of March 16, 2018.This information is current as

Cells T+150 AP-1 Site in Effector CD8−at the

A Transcriptional Block in the IL-2 Promoter

GreenbergRosalynde J. Finch, Patrick E. Fields and Philip D.

http://www.jimmunol.org/content/166/11/6530doi: 10.4049/jimmunol.166.11.6530

2001; 166:6530-6536; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/166/11/6530.full#ref-list-1

, 29 of which you can access for free at: cites 49 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2001 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on March 16, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on March 16, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

A Transcriptional Block in the IL-2 Promoter at the 2150AP-1 Site in Effector CD81 T Cells1

Rosalynde J. Finch,* Patrick E. Fields,2† and Philip D. Greenberg3*‡§

Both CD41 and CD81 T cells that produce IL-2 in response to Ag recognition have been isolated. However, most effector CD81

T cells recovered after exposure to Ag do not produce sufficient IL-2 to sustain growth, and depend on CD41 T helper cells forthis obligate growth factor. IL-2 expression in CD41 T cells is primarily controlled at the level of transcription, but mechanismsrestricting IL-2 production in CD8 1 T cells have not been elucidated. To evaluate transcriptional regulation of theIL-2 gene inCD81 T cells, we stably transfected reporter genes into Ag-specific CD81 T cell clones. CD281 CD81 T cells unable to transcribethe IL-2 gene in response to antigenic stimulation had a block in transactivation of the2150 CD28 response element (CD28RE)/AP-1 site of the IL-2 promoter, but did transactivate the composite NFAT/AP-1 and OCT/AP-1 sites, and a consensus AP-1 motif.Mutation of the nonconsensus2150 AP-1 site to a consensus AP-1 site, or insertion of a CD28RE/AP-1 consensus site upstreamof the native 2150 CD28RE/AP-1 site restored transactivation of the altered promoter. These results suggest that the defect at the2150 site may reflect the absence or inactivity of a required factor rather than repression of the IL-2 promoter. The Journal ofImmunology,2001, 166: 6530–6536.

I nterleukin-2 was first described as a lymphokine produced byactivated CD41 T cells (1). Although more recent experi-ments have shown that activated CD81 T cells can also pro-

duce IL-2, CD41 T helper cells represent the dominant IL-2-pro-ducing population. CD81 T cells mediating long term in vivoeffector responses depend on IL-2 produced by CD41 T cells tosustain proliferation and promote survival (2, 3). Although CD81

responses to viruses can be elicited in the absence of CD41 T cells,the establishment of CD81 T cell memory is severely compro-mised (4–6). Several studies have suggested that a dominant path-way for CD4 T cell help is via CD40 ligand-mediated activation ofAPC (7–9). However, a recent report has reaffirmed the importanceof direct CD41-to-CD81 T cell communication by way of lym-phokines (10), such as IL-2.

CD81 T cells capable of IL-2 production in response to Ag havebeen isolated in selected settings, and maintenance of the ability toexpress IL-2 appears to be dependent on concurrent costimulationwith each activation cycle. However, costimulation is not requiredfor the retention of cytolytic function, a phenomenon termed “splitanergy” (11). The potential for CD81 T cells to produce IL-2 inthe presence of sufficient costimulatory activity is further sup-ported by the generation of potent CD81 T cell responses to tu-mors independent of CD4 responses following in vitro stimulationwith B7-transfected tumor cells (12, 13). CD81 T cells appear to

require costimulation each time Ag is encountered to sustain thefacility for IL-2 expression. Naive CD81 T cells from 2C TCR-transgenic mice produced IL-2 following recognition of allogeneicLd1 target cells bearing B7 costimulatory molecules (14), but lostthe capacity to produce IL-2 following two sequential stimulationsin the absence of CD28 costimulation (P. Fields, unpublished ob-servations). These studies suggest that all naive CD81 T cells mayinitially be competent to produce IL-2, but lose the ability to sus-tain growth and survival as a consequence of not receiving thenecessary costimulatory signals due to recognition of B72 targetsand/or maturation to terminal effector cells.

The requirement for costimulation for CD81 T cells to produceIL-2 can be circumvented if a sufficiently strong signal is deliveredthrough the TCR. Effector CD81 T cells that do not produce IL-2in response to Ag (IL-22) can be triggered to produce IL-2 bycross-linking the TCR with anti-CD3 Abs, or by treatment with acalcium ionophore, such as ionomycin, in conjunction with a phor-bol ester, such as PMA (15). These responses to such nonphysi-ologic stimuli imply that the inability of most effector CD81 Tcells to produce IL-2 in response to Ag is not due to chromosomalinaccessibility of theIL-2 gene, but might instead be due to amechanism operating at the transcriptional level, similar to whathas been found in anergic CD41 T cells. Indeed, the block to IL-2production in anergic CD41 T cells can also be overcome by stim-ulation with PMA plus ionomycin (16, 17).

Anergic CD41 T cells share several additional characteristicswith IL-22 CD81 T cells. IL-22 effector CD81 T cells can pro-liferate in response to Ag and supplemental exogenous IL-2, andretain the capacity to produce other cytokines such as IFN-g. An-ergic CD41 T cells can proliferate following stimulation if exog-enous IL-2 is provided, but fail to expand when restimulated withAg even if costimulation is provided because of a specific inabilityto produce IL-2, while retaining the capacity to produce other cy-tokines such as IL-3 and IFN-g (18). The isolated defect in IL-2production in anergic CD41 T cells has been linked to reducedlevels of Fos/Jun proteins binding at the2150 AP-1 site in theIL-2 promoter (19), as well as to negative regulatory factors tar-geting the2150 and2180 AP-1 sites (20–22).

Department of *Immunology and‡Medicine, University of Washington, Seattle, WA98195;§Fred Hutchinson Cancer Research Center, Seattle, WA 98109; and†Com-mittee on Immunology, University of Chicago, Chicago, IL 60637

Received for publication April 6, 2000. Accepted for publication March 21, 2001.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby markedadvertisementin accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 These studies were supported by National Institutes of Health Grants CA33084,CA18029, and AI36613. R.F. was supported in part by The Benaroya FoundationTraining Grant in Immunology.2 Current address: Department of Immunobiology, Yale University, New Haven, CT06520.3 Address correspondence and reprint requests to Dr. Philip D. Greenberg, Program inImmunology, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue NorthD3-100, Seattle, WA 98109. E-mail address: pgreen@u.washington.edu

Copyright © 2001 by The American Association of Immunologists 0022-1767/01/$02.00

by guest on March 16, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

We examined the transcriptional regulation of theIL-2 gene inCD81 T cells to better understand the molecular basis for thefailure of effector CD81 T cells to produce IL-2 in response to Ag.Our investigation focused on the AP-1 binding sites located in theIL-2 promoter based on studies in CD41 T cells suggesting thatAP-1 is the target of clonal anergy. AP-1 is composed of ho-modimers of Jun (c-Jun, Jun B, and Jun D) or heterodimers of Junand Fos (c-Fos, Fos B, Fra-1, and Fra-2) (23). There are four AP-1sites in the proximal IL-2 promoter that can bind dimeric combi-nations of Fos and Jun family members. Three of the AP-1 sitescontain nonconsensus AP-1 motifs adjacent to binding sites forNFAT, CD28 response element (CD28RE),4 and OCT, respec-tively, and both elements of each composite site must be occupiedfor transactivation of the individual enhancers (24–26). All threeof the composite AP-1 sites are required for transactivation of theIL-2 promoter (27). A fourth AP-1 site at2180 from the tran-scriptional start site is a consensus site in the reverse orientation,but varies from a consensus AP-1 binding site by one base pair inthe forward orientation. The role of the2180 Ap-1 site in IL-2promoter regulation has not previously been well defined. How-ever, recent evidence indicates that a complex of cAMP responseelement-binding protein (CREB) and cAMP response elementmodulator binds to this site in anergic CD41 T cells (22), perhapsacting to repressIL-2 gene transcription.

Materials and MethodsT cell clones and stimulator lines

Four H-2Ld-reactive CD81 T cell clones, provided by Frank Fitch (Uni-versity of Chicago, Chicago, IL), were chosen for evaluation. L3 and DB45(28, 29) do not produce IL-2 in response to antigenic stimulation (IL-22),and Ld 8.6.1 and 2C (30, 31) produce IL-2 in response to Ag (IL-21). Allclones were restimulated every 14 days with allogeneic BALB/c spleno-cytes plus 12.5–25 U/ml recombinant human IL-2 (Chiron, Emeryville,CA). The H-2Ld-expressing murine mastocytoma P815, also obtained fromFrank Fitch, and the murine BALB/c tumor, LSTRA, maintained in ourlaboratory, were used as stimulator cells. P815 was transfected with bothB7-1 and B7-2 to provide costimulation, and LSTRA naturally expressesboth B7-1 and B7-2. All cells were maintained in RPMI 1640-HEPESsupplemented with 10% FCS (HyClone, Logan, UT), 4 mML-glutamine,50 U/ml penicillin, 50mg/ml streptomycin, and 53 1025 M 2-ME.

Flow cytometric analysis of cell surface molecules on T cellclones

Cells were analyzed with a FACSCalibur flow cytometer using CellQuestsoftware (BD Biosciences, Mountain View, CA.). All Abs were purchasedfrom PharMingen (San Diego, CA), unless otherwise noted. CD3 and CD8expression were evaluated with PE-conjugated anti-CD3 (145-2C11) andPE-conjugated anti-CD8a (53-6.7). PE-conjugated anti-CD4 (GK1.5) wasused as a control for nonspecific staining. CD28 expression was evaluatedwith mAb 37.51, followed by FITC-labeled rabbit anti-hamster IgG (Jack-son ImmunoResearch, West Grove, PA) using hamster IgG anti-keyholelimpet hemocyanin Ab Ha4/8 as an isotype control.

RT-PCR analysis of cytokine gene transcription

T cell clones were cultured at 37°C for 6 h in six-well plates (Costar,Cambridge, MA) with medium alone, an equal number of stimulator cells,plate-bound anti-CD3 (2C11) at 1mg/ml, anti-CD3 plus anti-CD28 (37.51)at 1mg/ml each, or 10 ng/ml PMA plus 1mM ionomycin (Sigma, St. Louis,MO). Cells were washed twice with PBS, RNA was extracted withRNAgents Total RNA Isolation kit (Promega, Madison, WI), and reversetranscribed into cDNA using Superscript II (Life Technologies, Gaithers-burg, MD). The cDNA was amplified with primers specific for murine IL-2or IFN-g, and all reactions includedb-actin primers to control for cDNAinput. Forward (F) and reverse (R) primers were generated by Life Technol-

ogies and paired as follows: IL-2F: CCTGCAGGCATGTACAGCATG1IL-2R: GAGGTACATAGTTATTGAGGGC, yielding a 510-bp product fromthe IL-2 gene that spans exon/intron boundaries, IFN-gF: GCTCTGAGACAATGAACGCTA 1 IFN-gR: CGAATCAGCAGCGACTCCTTT, yield-ing a 475-bp product from theIFN-g gene that spans exon/intron boundaries,and b-actinF: GACGGGGTCACCCACACTGTGCCCATCTA1 b-actinR:GAAGTCTAGAGCAACATAGCACAGCTTCTC, yielding a 200-bp prod-uct. PCR was repeated for 25 cycles for IFN-g and 35 cycles for IL-2. PCRwas performed on the DeltaCycler II (Ericomp, San Diego, CA). PCRproducts were resolved on 1.5% agarose gels and visualized by ethidiumbromide staining.

Reporter gene constructs

The LacZH constructs containing multimers of IL-2 promoter enhancerelements driving expression of theEscherichia coli lacZreporter gene,with the hygromycin resistance gene (H) for selection of stable transfec-tants have been described elsewhere (32). Briefly, IL-2-LacZH contains2326 to147 of the proximal human IL-2 promoter; NFAT/AP-1-LacZHcontains three copies of the NFAT/AP-1 binding site (2286 to2257)linked to the minimal IL-2 promoter (272 to147) encoding the TATAbox and transcriptional start site; OCT/AP-1-LacZH contains four copiesof the OCT/AP-1 binding site (293 to265) attached to the minimal IL-2promoter; and CD28RE/AP-1-LacZH contains four copies of the CD28RE/AP-1 binding region (2159 to2134) linked to the minimal IL-2 promoter.

A consensus AP-1 reporter gene construct was generated using oligo-nucleotides (oligo) representing the AP-1 binding site from the humanmetallothionein gene (33):tcgaCGCTTGATGACTCAGCCGGAA andtcgaTTCCGGCTGAGTCATCAAGCG (AP-1 binding site underlined,XhoIoverlap bases in lower case italics). Oligos were annealed and ligated intoLacZH containing the minimal IL-2 promoter. A plasmid with six copiesof the AP-1 consensus binding site in the forward orientation and one copyin the reverse orientation was selected for transfection studies. Fluorescentsequencing was performed on an Applied Biosystems Fluorescent Se-quencer usingTaq Dye Terminator reagents (Applied Biosystems, FosterCity, CA).

Mutations to the IL-2 promoter were accomplished using the PCRSplice Overlap Extension technique (PCR SOEing) (34), with IL-2-LacZHserving as a template. External primers were the same for all PCR SOEingreactions. The external forward primer (EXF) ATCGATGTTTTCTGAGTTACTT is complementary to the 59end of the 320-bp IL-2 promoter, andthe external reverse primer (EXR) TTCCCAGTCACGACGTTGTA iscomplementary to the 59end of thelacZgene. In the internal primers listedbelow, the binding sites are underlined and mutations are in bold type. The2180 AP-1 site was mutated to a nonbinding site by pairing EXF with the2180 AP-1 Null reverse primer CCAAAGACTGCAAGAATGGATGTAG in one PCR, and EXR with the 2180 AP-1 Null forward primerCTACATCCATTCTTGCAGTCTTTGG in a separate PCR. The2150AP-1 site was replaced with a consensus AP-1 site by pairing EXF and the2150 AP-1 consensus reverse primer CTCTTCTGATGAGTCATTGGAATTTC in one PCR, and EXR with the2150 AP-1 consensus forwardprimer GAAATTCCAATGACTCATCAGAGAG in a separate PCR. Acomposite CD28RE/AP-1 consensus site wasadded to the IL-2 promoter bypairing EXF with the CD28RE/AP-1 consensus reverse primer ATTTCTTTAAACCCCCAAAGACTGAGTCA, and then EXR with the CD28RE/AP-1consensus forward primer TTTGGGGGTTTAAAGAAATTCCAATGACTCA. The products from each of the sets of PCR were combined andused as overlapping templates in PCR SOEing reactions with external primersto generate the IL-2 promoter with the designated mutations (see Fig. 3A). Thefidelity of the mutations was confirmed by sequencing.

Stable transfection of murine T cell clones and P815

T cell clones were transfected by electroporation at 250 mV, 940mF (Pro-genetor II; Hoefer, San Francisco, CA) 6 days after antigenic stimulationwith irradiated BALB/c splenocytes. All reporter gene plasmids were lin-earized 59of the promoter of interest. Electroporated cells were selected for2–3 wk in medium containing 0.25 mg/ml hygromycin. Aliquots of thehygromycin-resistant cells were stimulated with 10 ng/ml PMA plus 1mMionomycin for 3 h, then assayed histochemically forb-galactosidase (b-gal) expression (35). It was necessary to subclone the majority of trans-fected lines to enrich forb-gal-expressing cells.b-gal1 lines were sub-cloned by limiting dilution in 96-well plates, and only transfectants thatexpressed negligibleb-gal in the absence of stimulation were selected.

cDNAs encoding murine B7-1 and B7-2 were cloned into the eukaryoticvectors pNA9and pHA9, respectively, as described (14). Both constructswere linearized, then transfected into P815 cells via electroporation (250mV, 940 mF). Electroporated cells were selected with 0.5 mg/ml G418

4 Abbreviations used in this paper: CD28RE, CD28 response element;b-gal, b-ga-lactosidase; CPS, counts per second; CREB, cAMP response element-binding protein;ERK, extracellular signal-regulated kinase; FRK, Fos regulating kinase; JNK, Junamino-terminal kinase; PCR SOEing, PCR Splice Overlap Extension technique; F,forward; R, reverse.

6531The Journal of Immunology

by guest on March 16, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

(Sigma) and 0.25 mg/ml hygromycin B (Boehringer Mannheim, Indianap-olis, IN). Antibiotic-resistant cells were screened for both B7-1 and B7-2expression by flow cytometry using FITC-coupled anti-B7-1 (1G10) andanti-B7-2 (GL-1). Positive cells were sorted into 96-well culture plates(Costar). Surface expression of B7-1 and B7-2 on subclones was deter-mined by flow cytometry, and a subclone expressing matched high levelsof B7-1 and B7-2 was selected for use as a stimulator cell line. TransfectedP815 cells were maintained in medium with 0.5 mg/ml G418 and 0.25mg/ml hygromycin B, and assessed by flow cytometry periodically to ver-ify stable B7-1 and B7-2 expression.

Chemiluminescent assay for quantitation ofb-gal activity

b-gal activity was measured using the chemiluminescent substrate Galac-ton-Star(Tropix, Bedford, MA). T cells (1.253 105) were plated in trip-licate in 96-well plates for 6 h at 37°C with medium alone, an equal numberof P815 stimulator cells, or 10 ng/ml PMA plus 1mM ionomycin, washedwith PBS, and lysed with buffer provided by the manufacturer. Sampleswere incubated with chemiluminescent substrate for 1 h in Dynex Mi-croFLUOR black 96-well microplates (Dynex Technologies, Chantilly,VA). Light output was measured using the Single Photon Count mode at24°C for 1.2 s/well on a Packard Top Count microplate luminometer(Packard, Meriden, CT). Due to variations inb-gal activity among sub-clones possibly resulting from a variable number of integrated transgenes,the induction ofb-gal activity in response to stimulation was comparedwith that detected in unstimulated cells for a panel of six subclones fromeach transfectant. The subclones representing the mean level ofb-gal in-duction for each stimulation condition are shown as the representativetransfectants (see Figs. 4– 6).

ResultsIL-22 and IL-21 CD81 T cell clones express comparable levelsof CD3, CD8, and CD28

One possible explanation for the inability of some effector CD81

T cells to produce IL-2 is decreased signal strength due to down-regulation of critical signaling molecules. Therefore, surface ex-pression of CD3, CD8, and CD28 on CD81 T cell clones wasassessed by flow cytometry. The IL-22 clones, L3 and DB45, andthe IL-21 clones, 2C and Ld 8.6.1, expressed approximatelyequivalent levels of CD3 and CD8 (Fig. 1,A andB). CD28 wasexpressed at the highest levels on L3, and was approximatelyequivalent on DB45 and 2C, but slightly lower on Ld 8.6.1. (Fig.1C). These results suggest that reduction of CD3, CD8, or CD28on L3 and DB45 did not account for the inability of these clonesto produce IL-2 in response to Ag.

IL-22 CD81 T cells do not transcribe IL-2 mRNA in responseto Ag

Transcription of theIL-2 and IFN-g genes was assessed undervarying conditions: either medium alone, or after stimulation withLSTRA, P815, P815/B7-11 2 transfectants, plate-bound anti-CD3, anti-CD3 plus anti-CD28, or PMA plus ionomycin. Allclones were assessed 6 h after stimulation following a rest periodof 10 days from the previous stimulation. IFN-g mRNA was in-duced in response to all stimuli, indicating that the cells were ac-tivated (Fig. 2A). No baseline transcription of theIL-2 gene wasdetectable in CD81 T cell clones cultured in medium alone (Fig.2B). Following stimulation with plate-bound anti-CD3, anti-CD3plus anti-CD28, or PMA plus ionomycin, IL-2 mRNA was tran-scribed by all CD81 T cell clones. In response to allogeneic stim-ulation with LSTRA, P815 cells, or P815/B7-11 2 transfectants,the IL-21 CD81 T cell clones 2C and Ld 8.6.1 transcribed IL-2mRNA, whereas the IL-22 CD81 T cell clones L3 and DB45 didnot transcribe detectable IL-2 mRNA. Thus, the restriction of IL-2production in CD81 T cell subsets is controlled at least in part atthe level of mRNA transcription and/or stability.

The proximal IL-2 promoter is not transactivated in IL-22

CD81 T cells

Transactivation of the proximal IL-2 promoter was evaluated inresponse to varying stimuli. The proximal IL-2 promoter-LacZHreporter gene construct (Fig. 3A) was stably transfected into theIL-22 CD81 clones L3 and DB45, and into the IL-21 CD81 clone2C, which most closely matched the surface phenotype of theIL-22 CD81 clones. Ld 8.6.1 was not used in reporter gene anal-yses due to variable stability of transgenes in this clone. Reportergene expression was detected in both L3 and DB45 in response toPMA plus ionomycin, but no significant activity was observedafter 6 h in response to antigenic stimulation with P815 or P85/B7-1 1 2 (Fig. 4A). In contrast, the IL-21 CD81 T cell clone 2Ctransactivated the IL-2 promoter in response to P815, and costimu-lation with B7-1 and B7-2 enhanced transactivation compared withstimulation with P815 alone. Analysis of a panel of L3 and DB45subclones failed to detect any cells capable of transactivating theIL-2 promoter in response to Ag, or Ag plus costimulation.

Disruption of the potentially inhibitory2180 AP-1 binding sitedoes not restore transactivation of the IL-2 promoter

We evaluated whether a negative regulatory factor similar to thatidentified in anergic CD41 T cells played a role in negativelyregulating IL-2 promoter transactivation in CD81 T cells by re-moving the binding site for the putative inhibitor. The2180 AP-1site in the IL-2 promoter was converted to a nonbinding site bymutating the TCAGTCA AP-1 motif to TCTTGCA (Fig. 3A),because an identical 3-bp mutation restored transactivation of theIL-2 promoter in anergic CD41 cells (21). In L3 and DB45 trans-fectants, the2180 AP-1 null version of the IL-2 promoter wasvery weakly activated in response to PMA plus ionomycin (Fig.4B). This reduced activity in comparison to the native IL-2 pro-moter suggested a potential positive rather than negative contribu-tion from this site in CD81 T cells. No significant response was

FIGURE 1. Comparable expression of CD3, CD8, and CD28 on IL-22

and IL-21 CD81 T cell clones. T cell clones were stained for CD3 (A),CD8 (B), or CD28 (C) expression, as described inMaterials and Methods.The shaded curve represents unstained cells, and the unshaded curve rep-resents staining with the labeled Ab.

6532 TRANSCRIPTIONAL BLOCK AT 2150 AP-1 SITE IN CD81 T CELLS

by guest on March 16, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

observed in L3 or DB45 transfectants following stimulation withAg or Ag plus costimulation. Analysis of multiple subclones of L3and DB45 confirmed that the2180 AP-1 mutation severely re-duced IL-2 promoter activity. IL-21 2C transfectants bearing the2180 AP-1 null mutation exhibited marginal promoter activitycompared with the native IL-2 promoter in response to PMA plusionomycin, Ag, or Ag plus costimulation, with only 1.3-fold in-duction over levels in unstimulated cells. Thus, the2180 AP-1 siteappears to provide a positive signal, and is not responsible forrepressing IL-2 transcription in CD81 T cells.

The2150 CD28RE/AP-1 site is selectively not transactivated inresponse to Ag in IL-22 CD81 T cells

The three enhancer binding sites for NFAT/AP-1, OCT/AP-1, andCD28RE/AP-1 have been identified as critical domains controllingIL-2 transcription in CD41 T cells (27). To evaluate transactiva-tion of these elements, reporter constructs (Fig. 3B) were trans-fected into L3, DB45, and 2C. Transactivation of the NFAT/AP-1binding site was observed in response to PMA plus ionomycin, Agstimulation, and Ag plus costimulation in all three clones (Fig. 5A).Analysis of multiple subclones for each transfectant confirmedtransactivation in response to all stimulation conditions.

The OCT/AP-1-LacZ reporter construct demonstrated inducibleb-gal activity in all three clones in response to PMA plus iono-mycin, Ag, or Ag plus costimulation (Fig. 5B), which was con-firmed for L3 by analysis of multiple subclones. Although thisbinding site did not induce high levels of reporter gene activity inany of the CD81 T cell clones, no significant differences wereevident between the IL-21 clone and IL-22 clones. Thus, neitherthe NFAT/AP-1 nor OCT/AP-1 binding site appear to be targetsfor differential regulation of the IL-2 promoter.

In contrast, the IL-22 clones L3 and DB45, despite beingCD281, induced the CD28RE/AP-1-LacZ reporter construct onlyin response to PMA plus ionomycin, and failed to induceb-galactivity in response to Ag, even in the presence of costimulation(Fig. 5C). This was again confirmed by analysis of a panel of L3

and DB45 subclones. However, IL-21 2C transfectants exhibitedreporter gene activity in response to all three stimuli, with thestrongest response induced by Ag plus costimulation. The activityof this enhancer element in all three clones mirrored those ob-served for the intact proximal IL-2 promoter in response to PMAplus ionomycin and Ag recognition. These results suggest that theCD28RE/AP-1 element may be subject to differential regulation insubpopulations of CD81 T cells.

IL-22 CD81 T cells express functional AP-1 complexes

Although all of the analyzed reporter constructs of multimerizedbinding elements represent composite sites containing an AP-1binding site, each composite site may bind different combinationsof Jun and/or Fos family members. Therefore, to determinewhether a general defect in AP-1 or a defect specific to the non-consensus2150 AP-1 site exists in IL-22 CD81 T cells, transac-tivation of a consensus AP-1 site was examined. The consensusAP-1 site differs from the CD28RE/AP-1 site in two significantways: it does not contain the binding site for the CD28 responsecomplex, and it exhibits higher affinity for the Jun/Fos heterodimer(36). The multimerized consensus AP-1-LacZ reporter gene (Fig.3B) was induced following activation of L3, DB45, and 2C withPMA plus ionomycin, Ag, and Ag plus costimulation (Fig. 6A).These results, confirmed by analysis of a panel of subclones foreach transfectant, suggest that functional AP-1 complexes are be-ing induced in IL-22 CD81 T cells in response to Ag recognition.

Mutation of2150 AP-1 site to a consensus AP-1 site restorestransactivation of the IL-2 promoter

The failure of IL-22 CD81 T cells to transactivate the CD28RE/AP-1 site could reflect either a defect in the CD28 response com-plex that binds to the CD28RE and/or a defect in specific AP-1

FIGURE 2. Differential transcription of IL-2 mRNA in IL-22 andIL-21 CD81 T cell clones in response to Ag. CD81 T cell clones werecultured for 6 h with medium alone (lane 1), LSTRA (2), P815 (3), P815/B7-1 1 2 (4), PMA plus ionomycin (5), anti-CD3 (6), or anti-CD31anti-CD28 (7). MW, A 100-bp molecular weight ladder (Life Technolo-gies). RNA was harvested and cDNA made as described inMaterials andMethods.A 475-bp product was amplified by RT-PCR from IFN-g cDNA(A), and a 510-bp product was amplified from IL-2 cDNA (B). A 200-bpfragment of theb-actin gene was amplified in all reactions as a control forcDNA input.

FIGURE 3. Schematics ofLacZH reporter gene constructs.A, IL-2-LacZH contains the proximal human IL-2 promoter (2326 to147) linkedto the lacZ gene. The2180 AP-1 null mutation,2150 AP-1 consensusmutation, and insertion of the CD28RE/AP-1 consensus site were per-formed as described inMaterials and Methods.B, All multimerized ele-ments were linked to the minimal IL-2 promoter containing the TATA boxand transcriptional start site (272 to147) preceding thelacZ gene.

6533The Journal of Immunology

by guest on March 16, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

complexes required to transactivate the AP-1 component of thecomposite site, because both sites must be occupied for enhanceractivity (25). To directly assess the AP-1 site, we left the CD28REintact, but replaced the native2150 AGAGTCA AP-1 site withthe consensus AP-1 motifTGACTCA, and transfected this mod-ified IL-2 promoter-LacZ reporter construct (Fig. 3A) into L3,DB45, and 2C. In response to PMA plus ionomycin, all threeclones transactivated the mutated IL-2 promoter (Fig. 6B). More-over, in contrast to the native IL-2 promoter, detectableb-gal ac-tivity from the modified2150 AP-1 consensus IL-2 promoter wasinduced by Ag in L3 and DB45, and was further increased bycostimulation. Clone 2C exhibited high levels ofb-gal activity inresponse to Ag and Ag plus costimulation. This pattern of activa-tion was confirmed by subclone analyses with L3 and 2C. Thus,conversion of the2150 AP-1 site to a consensus AP-1 site appearssufficient to at least partially restore IL-2 promoter activity in re-sponse to Ag in IL-22 CD81 T cell clones.

Transactivation of the IL-2 promoter containing the2150 AP-1consensus mutation in IL-22 CD81 clones could have resultedfrom replacement of an AP-1 site requiring specific AP-1 familymembers that are not present with a binding site capable of beingtransactivated by alternate AP-1 complexes, or from disruption ofa site that previously bound a negative regulator. To distinguishbetween these two possibilities, the native IL-2 promoter was al-tered by insertion of a modified CD28RE/AP-1 element containinga consensus AP-1 site between the2180 and2150 enhancer sites(Fig. 3A). This mutation adds a functional CD28RE/AP-1 site tothe promoter while leaving the native CD28RE/AP-1 site intactand potentially capable of binding a negative regulator. This mod-ified IL-2 promoter was responsive to PMA plus ionomycin, to Ag,

and to Ag plus costimulation in all three CD81 clones (Fig. 6C).This pattern of activation in response to all stimuli was consistentamong all L3 and 2C subclones. However, we noted that higherlevels of reporter gene activity were detected in the 2C transfectantthan in L3 and DB45. This increase might reflect a greater trans-gene copy number in the 2C transfectant, but we cannot com-pletely rule out the possibility of partial repressor activity at thissite in L3 and DB45. Thus, the addition of a functional CD28RE/AP-1 site could conceivably override or displace a repressor bind-ing at the -ISOAP-1 site in the native promoter, or alternativelyrestore transactivation by providing a composite site that can bindAP-1 complexes induced in response to Ag recognition.

DiscussionRecent evidence demonstrating that a CREB/cAMP response ele-ment modulator complex binds to the2180 AP-1 site in anergicCD41 T cells and negatively regulates IL-2 transcription sug-gested that a similar or related complex may restrict IL-2 expres-sion in effector CD81 T cells. However, mutations we made in the2180 AP-1 site, known to disrupt that site and restore promoteractivity in anergic CD41 T cells (21), suggested an alternativemechanism must be operative. In addition to the inhibitory mech-anism operating at the2180 AP-1 site, a defect at the2150 AP-1site has been implicated in anergy induction (19–21), and we haveidentified that this site is also targeted in the restriction of IL-2production by effector CD81 T cells.

One possibility for the observed failure of IL-22 CD81 T cellsto transactivate the nonconsensus2150 AP-1 site in response toAg is that the obligatory transcription factors were not induced or

FIGURE 4. Disruption of IL-2 promoter activity by2180 AP-1 sitemutation. L3, DB45, and 2C transfectants were cultured for 6 h with me-dium (unstimulated), Ag, (P815), Ag plus costimulation (P815/B7-11 2),or PMA plus ionomycin (P1I).b-gal activity was measured in counts persecond (CPS) as described inMaterials and Methods. Bar graphs representthe mean from three replicates6 SEM. A, IL-2-LacZH transfectants.B,IL-2-LacZH with 2180 AP-1 “null” mutation. For bothA and B, trans-fectants of L3 and DB45 are shown that represent the mean induction in apanel of six subclones for each transfectant. Activity of 2C was measuredin a transfected clonal population.

FIGURE 5. Selective transactivation of composite AP-1 sites in IL-2promoter. L3, DB45, and 2C transfectants were cultured for 6 h with me-dium (unstimulated), Ag, (P815), Ag plus costimulation (P815/B7-11 2),or PMA plus ionomycin (P1I).b-gal activity was measured in CPS. Bargraphs represent the mean from three replicates6 SEM. A, NFAT/AP-1-LacZH: L3, DB45, and 2C transfectants shown represent the mean activitydetected in a panel of six subclones for each transfectant.B, OCT/AP-1-LacZH: the representative mean transfectant from a panel of six subclonesis shown for L3; DB45 and 2C activity was measured in transfected clonalpopulations.C, CD28RE/AP-1-LacZH: representative mean transfectantsfrom panels of six subclones each are shown for L3 and DB45; activity of2C was measured in a transfected clonal population.

6534 TRANSCRIPTIONAL BLOCK AT 2150 AP-1 SITE IN CD81 T CELLS

by guest on March 16, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

activated. Members of the activating transcription factor-1/CREBfamily have been shown to transactivate the2150 AP-1 site (37),representing one possible complex that could act to differentiallyregulate the2150 AP-1 site. A second possibility is that the req-uisite Fos or Jun family member(s) were not induced or appropri-ately activated in response to antigenic stimulation. AP-1 com-plexes can consist of different dimeric Fos and Jun familymembers and exhibit variable DNA binding specificity. AlthoughJun/Jun homodimers can transactivate AP-1 sites, Fos/Jun het-erodimers are more potent transactivators (38). The nonconsensus2150 AP-1 site is a “low affinity” site for the Fos/Jun heterodimer(36), and may require a specific combination of Fos/Jun familymembers for activation. By contrast, the NFAT/AP-1 site and con-sensus AP-1 sites are “high affinity” binding sites and can be trans-activated with both Fos/Jun and Jun/Jun dimers (39). Hence, theability of IL-22 CD81 T cells to transactivate the NFAT/AP-1,OCT/AP-1, and consensus AP-1 sites but not the2150 AP-1 sitecould result from limitation or inactivation of a required factor,such as one of the Fos proteins. Several Fos family members suchas Fra1, Fra2, and an alternatively spliced form of FosB lack tran-scriptional activation domains (40, 41). These transcriptionally in-active forms of Fos might have preferential affinity for the2150AP-1 site while not efficiently binding and interfering with trans-activation of the NFAT/AP-1, OCT/AP-1, or consensus AP-1 sites.

Our results are consistent with the hypothesis that antigenicstimulation of IL-22 CD81 T cells does not result in the inductionor activation of the specific nuclear proteins required to transacti-vate the2150 AP-1 site, and consequently the entire IL-2 pro-moter is rendered inactive. Protein-DNA interactions at distal siteswithin the IL-2 promoter have been demonstrated to be unstable if

even one transcription factor is missing (42). The possibility that amissing factor is responsible for the differences in cytokine secre-tion patterns in IL-21 and IL-22 CD81 T cells is consistent withstudies using heterokaryons between CD41 and CD81 T cellclones. In those studies, fusion of the CD81 T cell clone L3 withan IL-21 CD41 fusion partner did not repress secretion of IL-2,suggesting the absence of a dominant negative regulatory factorfor IL-2 expression in CD81 T cells (43). In contrast, heterokaryonformation between nonanergic and anergic CD41 T cells disruptedtransactivation of theIL-2 gene in the fusion partner, suggestingthe presence of a dominant negative regulatory mechanism forrestriction of IL-2 production in anergic CD41 T cells (44).

Although we did not examine potential signaling defects in thisstudy, the data presented suggest that the failure of effector CD81

T cells to produce IL-2 may lie in their failure to adequately trans-mit a costimulatory signal, resulting in the inability to transactivatethe2150 AP-1 site. Identification of the specific transcription fac-tors that bind to the2150 AP-1 site in CD81 T cells in responseto Ag would provide insight into which signaling molecules mightbe involved in the restriction of IL-2 production in effector CD81

T cells. In light of the potential role of activating transcriptionfactor/CREB family members at the2150 AP-1 site (37), it mightbe of interest to examine p38 mitogen-activated protein kinase.Other candidates include extracellular signal-regulated kinase(ERK), Fos regulating kinase (FRK), and Jun amino-terminal ki-nase (JNK), that function downstream of Ras, and act together toregulate the expression and function of Fos and Jun proteins (45–47). ERK induces the transcription offos mRNA by phosphory-lating the Elk-1 transcription factor in the fos promoter (48), FRKacts to enhance transcriptional activation of Fos proteins by phos-phorylation (46), and JNK phosphorylates and activates Jun pro-teins (47). In anergic CD41 T cells, Ras activation was shown tobe selectively blocked, leading to reduced activity of ERK andJNK, but treatment with PMA, which bypasses the TCR to activatethe Ras signaling pathway, restored activation of both ERK andJNK and partially restored IL-2 production (16, 17). Our observa-tion that stimulation with ionomycin plus PMA induced IL-2 genetranscription in CD81 T cells that do not produce IL-2 in responseto Ag suggests that the Ras mitogen-activated protein kinase path-way may not be efficiently activated by Ag stimulation in IL-22

CD81 T cells. Although NFAT/AP-1, OCT/AP-1, and a consensusAP-1 site were transactivated in response to Ag, this does not ruleout the possibility that JNK was inactive in IL-22 CD81 T cells.Studies in anergic cells have shown that some AP-1 sites remainfunctional, despite the apparent block in JNK activation (20). Thissuggests that jun proteins that are not phosphorylated by JNK, suchas JunB, could act to transactivate certain AP-1 sites (49). Even ifJNK was active, transactivation of the2150 AP-1 site also re-quires transcriptionally active fos protein. The only mechanism forinducing and activating Fos proteins is through ERK and FRK,which are both dependent on Ras activity. Consequently, a blockin the Ras pathway could specifically affect the expression andactivation of Fos proteins, leading to impaired transactivation ofsites requiring Fos/Jun heterodimers and resulting in the failure ofeffector CD81 T cells to produce IL-2.

CD81 T cells may have evolved to lose the capacity for IL-2expression to provide an additional regulatory mechanism foravoiding autoimmune tissue damage caused by self-reactive CTLthat escape thymic deletion. Although there are settings in whichCD81 T cells can respond independently of CD41 T cells, such asto clear certain acute viral infections, immune responses in theabsence of CD4 help generally are limited in magnitude and do notpersist long-term (2–6). Mechanistically, the division of roles inthe T cell compartment could be governed by the different types of

FIGURE 6. Restoration of IL-2 promoter activity by consensus AP-1site mutations. L3, DB45, and 2C transfectants were cultured for 6 h withmedium (unstimulated), Ag, (P815), Ag plus costimulation (P815/B7-112), or PMA plus ionomycin (P1I).b-gal activity was measured in CPS.Bar graphs represent the mean from three replicates6 SEM. A, Multim-erized AP-1 consensus-LacZH: L3, DB45 and 2C transfectants represent-ing the average level of induction measured in a panel of six subcloneseach are shown.B, IL-2-LacZH with 2150 AP-1 consensus mutation.C,IL-2-LacZH with CD28RE/AP-1 consensus insertion. For bothB and C,mean transfectants from panels of six subclones each are represented forL3 and 2C, and activity of DB45 was measured in a transfected clonalpopulation.

6535The Journal of Immunology

by guest on March 16, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

APC recognized by CD41 and CD81 T cell subsets. CD41 Tlymphocytes recognize cells bearing Ag in the context of class IIMHC, and these “professional” APC usually express B7 mole-cules. Such APC are capable of delivering both a signal throughthe TCR and a costimulatory signal through CD28, resulting inIL-2 production by CD41 T cells. CD81 T lymphocytes recognizetargets expressing Ag in the context of class I MHC, and most ofthese cells lack the costimulatory molecules B7-1 and B7-2. Afterencounter with Ag on class I targets in the absence of costimula-tion, the CD81 T cell may become “anergized” with respect toIL-2 production while retaining effector function (11). The molec-ular mechanism for inducing and maintaining this state of splitanergy in CD81 T cells appears to share some, but not all, of thefeatures that have been described in anergic CD41 T cells. Agreater understanding of the molecular events leading to the aner-gic state in CD81 T cells could have implications for therapeuticintervention in a variety of clinical settings.

AcknowledgmentsWe thank Dr. Gerald Crabtree and Dr. Steven Fiering for providing theLacZH constructs. We are also grateful to Kent Slaven, Wendy Walker,and Katie Weber for maintaining our mouse colonies, and we are indebtedto Eric Baker for his assistance in the preparation of this manuscript.

References1. Miller, R. A. 1983. IL-2 production by mitogen-stimulated T cell subsets: helper

precursors are predominantly Lyt-22. J. Immunol. 31:2864.2. Matloubian, M., R. J. Concepcion, and R. Ahmed. 1994. CD41 T cells are re-

quired to sustain CD81 cytotoxic T-cell responses during chronic viral infection.J. Virol. 68:8056.

3. Cardin, R. D., J. W. Brooks, S. R. Sarawar, and P. C. Doherty. 1996. Progressiveloss of CD81 T cell-mediated control of ag-herpesvirus in the absence of CD41

T cells.J. Exp. Med. 184:863.4. Rahemtulla, A., W. P. Fung-Leung, M. W. Schilham, T. M. Kundig,

S. R. Sambhara, A. Narendran, A. Arabian, A. Wakeham, C. J. Paige,R. M. Zinkernagel, et al. 1991. Normal development and function of CD81 cellsbut markedly decreased helper cell activity in mice lacking CD4.Nature 353:180.

5. Battegay, M., D. Moskophidis, A. Rahemtulla, H. Hengartner, T. W. Mak, andR. M. Zinkernagel. 1994. Enhanced establishment of a virus carrier state in adultCD41 T-cell-deficient mice.J. Virol. 68:4700.

6. von Herrath, M. G., M. Yokoyama, J. Dockter, M. B. Oldstone, and J. L. Whitton.1996. CD4-deficient mice have reduced levels of memory cytotoxic T lympho-cytes after immunization and show diminished resistance to subsequent viruschallenge.J. Virol. 70:1072.

7. Ridge, J. P., F. DiRosa, and P. Matzinger. 1998. A conditioned dendritic cell canbe a temporal bridge between a CD41 T-helper and a T-killer cell.Nature 393:474.

8. Bennett, S. R. M., F. R. Carbone, F. Karamalis, R. A. Flavell, J. F. A. P. Miller,and W. R. Heath. 1998. Help for cytotoxic T-cell responses is mediated by CD40signaling.Nature 393:478.

9. Schoenberger, S. P., R. E. M. Toes, E. I. H. van der Voort, R. Offringa, andC. J. M. Melief. 1998. T cell help for cytotoxic T lymphocytes is mediated byCD40-CD40L interactions.Nature 393:480.

10. Lu, Z., L. Yuan, X. Zhou, E. Sotomayor, H. I. Levitsky, and D. M. Pardoll. 2000.CD40-independent pathways of T cell help for priming of CD81 cytotoxic Tlymphocytes.J. Exp. Med. 191:541.

11. Otten, G. R., and R. N. Germain. 1991. Split anergy in a CD81 T cell: receptordependent cytolysis in the absence of interleukin-2 production.Science 251:1228.

12. Chen, L., S. Ashe, W. A. Brady, I. Hellstrom, K. E. Hellstrom, J. A. Ledbetter,P. McGowan, and P. S. Linsley. 1992. Costimulation of antitumor immunity bythe B7 counterreceptor for the T lymphocyte molecules CD28 and CTLA-4.Cell71:1093.

13. Townsend, S., and J. P. Allison. 1993. Tumor rejection after direct costimulationof CD81 T cells by B7-transfected melanoma cells.Science 258:368.

14. Fields, P. E., R. J. Finch, G. S. Gray, R. Zollner, J. L. Thomas, K. Sturmhoefel,K. Lee, S. Wolf, T. F. Gajewski, and F. W. Fitch. 1998. B7.1 is a quantitativelystronger costimulus than B7.2 in the activation of naı̈ve CD81 TCR-transgenic Tcells.J. Immunol. 161:5268.

15. Noble, A., P. A. Macary, and D. M. Kemeny. 1995. IFNg and IL-4 regulate thegrowth and differentiation of CD81 T cells into subpopulations with distinctcytokine profiles.J. Immunol. 155:2928.

16. Li, W., C. D. Whaley, A. Mondino, and D. L. Mueller. 1996. Blocked signaltransduction to the ERK and JNK protein kinases in anergic CD41 T cells.Science 271:1272.

17. Fields, P. E., T. F. Gajewski, and F. W. Fitch. 1996. Blocked Ras activation inanergic CD41 T cells.Science 271:1276.

18. Jenkins, M. K., D. M. Pardoll, J. Mizuguchi, T. M. Chused, and R. H. Schwartz.1987. Molecular events in the induction of a non-responsive state in interleukin-2producing helper T-lymphocyte clones.Proc. Natl. Acad. Sci. USA 84:5409.

19. Mondino, A., C. D. Whaley, D. R. DeSilva, W. Li, M. K. Jenkins, andD. L. Mueller. 1996. Defective transcription of the IL-2 gene is associated withimpaired expression of c-fos, FosB, and JunB in anergic T helper 1 cells.J. Im-munol. 157:2048.

20. Kang, S. M., B. Beverly, A. C. Tran, K. Brorson, R. H. Schwartz, andM. J. Lenardo. 1992. Transactivation by AP-1 is a molecular target of T cellclonal anergy.Science 257:1134.

21. Sakakida, S. K., and R. H. Schwartz. 1996. Multifactorcis-dominant negativeregulation of IL-2 gene expression in anergized T cells.J. Immunol. 157:2328.

22. Powell, J. D., C. G. Lerner, G. R. Ewoldt, and R. H. Schwartz. 1999. The2180site of the IL-2 promoter is the target of CREB/CREM binding in T cell anergy.J. Immunol. 163:6631.

23. Angel, P., and M. Karin. 1991. The role of Jun, Fos, and the AP-1 complex incell-proliferation and transformation.Biochim. Biophys. Acta 1072:129.

24. Jain, J., P. G. McCaffrey, Z. Miner, T. K. Kerppola, J. N. Lambert, G. L. Verdine,T. Curran, and A. Rao. 1994. The T cell transcription factor NFATp is a substratefor calcineurin and interacts with Fos and Jun.Nature 365:352.

25. Shapiro, V. S., K. E. Truitt, J. B. Imboden, and A. Weiss. 1997. CD28 mediatestranscriptional upregulation of the IL-2 promoter through a composite elementcontaining the CD28RE and NFIL2B AP-1 sites.Mol. Cell. Biol. 17:4051.

26. De Grazia, U., M. P. Felli, A. Vacca, A. R. Farina, M. Maroder, L. Cappabianca,D. Meco, M. Farina, I. Screpanti, L. Frati, and A. Gulino. 1994. Positive andnegative regulation of the composite octamer motif of the interleukin 2 enhancerby AP-1, Oct-2, and retinoic acid receptor.J. Exp. Med. 180:1485.

27. Durand, D. B., J. P. Shaw, M. R. Bush, R. E. Replogle, R. Belagaje, andG. R. Crabtree. 1988. Characterization of antigen receptor response elementswithin the interleukin-2 enhancer.Mol. Cell. Biol. 8:1715.

28. Glasebrook, A. L., and F. W. Fitch. 1980. Alloreactive cloned T cell lines. I.Interactions between cloned amplifier and cytolytic T cell lines.J. Exp. Med.151:876.

29. Moldwin, R. L., D. W. Lancki, K. C. Herold, and F. W. Fitch. 1986. An antigenreceptor-driven, interleukin 2-independent pathway for proliferation of murinecytolytic T lymphocyte clones.J. Exp. Med. 163:1566.

30. McKisic, M. D., D. W. Lancki, D. C. Cronin, and F. W. Fitch. 1993. Cytolyticactivity of murine IL-2 producing CD41 and CD81 T cell clones cycles in re-sponse to IL-2.J. Immunol. 151:4055.

31. Saito, H., D. M. Kranz, Y. Takagaki, A. C. Hayday, H. N. Eisen, andS. Tonegawa. 1984. A third rearranged and expressed gene in a clone of cytotoxicT lymphocytes.Nature 312:36.

32. Mattila, P., K. S. Ullman, S. Fiering, E. A. Emmel, M. McCutcheon,G. R. Crabtree, and L. A. Herzenberg. 1990. The actions of cyclosporin A andFK506 suggest a novel step in the activation of T lymphocytes.EMBO J. 9:4425.

33. Lee, W., P. Mitchell, and R. Tjian. 1987. Purified transcription factor AP-1 in-teracts with TPA-inducible enhancer elements.Cell 6:741.

34. Ho, S. N., S. D. Hunt, J. K. Pullen, and L. R. Pearce. 1989. Site-directed mu-tagenesis by overlap extension using the polymerase chain reaction.Gene 77:51.

35. Bondi, A., G. Chieregatti, V. Eusebi, E. Fulcheri, and G. Bussolati. 1982. The useof b-galactosidase as a tracer in immunocytochemistry.Histochemistry 76:153.

36. Jain, J., V. E. Valge-Archer, and A. Rao. 1992. Analysis of the AP-1 sites in theIL-2 promoter.J. Immunol. 148:1240.

37. Butscher, W. G., C. Powers, M. Olive, C. Vinson, and K. Gardner. 1998. Coor-dinate transactivation of the interleukin-2 CD28 response element by c-relandATF-1/CREB2.J. Biol. Chem. 273:552.

38. Ryseck, R. P., and R. Bravo. 1991. c-Jun, JunB, and JunD differ in their bindingaffinities to AP-1 and CRE consensus sequences: effect of Fos proteins.Oncogene6:533.

39. Petrak, D., S. A. Memon, M. J. Birrer, J. D. Ashwell, and C. M. Zacharchuk.1994. Dominant negative mutant of c-Jun inhibits NF-AT transcriptional activityand prevents IL-2 gene transcription.J. Immunol. 153:2046.

40. Suzuki, T., H. Okuno, T. Yoshida, T. Endo, H. Nishina, and H. Iba. 1991. Dif-ference in transcriptional regulatory function between c-fosand Fra-2.NucleicAcids Res. 19:5537.

41. Yen, J., R. M. Wisdom, I. Tratner, and I. M. Verma. 1991. An alternative spliceform of fosB is a negative regulator of transcriptional activation and transforma-tion by fos proteins.Proc. Natl. Acad. Sci. USA 88:5077.

42. Chen, D., and E. V. Rothenberg. 1994. Interleukin-2 transcription factors as mo-lecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorialtranscription roles.J. Exp. Med. 179:931.

43. Havran, W. L., and F. W. Fitch. 1987. Characterization of murine cytolytic-helperT cell clones.Nature 325:65.

44. Telander, D. G., E. N. Malvey, and D. L. Mueller. 1998. Evidence for repressionof IL-2 gene activation in anergic T cells.J. Immunol. 162:1460.

45. Izquierdo, M., S. J. Leevers, C. J. Marshall, and D. Cantrell. 1993. p21ras couplesthe T cell antigen receptor to extracellular signal-regulated kinase-2 in T lym-phocytes.J. Exp. Med. 178:1199.

46. Deng, T., and M. Karin. 1994. c-Fos transcriptional activity stimulated by H-ras-activated protein kinase distinct from JNK and ERK.Nature 371:171.

47. Su, B., E. Jacinto, M. Hibi, T. Kallunki, M. Karin, and Y. Ben-Neriah. 1994. JNKis involved in signal integration during costimulation of T lymphocytes.Cell77:727.

48. Marais, R., J. Wynne, and R. Treisman. 1993. The SRF accessory protein Elk-1contains a growth-factor-regulated transcriptional activation domain.Cell 73:381.

49. Franklin, C. C., V. Sanchez, F. Wagner, J. R. Woodgett, and A. S. Kraft. 1992.Phorbol ester-induced amino-terminal phosphorylation of human c-jun but notJunB regulates transcriptional activation.Proc. Natl. Acad. Sci. USA 89:7247.

6536 TRANSCRIPTIONAL BLOCK AT 2150 AP-1 SITE IN CD81 T CELLS

by guest on March 16, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from