dotblotting and hybridization with specific 32P-labeled probes for IL-6, IL-8, and GAPDH, which have been extensively validated for

specificity in our samples by Northern blot as described (1, 2). Blots were quantified using a

phosphorimager, and variable loading was corrected for by expressing mRNA levels relative

to that of the housekeeping gene GAPDH. mRNA decay experiments were performed 1, 3,

and 5 h after stimulation by blocking gene transcription with 5 μg/ml actinomycin-D


49

(Boehringer Mannheim, Mannheim, Germany). After various periods of time, remaining

mRNA was determined as described above.

Isolation of Nuclear Extracts and Electrophoretic Mobility Shift Assay

Nuclear extracts were obtained after 1 h stimulation with 5 ng/ml TNF- , 1 μg/ml LPS, and

10 ng/ml IL-17, as described (1, 2). Protein contents was measured using a protein assay kit

(Biorad, Hercules, CA). Two micrograms of protein of the nuclear extracts were incubated

with 32P-labeled oligonucleotides at 4°C for 1 h and separated on a 4% nonreducing

polyacrylamide gel at slowly increasing voltages (60-220 V). Bands were identified by cold

oligo competition and by supershift using 1 μg of antibodies against p65 for nuclear factor

(NF)- B, c-fos and c-jun for activator protein (AP)-1, and C/EBP- (Santa Cruz

Biotechnology Inc., Santa Cruz, CA). The intensity of the bands was quantified using a

phosphorimager. The following oligonucleotides were used in the electrophoretic mobility

shift assay (EMSA):

NF- B: 5'-TTGCAAATCGTGGAATTTCCTCTGACATAA-3';

AP-1: 5'-TTAAGTGTGATGACTCAGGTTTAA-3';

C/EBP: 5'-TTAAAGGACGTCACATTGCACAATCTTAATAA-3'.

Transfection of IL-6 and IL-8 Promoter Chloramphenicol Acetyltransferase Constructs

NCI-H292 cells were grown to 70% confluence in 6-well plates and transfected with 5 μg of

chloramphenicol acetyltransferase (CAT) reporter vectors driven by the wild-type IL-8 (19) or

IL-6 promoter (20), as described (1, 2). Cells were stimulated with 5 ng/ml TNF- , 10 ng/ml

IL-17, or a combination of both, 24 h after transfection and 18 h before cell lysis. CAT

production was measured by CAT ELISA (Roche Diagnostics, Mannheim, Germany)

according to the manufacturer's instructions, and data were normalized for total protein

content.

Statistical Analysis

IL-8 and IL-6 protein production and EMSA data were analyzed by independent samples t test

or ANOVA combined with post hoc Bonferroni test. mRNA half-life was estimated by linear

regression. Differences were considered significant at P 0.05 (in the figures, if error bars are

not visible they are contained within the symbol).

Chapter 3

50

Results

IL-17 Amplifies IL-8 and IL-6 Responses to TNF- and LPS in Lung Epithelial Cells and

Lung Fibroblasts

IL-17 by itself (up to 100 ng/ml) induced low amounts of IL-6 and IL-8 in NCI-H292 and

Calu-3 (data not shown) lung epithelial tumor cell lines as well as in normal human bronchial

epithelial cells (NHBE). However, IL-17 markedly enhanced IL-6 and IL-8 responses by lung

epithelial cells to a concentration range of TNF- (Figure 1 and Table 1).

Figure 1. IL-17 augments IL-8 and IL-6 production to TNF- in lung epithelial cells. NCI-H292 (A and B) and NHBE (C and D)cells were exposed for 18 h to 0, 0.05, 0.5, and 5 ng/ml TNF- without IL-17 (shaded square), or with 1 ng/ml IL-17 (inverted open triangle), 10 ng/ml IL-17 (shaded triangle), or 100 ng/ml IL-17 (open triangle). Please note that curves for IL-17 in B overlap. IL-8 and IL-6 were measured by ELISA and expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P< 0.001 as determined by ANOVA and Bonferroni post test. (A and B: triplicate samples, n = 3; C and D: triplicate samples, a representative experiment of n = 2 is shown). If no error bars are visible they are contained within the symbol.

Interestingly, the effect of IL-17 was most pronounced with primary cells. NCI-H292 cells,

which were studied most extensively, showed a dose-dependent effect of IL-17 for the

enhanced IL-8 response (log-transformed data with 5 ng/ml of TNF- : r = 0.998), with a

maximal effect at 100 ng/ml. No dose-dependent effect of IL-17 on IL-6 responses was

observed.


51

TABLE 1: Effect of IL-17 on IL-6 and IL-8 production by lung epithelial cells relative to that without IL-17*

IL-6 IL-8

NCI-H292 1.9 ± 0.2# 2.1 ± 0.2#

2.0 ± 0.12## 2.7 ± 0.3##

NHBE 4.6 ± 0.2# 7.6 ± 0.8#

* Fold increase of curve steepness calculated from 0-0.5 ng/ml TNF- #) 10 ng/ml of IL-17;##) 100 ng/ml of IL-

17. Definition of abbreviations: IL, interleukin; NHBE, normal human bronchial epithelial cells.

We also determined whether IL-17 affected IL-6 and IL-8 responses by lung fibroblasts

(Figure 2 and Table 2). Again, IL-17 alone induced small amounts of IL-6 and IL-8 in the

human lung fibroblast cell lines MRC-5 (Figures 2A and 2B) and WI-38 (not shown), as well

as in primary human lung fibroblasts (Figures 2C and 2D). Similar to that for lung epithelial

cells, IL-17 markedly enhanced the IL-6 and IL-8 responses by these lung fibroblasts to a

concentration range of TNF- . The effect of IL-17 appeared concentration-dependent in the

range from 0-10 ng/ml of IL-17 (Figures 2A and 2B; at 5 ng/ml of TNF- , r = 0.97 and 0.95

for IL-6 and IL-8, respectively).

Figure 2. IL-17 enhances TNF- -induced IL-8 and IL-6 production by lung fibroblasts. MRC-5 (A and B) and primary (C and D) lung fibroblasts were exposed for 18 h to 0, 0.05, 0.5, and 5 ng/ml TNF- without IL-17 (shaded squares) or with 1 ng/ml IL-17 (inverted open triangles) or 10 ng/ml IL-17 (shaded triangles).IL-8 and IL-6 were measured by ELISA. Data are presented as mean ± SEM, n = 3 (triplicate samples) for A and B. C and D are representative of three experiments with cells from three different donors (duplicate samples). Statistics are as described in legends to Figure 1. **P < 0.01, ***P < 0.001 versus TNF- alone.

Chapter 3

52

TABLE 2. Effect of IL-17 (10 ng/ml) on IL-6 and IL-8 production by lung fibroblasts relative to that without IL-

17*

IL-6 IL-8

MRC-5 8.5 ± 0.7 2.0 ± 0.2

Primary 11.4 ± 1.0 4.2 ± 0.3

* Fold increase of curve steepness calculated from 0-0.5 ng/ml TNF. Definition of

abbreviation: IL, interleukin.

To better view the effect of IL-17 on the dose-response curves for the primary cells, we

expressed the effect of IL-17 relative to that without IL-17 for each dose of TNF- (Figure 3).

Whereas IL-17 showed the largest effect on TNF- -induced IL-8 response by NHBE, in TNF-

-stimulated lung fibroblasts IL-17 more profoundly enhanced the IL-6 response (see also

Tables 1 and 2). In addition, it is also clear that the extent of the effect of IL-17 varies with the

dose of TNF- .

Figure 3. Effect of IL-on IL-8 and IL-6 production by primary cells. Data from Figures 1 (A)and 2 (B) were used and expressed relative (± SEM) to that of responses by TNF-alone. IL-8 induction is shown in white bars, IL-6 induction in black bars.

We also tested whether IL-17 amplified IL-6 and IL-8 responses to proinflammatory stimuli

other than TNF- . IL-17 (10 ng/ml) increased the LPS-induced IL-8 and IL-6 production 2.5-

fold in NCI-H292 cells (not shown). Calu-3, NHBE cells, and lung fibroblasts did not produce

significant amounts of IL-8 and IL-6 in response to LPS, and no enhancement was observed

by co-incubation with IL-17 (data not shown). IL-1 (10 U/ml) potently stimulated NCI-H292

lung epithelial cells and MRC-5 lung fibroblasts to produce IL-8 (30- and 400-fold over basal


53

secretion, respectively) and IL-6 (20- and 130-fold, respectively), but IL-17 did not augment

IL-1 -induced responses (data not shown).

IL-17 Increases TNF- -Induced IL-8 and IL-6 mRNA Expression in Time

To provide a clue as to the mechanism of IL-17-enhanced IL-8 and IL-6 responses to TNF- ,

the expression of IL-8 and IL-6 mRNA were determined over time (Figures 4A and 4B). NCI-

H292 cells exposed to 5 ng/ml TNF- showed a rapid increase of IL-8 and IL-6 mRNA

levels, peaking at 1 h followed by a rapid decline to near basal levels, which is known to be

facilitated by active degradation of these mRNAs (1, 2). Exposure to TNF- plus IL-17 (10

ng/ml) resulted in a rapid increase of IL-8 and IL-6 mRNA expression, with similar kinetics

as for TNF- alone. However, the decline of IL-8 mRNA levels and to a lesser extent that of

IL-6 was slower than with TNF- alone, indicative of a reduced IL-8 and IL-6 mRNA

degradation. In line with the low levels of IL-6 and IL-8 induced by IL-17 (Figure 1), IL-17

(10 ng/ml) induced a small and relatively slow increase in IL-8 and IL-6 mRNA levels

(Figures 4A and 4B), peaking around 2 h and followed by a slow decline. Comparing the

dashed curve, i.e., the sum of the curves for TNF- and that of IL-17, with the curve for

combined exposure shows a statistically significant increase at the mRNA level. The effect of

IL-17 on the IL-8 mRNA expression was more pronounced than that for IL-6, in line with the

more pronounced effect of IL-17 on the IL-8 response by lung epithelial cells (Figure 1).

Figure 4. IL-17 enhances TNF- -induced IL-8 and IL-6 mRNA expression in time. NCI-H292 (A and B) and MRC-5 (C and D) cells were exposed to 10 ng/ml IL-17 (inverted shaded triangles), 5 ng/ml TNF- (shaded squares), or both (shaded triangles). The dashed curve represents the calculated additional effect of IL-17 and TNF- . RNA was isolated at indicated time points, isolated, dotblotted, and hybridized. The signal was quantified using a phosphorimager. Data are presented as fold-induction (duplicate samples; mean ± SEM) of the ratio IL-8 or IL-6 mRNA over that of GAPDH. Statistics are as described in legend to Figure 1.

Chapter 3

54

Similar experiments with MRC-5 fibroblasts showed that co-exposure to TNF- and IL-17

resulted in a significant 1.5 ± 0.05 fold increase of IL-8 mRNA that leveled off at five hours

and remained high thereafter (Figure 4C). Virtually similar results were obtained for IL-6

mRNA (Figure 4D), but with a 4.2- ± 0.3-fold increase of IL-6 mRNA upon co-exposure to

IL-17, showing a more profound increase than for IL-8 mRNA. This is in line with the larger

effect of IL-17 on the TNF- -induced IL-6 protein production as compared with that for IL-8

(Figure 2). As for IL-6 and IL-8 mRNA kinetics in airway epithelial cells (Figure 4A and B),

IL-17 particularly affects mRNA expression after the initial peak, suggestive of mRNA

stabilization in MRC-5 cells.

IL-17 Does Not Augment IL-8 or IL-6 Gene Transcription in Lung Epithelial Cells

IL-17 was reported to induce NF- B activation in a number of cell types (14, 15). Previous

experiments with NCI-H292 cells showed that NF- B and, to a lesser extent, AP-1 are

involved in IL-8 gene transcription, whereas C/EBP is involved in IL-6 gene transcription (1,

2). To assess the role of nuclear translocation and promoter binding of the relevant

transcription factors by IL-17 in NCI-H292 cells, EMSAs were performed. NCI-H292 cells

were stimulated for 1 h with TNF- (5 ng/ml) or LPS (1 μg/ml), with or without IL-17 (10

ng/ml). Figure 5A shows that both TNF- and LPS induced activation of NF- B, and to a

higher extent than by stimulation with IL-17. The combination of IL-17 with TNF- or LPS

did not further increase NF- B activation, indicating that the IL-17-enhanced IL-8 response

was not due to increased activation of NF- B. AP-1 recruitment (Figure 5B) was only slightly

elevated and was not significantly augmented by IL-17 with TNF- and LPS. C/EBP

recruitment (Figure 5C) was stimulated only weakly by either stimulus, and there was no

additional effect of IL-17 on C/EBP activation.

To assess the transcriptional effect of IL-17 by an alternative approach, we transfected

NCI-H292 cells with CAT constructs linked to the IL-8 or the IL-6 promoter. Transfected

cells were stimulated for 18 h and CAT production was measured by ELISA. The results

showed that TNF- -induced IL-8 (Figure 5D) and IL-6 (Figure 5E) gene transcription were

not augmented by IL-17, whereas IL-17 weakly activated both promoters. The small reduction

in CAT production in the combined exposure to IL-17 and TNF- was consistent in both

experiments, but did not reach statistical significance.


55

Figure 5. IL-17 does not enhance transcriptional activation in lung epithelial cells. EMSA (A-C): NCI-H292 cells were exposed for 1 h to 5 ng/ml TNF-α, 100 ng/ml LPS, 10 ng/ml IL-17, or a combination as indicated, followed by preparation of nuclear extracts (A-C). Specific bands, as determined by supershift and competition, are shown in rectangles. Bands were quantified with a phosphorimager as represented in the lower graphs. A representative experiment out of three experiments is shown. Reporter assay (D-E): NCI-H292 cells were transfected with CAT expression vectors in which the IL-8 (D) or IL-6 (E) promoter was cloned. Cells were exposed to 5 ng/ml TNF-α, 10 ng/ml IL-17, or both for 18 h. CAT production was measured by ELISA and correct for total protein. Data are expressed as fold induction over medium and represent the mean ± SEM of two independent experiments.

IL-17 Reduces IL-8 and IL-6 mRNA Degradation

To determine whether IL-17 (10 ng/ml) modulated IL-8 and IL-6 mRNA degradation in lung

epithelial cells, gene transcription was blocked using actinomycin D (5 μg/ml) 1 h after

stimulation, and the decline of IL-8 and IL-6 mRNA with time was quantified. Figure 6

represents results from mRNA half-life experiments with NCI-H292 and NHBE cells. In

TNF-α-stimulated NCI-H292 cells, the half-life of IL-8 and IL-6 mRNA (linear regression

over 80 min) was 50 ± 10 and 60 ± 11 min, respectively (Figures 6A and 6B). Co-incubation

with IL-17 (10 ng/ml and (not shown) 50 ng/ml) led to a small but consistent (n = 4, triplicate

samples) increase of 20-30% in the half-life of TNF-α-induced IL-8 and IL-6 mRNA,

resulting in half-lives of 61 ± 6 and 88 ± 6 min (P < 0.05) for IL-8 and IL-6 mRNA,

respectively.

Chapter 3

56

Figure 6. Half-life of IL-8 and IL-6 mRNA in lung epithelial cells stimulated with TNF-α and IL-17. NCI-H292 cells (A and B) and NHBE cells (C and D) were exposed to 5 ng/ml TNF-α(shaded squares) or to TNF-α and 10 ng/ml IL-17 (shaded triangles). After 1 h, Actinomycin D (ActD; 5 μg/ml) was added to block transcription. RNA was obtained at 0, 40, and 80 min after the addition of ActD, purified, and dotblotted. Blots were hybridized and IL-8 (Aand C) and IL-6 (B and D) mRNA was quantified with a phosphorimager. Variable loading was corrected by expressing IL-6 and IL-8 mRNA over that of GAPDH. Data are expressed as mean ± SEM (A and B, n = 3; Cand D, n = 2; all triplicate samples). Statistics are as described in legends to Figure 1.

Also for NHBE cells (Figures 6C and 6D), there was a consistent but small effect on the IL-8

and IL-6 mRNA half-lives. IL-17 (10 ng/ml and [not shown] 100 ng/ml) increased the IL-8

mRNA half-life from 181 ± 40 to 227 ± 0.53 (1.3-fold) minutes, and for IL-6 mRNA from

123 ± 24 to 234 ± 15 (P < 0.05: 1.9-fold). Similar results were obtained with Calu-3 cells

(data not shown). The enhanced response to LPS by IL-17 in NCI-H292 cells was also

paralleled by an increased half-life of the corresponding mRNAs. IL-8 mRNA half-life

increased from 80 ± 7 to 96 ± 1 min, and for IL-6 mRNA from 80 ± 7 to 242 ± 104 min.

Taken together, these results indicate that IL-17 increased IL-8 and IL-6 mRNA half-life in

lung epithelial cells.

mRNA decay in MRC-5 fibroblasts and primary human lung fibroblasts was analyzed 3 h

after exposure to TNF-α with or without IL-17, the time point at which mRNA curves for

cells with and without IL-17 start to deviate (cf. Figures 4C and 4D). IL-8 mRNA in both the

cell line and primary cells exposed to TNF-α was quite stable (Figures 7A and 7C), and thus a

stabilizing effect of IL-17 was difficult to assess. In contrast, IL-6 mRNA in MRC-5 and

primary lung fibroblasts had a half-life of 2.7 ± 0.2 h (Figure 7B) and 2.5 ± 0.4 h (Figure 7D),

respectively, which was increased by IL-17 to 61 ± 0.8 h and 4.8 ± 0.4 h (by extrapolation).

IL-8 and IL-6 mRNA decay at 5 h after stimulation yielded similar results (data not shown).

These data indicate that also for lung fibroblasts, IL-17 stabilizes IL-6 mRNA.


57

Figure 7. IL-17 stabilizes IL-6 mRNA in lung fibroblasts. MRC-5 (A and B) and primary (C and D) lung fibroblasts were exposed for 3 h to 5 ng/ml TNF-α without (shaded square) or with 10 ng/ml IL-17 (shaded triangle). IL-8 (A and C) and IL-6 (B and D) mRNA decay was assessed as described in the legend to Figure 6. Data are presented as mean ± SEM. For A and B, one representative experiment of three (all duplicate samples) is shown. C and D show an experiment (duplicate samples, n = 2) with cells from one donor, representative of that found with cells from three donors. Statistics are as described in legend to Figure 1.

Given that IL-17 failed to enhance IL-6 and IL-8 responses to IL-1β, the effect of IL-1β on

IL-6 and IL-8 mRNA half-life in MRC-5 fibroblasts was tested. IL-6 and IL-8 mRNA half-

life after stimulation with IL-1β was prolonged compared with that after stimulation with

TNF-α, which was not further increased by IL-17 (data not shown), indicating that IL-17 and

IL-1β may affect IL-6 and IL-8 mRNA half-life via the same pathway.

DiscussionStructural lung cells such as epithelial cells and fibroblasts contribute to airway inflammation

by the production of inflammatory mediators. Factors modulating the production of these

mediators may have profound effects on inflammation. We studied the contribution of IL-17

to IL-6 and IL-8 production by lung epithelial cells and fibroblasts. IL-17 by itself weakly

stimulated epithelial IL-6 and IL-8 production, but was 25-fold less potent then TNF-α at

equimolar amounts. Similar findings were obtained for lung fibroblasts. However, IL-17

potently enhanced TNF-α-induced IL-6 and IL-8 responses in cell lines of both cell types, and

even more so of their primary counterparts. Thus, IL-17 predominantly enhances IL-6 and IL-

8 responses to TNF-α rather than acts as a proinflammatory stimulus by itself.

The lower potency of IL-17 compared with that of TNF-α to induce IL-6 and IL-8

differs from that reported by Jones and Chan for primary bronchial epithelial cells (21), but is

in line with other reports for the bronchial epithelial cell line 16-HBE (22), airway smooth

Chapter 3

58

muscle cells (23), and several types of fibroblasts (17, 24). The reason for this discrepancy

with the results by Jones and Chan is not clear, but may relate to donor differences.

Nevertheless, Jones and Chan show, like in the present study, that IL-17 and TNF-α synergize

in IL-8 production, but without addressing the underlying mechanism. The slight increase in

IL-6 and IL-8 production by IL-17 alone is paralleled by a slow and transient increase of the

respective mRNAs in lung epithelial cells and fibroblasts. The kinetics of IL-6 and IL-8

mRNA are suggestive of a minor increase in transcription followed by a reduced rate of IL-6

and IL-8 mRNA degradation. In line herewith, we observed a modest increase in IL-8 and IL-

6 gene transcription by IL-17 alone by EMSA and with promoter constructs. We were unable

to determine the half-life of IL-6 and IL-8 mRNA in epithelial cells and fibroblasts exposed to

IL-17 alone, as mRNA levels remained too low for accurate measurements.

The enhanced IL-6 and IL-8 responses to TNF-α by IL-17, however, are not due to a

synergy with TNF-α at the transcriptional level; if anything, there was a small reduction in

transcriptional activity. Instead, IL-17 affected the post-transcriptional regulation as reflected

by a reduced IL-6 and IL-8 mRNA degradation. Identical effects of IL-17 on mRNA stability

for other cell types and transcripts have been described (16, 17, 23, 25, 26), but this is the first

report to show similar effects in lung epithelial cells and fibroblasts. The effect of IL-17 on

TNF-α-induced IL-6 and IL-8 responses was most pronounced for IL-6 in lung fibroblasts,

and for IL-8 in epithelial cells. The increased IL-6 response by lung fibroblasts may relate to

the more pronounced effect of IL-17 on IL-6 mRNA stabilization in fibroblasts than in lung

epithelial cells. The increased IL-8 response by lung epithelial cells, however, cannot solely

be explained by mRNA stabilization, as IL-6 mRNA in epithelial cells was stabilized to a

higher extent than that of IL-8. Although IL-17 exerts its effect apparently by stabilizing IL-6

and IL-8 mRNA, we cannot rule out that IL-17 also affects IL-6 and IL-8 mRNA translation.

IL-17 also enhanced LPS-induced IL-6 and IL-8 responses in NCI-H292 cells, but

failed to enhance IL-6 and IL-8 responses in airway epithelial cells and fibroblasts to IL-1β,

which also is a potent inducer of IL-6 and IL-8 production in these cell types. The most likely

explanation is that IL-1β affects the same post-transcriptional processes as IL-17, in addition

to IL-6 and IL-8 gene transcription. Indeed, we found that IL-1β stabilized IL-6 mRNA in

fibroblasts and thus IL-1β may induce a similar hyperresponsiveness by structural cells as

described here for IL-17. A similar failure of IL-1β to enhance IL-17 effects were reported by

Shimada and coworkers (17) and by Henness and colleagues (23). Both IL-17 and IL-1β have

been shown to activate p38 MAPK, a kinase of which its activation is strongly correlated with


59

IL-17- and IL-1β-induced mRNA stabilization (26, 27; reviewed in Ref. 28). Given these

findings, it is likely that activation of p38 MAPK by IL-17 is not further enhanced by IL-1β,

and vice versa.

Taken together, this indicates that IL-17 is a relative poor inducer of IL-8 and IL-6

gene transcription, and predominantly exerts its effect by modulating post-transcriptional

processes. IL-17-reduced IL-6 and IL-8 mRNA degradation is paralleled by a hyperresponsive

IL-6 and IL-8 production in lung epithelial cells, as shown previously for other conditions (3,

4, 29), and for the first time also in lung fibroblasts. It is important to further clarify what is

meant here by hyperresponsive IL-6 and IL-8 production. IL-17 synergizes with TNF-α,

either independent of the dose of the stimulus or dependent on the dose of TNF-α (as seen, for

example, for the fibroblastic IL-6 production). So, in both cases IL-17 enhances IL-6 and IL-8

responses, i.e., hyperresponsive IL-6 and IL-8 production. However, when the extent of

synergy varies with the dose of the stimulus, this will change the shape of the dose-response

curve, leading for example to a relative further enhanced IL-6 production for fibroblasts at

high doses of TNF-α

Like IL-6 and IL-8 mRNA, most if not all mRNAs encoding response genes contain a

common motif in the 3'-untranslated region of these mRNAs, referred to as AUUUA-repeats

or ARE-rich elements. Transfer of these repeats to stable mRNAs facilitates their rapid

degradation (30), and thus these repeats are strongly linked to mRNA degradation (31). As IL-

17 modulates mRNA degradation, this may be related to the AUUUA-repeats and thus may

apply to many mRNAs encoding response genes. This is in line with the data reported by

Jones and Chan (21) looking into the IL-17-induced gene expression in primary human

bronchial epithelial cells, where several response genes were upregulated.

IL-17 is found in tens of pg in bronchoalveolar lavage fluid and sputum of patients

with asthma (32, 33). Epithelial lining fluid, which is sampled by the lavage technique, is

diluted 50-fold, and thus levels of IL-17 in epithelial lining fluid may reach up to low ng

levels. In addition, it may be envisaged that T cells release IL-17 in close association with

structural cells and thus even higher local levels may be reached. It remains to be determined

whether IL-17, or indeed other mediators related to IL-17, contribute to chronic inflammation

in asthma or other inflammatory diseases. The present results, however, indicate that IL-6 and

IL-8 responses by lung epithelial cells and fibroblasts are highly susceptible to IL-17.

Moreover, compared with lung epithelial cells, lung fibroblasts on a cell-to-cell basis produce

10-fold more IL-8 and 100-fold more IL-6, underlining their potential as important players in

Chapter 3

60

inflammatory processes in the lung. Besides chronic inflammation, an apparently thickened

basement membrane and the appearance of myofibroblasts are characteristic of asthmatic

airways, which may also come about by activated fibroblasts and epithelial cells.

In summary, IL-17 potently amplifies IL-8 and IL-6 responses to secondary stimuli in

both lung epithelial cells and fibroblasts. IL-17 is released by memory T cells, which are part

of the adaptive immune system enabling the organism to respond more rapidly upon re-

exposure to antigens. Our results indicate that the adaptive immune system by means of IL-17

release may direct the lung innate immune response to act more vigorously.

AcknowledgmentsThe authors are grateful to Dr. Jeroen Maertzdorf for scientific input, to Dr. T. A. Out and

Prof. R. A. W. van Lier for critical reading of the manuscript, and to Nico Ponne for

automating the IL-6 ELISA on the Biomek.


61

References

1. Roger, T., T. A. Out, H. M. Jansen, and R. Lutter. 1998. Superinduction of interleukin-6 mRNA in lung epithelial H292 cells depends on transiently increased C/EBP activity and durable increased mRNA stability. Biochim.Biophys.Acta 1398:275-284.

2. Roger, T., T. Out, N. Mukaida, K. Matsushima, H. Jansen, and R. Lutter. 1998. Enhanced AP-1 and NF-kappaB activities and stability of interleukin 8 (IL-8) transcripts are implicated in IL-8 mRNA superinduction in lung epithelial H292 cells. Biochem.J. 330 ( Pt 1):429-435.

3. Lutter, R., S. Loman, M. Snoek, T. Roger, T. A. Out, and H. M. Jansen. 2000. IL-6 protein production by airway epithelial(-like) cells disabled in IL-6 mRNA degradation. Cytokine 12:1275-1279.

4. van Wissen, M., M. Snoek, B. Smids, H. M. Jansen, and R. Lutter. 2002. IFN-gamma amplifies IL-6 and IL-8 responses by airway epithelial-like cells via indoleamine 2,3-dioxygenase. J.Immunol. 169:7039-7044.

5. Yao, Z., S. L. Painter, W. C. Fanslow, D. Ulrich, B. M. Macduff, M. K. Spriggs, and R. J. Armitage. 1995. Human IL-17: a novel cytokine derived from T cells. J.Immunol. 155:5483-5486.

6. Fossiez, F., O. Djossou, P. Chomarat, L. Flores-Romo, S. Ait-Yahia, C. Maat, J. J. Pin, P. Garrone, E. Garcia, S. Saeland, D. Blanchard, C. Gaillard, M. B. Das, E. Rouvier, P. Golstein, J. Banchereau, and S. Lebecque. 1996. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J.Exp.Med. 183:2593-2603.

7. Kolls, J. K. and A. Linden. 2004. Interleukin-17 family members and inflammation. Immunity. 21:467-476.

8. Molet, S., Q. Hamid, F. Davoine, E. Nutku, R. Taha, N. Page, R. Olivenstein, J. Elias, and J. Chakir. 2001. IL-17 is increased in asthmatic airways and induces human bronchial fibroblasts to produce cytokines. J.Allergy Clin.Immunol. 108:430-438.

9. Wong, C. K., C. Y. Ho, F. W. Ko, C. H. Chan, A. S. Ho, D. S. Hui, and C. W. Lam. 2001. Proinflammatory cytokines (IL-17, IL-6, IL-18 and IL-12) and Th cytokines (IFN-gamma, IL-4, IL-10 and IL-13) in patients with allergic asthma. Clin.Exp.Immunol. 125:177-183.

10. Kotake, S., N. Udagawa, N. Takahashi, K. Matsuzaki, K. Itoh, S. Ishiyama, S. Saito, K. Inoue, N. Kamatani, M. T. Gillespie, T. J. Martin, and T. Suda. 1999. IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J.Clin.Invest 103:1345-1352.

11. Chabaud, M., J. M. Durand, N. Buchs, F. Fossiez, G. Page, L. Frappart, and P. Miossec. 1999. Human interleukin-17: A T cell-derived proinflammatory cytokine produced by the rheumatoid synovium. Arthritis Rheum. 42:963-970.

12. Fujino, S., A. Andoh, S. Bamba, A. Ogawa, K. Hata, Y. Araki, T. Bamba, and Y. Fujiyama. 2003. Increased expression of interleukin 17 in inflammatory bowel disease. Gut 52:65-70.

13. Hellings, P. W., A. Kasran, Z. Liu, P. Vandekerckhove, A. Wuyts, L. Overbergh, C. Mathieu, and J. L. Ceuppens. 2003. Interleukin-17 orchestrates the granulocyte influx into airways after allergen inhalation in a mouse model of allergic asthma. Am.J.Respir.Cell Mol.Biol. 28:42-50.

14. Andoh, A., H. Takaya, J. Makino, H. Sato, S. Bamba, Y. Araki, K. Hata, M. Shimada, T. Okuno, Y. Fujiyama, and T. Bamba. 2001. Cooperation of interleukin-17 and interferon-gamma on chemokine secretion in human fetal intestinal epithelial cells. Clin.Exp.Immunol. 125:56-63.

15. Kao, C. Y., Y. Chen, P. Thai, S. Wachi, F. Huang, C. Kim, R. W. Harper, and R. Wu. 2004. IL-17 markedly up-regulates beta-defensin-2 expression in human airway epithelium via JAK and NF-kappaB signaling pathways. J.Immunol. 173:3482-3491.

16. Faour, W. H., A. Mancini, Q. W. He, and J. A. Di Battista. 2003. T-cell-derived interleukin-17 regulates the level and stability of cyclooxygenase-2 (COX-2) mRNA through restricted activation of the p38 mitogen-activated protein kinase cascade: role of distal sequences in the 3'-untranslated region of COX-2 mRNA. J.Biol.Chem. 278:26897-26907.

17. Shimada, M., A. Andoh, K. Hata, K. Tasaki, Y. Araki, Y. Fujiyama, and T. Bamba. 2002. IL-6 secretion by human pancreatic periacinar myofibroblasts in response to inflammatory mediators. J.Immunol.168:861-868.

18. Noordhoek, J. A., D. S. Postma, L. L. Chong, J. T. Vos, H. F. Kauffman, W. Timens, and J. F. van Straaten. 2003. Different proliferative capacity of lung fibroblasts obtained from control subjects and patients with emphysema. Exp.Lung Res. 29:291-302.

19. Mukaida, N., Y. Mahe, and K. Matsushima. 1990. Cooperative interaction of nuclear factor-kappa B- and cis-regulatory enhancer binding protein-like factor binding elements in activating the interleukin-8 gene by pro-inflammatory cytokines. J.Biol.Chem. 265:21128-21133.

20. Libermann, T. A. and D. Baltimore. 1990. Activation of interleukin-6 gene expression through the NF-kappa B transcription factor. Mol.Cell Biol. 10:2327-2334.

Chapter 3

62

21. Jones, C. E. and K. Chan. 2002. Interleukin-17 stimulates the expression of interleukin-8, growth-related oncogene-alpha, and granulocyte-colony-stimulating factor by human airway epithelial cells. Am.J.Respir.Cell Mol.Biol. 26:748-753.

22. Prause, O., M. Laan, J. Lotvall, and A. Linden. 2003. Pharmacological modulation of interleukin-17-induced GCP-2-, GRO-alpha- and interleukin-8 release in human bronchial epithelial cells. Eur.J.Pharmacol. 462:193-198.

23. Henness, S., C. K. Johnson, Q. Ge, C. L. Armour, J. M. Hughes, and A. J. Ammit. 2004. IL-17A augments TNF-alpha-induced IL-6 expression in airway smooth muscle by enhancing mRNA stability. J.Allergy Clin.Immunol. 114:958-964.

24. Katz, Y., O. Nadiv, and Y. Beer. 2001. Interleukin-17 enhances tumor necrosis factor alpha-induced synthesis of interleukins 1,6, and 8 in skin and synovial fibroblasts: a possible role as a "fine-tuning cytokine" in inflammation processes. Arthritis Rheum. 44:2176-2184.

25. Yamazaki, S., T. Muta, S. Matsuo, and K. Takeshige. 2005. Stimulus-specific induction of a novel nuclear factor-kappaB regulator, IkappaB-zeta, via Toll/Interleukin-1 receptor is mediated by mRNA stabilization. J.Biol.Chem. 280:1678-1687.

26. Hata, K., A. Andoh, M. Shimada, S. Fujino, S. Bamba, Y. Araki, T. Okuno, Y. Fujiyama, and T. Bamba. 2002. IL-17 stimulates inflammatory responses via NF-kappaB and MAP kinase pathways in human colonic myofibroblasts. Am.J.Physiol Gastrointest.Liver Physiol 282:G1035-G1044.

27. Suswam, E. A., L. B. Nabors, Y. Huang, X. Yang, and P. H. King. 2005. IL-1beta induces stabilization of IL-8 mRNA in malignant breast cancer cells via the 3' untranslated region: Involvement of divergent RNA-binding factors HuR, KSRP and TIAR. Int.J.Cancer 113:911-919.

28. Dean, J. L., G. Sully, A. R. Clark, and J. Saklatvala. 2004. The involvement of AU-rich element-binding proteins in p38 mitogen-activated protein kinase pathway-mediated mRNA stabilisation. Cell Signal.16:1113-1121.

29. Roger, T., P. Bresser, M. Snoek, K. van der Sluijs, A. van den Berg, M. Nijhuis, H. M. Jansen, and R. Lutter. 2004. Exaggerated IL-8 and IL-6 responses to TNF-{alpha} by parainfluenza virus type 4-infected NCI-H292 cells. Am.J.Physiol Lung Cell Mol.Physiol 287:L1048-L1055.

30. Yu, Y. and K. Chadee. 2001. The 3'-untranslated region of human interleukin-8 mRNA suppresses IL-8 gene expression. Immunology 102:498-505.

31. Wreschner, D. H. and G. Rechavi. 1988. Differential mRNA stability to reticulocyte ribonucleases correlates with 3' non-coding (U)nA sequences. Eur.J.Biochem. 172:333-340.

32. Laan, M., L. Palmberg, K. Larsson, and A. Linden. 2002. Free, soluble interleukin-17 protein during severe inflammation in human airways. Eur.Respir.J. 19:534-537.

33. Barczyk, A., W. Pierzchala, and E. Sozanska. 2003. Interleukin-17 in sputum correlates with airway hyperresponsiveness to methacholine. Respir.Med. 97:726-733.

63

4Cytoskeletal architecture differentially controls post-

transcriptional processing of IL-6 and IL-8 mRNA in

airway epithelial-like cellsExp Cell Res. 2006 May 15;312(9):1496-506.

Arjen van den Berga, b, , Jaime Freitasb, Filiz Kelesb, Mieke Snoeka, b, Jan van Marlec, Henk M.

Jansena and René Luttera, b

aDepartment of Pulmonology, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands bDepartment of Experimental Immunology, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands cDepartment of Electron Microscopy, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands

Chapter 4

64

AbstractAirway epithelial cells are critically dependent on an intact cytoskeleton for innate defense

functions. There are various pathophysiological conditions that affect the cytoskeletal

architecture. We studied the effect of cytoskeletal distortion in polarized airway epithelial-like

NCI-H292 cells on inflammatory gene expression, exemplified by interleukin(IL)-6 and IL-8.

Disruption of microtubule structure with vinblastin and of actin with cytochalasin D did not

affect TNF- -induced IL-6 and IL-8 gene transcription but stabilized IL-8 and IL-6 mRNA. In

line with previous studies, IL-8 mRNA stabilization was paralleled by hyperresponsive IL-8

production, but surprisingly, IL-6 production was reduced despite IL-6 mRNA stabilization.

Polysome profiling revealed that, in cells with a disrupted cytoskeleton, translational

efficiency of IL-6 mRNA was reduced, whereas that of IL-8 mRNA remained unaffected. Our

findings indicate that distortion of the cytoskeleton in airway epithelial cells differentially

affects both degradation and translation of IL-6 and IL-8 mRNA, modifying inflammatory

gene expression and thus their innate defense function.

IntroductionAirway epithelial cells perform multiple functions that are implicated in protecting the

airways from exogenous insults. These innate defense functions range from maintaining

structural integrity of both the mucus and epithelial cell layer to the vectorial release of

bactericidal proteins and inflammatory mediators. A high degree of cellular organization and

polarization is essential to perform these functions.

Cellular polarization depends for a large part on the structure of the cytoskeleton, that

comprises three entities: actin filaments, microtubules, and microfilaments [1-4]. The

cytoskeleton is a dynamic structure that is under constant rearrangement and can be affected

during processes such as cellular repair and viral or bacterial infection [5-11]. Given the

intricate role of the cytoskeleton in cellular polarization, which is essential for epithelial

functioning, it is likely that epithelial cells with an altered cytoskeleton function differently

from cells with an intact cytoskeleton.

A key function of airway epithelial cells is the production of pro-inflammatory

mediators such as the neutrophil attractant interleukin-8 (IL-8) and the cytokine IL-6, which

has both pro- as well as anti-inflammatory activities. Several studies have suggested a

relationship between modulation of the cytoskeleton and production of IL-8. Diesel exhaust

particles (DEP) taken up by airway epithelial cells result in decreased actin stiffness [12] and

concomitantly induce IL-8 production [13]. Similarly, stretch-induced deformation of the

Cytoskeleton and regulation of IL-6 and IL-8

65

cytoskeleton enhances the LPS-induced production of the rodent homologue of human IL-8,

MIP-2, from fetal rat lung cells [14]. In contrast, DEP suppressed the IL-6 release from

alveolar macrophages in mice [15].

More direct evidence for the involvement of the cytoskeleton in IL-8 production

comes from in vitro experiments by Shibata et al. [16]. Treatment of bronchial epithelial-like

BET-1A cells with either neutrophil elastase (NE) or vinblastin alters the organization of

microtubules and induces IL-8 production. The correlation between microtubule disruption

and increased IL-8 secretion is apparent from the inhibitory effect of the microtubule-

stabilizing agent taxol, although the underlying mechanism remained elusive. No direct link

between IL-6 production and cytoskeleton disruption has been described so far.

Our previous studies on the regulation of IL-8 and IL-6 production by NCI-H292

airway epithelial-like cells indicated that, besides transcriptional regulation, mRNA

degradation is a major means of regulating IL-8 and IL-6 mRNA expression [17-20].

Interestingly, cells with impaired IL-8 and IL-6 mRNA degradation display exaggerated IL-8

and IL-6 responses to pro-inflammatory stimuli, particularly reflected by steeper dose–

response curves [17,18]. Similar findings were obtained for primary bronchial epithelial cells

[20]. A link between mRNA degradation and the cytoskeleton was described earlier for IL-2

mRNA. IL-2 mRNA degradation was reduced after disruption of the actin cytoskeleton by

cytochalasin B in PBMCs [21].

Therefore, we hypothesized that disruption of the microtubule and actin network in

airway epithelial cells may lead to reduced IL-8 and IL-6 mRNA degradation which could

result in exaggerated IL-8 and IL-6 responses. We targeted the cytoskeleton in airway

epithelial cell-like NCI-H292 with specific reagents and assessed the IL-8 and IL-6 response

to TNF- , a pro-inflammatory stimulus known to be present locally in the airways from

patients with inflammatory airway disease [22]. Our results indicate that airway epithelial

cells with a disrupted microtubule or actin network display a reduced IL-8 mRNA degradation

paralleled by a hyperresponsive IL-8 production to TNF- . Surprisingly, even though IL-6

mRNA was stabilized to a similar extent as that of IL-8, IL-6 protein production was

suppressed by cytoskeleton disruption. This suppression was caused by a translational

repression of IL-6 mRNA as assessed by polysome profiling. These data reveal new insights

in the post-transcriptional regulation of IL-8 and IL-6 and underline the role of the

cytoskeleton in regulation of inflammatory gene expression at the post-transcriptional level.

Chapter 4

66


Cell culture


American Type Culture Collection (ATCC), Manassas, VA) was cultured and propagated as

described before [19]. Cultures were negative for mycoplasm contamination. For cytokine

release, 6 × 105 cells were plated and grown overnight in 500 l medium in 24-wells plates.

For isolation of RNA and nuclear extracts, 30 × 105 cells were plated and grown overnight in

2.5 ml in 6-wells plates. For confocal microscopy, 3 × 105 cells were plated and grown

overnight on round 12-mm diameter glass coverslips (Menzelgläser, Braunschweitz,

Germany) in 500 l medium in 24-wells plates. For polysome profiling, 18 × 106 cells in 30

ml medium were plated in a 141-cm2 dish and grown overnight to ~70% confluency. Cell

viability was tested by trypan blue (0.1%) exclusion.

Disruption of cytoskeleton

For microtubule disruption, cells were preincubated for 1 h with 5 M of vinblastin (Vb,

Sigma, St. Louis, MO), with or without 10 M of the microtubule-stabilizing agent taxol

(Sigma). For actin disruption, cells were preincubated for 1 h with 0.5 M of cytochalasin D

(CytD, Sigma), alone or in combination with 10 nM of the actin-stabilizing agent

jasplakinolide (Molecular Probes, Eugene, OR). To correct for the contribution of the

compound solvent DMSO, all treated or control cells were exposed to 0.1% (v/v) DMSO.

Confocal microscopy

Cells attached to coverslips were fixed in McDowell's fixative (4% (w/v) paraformaldehyde

and 1% (v/v) glutaraldehyde (both from Merck, Darmstadt, Germany) containing 0.1% (v/v)

Triton X-100 (Sigma)) for 15 min at 37°C. Cells were rinsed with PBST/BSA (phosphate-

buffered saline with 0.02% (v/v) Triton X-100 and 0.1% (w/v) bovine serum albumin fraction

V (BSA, ICN, Aurora, OH)) and incubated in 1% (w/v) NaBH4 (Sigma) in PBS for 20 min to

block autofluorescence. Then cells were rinsed and blocked for 30 min with 5% (w/v) BSA

with 0.1% Triton X-100 in PBS. Subsequently, cells were incubated for 1 h with anti- -

tubulin (0.5 g/ml, B5-1-2, Sigma), for 1 h with goat–anti-mouse–biotin (4 g/ml, E0433,

DAKO, Carpinteria, CA), for 30 min with streptavidin-Alexa Fluor 488 (2 g/ml, Molecular

Probes), Phalloidin-TexasRed (20 U/ml, Molecular Probes) and Hoechst 33342 fluorescent

dye (0.5 g/ml, Sigma). In between incubations, cells were washed 3 times in PBST/BSA. On


67

each slide, three randomly chosen areas containing ~20 cells were studied in detail with a

Leica SP2 confocal scanning laser microscope.


After cytoskeleton disruption, cells were exposed for 7 h to various doses of TNF- (rhTNF-

, R&D Systems, Minneapolis, MN, USA) up to 5 ng/ml. The amount of IL-6 and IL-8 in

culture supernatants was measured by sandwich ELISA, as described before [18, 20].


Nuclear extracts were isolated after 1-h stimulation with 5 ng/ml TNF- and 0.1 g LPS as

described [19, 23]. Protein concentrations were measured as described above. Five

micrograms of the nuclear extracts was incubated with 32P-labeled oligonucleotides at 4°C for

1 h and separated on a 4% nonreducing poly-acrylamide gel at slowly increasing voltages

(60–220 V). Bands were identified by supershift using 1 g of antibodies against p65 for

NF B, c-fos, and c-jun for AP-1, and C/EBP- for C/EBP (Santa Cruz Biotechnology Inc.,

Santa Cruz, CA) and by competition with cold probe. The intensity of the bands was

quantified using a phosphorimager. The following oligonucleotides were used in the EMSA:

NF B, 5 -TTGCAAATCGTGGAATTTCCTCTGACATAA-3 ;

AP-1, 5 -TTAAGTGTGATGACTCAGGTTTAA-3 ;

C/EBP, 5 -TTAAAGGACGTCACATTGCACAATCTTAATAA-3 .

Transfection of IL-6 and IL-8 promoter chloramphenicol acetyltransferase (CAT) constructs

NCI-H292 cells were grown to 70% confluence in 6-wells plates and transfected with 5 g of

CAT reporter vectors driven by the wild-type IL-8 [24] or IL-6 promoter [25], as described

[19, 23]. Twenty-four hours after transfection, cells were preincubated for 1 h with

cytoskeleton disrupting agents and consequently stimulated with 5 ng/ml TNF- for 18 h

before cell lysis. CAT concentration in the cell lysate was measured by CAT ELISA (Roche

Diagnostics, Mannheim, Germany) according to the manufacturer, and data were normalized

for total protein content.

mRNA half-life analysis

Cells were stimulated with TNF- (5 ng/ml) or LPS (0.1 g/ml) for 1 h before 5 g/ml

actinomycin D (Sigma-Aldrich) was added to block further transcription. Total RNA was

extracted with TriZol (Invitrogen) at 0, 40, and 80 min after actinomycin D addition. The

Chapter 4

68

amount of IL-6, IL-8, and GAPDH mRNA was determined by dot blotting and hybridization

with specific 32P-labeled probes for IL-6, IL-8, and GAPDH, which have extensively been

validated for specificity in our samples by Northern blot as described [19, 23]. Blots were

quantified using a phosphorimager, and variable loading was corrected for by expressing

mRNA levels relative to that of the housekeeping gene GAPDH. mRNA half-life was

calculated using linear regression.

Lysate preparation for polysome profiling

Cells were collected in 10 ml of trypsin–EDTA containing 200 g/ml cycloheximide.

Subsequently, 5 ml of cold medium was added to inactivate trypsin, 500 l of suspension was

set apart for recovery calculations, and cells were pelleted in preweighed tubes. Medium was

carefully aspirated, and tubes were weighed to determine the amount of cells harvested. Cells

were lysed in 5 weight volumes (e.g., 100 mg of cells in 500 l) of lysate buffer (250 mM

sucrose, 50 mM HEPES pH 7.4, 70 mM KAc, 5 mM MgCl2, 5 mM NaCl, 1 mM EGTA, 1

mM DTT, 200 g/ml cycloheximide, 0.4% Triton X-100, 1 mM PMSF and 20 U/ml

RNAguard) and vortexed before deoxycholate (5% w/v in PBS (pH 10)) was added to a final

concentration of 0.8%. The suspension was vortexed and centrifuged for 10 min at 10,000

rpm in an Eppendorf centrifuge for 2 min. The cleared lysate was either directly loaded on a

sucrose gradient or snap frozen in liquid nitrogen and stored at 80°C. The remaining pellet

was dissolved in Trizol for recovery calculations (Recovery control (RC) 1).

Preparation of sucrose gradients

Isokinetic sucrose gradients were made from 0.5 M and 1.2 M sucrose solutions containing 50

mM HEPES pH 7.4, 70 mM KAc, 5 mM MgCl2, 5 mM NaCl, 1 mM EGTA, 1 mM DTT, 200

g/ml cycloheximide, and 0.1% DEPC. Gradients were made using a 15 ml home-made

gradient mixer and a Gilson minipulse II peristaltic pump. Gradients were pumped into

Beckman 9/16 × 3.5 inch polyallomer centrifuge tubes and stored overnight at 4°C. Five

hundred microliters of lysate was layered on top of the gradients and centrifuged for 90 min at

39,000 rpm in a Beckman SW 41 rotor ( 190,000 × g). The remaining lysate was mixed with

1 ml Trizol for recovery calculations (RC2).


69

Fractionation of polysome profile

After centrifugation, the gradients were placed in a tube holder and a thin needle was slowly

inserted in the gradient to the bottom of the tube. The gradient solution was pumped out via an

Uvikon 930 UV monitor reading absorbance at 260 nm, and 500 l fractions were collected in

500 l of 8 M guanidine–isothiocyanate in 2 ml Eppendorf tubes. Eppendorf tubes were

vortexed and 750 l of 100% ethanol was added, and samples were left to precipitate

overnight at 20°C. One milliliter of Trizol was added to the Beckman centrifuge tubes to

dissolve material pelleted at bottom of the tubes (RC3). The following day, the precipitate was

spun down at 15,000 × g for 10 min. Pellets were dissolved in 1 ml Trizol, pooled as

indicated, and RNA was isolated and analyzed as described above.

To ensure valid comparison between experimental conditions, recovery was calculated

from the sum of all gradient fractions plus recovery controls, divided by the sample taken

from the cell suspension (normalized to a 100%). Recovery was typically around 70%.

Statistical analysis

Data were analyzed by independent samples t test or ANOVA combined with post hoc

Bonferroni test. mRNA half-life was estimated by linear regression. Differences were

considered significant at P < 0.05.

Results

Effect of vinblastin and cytochalasin D treatment on cytoskeleton structure

To visualize the effect of cytoskeleton-disrupting agents and their stabilizing counterparts by

confocal microscopy, cells were treated and fixed, followed by staining with anti- -tubulin for

microtubules and phalloidin for actin. In untreated NCI-H292 cells, microtubules were

organized in a dense network spreading out from the nucleus to the periphery of the cell (Fig.

1A). Actin was located mainly near the cell surface and was most dense in the area where

cells were attached to the coverslip and at the apical surface of cells (Fig. 1B).

A range of Vb concentrations was tested which showed that 5 M Vb was the minimal

concentration required to completely disrupt microtubules in all cells. After 1 h of incubation

with 5 M Vb, microtubule structure was lost, and only aggregates of tubulin were found (Fig.

1C). Coincubation with 10 M taxol prevented the disruption of microtubules by Vb (Fig.

Chapter 4

70

1E), whereas lower concentrations of taxol only partly prevented disruption. Taxol by itself

did not affect microtubule structure (not shown).

Actin clustered into large aggregates when cells were treated with 0.5 M or higher

concentrations of CytD (Fig. 1D). Clustering was not prevented by coincubation with 1 to 100

nM jasplakinolide (Fig. 1F), a promoter of actin polymerization. Preincubation with 100 nM

jasplakinolide 1 h before CytD treatment neither prevented formation of aggregates. Even

concentrations of 1 to 10 M jasplakinolide did not prevent CytD-induced formation of actin

aggregates but did interfere with binding of phalloidin to actin. No effect of jasplakinolide by

itself was observed on actin morphology. Neither Vb nor taxol affected the morphology of the

actin network, nor did CytD or jasplakinolide have any effect on microtubule structure.

Stimulation with 5 ng/ml TNF- neither altered the organization of microtubules or actin

within 7 h. Further, none of the treatments influenced cell viability as determined by trypan

blue exclusion after 7 h of incubation. Nuclear staining with Hoechst 33342 did not reveal

apoptotic nuclei.

Fig. 1. Confocal images of cytoskeleton disruption in NCI-H292 cells. Images are presented as optical sections with a pinhole setting of 1 airy disk, corresponding to approximately 0.4 m. In control cells, treated with 0.1% (v/v) DMSO, microtubules spread out as a dense network from the nucleus to the periphery of the cell (A). In the same cells, actin was mostly localized near the membrane (B). Upon treatment of cells for 1 h with 5 Mvinblastin (C), microtubule structure was lost, and aggregates of tubulin were formed, which was prevented by coincubation with 10 M taxol (E). Actin aggregated after 1 h of treatment of cells with 0.5 M cytochalasin D (D), which was not prevented by preincubation with 100 nM jasplakinolide (F).


71

Disruption of microtubule and actin networks lead to exaggerated IL-8 responses and

suppressed IL-6 responses

To determine the effect of cytoskeleton disruption on IL-8 and IL-6 production, NCI-H292

cells with a disrupted cytoskeleton were exposed to a range of TNF- for 7 h after which

levels of IL-8 and IL-6 were determined in the supernatant. Disruption of microtubules (Fig.

2A) led to an increased basal IL-8 release from 204 ± 41 pg/ml (mean ± SEM, n = 4, triplicate

samples) before disruption to 4258 ± 862 pg/ml after disruption (P < 0.01). The basal

secretion of IL-6 also appeared to increase by microtubule disruption, though to a much lesser

and nonsignificant extent (24.6 ± 10.4 pg/ml vs. 43.3 ± 11.2 pg/ml). Exposing cells to TNF-

showed markedly increased IL-8 dose–response curves for cells with disrupted microtubules,

indicating that these cells are hyperresponsive (Fig. 2A). When data were expressed as fold

increase over untreated cells (Fig. 2C), IL-8 production was increased with all concentrations

of TNF- , most apparent for the lowest concentrations of TNF- . Surprisingly, TNF- -

induced IL-6 production was markedly downregulated when microtubules were disrupted

(Fig. 2D), which was particularly evident at the highest dose of TNF- .

Both IL-8 and IL-6 responses were significantly (P < 0.05) normalized, although not

completely, by coincubation of Vb with 10 M taxol, which prevented disruption of the

microtubules. For IL-8 production, coincubation of Vb and taxol particularly reduced the fold

induction at the lowest dose of TNF- (Fig. 2C), whereas for IL-6 production, normalization

was most apparent at the highest doses (Fig. 2F). Thus, taxol normalizes the most pronounced

effects of vinblastin. Taxol by itself had no influence on IL-8 or IL-6 production. It is

noteworthy that treatment with 0.5 M Vb, which only partially disrupted microtubules, still

led to an exaggerated IL-8 response that was not significantly different from the response by

cells with completely disrupted microtubules.

Disruption of actin by 0.5 M CytD (Fig. 2B) also resulted in an increased basal IL-8

secretion from 660 ± 63 to 6828 ± 582 pg/ml (mean ± SEM, n = 4, triplicate samples) and an

increased responsiveness. As with Vb, the effect of CytD was most prominent at low doses of

TNF- (Fig. 2B). IL-6 production in response to TNF- was greatly reduced and to a much

larger extent than after microtubule disruption (Fig. 2E).

Chapter 4

72

Fig. 2. Cytoskeleton disruption causes exaggerated IL-8 responses and suppresses IL-6 responses to TNF- in NCI-H292 cells. NCI-H292 cells were preincubated with vehicle (0.1% (v/v) DMSO) (shaded squares), 5 M Vb (shaded triangles), 0.5 M Vb (inverted shaded triangles), 10 M taxol (inverted open triangles), or a combination of both 10 M taxol and 5 M Vb (open diamonds) (A, D) or with 0.5 M CytD (inverted shaded triangles) (B, E) for 1 h and subsequently stimulated with TNF- for 7 h. IL-6 and IL-8 were determined by ELISA. Panels C and F show the fold induction over control for each concentration of TNF- for IL-8 and IL-6 respectively. Legends for panel F are as depicted in panel C. Data are shown as mean ± SEM for 3 independent experiments (triplicate samples). ***P < 0.001 vs. Co, *P < 0.05 vs. Co, #P < 0.05 vs. Vb, ##P < 0.01 vs. Vb, ###P < 0.001 vs. Vb.

Jasplakinolide (100 nM) did not modify CytD-induced IL-8 or IL-6 responses (data

not shown), in agreement with the lack of effect on CytD-induced actin aggregation (Fig. 1F).

Taxol (10 M) did also not affect CytD-induced alterations of IL-8 or IL-6 responses (data not

shown). Taken together, these data indicate that disruption of actin and microtubule networks

led to hyperresponsive IL-8 production, which was particularly evident at low doses of TNF-

, and to suppression of IL-6 responses in NCI-H292 cells.

Intracellular concentrations of IL-6, as measured in cell lysates, were also decreased

after cytoskeleton disruption, excluding the possibility of a block in IL-6 secretion. No further

experiments were performed with Jasplakinolide because of its lack of effect on CytD-

induced actin disruption and IL-8 responses.


73

Altered IL-8 and IL-6 responses are not due to transcriptional regulation

The changes in IL-8 and IL-6 mRNA expression after cytoskeleton disruption might be

caused by both transcriptional and post-transcriptional events. To investigate the mechanism

underlying the exaggerated IL-8 and reduced IL-6 response after cytoskeleton disruption, we

first determined IL-8 and IL-6 mRNA expression levels. NCI-H292 cells were preincubated

with cytoskeleton-disrupting or -stabilizing reagents and left unstimulated or exposed to TNF-

for 30 min. Fig. 3A shows that treatment with CytD only increased levels of both IL-8 and

IL-6 mRNA, whereas other treatments did not affect IL-8 or IL-6 mRNA levels. In

combination with TNF- , a similar picture emerged for IL-8, whereas IL-6 mRNA was

slightly, but not significantly, upregulated by all treatments.

Transcription of the IL-8 gene in TNF- -exposed NCI-H292 cells is critically

dependent on NF B and to a lesser extent on AP-1 [19]. IL-6 gene transcription is mainly

dependent on C/EBP in NCI-H292 cells [23]. EMSAs were performed in order to evaluate

whether the exaggerated IL-8 response and reduced IL-6 response were due to changes in

nuclear recruitment and specific binding capacity of transcription factors NF B, AP-1, and

C/EPB, respectively. NCI-H292 cells were preincubated with cytoskeleton-disruptive agents

and their stabilizing counterparts for 1 h and left unstimulated or exposed for 20 min or 1 h to

TNF- before nuclear extracts were prepared. Specificity of the shifted bands, as indicated by

arrows in Fig. 3B, was determined using antibodies against p65 for NF B (left panel), c-Fos,

and c-Jun for AP-1 (middle panel), and C/EBP-b for C/EBP (right panel). NF B signals were

significantly increased 1 h after TNF- stimulation as compared to no stimulation (P < 0.001,

Fig. 3C, left panel), whereas AP-1 and C/EBP did not show a marked activation (Fig. 3C,

middle and right panel). Neither microtubule nor actin disruption led to a significant increase

of NF B, AP-1, or C/EBP DNA-binding activities in either TNF- -stimulated or

nonstimulated cells, nor did it change the migration pattern of the bands. Similar results were

obtained after 20 min of TNF- stimulation (not shown).

These results were confirmed using CAT-promotor constructs (Fig. 3D). There was no

significant effect of either vinblastin or CytD treatment on IL-8 or IL-6 promotor activity.

It is therefore unlikely that the exaggerated IL-8 and reduced IL-6 responses after

cytoskeleton disruption were due to changes in IL-8 or IL-6 gene transcription.

Chapter 4

74

Fig. 3. Altered IL-8 and IL-6 responses are not due to transcriptional regulation. (A) Levels of IL-8 and IL-6 mRNA. NCI-H292 cells were treated as indicated in the legend and as described in Fig. 2. Cells were stimulated with vehicle ( TNF- ) or 5 ng/ml TNF- (+TNF- ) for 30 min before RNA was extracted. RNA was dot blotted and hybridized with 32P-labeled IL-8, IL-6, and GAPDH probes. Signals were quantified on a phosphorimager, and IL-8 and IL-6 mRNA levels were normalized for variable loading using GAPDH mRNA levels. Data are shown from one experiment (mean ± SEM; duplicate samples) representative of two experiments. (B) Supershift, using antibodies as indicated, identified specific bands (indicated by arrows) of NF B, AP-1 and C/EBP EMSAs. (C) NCI-H292 cells were treated as indicated and stimulated with vehicle (Basal) or with 5 ng/ml TNF- (TNF) for 1 h before nuclear extracts were prepared. EMSAs were performed, and the signal of the specific bands was quantified with a phosphoimager. The signal for control cells stimulated with TNF- was arbitrarily set to one. Data represent the mean ± SEM of two independent experiments. (D) NCI-H292 cells were transfected with IL-8 and IL-6 promoter CAT constructs 24 h before disruption of the cytoskeleton as indicated. Consequently cells were stimulated for 18 h before cell lysis. CAT concentration was measured by ELISA and normalized for total protein. The signal for control cells stimulated with TNF-

was arbitrarily set to one. Data represent the mean ± SEM of two independent experiments.


75

IL-8 and IL-6 mRNA stability increases after cytoskeleton disruption

The lack of changes in transcriptional regulation of IL-8 and IL-6 in cells with a disrupted

cytoskeleton pointed to post-transcriptional regulation. We therefore determined the half-life

of IL-8 and IL-6 mRNA after cytoskeleton disruption. NCI-H292 cells were incubated with

disrupting agents for 1 h and subsequently stimulated for 1 h with TNF- . Next, actinomycin

D was added to arrest transcription, and cells were harvested after 0, 40, and 80 min. In

control cells, the half-life of IL-8 mRNA was 54 ± 8 min (mean ± SD, n = 3, triplicate

samples). Disruption of microtubules by Vb led to a 2.4-fold increase in IL-8 mRNA half-life

to 127 ± 11 min (P < 0.01, Fig. 4A). Coincubation with taxol, which prevented microtubule

disassembly and partly normalized the IL-8 response, resulted in a near normalization of IL-8

mRNA half-life to 62 ± 11 min (P < 0.05). Taxol by itself had no significant influence on IL-8

mRNA half-life.

Fig. 4. Half-life of IL-8 and IL-6 mRNA is increased after cytoskeleton disruption in NCI-H292 cells. NCI-H292 cells were treated (A, C) with 0.1% (v/v) DMSO (shaded squares), 5 M Vb (shaded triangles), 10 M taxol (inverted open triangles), or a combination of both (open diamonds) or (B, D) with 0.5 M CytD (inverted shaded triangles) for 1 h and subsequently stimulated with 5 ng TNF- /ml for 1 h, before 5 g/ml actinomycin D was added. RNA was harvested at 0, 40, and 80 min after adding actinomycin D and dot blotted. Blots were hybridized with 32P-labeled IL-8, IL-6, and GAPDH probes and quantified with a phosphorimager. IL-8 (A, B) and IL-6 (C, D) mRNA levels were normalized over that of GAPDH. Data are shown as mean ± SEM of 3 independent experiments (triplicate samples). *P < 0.05 vs. control as determined by ANOVA and Bonferroni post test.

Chapter 4

76

Disruption of actin with CytD also resulted in a prolonged half-life of IL-8 mRNA (Fig. 4B),

which was increased from 55 ± 11 to 203 ± 13 min (P < 0.01, n = 3). These results show that

exaggerated IL-8 protein responses upon microtubule or actin disruption were paralleled by a

reduced IL-8 mRNA degradation. .

Surprisingly, taken the fact that cytoskeleton disruption leads to a suppressed IL-6

response, IL-6 mRNA was stabilized to a similar extent as that of IL-8 after both microtubule

and actin disruption (Figs. 4C and D). The Vb-induced stabilization of IL-6 mRNA seemed

relatively insensitive for taxol, though even if it had normalized IL-6 mRNA decay, that

would not explain the normalization of IL-6 protein production.

These results indicate that the decreased IL-6 production was due to a post-

transcriptional mechanism downstream of mRNA stabilization.

Cytoskeleton disruption leads to transcript specific repression of translation

Taken together the fact that IL-6 protein production was suppressed, IL-6 gene transcription

was not affected, and the IL-6 mRNA degradation was inhibited, we hypothesized that IL-6

production was suppressed at the translational level. Therefore, we employed the technique of

polysome fractionation to assess the ribosomal load of the IL-6 mRNA under conditions of

cytoskeleton disruption. Fig. 5 depicts the ribosomal load of IL-8 (A, B) and IL-6 (C, D)

mRNA (left y-axis) plotted against a typical A260 read-out. Cells were treated with

cytoskeleton-disrupting or -stabilizing agents for 1 h and subsequently stimulated for 1 h with

TNF- before lysates were prepared and loaded on a sucrose gradient. After centrifugation,

gradients were fractionated from the bottom up and subsequently pooled, so fraction 1

contains the mRNAs loaded with 8 or more ribosomes, and fraction 6 contains free mRNA.

Disruption of microtubules or actin clearly shifted the IL-6 mRNA to the fractions

containing fewer ribosomes, indicating a reduced IL-6 mRNA translation. The translational

inhibition of IL-6 mRNA after microtubule disruption was partly but not fully prevented by

coincubation with taxol, in line with the partial normalization of IL-6 protein production.

Taxol by itself did not have any effect on the distribution of IL-6 mRNA (data not shown).

These results indicate that upon cytoskeleton disruption, IL-6 was translationally inhibited.


77

Fig. 5. IL-6 translation is inhibited after cytoskeleton disruption. NCI-H292 cells were treated (A,C) with 0.1% (v/v) DMSO (shaded squares), 5 M Vb (shaded triangles), a combination of both 5 M Vb and 10 M taxol (open diamonds) or (B, D) with 0.5 M CytD (inverted shaded triangles) for 1 h and subsequently stimulated with 5 ng TNF- /ml for 1 h, before cell lysates were prepared and loaded on sucrose gradients. Gradients were centrifuged for 90 min at 190,000 × g and fractionated through an A260 monitor. A typical A260 profile is depicted (solid line). RNA was isolated and subsequently pooled into 6 fractions as indicated (fractions 1–6, separated by dashed line), representing the number of ribosomes bound to the IL-8 (A, B) and IL-6 (C, D) mRNAs as indicated. The pooled fractions were dot blotted and quantified as described in Fig. 3. Data represent results of a single experiment representative for at least 3 independent experiments.

As a control, we also analyzed the polysomal distribution of IL-8 mRNA after

cytoskeleton disruption, by stripping the blots and hybridizing with an IL-8 probe. IL-8

mRNA did not shift up or down, but the total amount of IL-8 mRNA in the fractions was

increased after cytoskeleton disruption (approximately 1.6-fold over control). Again taxol did

not influence the sedimentation pattern of IL-8 mRNA (data not shown), and overall, IL-8 did

not seem to be controlled at the translational level.

These results indicate that cytoskeleton disruption leads to silencing of IL-6

production at the translational level.

Chapter 4

78

DiscussionThe present study shows that an intact cytoskeleton is important for controlling inflammatory

gene expression in airway epithelial cells at the post-transcriptional level. Disruption of

microtubules and of actin led to stabilization of both IL-6 and IL-8 mRNA and concomitantly

reduced translational efficiency of IL-6 mRNA, whereas that of IL-8 remained unaffected.

This led to an exaggerated IL-8 and a reduced IL-6 response to TNF- , which indicates that

conditions that affect the cytoskeletal architecture may change inflammatory responses.

Our conclusions rely on the specificity of the reagents vinblastin (Vb) and

cytochalasin D (CytD), affecting microtubules and actin respectively. Indeed, Vb specifically

disturbed microtubule morphology and CytD that of actin, where Vb had no effect on actin

and CytD had no effect on microtubules. Moreover, taxol, which stabilized microtubules, also

prevented the Vb-induced stabilization of IL-8 mRNA and normalized IL-6 and IL-8 protein

production indicating that the observed effects were a direct consequence of microtubule

disruption. It is noteworthy that taxol by itself did not affect IL-8 or IL-6 responses, indicating

that IL-6 and IL-8 gene expression does not depend on microtubule dynamics, but rather on

an intact microtubule network.

Jasplakinolide, which promotes actin polymerization, did not prevent CytD-induced

actin disruption nor the effects on IL-6 and IL-8 gene expression but did bind to actin as

followed from reduced phalloidin staining [26]. As taxol did not prevent CytD-induced

alterations in IL-6 or IL-8 production (data not shown), it is unlikely that actin disruption

concomitantly affects microtubule structure, leading to the observed effects on IL-8 and IL-6

responses. Despite the distinct effects of Vb and CytD, both reagents exerted a similar effect

on IL-6 and IL-8 expression. A similar phenomenon was observed in rat alveolar type II cells,

in which both colchicine-induced microtubule disassembly and CytD-induced actin disruption

led to a decrease in levels of surfactant protein mRNA [27].

Vb and CytD treatment led to an increase in IL-6 and IL-8 mRNA stability. It was

shown by Henics et al. [21] that distortion of the actin architecture was paralleled by a

stabilization of IL-2 mRNA. IL-2, IL-6, and IL-8 belong to the family of early response genes,

the mRNAs of which contain AUUUA repeats or AU-rich elements (AREs) in their 3 -

untranslated region (3 -UTR). These AREs target mRNAs for rapid degradation, which is

thought to be under control of transacting factors. Henics et al. [21] showed that AUUUA-

repeat binding proteins (AUBPs) interact with actin, and that actin disruption was paralleled

by an increased binding of these AUBPs to AUUUA sequences. However, the identity and

specific functions of these proteins are still unknown. Our results indicate that distortion of


79

microtubules may affect similar mechanisms. In that context, it is of interest that Antic and

Keene [28] have shown that the family of ELAV proteins, which are also AUBPs involved in

mRNA stability, are present in mRNP particles associated with microtubules.

Also with respect to translational control, both Vb and CytD exerted similar effects,

but the effect on IL-6 differed from that on IL-8. The reduced IL-6 secretion may have come

about by blocking the release of de novo-synthesized IL-6. However, there was no

intracellular accumulation of IL-6. Similarly, an IL-6 isoform may have been released that

may not have been detected by our ELISA. However, Northern blotting did not reveal

alternative splicing of IL-6 mRNA, excluding the production of an alternative IL-6 isoform.

Together with a lack of effect on IL-6 transcription, this points to a role for the cytoskeleton in

translational control of IL-6 mRNA. In contrast, the translational efficiency of IL-8 was not

affected by cytoskeleton distortion.

A number mechanisms may explain the selective silencing of IL-6 after cytoskeleton

distortion. First, IL-6 mRNA may be bound by specific proteins impeding its translation.

AREs have also been implicated in translational efficiency, for example, by the AUBP TIA-1

[29]. ARE-containing genes have been divided into 5 clusters depending on the number of

motifs in the ARE stretch. IL-8 belongs to cluster II, whereas IL-6 belongs to cluster IV [30].

This may explain the difference in translational regulation of IL-6 and IL-8 after cytoskeleton

disruption. It is also possible that other regulatory sequences in the 3 -UTR of IL-6 mRNA are

responsible for inhibition of translation. Second, the cytoskeleton is involved in translocation

of mRNAs to distinct cellular compartments (for review, see [31]). IL-6 mRNA may be

translated at a different cellular location than IL-8, and cytoskeleton disruption may impede

its proper translocation, resulting in a decreased rate of translation.

Translational regulation of IL-6 has not been described in lung epithelial cells before

and is in general a poorly studied mechanism. Only one previous report has shown that, in

activated macrophages, IL-6 translation can be downregulated. The decreased IL-6 translation

in this system was due to inhibition of HSP-90 by geldanamycin [32]. However, HSP-90 does

not seem to be expressed in bronchial epithelium [33], rendering it unlikely that a similar

mechanism plays a role in our system.

Taken together, our studies provide further support for the role of the cytoskeleton in

the control of mRNA degradation and mRNA translation. An intact cytoskeleton ensures a

well-controlled and thus limited production of inflammatory mediators, whereas the distortion

of the cytoskeleton results in either exaggerated or reduced mediator production.

Chapter 4

80

The conditions that were applied here induced relatively large effects on the cytoskeletal

morphology. Pathophysiologically relevant conditions may lead to smaller effects on

microtubules and actin. Therefore, it is of interest that a low dose of vinblastin, which led to

partial microtubule disruption, had comparable effects on IL-8 and IL-6 production as seen

with higher doses of Vb, that gave complete microtubule disruption. This suggests already

small morphological changes in the microtubule network exert a significant impact on IL-6

and IL-8 production.

The increased IL-8 production and decreased IL-6 production after cytoskeleton

disruption may have a profound effect on inflammatory responses in vivo. IL-8 plays an

important role in the attraction of neutrophils, whereas IL-6 has been described to have anti-

inflammatory properties in the lung, including inhibition of neutrophil recruitment [34-37].

Thus, the opposite effects of cytoskeleton disruption on IL-8 and IL-6 production may lead to

a marked neutrophilia and concomitant lung damage. It remains to be determined how

cytoskeletal disruption affects expression of other genes, but it may affect physiology at large

as follows from effects on surfactant proteins A-C [27], uPAR [38], Gro- [39], nerve growth

factor [40], and glucokinase [41] in different cell types through various mechanisms.

In conclusion, the cytoskeleton of airway epithelial cells controls inflammatory gene

expression by two post-transcriptional processes, thus affecting both quantitative as well as

qualitative regulation of inflammatory responses. There are a large number of

pathophysiological conditions that are known to affect cytoskeletal architecture, and thus, the

effects described here may relate to a large variety of conditions. This study also clearly

indicates that levels of a specific mRNA do not predict the amount of protein produced, as

translational control is not to be neglected.

Acknowledgments The authors would like to acknowledge Professor Wout Lamers, Dr. Formijn van Hemert, and

Dr. Adri Thomas for the expert advice on polysome profiling. We also thank Drs. Kris

Reedquist and Theo Out for critical reading of the manuscript. This work was supported by

the Netherlands Asthma Foundation; Contract grant number: 99.27.


81

References [1] G. Guadiz, L.A. Sporn, R.A. Goss, S.O. Lawrence, V.J. Marder and P.J. Simpson-Haidaris, Polarized secretion of fibrinogen by lung epithelial cells, Am. J. Respir. Cell Mol. Biol. 17 (1997), pp. 60–69. [2] D. Hofer, T. Jons, J. Kraemer and D. Drenckhahn, From cytoskeleton to polarity and chemoreception in the gut epithelium, Ann. N. Y. Acad. Sci. 859 (1998), pp. 75–84. [3] A. Vaezi, C. Bauer, V. Vasioukhin and E. Fuchs, Actin cable dynamics and Rho/Rock orchestrate a polarized cytoskeletal architecture in the early steps of assembling a stratified epithelium, Dev. Cell 3 (2002), pp. 367–381. [4] A.S. Yap and S.W. Manley, Microtubule integrity is essential for apical polarization and epithelial morphogenesis in the thyroid, Cell Motil. Cytoskeleton 48 (2001), pp. 201–212. [5] M.R. Baldwin and J.T. Barbieri, The type III cytotoxins of Yersinia and Pseudomonas aeruginosa that modulate the actin cytoskeleton, Curr. Top. Microbiol. Immunol. 291 (2005), pp. 147–166. [6] B.A. Cowell, D.J. Evans and S.M. Fleiszig, Actin cytoskeleton disruption by ExoY and its effects on Pseudomonas aeruginosa invasion, FEMS Microbiol. Lett. (2005). [7] D.G. Guiney and M. Lesnick, Targeting of the actin cytoskeleton during infection by Salmonella strains, Clin. Immunol. 114 (2005), pp. 248–255. [8] P. Jackson and A.J. Bellett, Reduced microfilament organization in adenovirus type 5-infected rat embryo cells: a function of early region 1a, J. Virol. 55 (1985), pp. 644–650. [9] N.L. Jones, J.C. Lewis and B.A. Kilpatrick, Cytoskeletal disruption during human cytomegalovirus infection of human lung fibroblasts, Eur. J. Cell Biol. 41 (1986), pp. 304–312. [10] R.K. Shaw, K. Smollett, J. Cleary, J. Garmendia, A. Straatman-Iwanowska, G. Frankel and S. Knutton, Enteropathogenic Escherichia coli type III effectors EspG and EspG2 disrupt the microtubule network of intestinal epithelial cells, Infect. Immun. 73(2005), pp. 4385–4390. [11] C.M. Waters, P.H. Sporn, M. Liu and J.J. Fredberg, Cellular biomechanics in the lung, Am. J. Physiol.: Lung Cell. Mol. Physiol. 283 (2002), pp. L503–L509. [12] B. Doornaert, V. Leblond, S. Galiacy, G. Gras, E. Planus, V. Laurent, D. Isabey and C. Lafuma, Negative impact of DEP exposure on human airway epithelial cell adhesion, stiffness, and repair, Am. J. Physiol.: Lung Cell. Mol. Physiol. 284 (2003), pp. L119–L132. [13] S. Boland, A. Baeza-Squiban, T. Fournier, O. Houcine, M.C. Gendron, M. Chevrier, G. Jouvenot, A. Coste, M. Aubier and F. Marano, Diesel exhaust particles are taken up by human airway epithelial cells in vitro and alter cytokine production, Am. J. Physiol. 276 (1999), pp. L604–L613. [14] E. Mourgeon, N. Isowa, S. Keshavjee, X. Zhang, A.S. Slutsky and M. Liu, Mechanical stretch stimulates macrophage inflammatory protein-2 secretion from fetal rat lung cells, Am. J. Physiol.: Lung Cell. Mol. Physiol.279 (2000), pp. L699–L706. [15] K. Amakawa, T. Terashima, T. Matsuzaki, A. Matsumaru, M. Sagai and K. Yamaguchi, Suppressive effects of diesel exhaust particles on cytokine release from human and murine alveolar macrophages, Exp. Lung Res. 29(2003), pp. 149–164. [16] Y. Shibata, H. Nakamura, S. Kato and H. Tomoike, Cellular detachment and deformation induce IL-8 gene expression in human bronchial epithelial cells, J. Immunol. 156 (1996), pp. 772–777. [17] A. van den Berg, M. Kuiper, M. Snoek, W. Timens, D.S. Postma, H.M. Jansen and R. Lutter, Interleukin-17 induces hyperresponsive interleukin-8 and interleukin-6 production to tumor necrosis factor-alpha in structural lung cells, Am. J. Respir. Cell Mol. Biol. 33 (2005), pp. 97–104. [18] M. van Wissen, M. Snoek, B. Smids, H.M. Jansen and R. Lutter, IFN-gamma amplifies IL-6 and IL-8 responses by airway epithelial-like cells via indoleamine 2,3-dioxygenase, J. Immunol. 169 (2002), pp. 7039–7044. [19] T. Roger, T. Out, N. Mukaida, K. Matsushima, H. Jansen and R. Lutter, Enhanced AP-1 and NF-kappaB activities and stability of interleukin 8 (IL-8) transcripts are implicated in IL-8 mRNA superinduction in lung epithelial H292 cells, Biochem. J. 330 (1998) (Pt. 1), pp. 429–435. [20] R. Lutter, S. Loman, M. Snoek, T. Roger, T.A. Out and H.M. Jansen, IL-6 protein production by airway epithelial(-like) cells disabled in IL-6 mRNA degradation, Cytokine 12 (2000), pp. 1275–1279. [21] T. Henics, E. Nagy and J. Szekeres-Bartho, Interaction of AU-rich sequence binding proteins with actin: possible involvement of the actin cytoskeleton in lymphokine mRNA turnover, J. Cell. Physiol. 173 (1997), pp. 19–27. [22] P. Bresser, T.A. Out, L. van Alphen, H.M. Jansen and R. Lutter, Airway inflammation in nonobstructive and obstructive chronic bronchitis with chronic haemophilus influenzae airway infection. Comparison with noninfected patients with chronic obstructive pulmonary disease, Am. J. Respir. Crit. Care Med. 162 (2000), pp. 947–952. [23] T. Roger, T.A. Out, H.M. Jansen and R. Lutter, Superinduction of interleukin-6 mRNA in lung epithelial H292 cells depends on transiently increased C/EBP activity and durable increased mRNA stability, Biochim. Biophys. Acta 1398 (1998), pp. 275–284.

Chapter 4

82

[24] N. Mukaida, Y. Mahe and K. Matsushima, Cooperative interaction of nuclear factor-kappa B- and cis-regulatory enhancer binding protein-like factor binding elements in activating the interleukin-8 gene by pro-inflammatory cytokines, J. Biol. Chem. 265 (1990), pp. 21128–21133. [25] T.A. Libermann and D. Baltimore, Activation of interleukin-6 gene expression through the NF-kappa B transcription factor, Mol. Cell. Biol. 10(1990), pp. 2327–2334. [26] M.R. Bubb, A.M. Senderowicz, E.A. Sausville, K.L. Duncan and E.D. Korn, Jasplakinolide, a cytotoxic natural product, induces actin polymerization and competitively inhibits the binding of phalloidin to F-actin, J.Biol. Chem. 269 (1994), pp. 14869–14871. [27] J.M. Shannon, T. Pan, K.E. Edeen and L.D. Nielsen, Influence of the cytoskeleton on surfactant protein gene expression in cultured rat alveolar type II cells, Am. J. Physiol. 274 (1998), pp. L87–L96. [28] D. Antic and J.D. Keene, Messenger ribonucleoprotein complexes containing human ELAV proteins: interactions with cytoskeleton and translational apparatus, J. Cell Sci. 111 (1998) (Pt. 2), pp. 183–197. [29] M. Piecyk, S. Wax, A.R. Beck, N. Kedersha, M. Gupta, B. Maritim, S. Chen, C. Gueydan, V. Kruys, M. Streuli and P. Anderson, TIA-1 is a translational silencer that selectively regulates the expression of TNF-alpha, EMBO J. 19 (2000), pp. 4154–4163. [30] T. Bakheet, M. Frevel, B.R. Williams, W. Greer and K.S. Khabar, ARED: human AU-rich element-containing mRNA database reveals an unexpectedly diverse functional repertoire of encoded proteins, NucleicAcids Res. 29 (2001), pp. 246–254. [31] M. Lopez de Heredia and R.P. Jansen, mRNA localization and the cytoskeleton, Curr. Opin. Cell Biol. 16(2004), pp. 80–85. [32] S. Wax, M. Piecyk, B. Maritim and P. Anderson, Geldanamycin inhibits the production of inflammatory cytokines in activated macrophages by reducing the stability and translation of cytokine transcripts, Arthritis Rheum. 48 (2003), pp. 541–550. [33] J.K. Myung, K. Krapfenbauer, R. Weitzdoerfer, A. Peyrl, M. Fountoulakis and G. Lubec, Expressional pattern of chaperones in neuronal, glial, amnion, mesothelial, and bronchial epithelial cell lines, Mol. Genet. Metab. 80 (2003), pp. 444–450. [34] T.R. Ulich, S. Yin, K. Guo, E.S. Yi, D. Remick and J. del Castillo, Intratracheal injection of endotoxin and cytokines: II. Interleukin-6 and transforming growth factor beta inhibit acute inflammation, Am. J. Pathol. 138(1991), pp. 1097–1101. [35] H. Tilg, C.A. Dinarello and J.W. Mier, IL-6 and APPs: anti-inflammatory and immunosuppressive mediators, Immunol. Today 18 (1997), pp. 428–432. [36] W. Chen, E.A. Havell, F. Gigliotti and A.G. Harmsen, Interleukin-6 production in a murine model of Pneumocystis carinii pneumonia: relation to resistance and inflammatory response, Infect. Immun. 61 (1993), pp. 97–102. [37] L.E. Bermudez, M. Wu, M. Petrofsky and L.S. Young, Interleukin-6 antagonizes tumor necrosis factor-mediated mycobacteriostatic and mycobactericidal activities in macrophages, Infect. Immun. 60 (1992), pp. 4245–4252. [38] U. Bayraktutan and P. Jones, Expression of the human gene encoding urokinase plasminogen activator receptor is activated by disruption of the cytoskeleton, Exp. Cell Res. 221 (1995), pp. 486–495. [39] Z.H. Nemeth, E.A. Deitch, M.T. Davidson, C. Szabo, E.S. Vizi and G. Hasko, Disruption of the actin cytoskeleton results in nuclear factor-kappaB activation and inflammatory mediator production in cultured human intestinal epithelial cells, J. Cell. Physiol. 200 (2004), pp. 71–81. [40] C. Baudet, P. Naveilhan, F. Jehan, P. Brachet and D. Wion, Expression of the nerve growth factor gene is controlled by the microtubule network, J. Neurosci. Res. 41 (1995), pp. 462–470. [41] G.W. Beresford and L. Agius, Cytochalisin D exerts stimulatory and inhibitory effects on insulin-induced glucokinase mRNA expression in hepatocytes, Mol. Cell. Biochem. 139 (1994), pp. 177–184.

83

5Dexamethasone counteracts IL-17-induced IL-6 and IL-8

mRNA stabilization in structural lung cells.Manuscript in preparation

Arjen van den Bergab, Mathys Kuiperab, Mieke Snoekab, Henk M. Jansena and René Lutterab

Department of Pulmonologya and Laboratory of Experimental Immunologyb, Academic Medical Center,

University of Amsterdam, Amsterdam

Chapter 5

84

Abstract

IL-17 is found at elevated levels in airway secretions of asthma patients. IL-17 is considered a

pro-inflammatory cytokine, that can synergize with other stimuli to potentiate inflammatory

responses. We previously found that IL-17 amplified TNF- -induced IL-6 and IL-8

production by airway epithelial cells and fibroblasts by reducing the degradation of their

respective mRNAs. As corticosteroids can accelerate the rate of mRNA degradation in airway

epithelial cells, we hypothesized that dexamethasone counteracts the synergistic effect of IL-

17. Dexamethasone markedly suppressed the IL-17 potentiated IL-6 and IL-8 production in

both NCH-H292 epithelial cells and MRC-5 fibroblasts by accelerating mRNA degradation.

However, the synergistic effect of TNF- and IL-17 was not fully abrogated. Fibroblasts were

relatively unsensitive to inhibition by dexamethasone compared to epithelial cells. In

conclusion, IL-17 dampens the inhibitory effect of dexamethasone by modulating mRNA

stability.

Introduction

The T-cell cytokine IL-17 is emerging as an important player in inflammation in chronic

inflammatory diseases such as asthma [1-4], rheumatoid arthritis [5-9], and inflammatory

bowel disease [10]. In asthma patients, the number of IL-17-positive cells in sputum BAL

fluid are increased [4], and the levels of IL-17 in sputum correlate with the severity of the

disease [11] and with airway hyperresponsiveness [1]. In a mouse model for allergic asthma,

treatment with an anti-IL-17 antibody decreased pulmonary neutrophilia [3]. Furthermore,

intratracheal instillation of human IL-17 selectively recruited neutrophils into rat airways,

which was sensitive to inhibition by corticosteroids [12]. Thus IL-17 may in part be

responsible for the high levels of the chemoattractant IL-8 and increased numbers of

neutrophils detected in airway secretions from patients with severe asthma [13,14].

In contrast to the specific cells that produce IL-17, its receptor is expressed ubiquitously. A

number of in vitro studies have addressed the role of IL-17 in the production of inflammatory

mediators by lung structural cells. IL-17 has been shown to induce expression of interleukin

(IL)-6, granulocyte-colony-stimulating factor, the chemoattractants granulocyte chemotactic

protein (GCP)-2, growth-related oncogene (GRO)-alpha and interleukin-8 [12,15-18] in lung

epithelial cells. Whereas IL-17 alone only modestly stimulates the release of these pro-

Dexamethasone accelerates mRNA degradation

85

inflammatory mediators in combination with other pro-inflammatory stimuli, such as TNF- ,

LPS and IFN-γ, there is synergy leading to amplified mediator responses [15,19]. We have

recently shown that the synergy between IL-17 and TNF- on the IL-6 and IL-8 responses by

lung structural cells does not involve transcription, but rather post-transcriptional regulation;

i.e. a reduced IL-6 and IL-8 mRNA degradation [19].

Given the correlation between IL-17 and the severity of asthma, it has been questioned

whether the relative insensitivity to corticosteroid treatment in severe asthmatics may be

related to IL-17. Contradictory reports have been published on the effect of corticosteroids in

IL-17 exposed bronchial epithelial cells in vitro. Jones and Chan reported that dexamethasone

(Dex) did not inhibit IL-17-induced IL-8 release in primary bronchial epithelial cells [15]. On

the other hand, Laan et al. [12] and Prause et al. [18] showed that IL-17-induced IL-8 release

was inhibited by Dex in the16-HBE cell line, and in vivo in rat lungs. In primary lung

fibroblasts, Dex was reported to inhibit IL-17 induced IL-6 and Gro- production [4].

Previous studies [20] indicated that dexamethasone inhibited IL-8 production by accelerating

IL-8 mRNA degradation in primary airway epithelial cells rather than by affecting gene

transcription. We hypothesized that Dex could counteract the IL-17-induced IL-6 and IL-8

mRNA stabilization and thus suppress the synergy between IL-17 and TNF-α on IL-6 and IL-

8 responses by airway epithelial cells and fibroblasts. We found that Dex suppressed the IL-8

and IL-6 production by IL-17, either or not in combination with TNF- , by accelerating the

decay of their respective mRNA in both lung epithelial NCI-H292 cells and MRC-5 lung

fibroblasts. Even though the amount of IL-6 and IL-8 secretion was potently reduced in the

presence of Dex, IL-17 still synergized with TNF- to some extent giving rise to an enhanced

IL-6 and IL-8 production.


Cell culture



described before [21,22]. For IL-6 and IL-8 production, 3x105 cells were plated and grown

overnight in 500 μl in 24-wells plates. For isolation of mRNA and nuclear extracts, 15x105

cells were plated and grown overnight in 2.5 ml in 6-wells plates. Primary bronchial epithelial

cells (NHBE, Cambrex Bio Science Verviers, Belgium) were cultured and propagated as

Chapter 5

86

recommended by the supplier. Of these cells, 0.2x105 and 1x105 were plated in 48- and 12-

wells plates for measurement of cytokine production and mRNA analyses, respectively. Cells

were used between passage 3 and 5.

The human lung tissue derived fibroblast lines MRC-5 (ATCC CCL 171) was cultured and

propagated as recommended by the supplier. For cytokine release and isolation of RNA,

2.5x105 cells/ml were plated and grown overnight in 250 μl in 48 wells plates or in 1 ml in 12-

wells plates, respectively.


Cells were exposed for 18 hours to doses of TNF- (rhTNF- , R&D Systems, Minneapolis,

MN), IL-17 (rhIL-17, R&D Systems) and Dex (Pharmacy, AMC, Amsterdam) up to 5 ng/ml,

100 ng/ml and 4 M respectively. The amount of IL-6 and IL-8 in culture supernatants was

measured by sandwich ELISA, as described before [23].

mRNA analysis

Cells were stimulated with IL-17 (10 ng/ml), TNF- (5 ng/ml), and Dex (4 M). Total RNA

was extracted with TriZol (Invitrogen, Paisley, UK) and the amount of IL-6, IL-8 and

GAPDH mRNA was determined by dotblotting and hybridization with specific 32P-labelled

probes for IL-6, IL-8 and GAPDH, which have been extensively validated for specificity in

our samples by Northern blot as described [21,22]. Blots were quantified using a

phosphorimager and variable loading was corrected for by expressing mRNA levels relative

to that of the housekeeping gene GAPDH. mRNA decay experiments were performed 1, 3 and

5 hours after stimulation by blocking gene transcription with 5 g/ml actinomycin-D

(Boehringer Mannheim). Note that, where applicable, Dex was added at 4 M final

concentration 15 minutes before the addition of Act-D. After various periods of time,

remaining mRNA was determined as described above.


Nuclear extracts were obtained after 1 hr stimulation with 5 ng/ml TNF- , 10 ng/ml IL-17,

and 4 M Dex as described [21,22]. Protein contents was measured using a protein assay kit

(Biorad, Hercules, CA). Two μg protein of the nuclear extracts were incubated with 32P-

labeled oligonucleotides at 4°C for 1 h and separated on a 4% nonreducing poly-acrylamide

gel at slowly increasing voltages (60-220V). Bands were identified by cold oligo competition

and by supershift using 1 μg of antibodies against p65 for NF-κB, c-fos and c-jun for AP-1,


87

and C/EBP-β (Santa Cruz Biotechnology Inc., Santa Cruz, CA). The intensity of the bands

was quantified using a phosphorimager. The following oligonucleotides were used in the

EMSA:

NF-κB, 5’-TTGCAAATCGTGGAATTTCCTCTGACATAA-3’;

AP-1, 5’-TTAAGTGTGATGACTCAGGTTTAA-3’;

C/EBP, 5’-TTAAAGGACGTCACATTGCACAATCTTAATAA-3’.

Transfection of IL-6 and IL-8 promoter chloramphenicol acetyltransferase (CAT) constructs

NCI-H292 cells were grown to 70% confluence in 6-wells plates and transfected with 5 μg of

CAT reporter vectors driven by the wildtype IL-8 [24] or IL-6 promoter [25], as described

[21,22]. Cells were stimulated with 5 ng/ml TNF- , 10 ng/ml IL-17, 4 M Dex or in

combination, 24 h after transfection and 7 h before cell CAT mRNA was isolated and

analyzed as described above. Data were expressed CAT mRNA levels were normalized using

GAPDH expression.


IL-8 and IL-6 protein production and EMSA data were analyzed by independent samples t-

test or ANOVA combined with post-hoc Bonferroni test. mRNA half-life was estimated by

linear regression. Differences were considered significant at P 0.05. If error bars are not

visible they are contained within the symbol.

Results

IL-17 and TNF-α-induced production of IL-8 and IL-6 responses is suppressed by

Dexamethasone

To asses the susceptibility of NCI-H292 lung epithelial cells and MRC-5 lung fibroblasts to

inhibition of IL-8 production by Dex, cells were exposed to 5 ng/ml TNF- , 10 ng/ml IL-17

or the combination of IL-17 and TNF- with 0, 4 nM, 40 nM, 400 nM and 4 μM Dex.

Chapter 5

88

0.000 0.004 0.040 0.400 4.0000

100

200

300

400

500

*

*

*

*

***

*

*

*

*

** **

Dexamethasone (μM)

0.000 0.004 0.040 0.400 4.0000

10

20

30

40

** ** **

** **** ***** *** *****

IL-17IL-17+TNF-αTNF-α

Dexamethasone (μM)

IL-8

(ng/

ml)

0.000 0.004 0.040 0.400 4.0000.0

2.5

5.0

7.5

10.0

12.5

**

**

0.000 0.004 0.040 0.400 4.0000.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

**** **

A B

Figure 1: IL-8 production is inhibited by dexamethasone. NCI-H292 cells (A) and MRC-5 fibroblasts (B) were exposed to increasing doses of Dex (indicated at the x-axis) and exposed to IL-17 (grey bars), TNF- (black bars) or a combination of both (white bars) for 18 hrs. For clarity of the figure, the inserts show the effect of Dex on cells stimulated with IL-17 alone. IL-8 concentration in the supernatant was measured by ELISA. (n=2, triplicate samples) *= p< 0.05, **=p<0.01, ***=p<0.001 vs. control (0 M Dex)

IL-17 synergized with TNF- in IL-8 production in both cell types. Dex significantly inhibited

IL-8 production in response to IL-17 alone (insert Fig 1A&B), TNF- (black bars) and the

combination of TNF- and IL-17 (white bars) in both NCI-H292 cells (Fig 1A) and MRC-5

cells (Fig. 1B) at a dose as low as 4 nM. In NCI-H292 cells, this inhibition increased with

increasing doses of Dex, whereas in MRC-5 cells, maximum inhibition was already reached at

4 nM. Strikingly, Dex was much less potent in inhibiting IL-8 production by MRC-5

fibroblasts (Fig. 2B) than in NCI-H292 cells (Fig 2A).

0 0.004 0.04 0.4 40

10

20

30

40

50

60

70IL-17IL-17 + TNF- α TNF-α

***

***

***

***

***

******

*** **

Dex (μM)

Fold

inhi

bitio

n of

IL-

8 pr

oduc

tion

0 0.004 0.04 0.4 40

1

2

3

4

5

***

***

************

******

***

******

***

Dex (μM)

A B

Figure 2: Fold-inhibition of IL-8 production by increasing concentrations of Dex in NCI-H292 cells (A) and MRC-5 fibroblasts (B). Data is derived from figure 1. Fold inhibition was calculated as control value divided by Dex treated value in each group.


89

When data from Figure 1 were expressed as fold-inhibition of IL-8 production, the maximum

fold inhibition in NCI-H292 cells reached up to 63 ± 3, whereas in MRC-5 fibroblasts the

maximum inhibition was 4.5 ± 0.3 fold. Furthermore, in fibroblast IL-8 production to IL-17

alone was most potently inhibited whereas in NCI-H292 cells the combination of IL-17 and

TNF- was most potently inhibited.

0.00 0.25 0.50

0

25

50

75

100T+dexIL-17+T+dex

3 4 5

TNF-α (ng/ml)

IL-6

(pg/

ml)

***

***

***

0.0 0.1 0.2 0.3 0.4 0.5

0

2500

5000

7500T+dexIL-17+T+Dex

3 4 5

TNF-α

IL-8

(pg/

ml)

*****

***

0.0 0.1 0.2 0.3 0.4 0.5

0

2500

5000


3 4 5

TNF-α (ng/ml)

IL-6

(pg/

ml)

***

***

***

0.0 0.1 0.2 0.3 0.4 0.5

0

100000


3 4 5

***

***

***

TNF-α

IL-8

(pg/

ml)

A B

C D

We next assessed the effect of dexamethasone on responsiveness of the cells to TNF-α and

IL-17 in terms of IL-8 and IL-6 production by comparing the steepness of response curves to

TNF- in the presence or absence of 10 ng/ml IL-17 and 4 m Dex (Figure 3).

Strikingly, in the presence of Dex, IL-17 still synergized with TNF-α giving rise to

increased dose-response curves for both NCI-H292 cells and MRC-5 fibroblasts. So, even

though Dex overall reduced the production of IL-6 and IL-8, it did not fully abrogate synergy

Figure 3: Response curves to TNF- and IL-17 in the presence of Dex. NCI-H292 cells (A,B) and MRC-5 fibroblasts (C,D) were exposed to 4 M Dex and stimulated with 0,0.05, 0.5 and 5 ng/ml TNF- alone (shaded circles) or in the presence of 10 ng/ml IL-17 (open squares) for 18 hrs. IL-6 (A,C) and IL-8 (B,D) was measured by ELISA. One representative experiment out of 2 is shown (triplicate samples), **=p<0.01, ***=p<0.001 vs. control (0 M Dex).

Chapter 5

90

between TNF-α and IL-17. In both NCI-H292 cells and MRC-5 fibroblasts, IL-6 production

was less potently inhibited by Dex than IL-8 production.

Dex does not inhibit interaction of transcription factors with the IL-6 and IL-8 promoter in

NCI-H292 cells.

Dex has been described to inhibit NFκB-dependent transcription in a number of cell lines, but

not in lung epithelial HBE1 cells [20]. Analyzing the expression of IL-6 and IL-8 mRNA over

time showed a reduction of IL-6 and IL-8 mRNA induction by Dex in MRC-5 cells (Figure

4), which may be indicative of reduced gene transcription.

0.0 2.5 5.0 7.5 10.0

0

10

20

30

******

*** ***

A

***

time (hours)

mR

NA: I

L-6/

GAP

DH

fold

indu

ctio

n

0.0 2.5 5.0 7.5 10.0

0

10

20

****** ***B

******

time (hours)

mR

NA: I

L-8/

GAP

DH

fold

indu

ctio

n

Figure 4. IL-6 (A) and IL-8 mRNA (B) induction in time in MRC-5 cells. Cells were stimulated with 5 ng/ml TNF- (squares), or with 5 ng/ml TNF- and 10 ng/ml IL-17 (triangles) supplemented with 4 M Dex (inverted triangles) for the times indicated at the x-axis. mRNA was isolated and dot blotted. Results are corrected for variable loading using GAPDH levels. ***=p<0.001 compared to Dex treated cells. These data have been published in part before in ref. [19].

To investigate the mechanism by which Dex reduces IL-6 and IL-8 responses in H292 cells,

we next assessed its effect on transcription using EMSA and CAT-promoter constructs.

Earlier work using deletion CAT-promoter constructs showed that C/EBP is the main

transcription factor involved in IL-6 transcription and that NFκB and AP-1 are involved in IL-

8 transcription [21,22].

We first assessed the effect of Dex on the nuclear recruitment and DNA binding

capacity of C/EBP, NFκB and AP-1 (Figure 5) induced by TNF- and IL-17. Cells were

stimulated with 5 ng/ml TNF- , 100 ng/ml IL-17 and 4 μM Dex as indicated in Figure 5 for 1

hr, the time point when levels of IL-6 and IL-8 mRNA peak in NCI-H292 cells, before

nuclear extracts were prepared.


91

As described previously, IL-17 had no effect on the TNF- -induced recruitment of any of the

transcription factors involved [19]. Similar to HBE1 cells [20], Dex did not reduce the

recruitment of any of the transcription factors in NCI-H292 cells, even though the levels of

IL-6 and IL-8 mRNA and IL-6 and IL-8 protein production were clearly reduced by Dex. To

further investigate the effect of Dex on transcription, cells were transfected with IL-6- and IL-

8-CAT-promoter constructs. Twenty four hrs after transfection, cells were stimulated for 7 hrs

with TNF-α, IL-17 and Dex before isolation of mRNA. Transcription of the CAT-gene was

measured by dot blot using specific CAT probes. This procedure confirmed that Dex did not

reduce IL-6 or IL-8 promoter activity. (Data not shown).

Figure 5: Dex does not inhibit activation and nuclear recruitment of transcription factors involved in IL-6 and IL-8 transcription in NCI-H292 cells. Cells were exposed to 5 ng/ml TNF- , 10 ng/ml IL-17 and 4 M Dex as indicated above the figure for 1 h before nuclear extracts were prepared. Extracts were incubated with radiolabeled oligonucleotides and separated on a 4% nonreducing poly-acrylamide gel. Specific bands were quantified using a phosphoimager and the intensity is shown in the graph at the bottom of the figure. Results are representative for 3 independent experiments. These data have been published in part before in ref. [19].

Chapter 5

92

Dexamethasone increases IL-6 and IL-8 mRNA degradation in NCI-H292 cells and MRC-5

fibroblasts.

Having established that the inhibition of IL-6 and IL-8 production to TNF- and IL-17 by Dex

was unlikely to be caused by a transcriptional event, we next assessed the effects of Dex on

post-transcriptional regulation of IL-6 and IL-8 mRNA by analyzing the rate of mRNA

degradation. NCI-H292 cells and MRC-5 fibroblasts were exposed to 5 ng/ml TNF- and 10

ng/ml IL-17 for either 1 or 3 hr respectively, before Dex was added to a final concentration of

4 μM. Fifteen minutes after Dex addition, transcription was blocked with 5 μg/ml

Actinomycin D and mRNA was harvested at the timepoints indicated in Figure 6.

In both NCI-H292 cells (6A, B) and MRC-5 fibroblasts (6C, D) IL-6 mRNA (A, C)

and IL-8 mRNA (B, D) were significantly destabilized by Dex. The effect was smaller in

fibroblasts than in epithelial cells, in line with the smaller inhibitory effect of Dex on MRC-5

cells compared to that on NCI-H292 cells (see Figs. 1&2). So, the inhibitory effect of Dex can

at least partly be explained by the fact that Dex decreased the stability of IL-6 and IL-8

mRNA in NCI-H292 cells and MRC-5 fibroblasts.

Figure 6: Dexamethasone increases the degradation of IL-6 and IL-8 mRNA in NCI-H292 cells (A,B) and MRC-5 Fibroblasts (C,D). Cells were exposed to 5 ng/ml TNF- and 10 ng/ml IL-17 for 1h (A,B) or 3h (C,D) before vehicle (solid triangle) or Dex (solid circle, dashed line) was added to a final concentration of 4 M.Fifteen min after addition of Dex, transcription was blocked using 5 g/ml Actinomycin D and mRNA was isolated at times indicated at the x-axis. IL-6 and IL-8 mRNA was dot blotted and quantified using a phosphoimager. Results are normalized to GAPDH. One representative experiment out of 2 is shown (duplicate samples). *= p< 0.05, **=p<0.01, ***=p<0.001 vs. control (no Dex). These data have in part been published before in ref. [19].


93

DiscussionThe current study shows that dexamethasone inhibits the production of IL-6 and IL-8 induced

by TNF- and IL-17, but does not abrogate the synergy between the two stimuli in lung

epithelial en fibroblast cell lines. So, IL-17 partially counteracted the suppression of TNF- -

induced IL-6 and IL-8 production by dexamethasone. The mechanism of inhibition in both

cell types involved destabilization of IL-6 and IL-8 mRNA.

Strikingly, MRC-5 fibroblasts produced much larger amounts of cytokines than NCI-

H292 lung epithelial cells (~40-fold on cell to cell basis), similar to observations in primary

cells [19]. However, the production of IL-6 and IL-8 was inhibited to a much smaller extent

than in epithelial cells (~5-fold vs. ~65-fold, respectively). This decreased inhibition

compared to NCI-H292 cells was paralleled by a smaller effect of Dex on the rate of mRNA

degradation in fibroblasts, underlining the importance of post-transcriptional regulation by IL-

17 and dexamethasone. If the effect of Dex on these cell lines parallels that of Dex on primary

cells, it raises the question whether in patients with corticosteroid resistant inflammation, such

as severe asthma and COPD, fibroblasts are a more important source of inflammatory

mediators than for example airway epithelial cells.

The reason for the different effects of Dex between cell types may come about by a

difference in the expression level of the glucocorticoid receptor (GR), as the cellular

sensitivity to corticosteroids is directly proportional to the receptor expression level [26]. At

the lowest dose of Dex (4 nM, see Fig 2) the difference between inhibition in NCI-H292 cells

and MRC-5 fibroblasts is ~2-fold, and this difference increases with increased doses of Dex.

Thus, it may be that at 4 nM of Dex, all GRs in MRC-5 fibroblasts are engaged whereas a

higher level of GRs in NCI-H292 cells would allow for an increased inhibition with

increasing doses of Dex. The expression levels of GR in both cell lines remain to be

determined however.

A preliminary experiment indicated that IL-17 still increases the TNF- induced IL-6

and IL-8 mRNA half-life in the presence of Dex (Data not shown). Thus, IL-17 and Dex have

opposite effects on IL-6 and IL-8 mRNA stability. This may explain the fact that even in the

presence of Dex, IL-17 potentiates the IL-6 and IL-8 response. The mechanism underlying the

IL-17-induced stabilization of IL-6 and IL-8 mRNA is not clarified yet for lung fibroblast and

airway epithelial cells, but involves p38 Mitogen-Activated Protein Kinase (MAPK)

activation in other cell types [27]. In chondrocytes, dexamethasone blunted IL-17-dependent

Chapter 5

94

activation of MAP kinases [28]. Activation of p38 by phosporylation in general is associated

with mRNA stabilization (see [29,30] for review).

Interestingly, glucocorticoids induce the expression of MAP kinase phosphatase-1

(MKP-1), an inhibitor of p38 MAPK [31-33]. The opposing effects of IL-17 and MKP-1 on

p38 MAPK activation may explain the fact that IL-17 still increases the stability of TNF- -

induced IL-6 and IL-8 mRNA in the presence of Dex. In support of the de novo synthesis of

MKP-1, under conditions of restricted protein synthesis, Dex is no longer able to inhibit IL-6

and IL-8 production [20,34,35]. An alternative non-exclusive explanation follows from the

inactivation of glucocorticoid receptors by phopsphorylation by p38 Mitogen-activated

protein kinase [36]. Thus, IL-17 may dampen the effect of corticosteroids by inhibiting the

GR activity.

In conclusion, our results indicate that in airway epithelial cells and lung fibroblasts,

Dex inhibits production of IL-6 and IL-8 by increasing the rate of mRNA degradation. The

Dex-induced increase in mRNA degradation is counteracted by IL-17, which results in an

increased IL-6 and IL-8 production. So, not withstanding the strong inhibitory effects of Dex,

in patients with elevated expression of IL-17, corticosteroid treatment may be less effective in

controlling inflammation. This may be particular true when fibroblast-derived mediators

contribute largely to the inflammatory process, as fibroblasts are over 10 fold less sensitive to

inhibition by Dex than airway epithelial cells. The presented data show that IL-17 and Dex

have opposing effects on the stability of IL-6 and IL-8 mRNA, which warrants further

research into the mechanism underlying the modulation of mRNA degradation.

References

1. A.Barczyk, W.Pierzchala, E.Sozanska (2003). Interleukin-17 in sputum correlates with airway hyperresponsiveness to methacholine. Respir.Med. 97, 726-733.

2. T.Hashimoto, K.Akiyama, N.Kobayashi, A.Mori (2005). Comparison of IL-17 production by helper T cells among atopic and nonatopic asthmatics and control subjects. Int.Arch.Allergy Immunol. 137 Suppl 1, 51-54.

3. P.W.Hellings, A.Kasran, Z.Liu, P.Vandekerckhove, A.Wuyts, L.Overbergh, C.Mathieu, J.L.Ceuppens (2003). Interleukin-17 orchestrates the granulocyte influx into airways after allergen inhalation in a mouse model of allergic asthma. Am.J.Respir.Cell Mol.Biol. 28, 42-50.

4. S.Molet, Q.Hamid, F.Davoine, E.Nutku, R.Taha, N.Page, R.Olivenstein, J.Elias, J.Chakir (2001). IL-17 is increased in asthmatic airways and induces human bronchial fibroblasts to produce cytokines. J.Allergy Clin.Immunol. 108, 430-438.

5. M.C.Honorati, S.Neri, L.Cattini, A.Facchini (2006). Interleukin-17, a regulator of angiogenic factor release by synovial fibroblasts. Osteoarthritis.Cartilage. 14, 345-352.

6. S.Y.Hwang, H.Y.Kim (2005). Expression of IL-17 homologs and their receptors in the synovial cells of rheumatoid arthritis patients. Mol.Cells 19, 180-184.


95

7. M.I.Koenders, J.K.Kolls, B.Oppers-Walgreen, B.L.van den, L.A.Joosten, J.R.Schurr, P.Schwarzenberger, W.B.van den Berg, E.Lubberts (2005). Interleukin-17 receptor deficiency results in impaired synovial expression of interleukin-1 and matrix metalloproteinases 3, 9, and 13 and prevents cartilage destruction during chronic reactivated streptococcal cell wall-induced arthritis. Arthritis Rheum. 52, 3239-3247.

8. E.Lubberts, M.I.Koenders, W.B.van den Berg (2005). The role of T-cell interleukin-17 in conducting destructive arthritis: lessons from animal models. Arthritis Res.Ther. 7, 29-37.

9. L.Southam, O.Heath, K.Chapman, J.Loughlin (2006). Association analysis of the interleukin 17 genes IL17A and IL17F as potential osteoarthritis susceptibility loci. Ann.Rheum.Dis. 65, 556-557.

10. S.Fujino, A.Andoh, S.Bamba, A.Ogawa, K.Hata, Y.Araki, T.Bamba, Y.Fujiyama (2003). Increased expression of interleukin 17 in inflammatory bowel disease. Gut 52, 65-70.

11. J.Chakir, J.Shannon, S.Molet, M.Fukakusa, J.Elias, M.Laviolette, L.P.Boulet, Q.Hamid (2003). Airway remodeling-associated mediators in moderate to severe asthma: effect of steroids on TGF-beta, IL-11, IL-17, and type I and type III collagen expression. J.Allergy Clin.Immunol. 111, 1293-1298.

12. M.Laan, Z.H.Cui, H.Hoshino, J.Lotvall, M.Sjostrand, D.C.Gruenert, B.E.Skoogh, A.Linden (1999). Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J.Immunol. 162,2347-2352.

13. C.L.Ordonez, T.E.Shaughnessy, M.A.Matthay, J.V.Fahy (2000). Increased neutrophil numbers and IL-8 levels in airway secretions in acute severe asthma: Clinical and biologic significance. Am.J.Respir.Crit Care Med. 161, 1185-1190.

14. R.E.Nocker, D.F.Schoonbrood, E.A.van de Graaf, C.E.Hack, R.Lutter, H.M.Jansen, T.A.Out (1996). Interleukin-8 in airway inflammation in patients with asthma and chronic obstructive pulmonary disease. Int.Arch.Allergy Immunol. 109, 183-191.

15. C.E.Jones, K.Chan (2002). Interleukin-17 stimulates the expression of interleukin-8, growth-related oncogene-alpha, and granulocyte-colony-stimulating factor by human airway epithelial cells. Am.J.Respir.Cell Mol.Biol. 26, 748-753.

16. M.Kawaguchi, F.Kokubu, H.Kuga, S.Matsukura, H.Hoshino, K.Ieki, T.Imai, M.Adachi, S.K.Huang (2001). Modulation of bronchial epithelial cells by IL-17. J.Allergy Clin.Immunol. 108, 804-809.

17. M.Laan, J.Lotvall, K.F.Chung, A.Linden (2001). IL-17-induced cytokine release in human bronchial epithelial cells in vitro: role of mitogen-activated protein (MAP) kinases. Br.J.Pharmacol. 133, 200-206.

18. O.Prause, M.Laan, J.Lotvall, A.Linden (2003). Pharmacological modulation of interleukin-17-induced GCP-2-, GRO-alpha- and interleukin-8 release in human bronchial epithelial cells. Eur.J.Pharmacol.462, 193-198.


20. M.M.Chang, M.Juarez, D.M.Hyde, R.Wu (2001). Mechanism of dexamethasone-mediated interleukin-8 gene suppression in cultured airway epithelial cells. Am.J.Physiol Lung Cell Mol.Physiol 280, L107-L115.




24. N.Mukaida, Y.Mahe, K.Matsushima (1990). Cooperative interaction of nuclear factor-kappa B- and cis-regulatory enhancer binding protein-like factor binding elements in activating the interleukin-8 gene by pro-inflammatory cytokines. J.Biol.Chem. 265, 21128-21133.

25. T.A.Libermann, D.Baltimore (1990). Activation of interleukin-6 gene expression through the NF-kappa B transcription factor. Mol.Cell Biol. 10, 2327-2334.

26. R.H.Oakley, J.A.Cidlowski (1993). Homologous down regulation of the glucocorticoid receptor: the molecular machinery. Crit Rev.Eukaryot.Gene Expr. 3, 63-88.

27. M.Shimada, A.Andoh, K.Hata, K.Tasaki, Y.Araki, Y.Fujiyama, T.Bamba (2002). IL-6 secretion by human pancreatic periacinar myofibroblasts in response to inflammatory mediators. J.Immunol. 168,861-868.

Chapter 5

96

28. T.Shalom-Barak, J.Quach, M.Lotz (1998). Interleukin-17-induced gene expression in articular chondrocytes is associated with activation of mitogen-activated protein kinases and NF-kappaB. J.Biol.Chem. 273, 27467-27473.

29. A.R.Clark, J.L.Dean, J.Saklatvala (2003). Post-transcriptional regulation of gene expression by mitogen-activated protein kinase p38. FEBS Lett. 546, 37-44.

30. J.L.Dean, G.Sully, A.R.Clark, J.Saklatvala (2004). The involvement of AU-rich element-binding proteins in p38 mitogen-activated protein kinase pathway-mediated mRNA stabilisation. Cell Signal.16, 1113-1121.

31. P.Chen, J.Li, J.Barnes, G.C.Kokkonen, J.C.Lee, Y.Liu (2002). Restraint of proinflammatory cytokine biosynthesis by mitogen-activated protein kinase phosphatase-1 in lipopolysaccharide-stimulated macrophages. J.Immunol. 169, 6408-6416.

32. A.Imasato, C.sbois-Mouthon, J.Han, H.Kai, A.C.Cato, S.Akira, J.D.Li (2002). Inhibition of p38 MAPK by glucocorticoids via induction of MAPK phosphatase-1 enhances nontypeable Haemophilus influenzae-induced expression of toll-like receptor 2. J.Biol.Chem. 277, 47444-47450.

33. M.Lasa, S.M.Abraham, C.Boucheron, J.Saklatvala, A.R.Clark (2002). Dexamethasone causes sustained expression of mitogen-activated protein kinase (MAPK) phosphatase 1 and phosphatase-mediated inhibition of MAPK p38. Mol.Cell Biol. 22, 7802-7811.


35. T.Roger, P.Bresser, M.Snoek, S.K.van der, B.A.van den, M.Nijhuis, H.M.Jansen, R.Lutter (2004). Exaggerated IL-8 and IL-6 responses to TNF-alpha by parainfluenza virus type 4-infected NCI-H292 cells. Am.J.Physiol Lung Cell Mol.Physiol 287, L1048-L1055.

36. E.Irusen, J.G.Matthews, A.Takahashi, P.J.Barnes, K.F.Chung, I.M.Adcock (2002). p38 Mitogen-activated protein kinase-induced glucocorticoid receptor phosphorylation reduces its activity: role in steroid-insensitive asthma. J.Allergy Clin.Immunol. 109, 649-657.

97

6IL-17 does not affect the ribosomal load on IL-6 mRNA in

lung epithelial cells.

Submitted

Arjen van den Bergab, Jaime Freitasa, Jordi de Wita, Mieke Snoekab, Henk M. Jansena and

René Lutterab

Department of Pulmonologya and Laboratory of Experimental Immunologyb, Academic Medical Center, University of Amsterdam, Amsterdam

Chapter 6

98

AbstractIn airway epithelial cells , the T-cell derived IL-17 amplified the TNF-α-induced IL-6

production. This amplification was not controlled at the level of IL-6 gene transcription but at

the post-transcriptional level of mRNA degradation. Since IL-6 production can also be

controlled at the level of translation, we assessed whether IL-17 increased the ribosomal load

on IL-6 mRNA thus contributing the amplification of IL-6 production. Using the technique of

polysome profiling, we found that IL-17 did not increase the ribosomal load on IL-6 mRNA

in NCI-H292 cells. This indicates that the decreased IL-6 mRNA degradation is the most

important mechanism underlying the IL-17-induced amplification of IL-6 responses.

IntroductionT-cell derived IL-17 is emerging as an important modulator of inflammation in chronic

inflammatory diseases such as rheumatoid arthritis [1-5], inflammatory bowel disease [6],

asthma [7-10] and cystic fibrosis [11]. IL-17 is considered a proinflammatory cytokine

because it induces the production of a number of cytokines and chemokines. We have recently

shown that in lung structural cells, IL-17 by itself is a weak inducer of pro-inflammatory

mediators such as IL-6 and IL-8, and its main effect is to amplify pro-inflammatory responses

to secondary stimuli such as TNF- . This amplification is not controlled at the transcriptional

level; instead IL-17 prolonged the half-life of TNF- -induced IL-6 mRNA in epithelial cells

by 1.9-fold, concomitant with a 5-fold increase in TNF- induced IL-6 production [12].

As we have recently shown that IL-6 production is regulated independently at the level

of mRNA degradation and at the level of translation [13], we investigated whether IL-17

affected the translation of IL-6 mRNA by means of polysome profiling. We found that IL-17

did not affect the distribution of IL-6 mRNA in the polysome profile. This indicates that,

unless there is a simultaneous increase in both IL-6 mRNA initiation and elongation, the

decreased IL-6 mRNA degradation is the most important mechanism underlying the IL-17-

induced amplification of IL-6 responses.

IL-17-does not enhance IL-6 translation.

99

Methods

Cell culture



described before [14]. For experiments, 30 ml of cells at a density of 0.6x106/ml were plated

in a 141 cm2 dish and grown overnight to 70% confluency. Cells were stimulated for 4 hrs

with 5 ng/ml TNF- alone or in combination with 100 ng/ml IL-17 (both from R&D,

Minneapolis, Minn.). Cells were detached using 10 ml of Trypsin-EDTA containing 200

g/ml cycloheximide per dish.

Lysate preparation for polysome profiling.

Cells were collected in 10 ml of Trypsin-EDTA containing 200 g/ml cycloheximide.

Subsequently, 5 ml of cold medium was added to inactivate trypsin, 500 l of suspension was

set apart for recovery calculations, and cells were pelleted in preweighed tubes. Medium was

carefully aspirated and tubes were weighed to determine the amount of cells harvested. Cells

were lysed in 5 weight volumes (e.g. 100 mg of cells in 500 l) of lysate buffer (250 mM

sucrose, 50 mM HEPES pH 7.4, 70 mM KAc, 5 mM MgCl2, 5 mM NaCl, 1 mM EGTA, 1

mM DTT, 200 g/ml cycloheximide, 0.4% (v/v) Triton X-100, 1 mM PMSF and 20 U/ml

RNAguard) and vortexed before deoxycholate (5% w/v in PBS (pH 10)) was added to a final

concentration of 0.8 %. The suspension was vortexed and centrifuged for 10 min at 10,000

rpm in an eppendorf centrifuge for 2 min. The cleared lysate was either directly loaded on a

sucrose gradient or snapfrozen in liquid nitrogen and stored at –80oC. The remaining pellet

was dissolved in Trizol for recovery calculations (Recovery control (RC) 1).

Preparation of sucrose gradients.

Isokinetic sucrose gradients were made from 0.5 M and 1.2 M sucrose solutions containing 50

mM HEPES pH 7.4, 70 mM KAc, 5 mM MgCl2, 5 mM NaCl, 1 mM EGTA, 1 mM DTT, 200

g/ml cycloheximide and 0.1% DEPC. Gradients were made using a 15 ml home-made

gradient mixer and a Gilson minipulse II peristaltic pump. Gradients were pumped into

Beckman 9/16 x 3.5 inch polyallomer centrifuge tubes and stored overnight at 4oC. Five

hundred l of lysate was layered on top of the gradients and centrifuged for 90 minutes at

39,000 rpm in a Beckman SW 41 rotor (~190,000 x g). The remaining lysate was mixed with

1 ml Trizol for recovery calculations (RC2).

Chapter 6

100

Fractionation of polysome profile.

After centrifugation, the gradients were placed in a tubeholder and a thin needle was slowly

inserted in the gradient to the bottom of the tube. The gradient solution was pumped out via an

Uvikon 930 UV monitor reading absorbance at 260 nm and 500 l fractions were collected in

500 l of 8M Guanidine-isothiocyanate in 2 ml eppendorf tubes. Eppendorf tubes were

vortexed and 750 l of 100 % ethanol was added and samples were left to precipitate

overnight at –20oC. For recovery, one ml of Trizol was added to the Beckman centrifuge tubes

to dissolve pelleted material (RC3). The following day, the precipitate was spun down at

15,000 x g for 10 min. Pellets were dissolved in 1 ml Trizol, pooled as indicated in the figure

and RNA was isolated and analyzed as described below.

To ensure valid comparison between experimental conditions, recovery was calculated from

the sum of all gradient fractions plus recovery controls, divided by the sample taken from the

cell suspension (normalized to a 100%). Recovery was typically between 60 and 80%.

mRNA analysis

The amount of IL-6 mRNA was determined by dotblotting and hybridization with specific 32P-labelled probes for IL-6, which has been extensively validated for specificity in our

samples by Northern blot as described [14]. Blots were quantified using a phosphoimager.

RayBio Human Inflammation Antibody Array.

NCI-H292 cells were grown as described above in 6-wells plates to a confluency of 70%.

Next, medium was replaced with serum free medium to avoid background staining, and cells

were stimulated with 5 ng/ml TNF-α alone or in combination with 100 ng/ml IL-17 for 8 hrs

before culture supernatant was collected. Array Membranes (tebu-bio b.v., Heerhugowaard,

Netherlands) were incubated as indicated by the manufacturer and quantified. After

subtraction of the background levels the signals of TNF-α in combination with IL-17 were

divided by the signals from TNF-α alone. The definition for upregulation was arbitrarily set at

1.5, downregulation at 0.66 and values in between 0.66 and 1.5 were considered unchanged.


101

Results and Discussion

IL-17 amplified TNF- -induced IL-6 production not by transcriptional but by post-

transcriptional regulation by reducing the rate of IL-6 mRNA degradation. As IL-6 can be

subject to regulation at the translational level, we set out to investigate whether IL-17 also

modified translational efficiency of IL-6 mRNA using polysome profiling. NCI-H292 cells

were stimulated with 5 ng/ml TNF- , either or not in the presence of 100 ng/ml IL-17 for 4

hrs, before cell lysates were prepared. The time point of 4 hrs was derived from initial

experiments indicating that the ribosomal load of IL-6 mRNA increases from 1 to 4 hrs after

stimulation, and that at 4 hrs after stimulation IL-6 is still being produced in large amounts.

Cell lysates were separated over an isokinetic 0.5-1M sucrose gradient and fractions were

collected from the bottom up. Thus, the early fractions contain mRNA species that are more

heavily loaded with ribosomes than later fractions. Figure 1A represents a typical polysome

profile.

1 2 3 4 5 6 7 8 9 100

10

20

30

TNF-αIL-17+TNF-α

Fraction number

% IL

-6 m

RN

A in

pro

file

0 1 2 3 4 5 6 7 8 9 10

0.6

0.7

0.8

0.9

1.0

Fraction number

A260

(A.U

.)

A

B

Figure 1: IL-17 does not affect the distribution of IL-6 mRNA in a polysome profile. A representative polysome profile is shown in 1A. Fraction 1 represents the bottom of the gradient, fraction 10 the top. Cells were stimulated with TNF- (solid bars) or TNF- + IL-17 (open bars) for 4 hrs before cell extracts were prepared. Data are presented as the % of IL-6 mRNA of the total amount of IL-6 mRNA in the profile. One representative experiment (triplicate samples) out of 3 is shown.

Chapter 6

102

Fraction 1 to 7 contain the polysomes and fraction 8-10 contain monosomes and free

messenger ribonucleoprotein (mRNP) particles. Addition of IL-17 had no effect on the shape

of the polysome profile, suggesting that there is no metabolic effect of IL-17 on general

protein synthesis. To confirm this, we performed a cytokine antibody array experiment

analyzing the expression of 40 different inflammatory mediators. NCI-H292 cells were

stimulated for 8 hrs with TNF-α and IL-17 as described above and the culture supernatant was

incubated on the RayBio Human Inflammation Antibody Array III. The results indicated that

IL-17 differentially affects the expression of a number of mediators, and does not affect others

(see table 1).

Figure 1B shows the distribution of IL-6 mRNA in the polysome profile, expressed as the

percentage of the total IL-6 mRNA present in the profile. When comparing the total amount

of IL-6 mRNA in both gradients, there is no effect of IL-17 (arbitrary signals of 6083 vs. 5694

for TNF- and TNF- + IL-17 respectively) as observed before [12]. Mean recovery (n=3)

was 63% and 81.% for TNF-α and TNF-α + IL-17 stimulated groups respectively (See table 2

for calculations).

Upregulated Downregulated Unchanged IL-6 EOTAXIN ICAM-1 IL-8 EOTAXIN-2 IL-6sR

IFN-gamma IL-2 IL-10 I-309 IL-12 p40

IL-1 alpha IL-16 IL-12 p70 M-CSF

IL-13 MIP-1 alpha IL-15 MIP-1 beta IP-10 MIP-1 delta

MCP-1 RANTES MCP-2 TIMP-2

MIG

TNF-αTNF-α + IL-

17total gradient 6082.9 5694.4 RC1 954.3 1266.0 RC2 1367.9 1779.4 RC3 609.6 864.3 Sum 9014.8 9604.1 100% cells 14414.4 11810.4 recovery (%) 62.5 81.3

Table 1: The effect of IL-17 on TNF-α-induced gene expression in NCI-H292 cells. Data represent a single experiment.

Table 2: Recovery was calculated by dividing the sum of all individual fractions and recovery control (RC) signals, by the signal obtained from direct mRNA isolation from an aliquot of treated cells set to 100%. Total gradient = sum of all individual fractions from one profile, RC1 = pellet remaining from lysate preparation, RC2 = any lysate not loaded on the gradient and RC3 = pellet material after ultracentrifugation (see also materials and methods).


103

No significant effect of IL-17 on the distribution of IL-6 mRNA in the polysome

profile was observed, so IL-17 does not increase the translation of IL-6 mRNA by increasing

the ribosomal load on the IL-6 mRNA. However, we cannot exclude a simultaneous effect of

IL-17 on both the rate of IL-6 initiation and elongation, that would cancel out a shift of IL-6

mRNA in the polysome profile. These data indicate that the IL-17 induced stabilization of IL-

6 mRNA is likely to be the major cause of the increased IL-6 production in airway epithelial

cells. This underlines the need to assess whether the pathway of mRNA degradation can be a

therapeutic target in patients with chronic inflammatory diseases.

References

1. Honorati, M. C., Neri, S., Cattini, L., and Facchini, A. (2006). Interleukin-17, a regulator of angiogenic factor release by synovial fibroblasts. Osteoarthritis.Cartilage. 14, 345-352.

2. Hwang, S. Y. and Kim, H. Y. (2005). Expression of IL-17 homologs and their receptors in the synovial cells of rheumatoid arthritis patients. Mol.Cells 19, 180-184.

3. Koenders, M. I., Kolls, J. K., Oppers-Walgreen, B., van den, B. L., Joosten, L. A., Schurr, J. R., Schwarzenberger, P., van den Berg, W. B., and Lubberts, E. (2005). Interleukin-17 receptor deficiency results in impaired synovial expression of interleukin-1 and matrix metalloproteinases 3, 9, and 13 and prevents cartilage destruction during chronic reactivated streptococcal cell wall-induced arthritis. Arthritis Rheum. 52, 3239-3247.

4. Lubberts, E., Koenders, M. I., and van den Berg, W. B. (2005). The role of T-cell interleukin-17 in conducting destructive arthritis: lessons from animal models. Arthritis Res.Ther. 7, 29-37.

5. Southam, L., Heath, O., Chapman, K., and Loughlin, J. (2006). Association analysis of the interleukin 17 genes IL17A and IL17F as potential osteoarthritis susceptibility loci. Ann.Rheum.Dis. 65, 556-557.

6. Fujino, S., Andoh, A., Bamba, S., Ogawa, A., Hata, K., Araki, Y., Bamba, T., and Fujiyama, Y. (2003). Increased expression of interleukin 17 in inflammatory bowel disease. Gut 52, 65-70.

7. Barczyk, A., Pierzchala, W., and Sozanska, E. (2003). Interleukin-17 in sputum correlates with airway hyperresponsiveness to methacholine. Respir.Med. 97, 726-733.

8. Hashimoto, T., Akiyama, K., Kobayashi, N., and Mori, A. (2005). Comparison of IL-17 production by helper T cells among atopic and nonatopic asthmatics and control subjects. Int.Arch.Allergy Immunol. 137 Suppl 1, 51-54.

9. Hellings, P. W., Kasran, A., Liu, Z., Vandekerckhove, P., Wuyts, A., Overbergh, L., Mathieu, C., and Ceuppens, J. L. (2003). Interleukin-17 orchestrates the granulocyte influx into airways after allergen inhalation in a mouse model of allergic asthma. Am.J.Respir.Cell Mol.Biol. 28, 42-50.

10. Molet, S., Hamid, Q., Davoine, F., Nutku, E., Taha, R., Page, N., Olivenstein, R., Elias, J., and Chakir, J. (2001). IL-17 is increased in asthmatic airways and induces human bronchial fibroblasts to produce cytokines. J.Allergy Clin.Immunol. 108, 430-438.

11. McAllister, F., Henry, A., Kreindler, J. L., Dubin, P. J., Ulrich, L., Steele, C., Finder, J. D., Pilewski, J. M., Carreno, B. M., Goldman, S. J., Pirhonen, J., and Kolls, J. K. (2005). Role of IL-17A, IL-17F, and the IL-17 receptor in regulating growth-related oncogene-alpha and granulocyte colony-stimulating factor in bronchial epithelium: implications for airway inflammation in cystic fibrosis. J.Immunol. 175, 404-412.

12. van den Berg. A., Kuiper, M., Snoek, M., Timens, W., Postma, D. S., Jansen, H. M., and Lutter, R. (2005). Interleukin-17 induces hyperresponsive interleukin-8 and interleukin-6 production to tumor necrosis factor-alpha in structural lung cells. Am.J.Respir.Cell Mol.Biol. 33, 97-104.

13. van den Berg. A., Freitas, J., Keles, F., Snoek, M., van, M. J., Jansen, H. M., and Lutter, R. (2006). Cytoskeletal architecture differentially controls post-transcriptional processing of IL-6 and IL-8 mRNA in airway epithelial-like cells. Exp.Cell Res. 312, 1496-1506.

14. Roger, T., Out, T. A., Jansen, H. M., and Lutter, R. (1998). Superinduction of interleukin-6 mRNA in lung epithelial H292 cells depends on transiently increased C/EBP activity and durable increased mRNA stability. Biochim.Biophys.Acta 1398, 275-284.

104

105

7Haemophilus influenzae and neutrophil defensins

amplify airway epithelial IL-8 release via mRNA

stabilization

Submitted

Annelies D. Gorter, Arjen van den Berg, Mieke Snoek, René Lutter, Pieter S.

Hiemstra, Jacob Dankert and Loek van Alphen.

Chapter 7

106

Abstract

Chronic bronchitis (CB) and chronic obstructive pulmonary disease (COPD) are

characterized by frequent infections with bacteria, such as Haemophilus influenzae,

and chronic neutrophilic inflammation of the airways. Neutrophils contain a variety of

antimicrobial peptides like neutrophil defensins, that can kill microorganisms and

induce pro-inflammatory interleukin(IL)-8 and IL-6 release by airway epithelial cells.

Neutrophil defensins may also promote adherence of H. influenzae to epithelial cells.

As H. influenzae induces IL-8 and IL-6 expression in epithelial cells we aimed to

determine whether defensins modulate the bacterial-induced IL-8 and IL-6 release.

Defensins and H. influenzae synergized in the release of IL-8 and IL-6 by the human

airway epithelial cell line NCI-H292 (p < 0.02), which was particularly evident at

early time points after exposure and at low bacterial loads. For IL-8, this synergism

was due, at least in part, to a reduced IL-8 mRNA degradation. These findings

indicate that defensins may facilitate early recognition of bacterial infection.

Furthermore, the synergistically enhanced release of IL-8 may perpetuate

inflammatory responses that could explain chronic airway inflammation in COPD

patients with bacterial infections.

IntroductionThe airways of patients with chronic bronchitis and chronic obstructive pulmonary

disease (COPD) are chronically inflamed (3). This inflammatory process may

predispose to bacterial colonization and (recurrent) infection of the lower respiratory

tract, with Haemophilus influenzae as one of the most frequently isolated pathogens

(11,19). H. influenzae persists in the airways of these patients, despite the abundant

presence of bactericidal antibodies and neutrophilic antimicrobial peptides including

neutrophil defensins [also referred to as human neutrophil peptides, HNP] (7,8,15).

Previously, we have shown that defensins affect the interaction of H. influenzae

with epithelial cells by enhancing bacterial adherence, a process for which

metabolically-active cells are required (9,10). This effect was observed using isotonic

cell culture media that restrict the salt-dependent antimicrobial activity of defensins.

Since both H. influenzae (4,14,20) and neutrophil defensins (23,24) induce the release

of the pro-inflammatory cytokines interleukin-8 (IL-8) and IL-6, we determined

Neutrophil defensins amplify H. Influenza-induced IL-8 production

107

whether the presence of defensins affects the IL-8 and IL-6 release induced by H.

influenzae. This is of particular interest because both IL-8 (1) and IL-6 (13,18) are key

mediators in neutrophilic inflammation. The human lung mucoepidermoid carcinoma-

derived epithelial cell line NCI-H292 was used as a model, since this cell line was

previously used for the adherence studies with H. influenzae and defensins (9,10), as

well as for unraveling regulatory mechanisms in the IL-8 and IL-6 responses

(4,16,17).

In this study, we show that the IL-8 and IL-6 release by NCI-H292 epithelial cells

upon exposure to H. influenzae increased synergistically in the presence of neutrophil

defensins. For IL-8, the increased release was due at least in part to a reduced IL-8

mRNA degradation.

Materials and MethodsBacterial strains, culture and lipooligosaccharide (LOS)

Haemophilus influenzae strains were cultured on chocolate agar plates (Oxoid,

Haarlem, The Netherlands). For the present study, we used strains A850048 and

A950006, which were characterized earlier (9,10,21) as non-adherent and adherent to

NCI-H292 cells, respectively. The bacteria were resuspended in PBS so that the

optical density at 600 nm was 1, which corresponds to about 109 CFU/ml. These

suspensions were used in adherence assays, whereas 10-fold dilutions of the bacterial

stocks in PBS were used for IL-8 and IL-6 release. LOS was purified from H.

influenzae strain 770235 using hot-phenol extraction as described previously (25).

Cell culture

NCI-H292 cells (ATCC CRL 1848) (2) were maintained in RPMI 1640 medium (In

Vitrogen, Paisley, UK) supplemented with 10% fetal calf serum (FCS). The cells

were maintained in the absence of antibiotics and grown in 25 or 75 cm2 culture flasks

(Falcon) at 37°C in a humidified atmosphere containing 5% CO2. For cytokine

release, 3x105 cells were plated and grown overnight in 500 μl in 24-wells plates. For

isolation of mRNA and nuclear extracts, 15x105 cells were plated and grown

overnight in 2.5 ml in 6-wells plates. For the adherence assays, 3x105 cells were

plated and grown overnight in 500 μl in 24-wells plates on round glass coverslips (12

mm diameter) (Menzelgläser, Braunschweitz, Germany). The culture medium was

Chapter 7

108

replaced by RPMI 1640 medium without FCS and incubated for another night prior to

the addition of bacteria and/or defensins.

Isolation of neutrophil defensins

The neutrophil defensins were isolated as a mixture of HNP-1, HNP-2, and HNP-3

from an acetic acid extract obtained from human neutrophilic granules using gel

filtration chromatography on Sephacryl S-200 HR (2.5x100 cm) (Pharmacia, Uppsala,

Sweden) as described (23). The purity of the defensins was assessed by SDS-PAGE,

acid urea-PAGE, and mass spectrometry (12,23).

Exposure of NCI-H292 cells to bacteria and defensins

Cells were exposed in serum-free RPMI medium to 106 CFU/ml H. influenzae, and/or

20 μg/ml HNP1-3 (unless indicated otherwise) in a 1 ml final volume for both 24- and

6-wells plates. As a positive control, TNF-α (rhTNF- , R&D Systems, Minneapolis,

MN, USA) (20 ng/ml in 24-well plates and 5 ng/ml in 6-wells plates) was used. Four

h after the initial exposure, 3 μg/ml chloramphenicol was added to all wells. This

concentration of chloramphenicol inhibited bacterial growth, as determined by colony

counts after 24 h incubation, but did not affect IL-8 and IL-6 release. In selected

experiments, heat-inactivated bacteria (56°C for 30 min) and purified LOS from H.

influenzae strain 770235 (100 μg/ml) were used. To examine the effect of

dexamethasone (dex) on IL-8 and IL-6 release, the cells were co-exposed with or

without pre-exposure for 16 h to dexamethasone (Sigma Chemical Co; 1 μM).

After the appropriate time of stimulation, the culture supernatants from the 24-

wells plates were collected and stored at –20°C until analysis. The NCI-H292 cells

from the 6-wells plates were lyzed with TRIzol reagent (In Vitrogen) to isolate RNA

according to the manufacturer’s protocol. Alternatively, after the exposure of the

epithelial cells grown in 6-wells plates, nuclear extracts were prepared (as outlined

below).


The amounts of IL-8 and IL-6 in culture supernatants were measured using ELISA

kits from Sanquin/CLB (Amsterdam, The Netherlands) according to the

manufacturer’s protocol.


109

RNA analysis

IL-8 and IL-6 mRNA were determined essentially as described (16,17), using dot-

blotting instead of Northern blotting. After hybridization with 32P-labeled probes for

IL-8 or IL-6 that were extensively tested for specificity on northern blot (16,17),

mRNA levels were quantified using a phosphorimager and variable loading was

corrected for by expressing mRNA levels relative to the housekeeping GAPDH

mRNA. The stability of IL-8 and IL-6 mRNA was analyzed following co-incubation

with actinomycin D (5 μg/ml) (Sigma Chemical Co) for 0, 40, and 80 min, after 8 and

24 h exposure to H. influenzae and defensins.


Nuclear extracts were isolated after 1, 2, 4 and 24 hr stimulation with 106 CFU/ml H.

influenzae strain A850048 and/or 20 μg/ml defensins and was performed as described

(16,17). Protein concentrations were measured using a protein assay kit (Biorad,

Hercules, CA). Two μg of the nuclear extracts were incubated with 32P-labeled

oligonucleotides at 4°C for 1 h as described (16,17) and separated on a 4% non-

reducing poly-acrylamide gel at slowly increasing voltages (80-200V). The specificity

of the bands was confirmed by supershift using 1 μg of antibodies against p65 for NF-

κB, c-fos and c-jun for AP-1, and C/EBP-β for C/EBP (Santa Cruz Biotechnology

Inc., Santa Cruz, CA). The intensity of the bands was quantified using a

phosphorimager. The following oligonucleotides were used in the EMSA: NF-κB, 5’-

TTGCAAATCGTGGAATTTCCTCTGACATAA-3’; AP-1, 5’-TTAAGTGTGAT

GACTCAGGTTTAA-3’; C/EBP, 5’-TTAAAGGACGTCACATTGCACAATCTTA

ATAA-3’.

Bacterial adherence assay

The adherence assay (9,22,10) was used to determine whether adherence of H.

influenzae strains was affected by the presence of 1 μM dexamethasone. Briefly, cells

were pre-treated with 1 μM dexamethasone for 16 h and incubated in the presence of

1 μM dexamethasone (Sigma Chemical Co) with bacteria and defensins at final

concentrations of 108 CFU/ml and 20 μg/ml, respectively. After 4 h of incubation and

subsequent washing, the cells were fixed in 4% paraformaldehyde and 1%

Chapter 7

110

glutaraldehyde and the number of adherent bacteria was counted using light

microscopy (9,22).


The data were statistically analyzed by a student’s t-test and differences were

considered significant at p < 0.05.

Results

Time-dependent IL-8 and IL-6 release by NCI-H292 cells after exposure to H.

influenzae and defensins.

The effect of H. influenzae (106 CFU/ml) and neutrophil defensins (20 μg/ml) on IL-8

and IL-6 release by NCI-H292 cells was determined after 6, 24 and 30 h of exposure.

Exposure for 6 h of the cells to the non-adherent H. influenzae strain A850048 or to

defensins resulted in a low IL-8 release, whilst IL-6 was not released (Table 1). The

combination of H. influenzae strain A850048 and defensins resulted in a non-

significant 2-fold increased IL-8 release and in a low release of IL-6 (Table 1).

Exposure for 24 h to either H. influenzae strain A850048 or defensins resulted in a

low release of IL-8 and IL-6 (Table 1). Exposure for 24 h to the combination of H.

influenzae and defensins synergistically increased the IL-8 and IL-6 release (p < 0.04)

(Table 1). Exposure for 30 h to H. influenzae strain A850048 resulted in increased IL-

8 and IL-6 levels compared to those after 24 h. At this time point, the synergistic

effect of defensins on the IL-6 release was no longer present, whereas it persisted for

IL-8 (Table 1).


111

Table 1. Levels of IL-8 and IL-6 in cell culture supernatant of NCI-H292 cells after 6, 24, and 30 h of

exposure to H. influenzae (Hi) strain A850048 (106 CFU/ml), defensins (HNP1-3, 20 μg/ml), or a

combination of both.

6 h 24 h 30 h

IL-8† IL-6 IL-8 IL-6 IL-8 IL-6

control < 15 < 10 < 15 < 10 < 15 < 10

Hi 23 ± 7 < 10 204 ± 119 35 ± 22 636 ± 238 284 ± 172

HNP 24 ± 9 < 10 153 ± 101 24 ± 27 100 ± 54 24 ± 24

Hi+HNP 66 ± 36 22 ± 25 1090 ± 350* 182 ± 72* 1517 ± 672* 367 ± 89

† data are expressed as the average ± SEM (pg/ml) for three independent experiments, each

performed in triplicate. * p < 0.05 compared to Hi A850048 alone and defensins alone and to the sum

of both

IL-8 and IL-6 release as a function of bacterial load and amount of defensins

We next determined the IL-8 and IL-6 release in 24 h following exposure to various

concentrations of H. influenzae strain A850048 and defensins. Only at 105 and 106

CFU/ml of H. influenzae, defensins synergized with H. influenzae in IL-8 and IL-6

release (Fig. 1). A more than 3-fold increased IL-8 release (p < 0.02) was found for

105 or 106 CFU/ml of H. influenzae and 10 or 20 μg/ml defensins compared to the

exposure to either H. influenzae or defensins (Fig. 1A). Similarly, IL-6 release

increased more than 3-fold (p < 0.02) with 105 or 106 CFU/ml of bacteria and 10 or 20

μg/ml of neutrophil defensins (Fig. 1B). Higher numbers of H. influenzae (107 and

108 CFU/ml) in combination with defensins did not result in higher IL-8 and IL-6

release (Fig. 1). These results indicated that the synergism of H. influenzae and

defensins was most prominent in the presence of low numbers of bacteria.

Chapter 7

112

Fig. 1. The release of IL-8 (A) and IL-6 (B) by NCI-H292 cells after 24 h exposure to various numbers of H. influenzae (Hi) strain A850048 and various concentrations of neutrophil defensins (HNP1-3). The results are expressed as the average and SEM of at least three independent experiments, each performed in triplicate. *, p < 0.05 compared to the IL-8 and IL-6 levels released after exposure to either H. influenzae or defensins as well as to their sum.

Further characteristics of the synergism between H. influenzae and defensins in IL-8

and IL-6 release.

To determine whether the synergism observed for the non-adherent strain and

defensins also occurred for an adherent strain, the NCI-H292 cells were exposed to H.

influenzae strain A950006. Exposure for 24 h to H. influenzae strain A950006 (106

CFU/ml) in combination with defensins (20 μg/ml) resulted in a more than 3-fold

increased IL-8 and IL-6 release compared to the release upon exposure to either H.

influenzae strain A950006 or defensins alone (p < 0.04) (Fig. 2). There was no

difference between the non-adherent and the adherent strain.


113

Fig. 2. The release of IL-8 (A) and IL-6 (B) by NCI-H292 cells after 24 h exposure to 106 CFU/ml H.influenzae strain A850048 or A950006 in the absence (-) and presence (+) of 20 μg/ml neutrophil defensins (HNP1-3). Viable or heat-inactivated (56°C for 30 min) H. influenzae strains were used. The results are expressed as the average and SEM of at least three independent experiments, each performed in triplicate. *, p < 0.05 compared to the IL-8 or IL-6 levels released after exposure to either H. influenzae or defensins as well as to their sum; **, p < 0.05 compared to the IL-8 or IL-6 levels released after exposure to either H. influenzae or defensins.

In a further series of experiments, we determined whether viable bacteria were

required for the synergism. The NCI-H292 cells were exposed to heat-inactivated

bacteria (56°C for 30 min). Exposure to the combination of heat-inactivated H.

influenzae strain A850048 and defensins resulted in a significantly more than 2-fold

increased IL-8 release (p < 0.05) and in a slightly higher IL-6 release compared to the

viable strains (Fig. 2). These findings indicated that no viable bacteria are required

and that a heat-stable bacterial component is involved. A heat-stable H. influenzae

component is LOS. In addition, LOS induces IL-8 and IL-6 release by epithelial cells

(20). Therefore, we studied whether purified H. influenzae LOS in combination with

Chapter 7

114

defensins displayed an effect on the IL-8 and IL-6 release by epithelial cells.

Exposure of NCI-H292 cells to 100 μg/ml purified LOS from H. influenzae for 24 h,

resulted in a release of 322 ± 122 pg/ml IL-8 and 211 ± 33 pg/ml IL-6 (n = 3). The

release of these cytokines by the combination of purified LOS and defensins (20

μg/ml) was not enhanced.

Effect of H. influenzae and defensins on IL-8 and IL-6 mRNA levels

To examine the mechanism by which the combination of H. influenzae and defensins

enhanced the IL-8 and IL-6 release, we first determined IL-8 and IL-6 mRNA

expression with time (Fig. 3). Only exposure to bacteria and to bacteria with defensins

resulted in a marked but slow increase of IL-8 and IL-6 mRNA levels, in accordance

with the kinetics of the IL-8 and IL-6 release. Exposure to H. influenzae (106 CFU/ml)

and defensins (20 μg/ml) for 24 h yielded higher IL-8 and IL-6 mRNA levels as

compared to those observed with either bacteria or defensins alone, but the difference

did not reach statistical significance.

Fig. 3. IL-8 (A) and IL-6 (B) mRNA levels in NCI-H292 cells after exposure to H. influenzae strain A850048 (106 CFU/ml) and neutrophil defensins (HNP1-3, 20 μg/ml). The results are expressed as fold-increase compared to resting, non-exposed cells. The average and SEM of three independent experiments, each performed in duplicate or triplicate are shown.


115

Effect of H. influenzae and defensins on transcriptional activity

IL-8 gene transcription in TNF-α- and LPS-stimulated NCI-H292 cells is dependent

on transcription factor nuclear factor κB (NF-κB) and activator protein-1 (AP-1) (17).

The production of IL-6 is dependent on the transcription factor CCAAT/enhancer

binding protein (C/EBP) (16). To determine whether the synergism between H.

influenzae and defensins is related to an increased activation (i.e. increased nuclear

localization and specific DNA-binding capacity) of the relevant transcription factors,

we performed electrophoretic mobility shift assays (EMSA) with nuclear extracts. No

marked increase in the DNA-binding activity of the transcription factors compared to

the control was observed for any of the conditions tested (Fig. 4), whereas stimulation

with TNF-α showed increases for NF-κB and AP-1 DNA-binding activities. These

results indicated that the synergism by H. influenzae and defensins in IL-8 and IL-6

release was apparently not due to increased activation of the studied transcription

factors.

Fig. 4. The DNA-binding activities for NF-κB (A), AP-1 (B) and C/EBP (C) in nuclear extracts from NCI-H292 cells upon exposure to H. influenzaestrain A850048 (106 CFU/ml) and neutrophil defensins (HNP1-3, 20μg/ml). The quantification of electophoretic mobility shift assays from three independent experiments is given.

Chapter 7

116

Effect of H. influenzae and defensins on IL-8 and IL-6 mRNA degradation

To determine whether the synergism in IL-8 and IL-6 mRNA release was dependent

on a reduced IL-8 and IL-6 mRNA degradation, mRNA half-lives were assessed after

8 and 24 h of exposure to H. influenzae strain A850048 (106 CFU/ml) and defensins

(20 μg/ml). IL-8 mRNA degradation in cells after 24 h of exposure to H. influenzae

and defensins revealed mRNA stabilization (Fig. 5B). Defensins alone tended to

increase the half-life of IL-8 mRNA, but this was not significant compared to that by

H. influenzae alone. For IL-6 mRNA at 8 and 24 h of exposure and for IL-8 mRNA at

8 h of exposure, no differences in mRNA stability were observed for the different

stimuli (Fig. 5). These results indicated that the synergism between H. influenzae and

defensins in IL-8 release was, at least in part, due to an increased stability of IL-8

mRNA.

Fig. 5. Stability of IL-8 (A,B) and IL-6 (C,D) mRNA after 8 h (A,C) and 24 h (B,D) of exposure to H. influenzae strain A850048 (106 CFU/ml) and neutrophil defensins (HNP1-3, 20 μg/ml). The results are expressed as the average and SEM of five different experiments, each performed in duplicate or triplicate. *, p < 0.05 compared to the rate of mRNA degradation upon exposure to either H. influenzaeor defensins alone; #, p < 0.01 compared to the rate of mRNA degradation upon exposure to H. influenzae alone.


117

Effect of dexamethasone on IL-8 and IL-6 release

Corticosteroids exert anti-inflammatory effects by modulating the expression of many

inflammatory mediators such as IL-8 and IL-6 (5). In this study, the effect of the

corticosteroid dexamethasone on the IL-8 and IL-6 release by NCI-H292 cells

induced by H. influenzae strain A850048 and A950006 (106 CFU/ml) and defensins

(20 μg/ml) was assessed. The IL-8 and IL-6 release upon exposure to H. influenzae

strain A850048 as well as strain A950006 and defensins was significantly inhibited by

simultaneous exposure to 1 μM dexamethasone (Fig. 6) and this inhibition was even

more pronounced following a 16 h-preincubation with dexamethasone prior to

stimulation (data not shown).

The adherence of both H. influenzae strains as well as the defensin-enhanced

adherence of these strains were not affected by dexamethasone (Table 2). These

results indicated that the H. influenzae plus defensin-induced IL-8 and IL-6 release

was sensitive to dexamethasone.

Fig. 6. Effect on IL-8 (A) and IL-6 (B) release after 24 h of exposure to H. influenzae strain A850048 (106 CFU/ml) and neutrophil defensins (HNP1-3, 20 μg/ml) in the absence or presence of dexamethasone (dex). Dex was added simultaneously with defensins and bacteria. The results are expressed as the average and SEM of four independent experiments, each performed in triplicate. *, p < 0.05 compared to the control in the absence of dex.

Chapter 7

118

Table 2. Effect of dexamethasone (dex, 1 μM) on the adherence of H. influenzae to NCI-H292 cells in

the presence and absence of neutrophil defensins (HNP1-3, 20 μg/ml)

Adherence†

control range dex range

A850048 0 0

A850048 + HNP1-3 138 (108-179) 137 (99-197)

A950006 23 (13-35) 26 (12-59)

A950006 + HNP1-3 126 (96-172) 106 (94-117)

† adherence (bacteria / epithelial cell) as determined by light microscopy of two different

experiments, each performed in duplicate

Discussion

The results from the present study show that the combination of H. influenzae and

neutrophil defensins synergistically increases the release of the pro-inflammatory

cytokines IL-8 and IL-6. This synergism was observed using isotonic cell culture

media that restrict the salt-dependent antimicrobial activity of defensins. For IL-8, the

synergism involves at least stabilization of IL-8 mRNA. The mechanism underlying

the synergism for IL-6 remains to be resolved.

Neutrophil defensins increased the H. influenzae-induced release of IL-8 and IL-6

particularly at early time points (i.e. 6 and 24 h after initial exposure) and at low

bacterial loads. These findings may indicate that inflammatory responses to infection

are promoted by defensins especially at early stages of infection and when low

numbers of bacteria are present. It is of interest to note that in the presence of high

numbers of bacteria, defensins did not further increase IL-8 and IL-6 release. It may

be envisaged that this mechanism limits extensive inflammation and subsequent tissue

damage.

Defensins synergized in the release of IL-8 and IL-6 with both viable and heat-

inactivated H. influenzae, suggesting that no live bacteria are required and that the

relevant bacterial component is heat-stable. Although LOS of H. influenzae is heat-

stable and has been shown to induce IL-8 and IL-6 release by epithelial cells (20),

purified LOS combined with defensins did not synergize in the release of IL-8 and IL-

6. Purification of LOS may have affected its conformational state (21), which may


119

have prevented synergism and, therefore, it does not exclude LOS as a relevant

component in the defensin-mediated synergized IL-8 and IL-6 release. Alternatively,

another heat-stable bacterial component, such as peptidoglycan, may be involved in

the synergism between defensins and bacteria in IL-8 and IL-6 release.

The induction of IL-8 and IL-6 protein by H. influenzae and defensins is slow as

compared to previous studies with this cell line when exposed to TNF-α (16,17). This

is also reflected at the mRNA level, where no clear peaks were observed, but instead a

gradual increase. In a previous study, using higher concentrations of HNP-1 (100

μg/ml) than those used in the present study, a marked increase in IL-8 mRNA was

observed at 3-6 h in cells of the airway epithelial cell line A549 and subcultures of

primary bronchial epithelial cells (23). In the present study, the most pronounced

effect was seen when H. influenzae and defensins were combined, apparently

resulting in further increased IL-8 and IL-6 mRNA levels of NCI-H292 cells after 24

h of exposure. In line with these findings, no clear differences were observed for the

transcriptional activation by H. influenzae and defensins compared to the control. The

most significant effect was on IL-8 mRNA degradation, which is an important

mechanism to modulate mRNA levels. The combination of H. influenzae and

defensins as well as defensins alone increased the stability of IL-8 mRNA after 24 h

of exposure. In line with our results that 8 h exposure to neutrophil defensins did not

affect the half-life of IL-8 mRNA in NCI-H292 cells, it was shown previously that

defensins did not affect the stability of IL-8 mRNA in A549 cells after 6 h of

exposure (23).

Whereas numerous in vitro and in vivo studies have shown that glucocorticoids

reduce the expression of the pro-inflammatory cytokines, their contribution to the

control of airway inflammation in COPD is highly controversial. Pre-treatment of

cells with the glucocorticoid dexamethasone, as well as the simultaneous addition of

dexamethasone to H. influenzae and/or defensins-exposed NCI-H292 cells, resulted in

a reduced IL-8 and IL-6 release. This is in line with our previous observation that

dexamethasone inhibited the neutrophil defensin-induced cytokine release by airway

epithelial cells (24). However, despite the use of dexamethasone, defensins and H.

influenzae still seemed to synergize in IL-8 and IL-6 release, although this was only

statistically significant (p=0.028) for IL-6 production by Hi A950006 and a trend for

IL-8 release by Hi A850048 (p=0.097) (Figure 6). In view of these data and the

Chapter 7

120

apparent reduced sensitivity of the inflammatory process to glucocorticoids in COPD,

it is tempting to speculate that defensins contribute to the decreased glucocorticoid

sensitivity. Previously, it was shown that dexamethasone may reduce IL-8 and IL-6

gene expression by promoting IL-8 and IL-6 mRNA degradation (6). Since exposure

of NCI-H292 cells to H. influenzae and defensins increased IL-8 mRNA stability, it

may be envisaged that this counteracts the inhibitory effect of dexamethasone on IL-8

expression.

In summary, the results from this study show a synergism in the release of pro-

inflammatory cytokines IL-8 and IL-6 from NCI-H292 cells upon exposure to H.

influenzae and neutrophil defensins, which is particulary apparent at low bacterial

loads and low amounts of defensins. In vivo, defensins may display two faces. When

the salt-dependent antimicrobial activity of defensins is not restricted by the local

environment, defensins will directly contribute to killing of micro-organisms. If this

activity does not suffice, defensins may indirectly contribute to host defence by

lowering the threshold so that low bacterial numbers will evoke an adequate host

defence response through the production of cytokines such as IL-8 and IL-6 that are

important in neutrophil accumulation in the lung (1,13,18). Furthermore, the

synergistically enhanced release of IL-8 may perpetuate inflammatory responses that

could contribute to chronic airway inflammation in COPD patients with bacterial

infections.

Acknowledgments The authors thank Sylvia Lazeroms (Department of Pulmonology, Leiden University Medical Center, Leiden, The Netherlands) for the isolation of HNP1-3. This work was supported by the Netherlands Asthma Foundation (grant number 95.36 and 99.27).

References

1. Baggiolini M, Dewald B, and Moser B. Interleukin-8 and related chemotactic cytokines--CXC and CC chemokines. Adv Immunol 55: 97-179, 1994.

2. Banks-Schlegel SP, Gazdar AF, and Harris CC. Intermediate filament and cross-linked envelope expression in human lung tumor cell lines. Cancer Res 45: 1187-1197, 1985.

3. Barnes P. Chronic obstructive pulmonary disease. N Engl J Med 343: 269-280, 2000. 4. Bresser P, Van Alphen L, Habets FJM, Hart AAM, Dankert J, Jansen H, and Lutter R.

Persisting Haemophilus influenzae strains induce lower levels of interleukin-6 and interleukin-8 in H292 lung epithelial cells than nonpersisting strains. Eur Respir J 10: 2319- 2326, 1997.


121

5. Burnstein KL and Cidlowski JA. Regulation of gene expression by glucocorticoids. Ann Rev Physiol 51: 683- 699, 1989.

6. Chang MM, Juarez M, Hyde DM, and Wu R. Mechanism of dexamethasone-mediated interleukin-8 gene suppression in cultured airway epithelial cells. Am J Physiol 280: L107-L115, 2001.

7. Ganz T and Lehrer RI. Antimicrobial peptides of vertebrates. Curr Opin Immunol 10: 41-44, 1998.

8. Ganz T, Selsted ME, Szklarek D, Harwig SSL, Daher K, Bainton DF, and Lehrer RI.Defensins. Natural peptide antibiotics of human neutrophils. J Clin Invest 76: 1427-1435, 1985.

9. Gorter AD, Eijk PP, van Wetering S, Hiemstra PS, Dankert J, and Van Alphen L.Stimulation of the adherence of Haemophilus influenzae to human lung epithelial cells by antimicrobial neutrophil defensins. J Infect Dis 178: 1067-1074, 1998.

10. Gorter AD, Hiemstra PS, de Bentzmann S, van Wetering S, Dankert J, and Van Alphen L.Stimulation of bacterial adherence by neutrophil defensins varies among bacterial species but not among host cell types. FEMS Immunol Med Microbiol 28: 105-111, 2000.

11. Groeneveld K, Van Alphen L, Eijk PP, Visschers G, Jansen HM, and Zanen HC.Endogenous and exogenous reinfections by Haemophilus influenzae in patients with chronic obstructive pulmonary disease; the effect of antibiotic treatment upon persistence. J Infect Dis161: 512-517, 1990.

12. Harwig SSL, Ganz T, and Lehrer RI. Neutrophil defensins: purification, characterization, and antimicrobial testing. Methods Enzymol 236: 160-172, 1994.

13. Kelley J. Cytokines of the lung. Am Rev Respir Dis 141: 765-788, 1990. 14. Khair OA, Davies RJ, and Devalia JL. Bacterial-induced release of inflammatory mediators by

bronchial epithelial cells. Eur Respir J 9: 1913-1922, 1996. 15. Raj PA and Dentino AR. Current status of defensins and their role in innate and adaptive

immunity. FEMS Microbiol Lett 206: 9-18, 2002. 16. Roger T, Out TA, Jansen HM, and Lutter R. Superinduction of interleukin-6 mRNA in lung

epithelial H292 cells depends on transiently increased C/EBP activity and durable increased mRNA stability. Biochim Biophys Acta 1398: 275-284, 7-9, 1998.

17. Roger T, Out TA, Mukaida N, Matsushima K, Jansen HM, and Lutter R. Enhanced AP-1 and NFκB activities and stability of interleukin 8 (IL-8) transcripts are implicated in IL-8 mRNA superinduction in lung epithelial H292 cells. Biochem J 330: 429-435, 1998.

18. Sethi S, Evans N, Grant BJ, and Murphy TF. New strains of bacteria and exacerbations of chronic obstructive pulmonary disease. N Engl J Med. 347(7):465-71, 2002.

19. Suwa T, Hogg JC, Klut ME, Hards J, and van Eeden SF. Interleukin-6 changes deformability of neutrophils and induces their sequestration in the lung. Am J Respir Crit Care Med 163: 970-976, 2001.

20. Tong HH, Chen Y, James M, van Deusen J, Welling DB, and DeMaria TF. Expression of cytokine and chemokine genes by human middle ear epithelial cells induced by formalin-killed Haemophilus influenzae or its lipooligosaccharide htrB and rfaD mutants. Infect Immun 69: 3678-3684, 2001.

21. Van Alphen L, Verkleij A, Burnell E, and Lugtenberg B. 31P nuclear magnetic resonance and freeze-fracture electron microscopy studies on Escherichia coli. II. Lipopolysaccharide and lipopolysaccharide-phospholipid complexes. Biochim Biophys Acta 597: 502-517, 4-24-1980.

22. van Schilfgaarde M, Van Alphen L, Eijk P, Everts V, and Dankert J. Paracytosis of Haemophilus influenzae through cell layers of NCI-H292 lung epithelial cells. Infect Immun 63: 4729-4737, 1995.

23. van Wetering S, Mannesse-Lazeroms SPG, van Sterkenburg MAJA, Daha MR, Dijkman JH, and Hiemstra PS. Effect of defensins on interleukin-8 synthesis in airway epithelial cells.Am J Physiol 272: L888-L896, 1997.

24. van Wetering S, Mannesse-Lazeroms SPG, van Sterkenburg MAJA, and Hiemstra PS.Neutrophil defensins stimulate the release of cytokines by airway epithelial cells: modulation by dexamethasone. Inflamm Res 5t: 8-15, 2002.

25. Westphal O and Jann JK. Bacterial lipopolysaccharide biosynthesis in pathogenic Neisseria. Cloning, identification, and characterization of the phosphoglucomutase gene. Eur J Biochem 9: 245-249, 1965.

122

123

8Discussion

Discussion

124

The inflammatory airway diseases asthma and chronic obstructive pulmonary disease (COPD)

represent major global causes of disability and death, whereby COPD is estimated to become

the third most common cause of death by 2020 [1]. The current treatment with corticosteroids,

though applied successfully to contain most cases of asthma (for review see [2]), is not very

effective in suppressing inflammation in COPD and patients with severe corticosteroid-

resistant asthma [3,4]. Furthermore, the continuous admission of high doses of steroids can

have adverse effects on the patients’ health. Thus, there is still a need to further improve anti-

inflammatory interventions and therefore to improve the understanding of inflammatory gene

expression in the airways.

Lung fibroblasts and airway epithelial cells, lining the airway, are part of the innate

immune system that will respond to hazards present in the environment. To that end, these

structural lung cells produce a large range of products such as anti-microbial agents like

defensins and enzymes (lysozyme), anti-oxidants, secretory IgA/IgM and mucins. In addition,

these cells produce pro-inflammatory and anti-inflammatory mediators, attracting and/or

activating various inflammatory and immune cells, thus directing both the innate and the

adaptive immune response. These inflammatory mediators need to be produced in a tightly

controlled fashion, as they can be quite detrimental when being under- or overproduced,

leading to collateral tissue damage and ultimately disturb the functioning of organs.

A consistent feature in stable and exacerbating COPD (and severe asthma) are the

increased sputum/lavage levels of interleukin-8 (IL-8), which are paralleled by markedly

increased number of neutrophils in the airways [5,6]. Airway epithelial cells obtained from

patients with COPD display a significant upregulation of IL-8 production compared to non-

COPD smokers and control subjects, indicative of an aberrant control of IL-8 gene expression

[7]. Another reason for implicating airway epithelial cells in inflammation in COPD and

asthma is that viruses and bacteria, which induce exacerbations, predominantly target and thus

activate airway epithelial cells. Along similar lines also fibroblasts have been implicated in

asthma, for example as increased numbers of fibroblasts lie adjacent to thickened areas of the

subepithelial lamina reticularis [8-10]. Taken together, this supports the notion that structural

lung cells may play an important role in directing and perpetuating inflammation in COPD

and asthma.

Chapter 8

125

Whilst over the last decades, much attention has been paid to the transcriptional regulation of

inflammatory mediator production in structural lung cells, another key mechanism in

controlling the inflammatory response is at the post-transcriptional level of mRNA stability.

Previous work with airway epithelial cells by our group indicated that alterations in the rate of

mRNA degradation can have major effects on the production of inflammatory mediators [11-

14].

This thesis comprises studies that show that the rate of mRNA degradation is easily

affected in a number of conditions relevant to pulmonary inflammatory diseases, and that that

can lead to exaggerated production of inflammatory mediators. Furthermore, mRNA

translation, another post transcriptional control mechanism, is also involved in controlling the

inflammatory mediator response. In both airway epithelial cells and fibroblasts, IL-6 and IL-8

mRNA stability and protein production were increased by the T-cell mediator IL-17, which is

present in elevated levels in patients with asthma [15] and COPD patients during acute

exacerbations [16] (chapter 3). Addition of corticosteroids led to an increased mRNA

degradation and concomitant decrease in IL-8 and IL-6 production (chapter 5). Changes in

airway epithelial cell cytoskeleton morphology, that can occur during cellular repair, bacterial

and viral infections, decreased mRNA degradation and selectively inhibited IL-6 translation,

resulting in a increased IL-8 production and a decreased IL-6 production (chapter 4). The co-

exposure of airway epithelial cells to neutrophil defensins and Haemophilus influenzae,

bacteria often found in the lungs of COPD patients [17,18], also affected mRNA stability

(chapter 7). Thus, post-transcriptional mechanisms are surprisingly often modified and can

have large quantitative and qualitative effects on the inflammatory mediator response. This

designates it as a potential mechanism for intervention in inflammatory pulmonary diseases.

The mechanistic natures of the studies described in this thesis have limited our

experimental approach to in vitro cell culture systems of well characterized cell lines and

primary cells. The cytokine IL-6 and chemokine IL-8, besides being important mediators by

themselves and being implicated in COPD and asthma, can serve also as a model for other

mediators belonging to the family of response genes, many of which are inflammatory

mediators.

Control of inflammatory gene expression:

Transcription plays a pivotal role in the onset of an inflammatory response. The inflammatory

response starts by the triggering of a receptor that, through a cascade of 2nd messengers,

activate transcription factors that consequently locate to the nucleus. Nuclear Factor-κB is

Discussion

126

considered a key player in the transcription of many inflammatory genes, but Activator

Protein-1 and CAAT/Enhancer Binding protein are also important transcription factors

[19,20]. The activation of all three has been studied in this thesis. Activated transcription

factors bind to specific DNA motifs in the promoter of a gene and recruit cofactors with

histone acetylase activity (see e.g. [21] for review). This complex then unwinds the DNA

allowing DNA transcription by RNA polymerases, ultimately leading to the formation of

mature mRNA that is subsequently translated in a protein.

The level of mRNA measured at a single time point does not necessarily predict the

amount of protein produced however, which is especially true for inflammatory mediators. A

striking example illustrating this came from our studies into the effect of E1A expression

(chapter 2), where there was no correlation between the amount of IL-6 and IL-8 mRNA

produced and the amount of protein secreted when comparing different clones expressing

early adenoviral gene(s) (unpublished results, see figure 1). The same holds true for IL-6

production after cytoskeleton disruption (chapter 4), where despite abundant presence of IL-6

mRNA, no protein is produced due to translational silencing of IL-6 mRNA.

Figure 1: Comparison between levels of IL-6 mRNA expression (upper left panel) and IL-6 protein production

(upper right panel) in different clones 1 hour after stimulation with 5 ng/ml TNF-α. The same is shown for IL-8

in the lower panels.

Chapter 8

127

Many of the mRNAs encoding inflammatory mediators belong to the family of so called

‘early response genes’. A common feature of early response genes is that their transcription is

rapidly but transiently upregulated and that the levels of mRNA are quickly downregulated

again, resulting in a limited amount of protein being produced (See figure 4, Chapter 3). The

rapid downregulation of mRNA levels comes about by the intrinsic instability of these

mRNAs, which is often associated with AUUUA-repeats (AREs) present in the 3’-UTR of

these genes [22-28]. Depending on the number and composition of the AREs, response genes

have been divided in 3 classes [24,29,30], that also show some functional homology. For

example, class I contains many secreted proteins that affect the growth of hematopoietic and

immune cells, and a lot of cytokines are encoded by mRNAs containing ClassII AREs. Class

III AREs, to which c-jun belongs, contain U-rich regions but no AREs.

The machinery controlling the rate of ARE containing mRNA degradation has been

subject to investigation, and over the last couple of years exciting progress has been made.

About 30 proteins have been described to bind to the ARE, some of which consequently

affected the stability of the ARE-containing mRNA, acting either as mRNA-stabilizing factors

or -destabilizing factors. As in NCI-H292 cells, inhibition of protein synthesis leads to a

stabilization of both IL-6 and IL-8 mRNA [19,20], it is likely that a labile protein is involved

in the targeting of the respective mRNAs to rapid decay. We found previously that IL-6 and

IL-8 are constitutively expressed by NCI-H292 cells, and that there are low levels of IL-6 and

IL-8 mRNA present in unstimulated cells. When the stability of these mRNAs was assessed,

they appeared to be quite stable (unpublished observation). This in turn suggests that after

stimulation with TNF- or LPS, another factor, is co-induced and targets the induced IL-6 and

IL-8 mRNA for rapid degradation. The identity of this factor remains to be investigated. In

other cells, ARE binding proteins such as HuR, AUF1 and the labile protein tristetraprolin

have been described to affect the stability of a number of ARE genes, as will be discussed

later.

Besides the fact that mRNA degradation appears inducible, we observed that the induced level

of IL-6 mRNA induction correlates with the rate of IL-6 mRNA decay in E1A clones (fig. 2),

although this correlation was less evident for IL-8.

Discussion

128

In line herewith, TNF- induces IL-6 and IL-8 mRNA to a higher level than LPS, and the

half-life of both messengers in response to TNF- is shorter than in response to LPS in normal

NCI-H292 cells (see table 1, unpublished results). It thus seems that the rate of IL-6 and IL-8

mRNA decay is dependent on their respective level in the cell. A similar observation was

made by Wax et al. for the rate of TNF- mRNA degradation in macrophages [31].

TNF-α LPS

mRNA level

(a.u.)

Half-life

(min)

mRNA level

(a.u.)

Half-life

(min)

IL-6 0.41 61 0.23 81

IL-8 0.74 49 0.32 80

Table 1: NCI-H292 cells were stimulated for 1 hr with 5 ng/ml TNF-a or 5 ug/ml LPS before Actinomycin D

was added to arrest transcription in order to assess the half-life of the mRNA. The level of mRNA (corrected for

GAPDH expression) at T0 is shown together with the mRNA half-life, illustrating the effect of initial mRNA

concentration on the half-life of the mRNA.

This may be simply related to enzyme kinetics, but may also indicate a more intricate relation

between gene expression and mRNA degradation. The use of inducible IL-6 transfectants or

microinjection or electroporation of in vitro synthesized IL-6 mRNA, and consequent studies

on the stability of multiple mRNAs could shed light upon this issue.

Proteins involved in post transcriptional regulation of ARE mRNA expression

About 30 proteins involved in post-transcriptional regulation of ARE gene expression have

been identified over the recent years, the most important of which are discussed below.

HuR is a member of the embryonic lethal abnormal vision (ELAV)-like family of RNA-

binding proteins. HuR binds AREs with high affinity and appears to function as an mRNA-

Figure 2: correlation between the half-life of IL-6 mRNA (y-axis) and the amount of induced IL-6 mRNA (x-axis) in different E1A/B transfected clones.

Chapter 8

129

stabilizing factor. HuR is not an abundant protein, and HuR levels can be easily perturbed by

overexpression resulting in stabilization of reporter mRNAs which contain AREs for GM-

CSF [32], TNF- [33], IL-3 [34] and COX-2 [35]. Suppression of HuR expression results in

destabilization of the ARE-containing mRNAs VEGF [36], cyclins A and B1 [37] and p21

[38] in agreement with the overexpression data.

AUF1 stands for ARE/poly-(U)-binding/degradation factor 1. It was originally identified as a

protein binding the c-Myc 3 UTR which displayed high affinity for poly-(U) RNA [39].

AUF1 exists as four different isoforms, p37, p40, p42 and p45 which result from differential

splicing of exons 2 and 7 [40]. Endogenous AUF1 binds the TNF- [41], GM-CSF and COX-

2 [42] AREs in EMSA of crude cell extracts. Both destabilizing and stabilizing roles for

AUF1 have been suggested from the results of overexpression experiments. ARE-directed

destabilization of a reporter mRNA was blocked during hemin-induced differentiation in

K562 cells [43]. Overexpression of AUF1 isoforms, in particular p37 and p42, was found to

restore rapid decay to the ARE reporter mRNAs in hemin-treated cells, suggesting a

destabilizing role [43]. The same group subsequently found that overexpression of AUF1

isoforms in NIH 3T3 cells resulted in stabilization of ARE reporter mRNAs, in particular,

those carrying class II AREs [44].

Tristetraprolin (TTP) binds class II AREs including those from TNF- [45,46], GM-CSF, IL-

3 [47] and COX-2 [35] mRNAs. TTP-null mice display an inflammatory phenotype

(inflammatory arthritis, dermatitis, cachexia, autoimmunity and myeloid hyperplasia) caused

by the expression of higher than normal levels of TNF- protein and mRNA [48]. LPS-

induced COX-2 protein levels are also much higher in TTP knockout mice than in wild-type

mice [49]. TNF- mRNA is more stable in macrophages from the knockout compared with

wild-type mice indicating that TTP has a destabilizing function [45].

The activation of the p38 Mitogen Activated Protein Kinase (MAPK) pathway is

associated with mRNA stabilization in a number of cell types (see [50,51] for review). This

pathway has recently been shown to up-regulate TTP expression at least in part by stabilizing

TTP mRNA via an ARE present in its 3 UTR [52]. Induction of TTP protein following p38

activation may serve as a negative feedback loop to destabilize mRNA, switching off mRNA

stabilization and preventing further gene expression.

Discussion

130

T cell-restricted intracellular antigen (TIA)-1 and TIA-related protein (TIAR) bind tightly to

uridylate-rich stretches of RNA [53]. TIAR was identified as a TNF- ARE binding protein in

a screen of a macrophage cDNA expression library [54]. TIA-1 was subsequently shown to

also bind the TNF- ARE in supershifts in EMSA [55]. TNF- mRNA steady-state levels and

stability are normal in TIA-1-null mice [55]. LPS-treated macrophages from these mice

produce approximately twice as much TNF- protein as wild-type mice whilst no defects

were seen in IL-1 , IL-6, GM-CSF or IFN- production [55]. In the case of TNF- , the

absence of TIA-1 was found to increase the association of the mRNA with polysomes and it

was suggested that TIA-1 functions as a translational silencer.

At present, we have established the expression of TTP, AUF1 and TIA-R by western blot in

NCI-H292 cells, and that there are no clear differences in expression of these proteins in E1A

clones. Whether these proteins are involved in the regulation of IL-6 and IL-8 mRNA

expression in NCI-H292 cells remains to be established. Transfection experiments using

dominant negative forms of these proteins, siRNA or inducible shRNA constructs and

overexpression studies could reveal their possible role in a number of different conditions

where the half-life of IL-8 and IL-6 mRNA are affected, for example after exposure to IL-17

and TNF- or cytoskeleton disruption.

A more interesting, but technically challenging approach to gain more insight in the

regulation of mRNA stability in lung epithelial cells would be to isolate ribosomes

specifically bound to IL-6 or IL-8 mRNA and analyze proteins bound to this complex. In the

past, strategies using antibodies to a protein target have been used to isolate the mRNA

encoding this target to identify its sequence. Exploiting the technique of polysome profiling,

we could apply a similar strategy to extract the complex actively translating IL-6 or IL-8

mRNA. These samples could than be subjected to 2-dimensional gel electrophoreses and mass

spectrometry. Recent trials using polyclonal IL-6 antibodies bound to magnetic beads have

shown that in theory it is possible to isolate large complexes containing IL-6 polysomes,

though the purity of the isolates needs further improvement. Nevertheless, this procedure may

allow us to confirm the involvement of known proteins and even to identify new proteins

specifically involved in the regulation of IL-6/8 mRNA degradation and translation in lung

epithelial cells. Possible targets can than be studied in vitro and in turn, protein expression

profiling of interesting candidate targets in patient material may ultimately contribute to

resolve aberrant expression of inflammatory markers in patients.

Chapter 8

131

A role for small RNA molecules in gene expression

Another emerging mechanism of post-transcriptional control of gene expression, independent

of the presence of AREs, is by the so called microRNAs (miRNAs). miRNAs are endogenous

short RNA molecules of about 22 nt [56] that the 3’-UTR of the target mRNA through

specific base pairing, resulting in either mRNA degradation or silencing of translation.

Shortly, the miRNA gene is transcribed by RNA polymerase 2 resulting in a relatively long

transcript (pri-miRNA) that contains a stem-loop structure, which is consequently cleaved

yielding the pre-miRNA [57]. The pre-miRNA is then transported to the cytoplasm and

processed by the enzyme Dicer, removing the loop structure thus yielding the miRNA duplex

of about 22 nt. The next step is the formation of the miRISC (miRNA containing RNA-

induced silencing complex) during which strand selection takes place [58-60].

In mammalian cells, depending whether the miRNA is a perfect or imperfect match to

its target either promotes mRNA degradation or translational silencing, respectively [61,62].

(See figure 3). A key component of the miRISC complex are the so called Argonaute proteins

[63], which are involved in both the mRNA degradation process as well as the translational

repression process [64,65].

Although in the lung miRNAs have been mostly associated with lung cancer until now

[66,67], there are indications that inflammatory mediators are also under control of miRNAs.

Figure 3: maturation, processing and function of microRNAs. Details as described in the text.

Discussion

132

Interestingly, knockdown of miR-289, a miRNA that is complementary to sequences in the

ARE of both IL-6 and IL-8 mRNA, led to an increase in the half-life of both IL-6 and IL-8

mRNA in Drosophila S2 cells [68], suggesting the involvement of miRNAs in the degradation

of these genes. At the time of writing, preliminary experiments indicate that in NCI-H292

cells, transient transfection with miR-16, that also contains a sequence complementary to the

IL-6 and IL-8 ARE, decreases the TNF- induced IL-8 and IL-6 production, although the

effect is less obvious for IL-6. Efforts are now underway to construct inducible transfectants

expressing various miRNA genes, including miR-16 and miR-289, to elucidate a possible role

of these miRNAs in controlling the inflammatory response in lung epithelial cells.

Translational control of gene expression

In mammalian cells, miRNAs seem to act not only as promoters of mRNA degradation, but

also as translational repressors. We have shown that, under conditions of cytoskeleton

disruption (chapter 4), IL-6 mRNA was translationally repressed, whereas IL-8 translation and

GAPDH translation (unpublished observation) remained unaffected. Transcript specific

downregulation of translation is not unique for IL-6 and has been described for other genes,

either via miRNAs or other mechanisms.

In the case of miRNA mediated translational repression, is was observed in C. elegans

that protein expression was reduced in spite of the fact that the mRNA level remained

unaffected [69] and thus it was concluded that translation was repressed. Further analysis in

mammalian cells indicated that depending on whether the small RNA molecule has a perfect

or incomplete match with its target, it promotes mRNA decay or inhibits the translation of the

target mRNA, respectively [61,62].

The miRNA-controlled silencing seems to take place in specific cellular

compartments, so called processing-bodies (p-bodies). P-bodies were first described about 4

years ago as a dynamic focal spot where decapping enzymes, necessary for mRNA

degradation, were concentrated along with other proteins involved in mRNA degradation

[70]. Besides playing a role in mRNA degradation, it was found that p-bodies contain

untranslated mRNA. Also, the Argonaute proteins, the core components of RISC, localized to

mammalian P-bodies and reporter mRNAs targeted for translational repression by miRNAs

became concentrated in P-bodies in a miRNA-dependent manner [64]. Furthermore, mRNA

can be exchanged between p-bodies, where they are translationally repressed, and polysomes,

where they are actively translated [71], indicating that the silencing is reversible. Thus,

miRNAs can regulate both mRNA stability and mRNA translation in a sequence specific

Chapter 8

133

manner and these processes seems to take place in specific cytoplasmic foci. This designates

miRNA forward as of paramount interest in post-transcriptional gene regulation.

Another example of sequence specific, non-miRNA mediated, translational repression

follows from studies into the regulation of ceruloplasmin (Cp) production by cytokine-

stimulated macrophages. IFN-γ stimulation of macrophages induces Cp mRNA and protein

expression [72], which is selectively terminated 16 hr after IFN-γ stimulation, despite of high

levels of remaining Cp mRNA [73]. An inhibitory factor was found in the cytoplasm that

blocked in vitro Cp translation and bound to a sequence in the 3’-UTR of Cp mRNA. Further

research showed that IFN-γ exposure led to the delayed phosphorylation of the ribosomal

protein L13a, causing it to dissociate from the ribosomes and bind to the Cp 3’-UTR thus

blocking the initiation of Cp mRNA [74].

Interestingly, IFN-γ mRNA contains an autoregulatory element, namely is a

pseudoknot structure in its 5’-UTR. This dsRNA loop locally activates PKR in the cell,

leading to local eIF-2 phosphorylation and repression of IFN-γ mRNA translation [75].

Thus, there are a number of mechanisms by which translation can be silenced in a transcript

specific manner, and the latter example again illustrates this may take part in strictly localized

spots in a cell. This localized translational inhibition may also account for the selective

silencing of IL-6 after cytoskeleton disruption, assuming a different location of translation

between IL-8 and IL-6. However, the physiological basis for that, both proteins need to be

secreted, is not evident.

Ongoing and future studies should clarify whether miRNAs are involved in

translational silencing of IL-6 production in our cell model, and whether this is also associated

with the sequestration of IL-6 mRNA in p-bodies using combined in situ hybridization and

immunohistochemistry studies.

Even though in vitro cell culture experiments point to a paramount role for post-

transcriptional control in inflammatory responses, nothing is known about whether this

pathway is actually affected in patients with diseases as COPD and asthma, as with current

techniques it is practically (and ethically) impossible to study. However, due to its impact on

inflammatory responses, it is an attractive point for clinical intervention.

Basically, the road to the most elegant intervention therapy would be to identify the

key players in post transcriptional regulation, such as proteins and/or microRNAs in primary

cell cultures. Next, it should be investigated whether these molecules can modify

Discussion

134

inflammatory responses in mouse models. In parallel, it should be assessed whether these

molecules are differentially expressed in patient material vs. healthy control tissues. However,

if this would not be the case, attenuating the expression of key players in post transcriptional

regulation may still be beneficiary in dampening inflammation.

On the other hand, it should be considered to directly and specifically target the

inflammatory mediators now known to play a role in asthma and COPD for rapid degradation.

A promising strategy could be directing miRNAs targeting inflammatory mediators to the

lung.

A role for E1A expression in COPD?

In chapter 2, we studied the possible contribution of post-transcriptional regulation in the

proposed role of the adenoviral protein E1A as an enhancer of inflammatory responses. The

group of Hogg et al. had previously shown the presence of integrated E1A DNA and E1A

protein expression in lung tissue [76,77], although the number of E1A-positive cells was

~1400/m2 lung tissue [78] (which is in the order of 10-5 % of the total cell number/m2), even in

severe patients. In a model with the Ras-transformed A549 alveolar type-II like-cell line

stably transfected with E1A they showed increased IL-8 production in response to LPS and

particulate matter [79-82] by a transcriptional mechanism. As we previously studied

mechanisms of regulation of IL-8 and IL-6 production in NCI-H292 cells, we hypothesized

that a post-transcriptional mechanism might also contribute to exaggerated IL-8 response of

these E1A expressing clones.

Thus, we set out to create a number of stable E1A transfectants using the same vector

as Hogg’s group. Transfection with this vector did not yield viable clones, which is most

likely due to the fact that in most cell types, E1A expression leads to apoptosis. This apoptotic

property of E1A is counteracted by E1B, but also by overexpression of Ras, explaining why

in Ras-transformed A549 cells, transfection with E1A alone yielded viable clones. So, we

created a vector containing both E1A and E1B and successfully established a number of

viable clones expressing E1A. When clones were tested for IL-8 and IL-6 responses we

observed that there was a large variation in the magnitude of responses between E1A-positive

clones independent of the expression levels of E1A. Further investigation of transcriptional

activation and mRNA half-life did not provide any insight in the variety of responses. To

exclude the possibility that this variant was solely due to variances in the mother cell line we

tested the intrinsic variation of responses by subcloning the mother cell line, and found a

rather large variance in responses, which may be due to variation in the mother cell line or the

Chapter 8

135

process of limiting dilution. Subcloning a subclone led again to variance in the responses

although smaller than the variance of the subcloned mother line, indicating that there is some

heterogeneity in the mother cell line and some is introduced by the process of subcloning.

These studies clearly demonstrated the pitfalls of working with stable transfectants in

terms of heterogeneous behavior and also shows that a large panel of transfectants is needed

to draw solid conclusions. Ideally, these kind of experiments should have been performed

using a panel of clones with inducible expression of the gene of interest, which was an

emerging technique at the late nineties [83]. In NCI-H292 cells the Tet-on system is quite

leaky however and needs an extra suppressor construct to suppress target gene expression in

the absence of doxycyclin.

Nevertheless, when we transfected a NCI-H292 subclone with E1A and E1B, resulting

in 10 E1A positive clones, we observed a more homogenous effect of E1A expression. When

compared to E1A- clones, there was a clear reduction in IL-6 production in response to both

LPS and TNF- and none of the clones displayed an exaggerated IL-8 response, when

expressed as amounts of protein produced. Interestingly, Hogg et al reported that in primary

bronchial epithelial cells transformed with E1A and E1B, IL-8 expression in response to LPS

stimulation was compared with the unstimulated state, the ratio increased from 1.3 ± 0.8 in

E1A-negative cells to 37 ± 11 in the E1A positive cells (average ± SD, n = 6, p < 0.00004)

[84]. When we expressed our data in a similar way, as the fold induction over unstimulated

state, we also found that E1A positive cells were more responsive than E1A-negative cells.

However, considering the low amount of IL-8 secreted by E1A positive cells (Chapter 2, fig.

6), we feel that this interpretation of data does not allow the conclusion that E1A contributes

to inflammation in COPD.

Another issue with the concept of the contribution of E1A to inflammation in patients

with COPD is that epithelial cells have a limited live span in the order of weeks to a month or

two, and thus it should be the epithelial stem cell that continuously gives rise to new E1A-

expressing cells. On the other hand, there may be a more simple explanation for the presence

of E1A DNA in epithelial cells, which would be recurrent infection with Adenoviruses and

consequent DNA integration. As Ad5 infects cells using a receptor that is mainly located

basolateral [85], damaged tissue may be much more readily infected and thus would explain

the presence of E1A as an epiphenomenon in COPD patients. Taken together, our findings

and the fact that only a minute percentage of cells seem to be expressing E1A warrants critical

reviewing of the specific role of E1A in COPD.

Discussion

136

This does not exclude possible adverse effects of integration of viral DNA in the human

genome though. Dependent on the exact location of integration in the genome, effects can

range to altered expression of downstream located genes [86], but one may also envision the

disruption of regulatory genes or miRNAs by integration, thus leading to aberrant control of

gene expression.

Concluding remarks

One of the most intriguing observations associated with changes in mRNA stability is the

effect on the cellular dose response curve to a given stimulus. At conditions of a reduced

mRNA degradation, there is an increase in the steepness of the response curve. This

implicates that, compared to conditions where there is a normal mRNA degradation, a smaller

dose of the stimulus results in the production of large amounts of protein encoded by the

mRNA. Thus, for patients with aberrant cellular regulation of mRNA degradation, (for

example due to high levels of IL-17) there is little stimulation/agitation required to mount a

large inflammatory mediator response. As a result, inflammation may be perpetuated by

stimuli not harmful to individuals with a normal control of mRNA degradation. Reversely,

accelerating the rate of mRNA degradation largely reduces the output of inflammatory

mediators, also in conditions were there is no abnormal mRNA degradation. Thus, there lies a

great, clinically relevant challenge in unraveling the mechanism, pathway and players that

control the rate of inflammatory mRNA metabolism.

References

1. A.D.Lopez, C.C.Murray (1998). The global burden of disease, 1990-2020. Nat.Med. 4, 1241-1243. 2. P.J.Barnes (2006). Corticosteroids: the drugs to beat. Eur.J.Pharmacol. 533, 2-14. 3. S.V.Culpitt, W.Maziak, S.Loukidis, J.A.Nightingale, J.L.Matthews, P.J.Barnes (1999). Effect of high

dose inhaled steroid on cells, cytokines, and proteases in induced sputum in chronic obstructive pulmonary disease. Am.J.Respir.Crit Care Med. 160, 1635-1639.

4. V.M.Keatings, A.Jatakanon, Y.M.Worsdell, P.J.Barnes (1997). Effects of inhaled and oral glucocorticoids on inflammatory indices in asthma and COPD. Am.J.Respir.Crit Care Med. 155, 542-548.

5. R.E.Nocker, D.F.Schoonbrood, E.A.van de Graaf, C.E.Hack, R.Lutter, H.M.Jansen, T.A.Out (1996). Interleukin-8 in airway inflammation in patients with asthma and chronic obstructive pulmonary disease. Int.Arch.Allergy Immunol. 109, 183-191.

6. C.Yamamoto, T.Yoneda, M.Yoshikawa, A.Fu, T.Tokuyama, K.Tsukaguchi, N.Narita (1997). Airway inflammation in COPD assessed by sputum levels of interleukin-8. Chest 112, 505-510.

7. C.Schulz, K.Wolf, M.Harth, K.Kratzel, L.Kunz-Schughart, M.Pfeifer (2003). Expression and release of interleukin-8 by human bronchial epithelial cells from patients with chronic obstructive pulmonary disease, smokers, and never-smokers. Respiration 70, 254-261.

8. C.E.Brewster, P.H.Howarth, R.Djukanovic, J.Wilson, S.T.Holgate, W.R.Roche (1990). Myofibroblasts and subepithelial fibrosis in bronchial asthma. Am.J.Respir.Cell Mol.Biol. 3, 507-511.

9. M.J.Evans, L.S.Van Winkle, M.V.Fanucchi, C.G.Plopper (1999). The attenuated fibroblast sheath of the respiratory tract epithelial-mesenchymal trophic unit. Am.J.Respir.Cell Mol.Biol. 21, 655-657.

Chapter 8

137

10. P.K.Jeffery, A.J.Wardlaw, F.C.Nelson, J.V.Collins, A.B.Kay (1989). Bronchial biopsies in asthma. An ultrastructural, quantitative study and correlation with hyperreactivity. Am.Rev.Respir.Dis. 140, 1745-1753.


12. R.Lutter, M.van Wissen, T.Roger, P.Bresser, K.van der Sluijs, M.Nijhuis, H.M.Jansen (2003). Mechanisms that potentially underlie virus-induced exaggerated inflammatory responses by airway epithelial cells. Chest 123, 391S-392S.

13. T.Roger, P.Bresser, M.Snoek, K.van der Sluijs, A.van den Berg, M.Nijhuis, H.M.Jansen, R.Lutter (2004). Exaggerated IL-8 and IL-6 responses to TNF-alpha by parainfluenza virus type 4-infected NCI-H292 cells. Am.J.Physiol Lung Cell Mol.Physiol 287, L1048-L1055.


15. S.Molet, Q.Hamid, F.Davoine, E.Nutku, R.Taha, N.Page, R.Olivenstein, J.Elias, J.Chakir (2001). IL-17 is increased in asthmatic airways and induces human bronchial fibroblasts to produce cytokines. J.Allergy Clin.Immunol. 108, 430-438.

16. F.Shen, M.W.Zhao, B.He, Y.Z.Wang, W.Z.Yao (2004). [The levels and clinical implications of induced sputum interleukin-17 in chronic obstructive pulmonary disease and asthma]. Zhonghua Nei Ke.Za Zhi.43, 888-890.

17. P.Bresser, L.van Alphen, R.Lutter (2002). New strains of bacteria and exacerbations of COPD. N.Engl.J.Med. 347, 2077-2079.

18. K.Groeneveld, L.van Alphen , P.P.Eijk, G.Visschers, H.M.Jansen, H.C.Zanen (1990). Endogenous and exogenous reinfections by Haemophilus influenzae in patients with chronic obstructive pulmonary disease: the effect of antibiotic treatment on persistence. J.Infect.Dis. 161, 512-517.



21. P.J.Barnes, I.M.Adcock, K.Ito (2005). Histone acetylation and deacetylation: importance in inflammatory lung diseases. Eur.Respir.J. 25, 552-563.

22. M.Akashi, G.Shaw, M.Hachiya, E.Elstner, G.Suzuki, P.Koeffler (1994). Number and location of AUUUA motifs: role in regulating transiently expressed RNAs. Blood 83, 3182-3187.

23. C.Y.Chen, T.M.Chen, A.B.Shyu (1994). Interplay of two functionally and structurally distinct domains of the c-fos AU-rich element specifies its mRNA-destabilizing function. Mol.Cell Biol. 14, 416-426.

24. C.Y.Chen, A.B.Shyu (1995). AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem.Sci. 20, 465-470.

25. G.Shaw, R.Kamen (1986). A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46, 659-667.

26. D.H.Wreschner, G.Rechavi (1988). Differential mRNA stability to reticulocyte ribonucleases correlates with 3' non-coding (U)nA sequences. Eur.J.Biochem. 172, 333-340.

27. Y.You, C.Y.Chen, A.B.Shyu (1992). U-rich sequence-binding proteins (URBPs) interacting with a 20-nucleotide U-rich sequence in the 3' untranslated region of c-fos mRNA may be involved in the first step of c-fos mRNA degradation. Mol.Cell Biol. 12, 2931-2940.

28. Y.Yu, K.Chadee (2001). The 3'-untranslated region of human interleukin-8 mRNA suppresses IL-8 gene expression. Immunology 102, 498-505.

29. T.Bakheet, M.Frevel, B.R.Williams, W.Greer, K.S.Khabar (2001). ARED: human AU-rich element-containing mRNA database reveals an unexpectedly diverse functional repertoire of encoded proteins. Nucleic Acids Res. 29, 246-254.

30. T.Bakheet, B.R.Williams, K.S.Khabar (2006). ARED 3.0: the large and diverse AU-rich transcriptome. Nucleic Acids Res. 34, D111-D114.

31. S.Wax, M.Piecyk, B.Maritim, P.Anderson (2003). Geldanamycin inhibits the production of inflammatory cytokines in activated macrophages by reducing the stability and translation of cytokine transcripts. Arthritis Rheum. 48, 541-550.

32. X.C.Fan, J.A.Steitz (1998). Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J. 17, 3448-3460.

33. J.L.Dean, R.Wait, K.R.Mahtani, G.Sully, A.R.Clark, J.Saklatvala (2001). The 3' untranslated region of tumor necrosis factor alpha mRNA is a target of the mRNA-stabilizing factor HuR. Mol.Cell Biol. 21,721-730.

Discussion

138

34. X.F.Ming, G.Stoecklin, M.Lu, R.Looser, C.Moroni (2001). Parallel and independent regulation of interleukin-3 mRNA turnover by phosphatidylinositol 3-kinase and p38 mitogen-activated protein kinase. Mol.Cell Biol. 21, 5778-5789.

35. G.Sully, J.L.Dean, R.Wait, L.Rawlinson, T.Santalucia, J.Saklatvala, A.R.Clark (2004). Structural and functional dissection of a conserved destabilizing element of cyclo-oxygenase-2 mRNA: evidence against the involvement of AUF-1 [AU-rich element/poly(U)-binding/degradation factor-1], AUF-2, tristetraprolin, HuR (Hu antigen R) or FBP1 (far-upstream-sequence-element-binding protein 1). Biochem.J. 377, 629-639.

36. N.S.Levy, S.Chung, H.Furneaux, A.P.Levy (1998). Hypoxic stabilization of vascular endothelial growth factor mRNA by the RNA-binding protein HuR. J.Biol.Chem. 273, 6417-6423.

37. W.Wang, M.C.Caldwell, S.Lin, H.Furneaux, M.Gorospe (2000). HuR regulates cyclin A and cyclin B1 mRNA stability during cell proliferation. EMBO J. 19, 2340-2350.

38. W.Wang, H.Furneaux, H.Cheng, M.C.Caldwell, D.Hutter, Y.Liu, N.Holbrook, M.Gorospe (2000). HuR regulates p21 mRNA stabilization by UV light. Mol.Cell Biol. 20, 760-769.

39. W.Zhang, B.J.Wagner, K.Ehrenman, A.W.Schaefer, C.T.DeMaria, D.Crater, K.DeHaven, L.Long, G.Brewer (1993). Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1. Mol.Cell Biol. 13, 7652-7665.

40. B.J.Wagner, C.T.DeMaria, Y.Sun, G.M.Wilson, G.Brewer (1998). Structure and genomic organization of the human AUF1 gene: alternative pre-mRNA splicing generates four protein isoforms. Genomics48, 195-202.

41. G.M.Wilson, J.Lu, K.Sutphen, Y.Sun, Y.Huynh, G.Brewer (2003). Regulation of A + U-rich element-directed mRNA turnover involving reversible phosphorylation of AUF1. J.Biol.Chem. 278, 33029-33038.

42. M.Lasa, K.R.Mahtani, A.Finch, G.Brewer, J.Saklatvala, A.R.Clark (2000). Regulation of cyclooxygenase 2 mRNA stability by the mitogen-activated protein kinase p38 signaling cascade. Mol.Cell Biol. 20, 4265-4274.

43. P.Loflin, C.Y.Chen, A.B.Shyu (1999). Unraveling a cytoplasmic role for hnRNP D in the in vivo mRNA destabilization directed by the AU-rich element. Genes Dev. 13, 1884-1897.

44. N.Xu, C.Y.Chen, A.B.Shyu (2001). Versatile role for hnRNP D isoforms in the differential regulation of cytoplasmic mRNA turnover. Mol.Cell Biol. 21, 6960-6971.

45. E.Carballo, W.S.Lai, P.J.Blackshear (1998). Feedback inhibition of macrophage tumor necrosis factor-alpha production by tristetraprolin. Science 281, 1001-1005.

46. W.S.Lai, E.Carballo, J.R.Strum, E.A.Kennington, R.S.Phillips, P.J.Blackshear (1999). Evidence that tristetraprolin binds to AU-rich elements and promotes the deadenylation and destabilization of tumor necrosis factor alpha mRNA. Mol.Cell Biol. 19, 4311-4323.

47. A.Raghavan, R.L.Robison, J.McNabb, C.R.Miller, D.A.Williams, P.R.Bohjanen (2001). HuA and tristetraprolin are induced following T cell activation and display distinct but overlapping RNA binding specificities. J.Biol.Chem. 276, 47958-47965.

48. E.Carballo, G.S.Gilkeson, P.J.Blackshear (1997). Bone marrow transplantation reproduces the tristetraprolin-deficiency syndrome in recombination activating gene-2 (-/-) mice. Evidence that monocyte/macrophage progenitors may be responsible for TNFalpha overproduction. J.Clin.Invest 100,986-995.

49. K.Phillips, N.Kedersha, L.Shen, P.J.Blackshear, P.Anderson (2004). Arthritis suppressor genes TIA-1 and TTP dampen the expression of tumor necrosis factor alpha, cyclooxygenase 2, and inflammatory arthritis. Proc.Natl.Acad.Sci.U.S.A 101, 2011-2016.

50. A.R.Clark, J.L.Dean, J.Saklatvala (2003). Post-transcriptional regulation of gene expression by mitogen-activated protein kinase p38. FEBS Lett. 546, 37-44.

51. J.L.Dean, G.Sully, A.R.Clark, J.Saklatvala (2004). The involvement of AU-rich element-binding proteins in p38 mitogen-activated protein kinase pathway-mediated mRNA stabilisation. Cell Signal.16, 1113-1121.

52. C.R.Tchen, M.Brook, J.Saklatvala, A.R.Clark (2004). The stability of tristetraprolin mRNA is regulated by mitogen-activated protein kinase p38 and by tristetraprolin itself. J.Biol.Chem. 279, 32393-32400.

53. L.M.Dember, N.D.Kim, K.Q.Liu, P.Anderson (1996). Individual RNA recognition motifs of TIA-1 and TIAR have different RNA binding specificities. J.Biol.Chem. 271, 2783-2788.

54. C.Gueydan, L.Droogmans, P.Chalon, G.Huez, D.Caput, V.Kruys (1999). Identification of TIAR as a protein binding to the translational regulatory AU-rich element of tumor necrosis factor alpha mRNA. J.Biol.Chem. 274, 2322-2326.

55. M.Piecyk, S.Wax, A.R.Beck, N.Kedersha, M.Gupta, B.Maritim, S.Chen, C.Gueydan, V.Kruys, M.Streuli, P.Anderson (2000). TIA-1 is a translational silencer that selectively regulates the expression of TNF-alpha. EMBO J. 19, 4154-4163.

Chapter 8

139

56. R.C.Lee, R.L.Feinbaum, V.Ambros (1993). The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843-854.

57. Y.Lee, K.Jeon, J.T.Lee, S.Kim, V.N.Kim (2002). MicroRNA maturation: stepwise processing and subcellular localization. EMBO J. 21, 4663-4670.

58. Y.Lee, C.Ahn, J.Han, H.Choi, J.Kim, J.Yim, J.Lee, P.Provost, O.Radmark, S.Kim, V.N.Kim (2003). The nuclear RNase III Drosha initiates microRNA processing. Nature 425, 415-419.

59. D.S.Schwarz, G.Hutvagner, T.Du, Z.Xu, N.Aronin, P.D.Zamore (2003). Asymmetry in the assembly of the RNAi enzyme complex. Cell 115, 199-208.

60. R.Yi, Y.Qin, I.G.Macara, B.R.Cullen (2003). Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev. 17, 3011-3016.

61. S.Saxena, Z.O.Jonsson, A.Dutta (2003). Small RNAs with imperfect match to endogenous mRNA repress translation. Implications for off-target activity of small inhibitory RNA in mammalian cells. J.Biol.Chem. 278, 44312-44319.

62. Y.Zeng, R.Yi, B.R.Cullen (2003). MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc.Natl.Acad.Sci.U.S.A 100, 9779-9784.

63. S.M.Hammond, S.Boettcher, A.A.Caudy, R.Kobayashi, G.J.Hannon (2001). Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293, 1146-1150.

64. J.Liu, M.A.Valencia-Sanchez, G.J.Hannon, R.Parker (2005). MicroRNA-dependent localization of targeted mRNAs to mammalian P-bodies. Nat.Cell Biol. 7, 719-723.

65. G.Meister, M.Landthaler, A.Patkaniowska, Y.Dorsett, G.Teng, T.Tuschl (2004). Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol.Cell 15, 185-197.

66. F.J.Slack, J.B.Weidhaas (2006). MicroRNAs as a potential magic bullet in cancer. Future.Oncol. 2, 73-82.

67. N.Yanaihara, N.Caplen, E.Bowman, M.Seike, K.Kumamoto, M.Yi, R.M.Stephens, A.Okamoto, J.Yokota, T.Tanaka, G.A.Calin, C.G.Liu, C.M.Croce, C.C.Harris (2006). Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 9, 189-198.

68. Q.Jing, S.Huang, S.Guth, T.Zarubin, A.Motoyama, J.Chen, P.F.Di, S.C.Lin, H.Gram, J.Han (2005). Involvement of microRNA in AU-rich element-mediated mRNA instability. Cell 120, 623-634.

69. J.G.Doench, P.A.Sharp (2004). Specificity of microRNA target selection in translational repression. Genes Dev. 18, 504-511.

70. U.Sheth, R.Parker (2003). Decapping and decay of messenger RNA occur in cytoplasmic processing bodies. Science 300, 805-808.

71. M.Brengues, D.Teixeira, R.Parker (2005). Movement of eukaryotic mRNAs between polysomes and cytoplasmic processing bodies. Science 310, 486-489.

72. B.Mazumder, C.K.Mukhopadhyay, A.Prok, M.K.Cathcart, P.L.Fox (1997). Induction of ceruloplasmin synthesis by IFN-gamma in human monocytic cells. J.Immunol. 159, 1938-1944.

73. B.Mazumder, P.L.Fox (1999). Delayed translational silencing of ceruloplasmin transcript in gamma interferon-activated U937 monocytic cells: role of the 3' untranslated region. Mol.Cell Biol. 19, 6898-6905.

74. B.Mazumder, P.Sampath, V.Seshadri, R.K.Maitra, P.E.DiCorleto, P.L.Fox (2003). Regulated release of L13a from the 60S ribosomal subunit as a mechanism of transcript-specific translational control. Cell115, 187-198.

75. R.Kaempfer (2006). Interferon-gamma mRNA attenuates its own translation by activating PKR: A molecular basis for the therapeutic effect of interferon-beta in multiple sclerosis. Cell Res. 16, 148-153.

76. W.M.Elliott, S.Hayashi, J.C.Hogg (1995). Immunodetection of adenoviral E1A proteins in human lung tissue. Am.J.Respir.Cell Mol.Biol. 12, 642-648.

77. T.Matsuse, S.Hayashi, K.Kuwano, H.Keunecke, W.A.Jefferies, J.C.Hogg (1992). Latent adenoviral infection in the pathogenesis of chronic airways obstruction. Am.Rev.Respir.Dis. 146, 177-184.

78. I.Retamales, W.M.Elliott, B.Meshi, H.O.Coxson, P.D.Pare, F.C.Sciurba, R.M.Rogers, S.Hayashi, J.C.Hogg (2001). Amplification of inflammation in emphysema and its association with latent adenoviral infection. Am.J.Respir.Crit Care Med. 164, 469-473.

79. T.Fujii, J.C.Hogg, N.Keicho, R.Vincent, S.F.Van Eeden, S.Hayashi (2003). Adenoviral E1A modulates inflammatory mediator expression by lung epithelial cells exposed to PM10. Am.J.Physiol Lung Cell Mol.Physiol 284, L290-L297.

80. P.S.Gilmour, I.Rahman, S.Hayashi, J.C.Hogg, K.Donaldson, W.MacNee (2001). Adenoviral E1A primes alveolar epithelial cells to PM(10)-induced transcription of interleukin-8. Am.J.Physiol Lung Cell Mol.Physiol 281, L598-L606.

81. N.Keicho, W.M.Elliott, J.C.Hogg, S.Hayashi (1997). Adenovirus E1A upregulates interleukin-8 expression induced by endotoxin in pulmonary epithelial cells. Am.J.Physiol 272, L1046-L1052.

Discussion

140

82. N.Keicho, Y.Higashimoto, G.P.Bondy, W.M.Elliott, J.C.Hogg, S.Hayashi (1999). Endotoxin-specific NF-kappaB activation in pulmonary epithelial cells harboring adenovirus E1A. Am.J.Physiol 277,L523-L532.

83. L.M.Levy, D.Attwell, F.Hoover, J.F.Ash, M.Bjoras, N.C.Danbolt (1998). Inducible expression of the GLT-1 glutamate transporter in a CHO cell line selected for low endogenous glutamate uptake. FEBS Lett. 422, 339-342.

84. Y.Higashimoto, W.M.Elliott, A.R.Behzad, E.G.Sedgwick, T.Takei, J.C.Hogg, S.Hayashi (2002). Inflammatory mediator mRNA expression by adenovirus E1A-transfected bronchial epithelial cells. Am.J.Respir.Crit Care Med. 166, 200-207.

85. R.W.Walters, T.Grunst, J.M.Bergelson, R.W.Finberg, M.J.Welsh, J.Zabner (1999). Basolateral localization of fiber receptors limits adenovirus infection from the apical surface of airway epithelia. J.Biol.Chem. 274, 10219-10226.

86. A.Tamori, Y.Yamanishi, S.Kawashima, M.Kanehisa, M.Enomoto, H.Tanaka, S.Kubo, S.Shiomi, S.Nishiguchi (2005). Alteration of gene expression in human hepatocellular carcinoma with integrated hepatitis B virus DNA. Clin.Cancer Res. 11, 5821-5826.

141

9Summary

Summary

142

The conducting airways and respiratory surface, approximating the surface a tennis court

(100-140 m2), are continuously exposed to environmental hazards such as micro-

organisms and toxic air pollutants. The first line of defense to these hazards is the

epithelial barrier. To perform its task in sensing danger and mounting an appropriate

response, airway epithelial cells are capable of secreting immuno-modulatory mediators,

thereby initiating and/or modulating the innate and adaptive immune responses. Aberrant

control of these mediators, resulting in either a reduced or exaggerated immune response

is quite detrimental to the host and can ultimately lead to extensive lung damage and

impaired lung function. The studies in this thesis are aimed at clarifying the aberrant

regulation of the expression of two important inflammatory mediators, IL-6 and IL-8

(that exemplify a large family of other response genes) at conditions relevant to the

inflammatory airway diseases COPD and asthma.

Chapter 1 reviews the current insights into post-transcriptional regulation of gene

expression and its potential relevance to inflammatory diseases. In chapter 2 we studied

the putative role of the adenoviral protein E1A in inflammatory mediator production in

COPD, as proposed by Hogg et al. This group was the first to show that in the lungs of

patients with COPD more E1A DNA and also E1A protein were present than lungs of

non-COPD smokers. With an in vitro model, where E1A DNA was transfected into

alveolar-type-II-like A549 cells, they found that E1A expression increased IL-8

production after exposure to specifically LPS, and that this was due to increased

activation of NF B. Previous work by our group indicated that post-transcriptional

processes are decisive in controlling the magnitude of the inflammatory mediator

response. It was hypothesized that besides increased IL-8 transcription, post-

transcriptional control would also play a role in the E1A-induced increase in IL-8

production following LPS exposure. We created stable transfectants of the lung epithelial

cell line NCI-H292 expressing E1A and E1B, the latter to prevent E1A-induced

apoptosis, and established 16 E1A-positive clones. Results indicated that E1A expression

does not necessarily increase IL-8 production upon LPS or TNF- exposure, but IL-6

production was consistently suppressed. There were no uniform effects of E1A

expression on nuclear translocation of the transcription factors NF B, AP-1 or C/EBP,

nor on the stability of IL-8 and IL-6 mRNA. Attempts to knockdown E1A expression to

Chapter 9

143

assess the specificity of E1A effects using siRNA were not successful, although GAPDH

mRNA could be suppressed, indicating that the applied strategy was functional. In

conclusion, the data in chapter 2 are not in line with previous results indicative of a role

of E1A expression in the enhanced expression of IL-8 in COPD, and thus warrant critical

review of this hypothesis. However, as IL-6 in association with the IL-6-receptor has

been described to have anti-inflammatory properties in the lung, E1A expression may

contribute to inflammation in COPD by reducing the IL-6 production.

Chapter 3 describes the effects of potential cross-talk between the adaptive and

the innate immune system through the T-cell cytokine IL-17. IL-17 is a recently

discovered cytokine that is detected in elevated amounts in the lungs of patients with

asthma. We showed that in both lung epithelial cells and fibroblasts, IL-17 is a weak

inducer of IL-8 and IL-6 production by itself, but synergistically increases TNF- -

induced IL-6 and IL-8 secretion. This synergism was not due to increased transcription

but was paralleled by an increased stability of the respective mRNAs. Assessment of

translational control by IL-17 (chapter 6) confirmed that the enhanced mRNA stability

was the only mechanism underlying the synergism in IL-6 and IL-8 production.

Although, we cannot exclude an enhanced translation by a simultaneous increase in the

rate of both initiation and elongation of IL-6 mRNA translation. Furthermore, the TNF-

+ IL-17-induced IL-8 and IL-6 secretion was reduced by dexamethasone treatment

(chapter 5), paralleled by a decreased stability of their respective mRNAs. However,

even in the presence of dexamethasone, IL-17 still synergized with TNF- , and TNF- -

induced IL-6 or IL-8 mRNA is stabilized by IL-17. In conclusion, by releasing IL-17 the

adaptive immune system can affect post-transcriptional processing of IL-6 and IL-8

mRNA in cells from the innate immune system, causing the latter to respond more

vigorously to inflammatory stimuli.

The structural integrity of airway epithelial cells, which can be affected by several

environmental factors, is of paramount importance to a well-contained inflammatory

response as is described in chapter 4. Here, by using well-defined drugs, we mimicked

disturbance of the cytoskeletal architecture in lung epithelial cells, which can occur in

vivo by viral- or bacterial infection, mechanical ventilation stress or exposure to

particulate matter. Disruption of either microtubules or actin networks resulted in the

Summary

144

stabilization of TNF- -induced IL-6 and IL-8 mRNA, whereas transcriptional events

remained unaffected. In line with expectations, the stabilization of IL-8 mRNA was

accompanied by an increased IL-8 production. Surprisingly, IL-6 production was

diminished despite the abundant presence of stabilized IL-6 mRNA. Analysis of

translational efficiency using polysome profiling revealed that disruption of microtubules

or actin networks led to a decreased ribosomal load of IL-6 mRNA, whereas loading on

IL-8 mRNA remained unaffected. As IL-6 has been described to have anti-inflammatory

effects in the lung, cytoskeletal disruption not only affects the magnitude of the

inflammatory response, but it may also change the nature of the response.

Airways of patients with chronic bronchitis (CB) and chronic obstructive

pulmonary disease (COPD) are frequently infected with bacteria, such as Haemophilus

influenzae, coinciding with neutrophilic inflammation. Neutrophils contain a variety of

antimicrobial peptides like neutrophil defensins, that can kill micro-organisms and induce

IL-8 and IL-6 release by airway epithelial cells. In chapter 7, we show that the IL-8 and

IL-6 production by NCI-H292 epithelial cells upon exposure to H. influenzae increased

synergistically in the presence of neutrophil defensins. For IL-8, the increased release

was due at least in part to a reduced IL-8 mRNA degradation. For IL-6, the mechanism

remains to be resolved.

Finally, in chapter 8 we discuss the results presented in this thesis in view of new

developments and unpublished observations.

Concluding remarks

The studies presented in this thesis show that post-transcriptional regulation of

inflammatory gene expression in structural airway cells is a powerful and not uncommon

means of both amplifying and restricting inflammatory mediator production. Notably,

alterations in inflammatory mRNA stability change the responsiveness of airway

epithelial cells to stimuli, resulting in either decreased or increased inflammatory

mediator production to a given dose of a stimulus. Therefore, we argue that post-

transcriptional processes should no longer be ignored as possibly relevant mechanisms

contributing to inflammation in chronic inflammatory diseases, such as COPD and

asthma. Future studies should provide hints to whether post-transcriptional processes are

Chapter 9

145

altered in cells from patients suffering from asthma or COPD. More fundamental

experiments identifying key players involved in mRNA degradation, such as certain

proteins and microRNAs, are needed to allow this progress though.

146

147

Nederlandse samenvatting

Nederlandse Samenvatting

148

Door de functie van de long, het klaren van kooldioxide en het opnemen van zuurstof, wordt

het oppervlak van de luchtweg en dat van het epitheel waarover de gaswisseling plaatsvindt

continu blootgesteld aan potentieel gevaarlijke micro-organismen en vervuilde lucht. Een van

de eerste verdedigingslinies tegen deze gevaren van buitenaf wordt gevormd door het

luchtwegepitheel. Om de aanwezigheid van potentieel gevaarlijke stoffen te registreren en

daarop een adequate reactie in gang te zetten, kunnen luchtwegepitheelcellen mediatoren

uitscheiden, die een afweerreactie in gang kunnen zetten of beïnvloeden. Een onjuiste controle

van de productie van deze mediatoren, met als gevolg een te zwakke of een te sterke

ontstekingsreactie, kan het longweefsel ernstig beschadigen mogelijk resulterend in een

verstoorde longfunctie.

De studies die in dit proefschrift zijn opgenomen zijn bedoeld om licht te werpen op

de regulatie van de productie van twee belangrijke ontstekingsmediatoren, interleukine(IL)-6

en IL-8 (die model staan voor een grotere familie van ‘respons genen’) onder condities die

relevant zijn voor de inflammatoire longziekten, chronisch obstructief longlijden (COPD) en

astma.

In hoofdstuk 1 worden de huidige inzichten in de rol van post-transcriptionele regulatie van

inflammatoire genexpressie beschreven en het potentieële belang van deze processen bij

inflammatoire longziekten.

In hoofdstuk 2 wordt een studie beschreven naar de mogelijke rol van het adenovirale

eiwit E1A bij de productie van ontstekingsmediatoren in COPD, zoals voorgesteld door Hogg

et al. Deze onderzoekers vonden dat in longweefsel van COPD patiënten meer E1A DNA en

ook E1A eiwit aanwezig was dan in longweefsel van rokers zonder COPD. Vervolgens werd

beschreven dat in een model met gekweekte cellen, waarbij het E1A eiwit tot expressie werd

gebracht in alveolaire type-II achtige A549 cellen, de productie van IL-8 na blootstelling aan

bacteriële lipopolysacchariden (LPS) veel hoger was dan bij A549 cellen zonder E1A eiwit.

De reden voor de verhoogde IL-8 expressie werd herleid tot een verhoogde activatie van de

transcriptie factor NFκB. Eerdere studies van onze groep wezen erop dat post-transcriptionele

regulatie van genexpressie in longepitheelcellen van grote invloed is op de productie van

ontstekingsmediatoren. Onze hypothese was dan ook dat de verhoogde LPS-geïnduceerde IL-

8 productie als gevolg van E1A expressie, niet alleen door verhoogde transcriptie van het IL-8

gen maar ook door post-transcriptionele processen veroorzaakt zou kunnen worden.

De longepitheelcellijn NCI-H292 werd getransfecteerd met E1A en E1B DNA (E1B

voorkomt de door E1A-geïnduceerde geprogrammeerde celdood) waaruit 16 E1A-positieve


149

klonen werden geselecteerd. Echter, onze resultaten lieten zien dat E1A expressie niet altijd

de IL-8 productie verhoogd na blootstelling aan LPS of TNF- , maar dat IL-6 productie wel

consistent werd geremd. Er waren geen eenduidige effecten van E1A expressie op de activatie

en nucleaire translocatie van de relevante transcriptiefactoren NF B, AP-1 of C/EBP, en ook

niet op de stabiliteit van IL-6 of IL-8 mRNA. Pogingen om E1A expressie te onderdrukken

met siRNA om de specificiteit van de bevindingen te verifiëren waren niet succesvol.

GAPDH expressie was echter makkelijk te blokkeren met het door ons gebruikte systeem,

hetgeen aangaf dat de gevolgde strategie functioneel was. De resultaten gepresenteerd in

hoofdstuk 2 komen niet overeen met een rol voor E1A bij de verhoogde productie van IL-8 in

COPD, en geven aan dat deze hypothese nog eens kritisch tegen het licht moet worden

gehouden. Echter, het is bekend dat IL-6 in associatie met de IL-6 receptor remmend kan

werken op ontstekingsprocessen, en dus door IL-6 productie te remmen zou E1A alsnog een

bijdrage kunnen leveren aan de ontstekingsprocessen in COPD.

In hoofdstuk 3 wordt een studie beschreven naar de effecten op de IL-6 en IL-8

expressie door het T-cel cytokine IL-17. IL-17 is een recent ontdekt cytokine dat in verhoogde

hoeveelheden wordt aangetroffen in luchtwegsecreten van astmapatiënten. Wij laten zien dat

in zowel longepitheelcellen als longfibroblasten, IL-17 zelf een zwakke stimulus is van de IL-

6 en IL-8 productie, maar dat IL-17 en TNF-α in synergie de IL-6 en IL-8 productie

verhogen. Deze synergie werd niet veroorzaakt door een verhoogde transcriptie, maar ging

gepaard met een verhoogde stabiliteit van IL-6 en IL-8 mRNA. Onderzoek naar de invloed

van IL-17 op de translationele regulatie (hoofdstuk 6) bevestigde dat de verhoogde mRNA

stabiliteit waarschijnlijk het belangrijkste mechanisme is dat de synergie tussen IL-17 en

TNF-α verklaart, hoewel wij niet kunnen uitsluiten dat IL-17 tegelijkertijd de initiatie en de

elongatie van IL-6 mRNA translatie beïnvloedt. Verder bleek dat de door TNF-α en IL-17-

geïnduceerde IL-6 en IL-8 productie geremd werd door het corticosteroid dexamethasone

(Hoofdstuk 5), hetgeen gepaard ging met een verlaging van de stabiliteit van beide mRNA’s.

Desalniettemin verhoogde IL-17 in de aanwezigheid van dexamethasone nog steeds de

stabiliteit van de TNF-α-geïnduceerde IL-6 en IL-8 mRNA, en bleef ook de synergie tussen

beide stimuli voor een deel bestaan. Geconcludeerd werd dat cellen van adaptieve immuun

systeem, door middel van het secreteren van IL-17, de post-transcriptionele regulatie van IL-6

en IL-8 mRNA in cellen van het aangeboren immuunsysteem kan beïnvloeden, waardoor deze

cellen heftiger reageren op inflammatoire stimuli.

Nederlandse Samenvatting

150

De structurele integriteit van luchtwegepitheelcellen, die beïnvloed kan worden door

verschillende omgevingsfactoren, bleek erg belangrijk te zijn voor het in de hand houden van

ontstekingsreacties, zoals blijkt uit hoofdstuk 4. In deze studie gebruikten wij specifieke

chemische stoffen om verstoringen van het cytoskelet in luchtwegepitheelcellen te

bewerkstelligen, zoals die ook in vivo kunnen ontstaan door virale- of bacteriële infecties,

mechanische beademing of blootstelling aan micropartikels uit vervuilde lucht. Verstoring

van microtubuli- zowel als actine-netwerken resulteerde in de stabilisatie van de TNF- -

geïnduceerd IL-6 en IL-8 mRNA, zonder dat de transcriptie van beide genen beïnvloed werd.

Zoals verwacht ging de stabilisatie van IL-8 mRNA gepaard met een verhoogde IL-8

productie, maar verrassend genoeg werd de IL-6 productie geremd ondanks de aanwezigheid

van grote hoeveelheden gestabiliseerd IL-6 mRNA. Analyse van de translatie van IL-6 mRNA

aan de hand van polysoom profielen maakte duidelijk dat de verstoring van het cytoskelet

leidde tot een daling van het aantal ribosomen op IL-6 mRNA, terwijl het aantal ribosomen op

IL-8 en GAPDH mRNA niet veranderde. Omdat IL-6 anti-inflammatoire effecten kan

sorteren, leidt verstoring van het cytoskelet waarschijnlijk niet alleen tot veranderingen in de

omvang van de inflammatoire respons, maar kan het ook tot een kwalitatief andere reactie

leiden.

De luchtwegen van patiënten met chronische bronchitis en COPD worden regelmatig

geïnfecteerd met bacteriën, zoals Haemophilus influenzae, hetgeen vaak samengaat met

neutrofiele ontstekingsprocessen. Neutrofielen bevatten verschillende anti-microbiële

peptiden zoals defensines, die micro-organismen kunnen doden en IL-8 en IL-6 secretie door

luchtwegepitheelcellen kunnen induceren. Hoofdstuk 7 beschrijft dat neutrofiele defensinen

de H. influenzae-geïnduceerde IL-8 en IL-6 productie door NCI-H292 epitheelcellen op

synergistische wijze verhogen. De verhoogde productie van IL-8 kon deels verklaard worden

door een verhoogde stabiliteit van het IL-8 mRNA, maar het mechanisme achter de verhoogde

IL-6 productie moet nog worden opgehelderd.

Tenslotte worden in hoofdstuk 8 de resultaten zoals beschreven in dit proefschrift

bediscussieerd in het licht van nieuwe ontwikkelingen en niet eerder getoonde data.

Belangrijkste bevindingen

De studies beschreven in dit proefschrift laten zien dat post-transcriptionele regulatie van

inflammatoire genexpressie in luchtwegepitheelcellen een krachtige en niet zeldzame manier

is om de productie van ontstekingsmediatoren te temperen danwel te versterken. Opvallend is

dat veranderingen in de stabiliteit van inflammatoire mRNAs leiden tot een veranderde


151

gevoeligheid van de epitheelcel voor een bepaalde stimulus. Dit heeft bijvoorbeeld bij mRNA

stabilisatie tot gevolg dat een cel een veel lagere dosis van een stimulus nodig heeft om een

fysiologisch significant IL-6 of IL-8 signaal af te geven. Wij stellen dan ook dat het

waarschijnlijk is dat post-transcriptionele processen bijdragen aan chronische

ontstekingsziekten zoals COPD en astma. Toekomstige studies moeten helder kunnen maken

of er afwijkingen zijn in de post-transcriptionele regulatie van genexpressie in cellen van

patiënten met COPD danwel astma. Daarvoor zijn echter ook meer basale studies nodig die

ons duidelijk maken welke elementen, zoals bepaalde eiwitten en microRNAs, de

belangrijkste spelers zijn in dit proces.

152

153

Dankwoord

De meeste mensen die dit proefschrift onder ogen krijgen, zullen daar in de breedste betekenis

van het woord een bijdrage aan geleverd hebben. Ik zou dan ook graag volstaan met een

‘generaal bedankt’, zodat ik niemand vergeet..bij deze dus alvast..

Gelukkig ben ik de beroerdste niet, en is het schrijven van een dankwoord bijna net zo

leuk als een discussie. Laat me beginnen bij mijn promotor Professor doctor Henk M. Jansen.

Beste Henk, ik ben u bijzonder erkentelijk voor het feit dat u altijd de ruimte gaf voor een

creatieve aanpak van rijzende vraagstukken. Hoewel ik meestal enigszins nerveus was als ik

op audiëntie moest, waren onze discussies erg boeiend en motiverend. Gesproken over

motiveren, mijn co-promoter René Lutter is daar een absolute ster in. René, je zal het af en toe

best moeilijk gehad hebben met me, en ik dank je bijzonder voor je geduld en je steun. Ik heb

genoten van onze samenwerking. Zonder jouw charisma, tolerantie en besmettelijk

enthousiasme had ik nooit zover kunnen komen. Het feit dat je mijn wetenschappelijke

carrière ook weer even op de rit hebt gezet getuigt ook van jouw vertrouwen in mij...ik hoop

dan ook dat wij in de toekomst samen nog een aantal mooie dingen kunnen doen.

Onderzoek doe je nooit helemaal alleen, en de vanzelfsprekendheid van een goed

lopend lab is bedrieglijk. Ik wil daarom ook iedereen die zich heeft bekommerd om ons lab tot

een functionele werkomgeving te maken/behouden bedanken. Ik heb het AMC als een prettig

instituut ervaren, met name de openheid die er heerst t.o.v samenwerking met andere

afdelingen, zoals bv het sequence lab en de afdeling celbiologie, van wiens faciliteiten ik

altijd gebruik mocht maken en goede adviezen kreeg. Mijn favoriete speeltje was altijd wel de

confocale microscoop, waarop Jan van Marle mij wegwijs heeft gemaakt. Voor technische en

praktische ondersteuning ben ik Mieke erg dankbaar, bijvoorbeeld voor de ontelbare blots en

ELISAs die je voor me hebt gedaan. En ik weet niet precies wie die croissantjes maakt op het

AMC, maar bedankt in ieder geval!!

Naast de praktische zaken op het lab, maken ook de sociale interacties een belangrijk

deel uit van een prettige werkomgeving. Het feit dat ik er wat aangepaste werktijden op

nahield, betekent geenszins dat ik mijn collega’s probeerde te ontlopen. Ik vond het vaak

gezellig. Dames diagnostiek, met name Monique, jullie waren altijd een luisterend oor. Aan

mij directe collega’s Tamaar, Bar, Bolle en Koen: wat hebben we gelachen!! Met gemengde

gevoelens heb ik na een jaar het kippenhok verlaten, few wat een rust, maar ik heb ook af en

toe de overdaad aan gezelligheid gemist van het gezelschap van Lailie, Mireille, Esther, Els,

154

Godelieve en Nuno (also thanks for teaching me to get what I want in Portuguese). Gelukkig

zijn we allen redelijk ongeschonden (de meeste ticks hadden we al, toch?) uit de strijd

gekomen.

Mijn studenten Filiz, Mathijs, Jaime en Jordi wil ik bedanken voor jullie inzet, ik hoop

dat jullie net zoveel van mij geleerd hebben als ik van jullie. Het was mij een waar genoegen.

Eén ding heb ik niet geleerd, dat wist ik namelijk al. Zonder vrienden ben ik nergens.

Ivo, dude, ..ik zeg het vaak genoeg tegen je..je weet wel wat ik bedoel..ik ben apetrots dat jij

mijn paranimf bent..jij hebt mij de term ‘onvoorwaardelijk’ doen herdefiniëren..(je moet eens

vaker iemand voor z’n kop slaan denk ik dan). Lieve Wanneke, voor jou geldt hetzelfde,

behalve dan die laatste opmerking. Hoewel wij als mens al redelijk meercellig zijn, blijkt ook

op dit niveau van organisatie nog het een en ander samen te kunnen smelten tot een heel

nieuw organisme. Ik ben blij, trots en dankbaar hiervan deel uit te mogen maken. En dat

Zaakelijke discussies wel degelijk nuttig zijn blijkt wel uit het feit dat een bepaald cytokine

wel erg vaak genoemd word in dit proefschrift (met stip op #4). Jeroen, drinkebroeder,

navigator en klusleraar (over 5 jaar ons eigen lab in Barcelona!), BartBartBartBartBart, Teppie,

Rich (al dan niet in het gezelschap van Knabbel en Babbel), F-wezen, Fitz, Carlos (mag ik na

de 27e eindelijk je jasje lenen?), Claudia, Spijker, Collie, Polleke, Gio, Chielus, Majo en

Kennislink makkers: samenzijn is fijn! Dank voor alle gezelligheid, borrels, concertjes,

festivals, morele steun, vakanties, etentjes, inspiratie, verbouwingen, zorg, boottochtjes..

enz..ik zal jullie missen..

Rest mijn familie, het is van onschatbare waarde om op te groeien in een warm nest.

Mijn ouders wil ik bedanken voor het combineren van een hele aardige set genen (al had het

lichaam wel iets groter mogen zijn), en jullie onvoorwaardelijke steun bij de dingen die mij

op dit punt van mijn leven hebben gebracht. Lieve Wim, Ineke en Marlies, bedankt!

Arjen

Documents

Post-transcriptional modulation of IL-6 and IL-8 responses · Post-transcriptional modulation of IL-6 and IL-8 responses in structural airway cells. ... Departments of Pulmonology