Overexpression of Human CAP10-Like Protein 46 KDin T-Acute Lymphoblastic Leukemiaand Acute Myelogenous Leukemia

Youxin Wang,1 Naibai Chang,2 Tian Zhang,1 Hui Liu,2 Wenzhan Ma,1

Qiaoyun Chu,1 Qingxuan Lai,1 Lixin Liu,1 and Wei Wang1,3,4

Aims: We earlier identified a novel gene human CAP10-like protein 46 KD (hCLP46) from human acute mye-logenous leukemia (AML) transformed from myelodysplastic syndrome CD34þ cells, but the function of this generemains unclear. In this study, a real-time polymerase chain reaction-based assay was developed to quantifyexpression of hCLP46 in the peripheral blood of AML and T-acute lymphoblastic leukemia (T-ALL) primarysamples and in six leukemic cell lines. Also, we investigated expression of CDKN2A=B and the apoptosis inU937 cells when hCLP46 is downregulated in vitro. Results: Our findings showed that hCLP46 was overexpressedin AML, T-ALL, and the leukemic cell lines. Suppressing hCLP46 overexpression had no effect on expression ofCDKN2A=B and apoptosis of U937 cells. Conclusion: Considering that hCLP46 has the capability of modifying theNotch pathway, our finding adds weight to the importance of Notch signaling in hematopoiesis and suggests thatoverexpression of hCLP46 might be an early event in the pathogenesis of AML and T-ALL.

Introduction

We earlier identified a novel gene human CAP10-likeprotein 46 KD (hCLP46) from human acute myeloge-

nous leukemia (AML) transformed from myelodysplasticsyndrome CD34þ cells (Teng et al., 2006). hCLP46 (3q13.33)encodes a polypeptide of 392 amino acids, with a highlyconserved CAP10 domain, an N-terminal hydrophobic signalpeptide, and a C-terminal KTEL endoplasmic reticulum (ER)retention signal motif (Teng et al., 2006). The identification ofhCLP46 from myelodysplastic syndrome made us hypothe-size that this gene might overexpress in some types of he-matological malignancies.

Leukemia is characterized by an abnormal proliferation ofblood cells, usually leukocytes. hCLP46, identified in ourearlier study, possesses the ability of promoting cell prolifer-ation (Teng et al., 2006). Cell growth arrest is usually accom-panied by increase of CKIs and=or decreases of cyclins orcyclin-dependent kinases (CDKs), and CDKN2A (p16) andCDKN2B (p15) proteins are two cell cycle regulators involvedin the inhibition of G1 phase progression (Serrano and Han-non, 1993). Inactivation of CDKN2A and CDKN2B is fre-quently observed in AML and ALL, especially in T-acutelymphoblastic leukemia (T-ALL) (Sherr, 1996; Drexler, 1998;

Rosu-Myles and Wolff, 2008). Therefore, it is possible thathCLP46 promotes cell proliferation or apoptosis by theblocking of expression of CDKN2A and=or CDKN2B.

hCLP46 was speculated to be an enzyme for glycosylationof proteins (putative lipopolysaccharide-modifying enzyme,www.smart.embl-heidelberg.de with the SMART accessionnumber of SM00672). Rumi, a homolog of hCLP46, was re-cently mapped to CG31152 in Drosophila melanogaster (Acaret al., 2008). Rumi shares 52% identity with hCLP46 and alsoencodes a conserved protein with a signal peptide, a CAP10domain, and a C-terminal KDEL ER retention motif (Acaret al., 2008). Rumi, an O-glucosyltransferase, is capable ofadding glucose to serine residues in Notch epidermal growthfactor (EGF) repeats with the consensus C1-X-S-X-P-C2 se-quence; by O-glucosylating Notch in the ER, Rumi regulatesNotch folding and=or trafficking and allows signaling at thecell membrane (Acar et al., 2008). Considering that hCLP46and Rumi have similar sequence, identical structure andsubcellular location, the evolutionary conservation of theNotch signaling pathway, and presence of O-glucosylation inNotch proteins, we can arrive at the suggestion that hCLP46might have activity similar to Rumi and that it might be re-sponsible for adding glucose to serine residues in NotchEGF repeats. Haltiwanger et al. (Prof. Robert S. Haltiwanger,

1College of Life Science, Graduate University of Chinese Academy of Sciences, Beijing, China.2Department of Hematology, Beijing Hospital, Beijing, China.3School of Public Health and Family Medicine, Capital Medical University, Beijing, China.4Centre for Human Genetics, Edith Cowan University, Perth, Australia.

GENETIC TESTING AND MOLECULAR BIOMARKERSVolume 14, Number 1, 2010ª Mary Ann Liebert, Inc.Pp. 127–133DOI: 10.1089=gtmb.2009.0145

127

personal communication) expressed both the mouse and hu-man forms of the Rumi gene (hCLP46) and demonstrated thatthe expressed proteins contain protein O-glucosyltransferaseactivity.

In the present study, we investigated the expression pat-terns of hCLP46 in primary leukemic cells isolated from pe-ripheral blood mononuclear cells (PBMC) of normal subjectsand patients with AML or T-ALL and in six cultured leukemiccell lines. We also examined the alteration of expression of twoCDK inhibitors (CDKN2A and CDKN2B) and the apoptoticrate when hCLP46 was suppressed in U937 cells.

Materials and Methods

Blood samples and cell cultures

Twelve patients with primary AML and eight patients withprimary T-ALL were recruited from a single institution (Fu-jian Institute of Hematology, Fujian, China). Six patients withautoimmune-mediated thrombocytopenia and six healthyvolunteers acted as controls. All subjects had given theirconsent to the study. Diagnoses were made according tostandard morphological, immunological, and molecular ge-netic criteria. PBMC were separated using Ficoll-Urografingradients, frozen as viable cells, and kept at �808C.

The following leukemic cell lines were used: K562, Raji-1,KG-1, HL-60, U-937, and THP-1. They were cultured, as pre-viously reported (Chiaramonte et al., 2003), in completeRPMI-1640 medium supplemented with 5% fetal calf serumand incubated in humidified air with 5% CO2.

U937 cells transfection

U937 cells were grown in 1640 medium supplemented with5% fetal bovine serum at 378C in a humidified 5% CO2 at-mosphere. To suppress expression of hCLP46, we designedand synthesized an Hairpin siRNA (siRNA6) targeted tothe opening reading frame of hCLP46, with the sequences50-CACCGGCGTAGCTGCAAGTTTCCGGTTTATTCAAGAGATAAACCGGAAACTTGCAGCTACGCCTTTTTTG-30 and30-CCGCATCGACGTTCAAAGGCCAAATAAGTTCTCTATTTGGCCTTTGAACGTCGATGCGGAAAAAACCTAG-50 andinserted the oligonucleotides into the pGPU6=GFP=Neo-siRNAexpression vector (GenePharma, Shanghai, China) to generatethe pGPU6=GFP=Neo-siRNA6 expression vector according tothe user’s manual. Transfections were performed using Li-pofectamine� 2000 Reagent (Invitrogen, Auckland, NewZealand). Transfection cells were replated at a low density toisolate single colonies 24 h later. The clonal cell lines derived

from the transfectants were maintained in selective mediumcontaining 400mg=mL geneticin disulfate (G418; Sigma, St.Louis, MO).

Retrotranscription and amplification

Total RNA was extracted by Trizol (Invitrogen) according tothe user’s manual. The RNA samples were retrotranscribed bySensiscript Reverse Transcriptase in the conditions suggested(Qiagen, Valencia City, CA). For relative quantification ofhCLP46, CDKN2A, and CDKN2B, a real-time polymerase chainreaction (PCR) was performed using a 96-well tray and opticalcaps (Applied Biosystems) with a 25mL final reaction mixturecontaining 250 nM each primer, 2mL of cDNA, and 12.5mLPower SYBR� Green PCR Master Mix (Applied Biosystems,Foster City, CA) and the housekeeping gene b-actin was usedfor normalization. The primers for real-time PCR are specifiedin Table 1. Amplifications for relative quantification wereperformed in a 7500 real-time PCR System (Applied Biosys-tems) according to the following regime: preheated at 958C for15 min, followed by 45 cycles at 958C for 15 s, and at 608C for1 min. The final results expressed as N-fold differences in targetgene expression relative to the calibrator (b-actin) using the2�DDCT method (Livak and Schmittgen, 2001).

All primer pairs were intron spanning and gave no PCRproduct using 50 ng genomic DNA as the template. Also, allRT reactions (cDNA synthesis without reverse transcriptase)gave no PCR product.

When the amplifications were completed, a standard op-tion for melting curve (Tm) analysis was carried out to vali-date the results of amplification. Amplified cDNAs wereseparated by 2% agarose gel (Biowest, Nuaille, France) elec-trophoresis in the presence of 0.01% Gel-red (Biotium, Hay-ward, CA). The results of electrophoresis were acquired bythe image acquisition system EDAS 2400 (Kodak, Rochester,NY) and further analyzed by Kodak 1D image analysis sys-tem. PCR products were purified by Agarose Gel DNA Pur-ification Kit Ver.2.0 (TaKaRa, Dalian, China), cloned intopMD18-T Simple Vector (TaKaRa), and sequenced with anABI PRISM 3730 DNA Sequencer according to the user’smanual (Applied Biosystems).

Western blotting analysis for CDKN2A (p16)and CDKN2B (p15) expression

The cloned cells were then washed twice with cold phos-phate-buffered saline (PBS) (pH 7.4) and lysed with lysis buffercontaining 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.5%

Table 1. Oligonucleotide Primer Sequences Used for Real-Time Polymerase Chain Reaction

Genes Oligonucleotide SequencesPCR product

size (bp)

hCLP46 Upper primer GCCAGCTGCTAAGGATGTCCA 80Lower primer AACTTGCAGCTACGCCTCGAA

CDKN2B Upper primer GCACTCAATCATTAGAGGCTACAAG 186Lower primer TGACCCAGTATAATGCAACTAGCAA

CDKN2B Upper primer GGCACCAGAGGCAGTAACCA 126Lower primer GGACCTTCGGTGACTGATGATCTAA

b-actin Upper primer TGGCACCCAGCACAATGAA 195Lower primer CTAAGTCATAGTCCGCCTAGAAGCA

hCLP46, human CAP10-like protein 46 KD; PCR, polymerase chain reaction.

128 WANG ET AL.

Nonidet P-40, 50 mM NaF, 1% Triton-X-100, 1 mM dithiothrei-tol, and 1 mM phenylmethylsulfonyl fluoride. For western blotanalysis, protein concentrations were determined and an equalamount of each sample was resolved by 10% sodium dodecylsulfate-polyacrylamide gel electrophoresis and transferred to apolyvinylidene fluoride (PVDF) membrane. The process wasblocked using PBS containing 5% bovine serum albumin and0.1% Tween-20, and the membrane was incubated with anti-CDKN2A monoclonal antibody or anti-CDKN2B monoclonalantibody at room temperature for 2 h. This was followed by asecond incubation with an horseradish peroxidase-linked sec-ondary antibody at room temperature for 2 h. The signals weredetected using a chemiluminescent substrate (ECL; Amersham,Milwaukee, WI). The experiment was performed in triplicate.

Apoptosis analysis of hCLP46 downregulatedU937 cells

Apoptosis was assessed using annexin V, a protein thatbinds to phosphatidylserine residues which are exposed onthe cell surface of apoptotic cells. The clonal cell lines derivedfrom the transfectants and the controls (u937 cells) werewashed twice with PBS and stained with propidium iodide(PI) and fluorescent isothiocyanate-labeled annexin V (An-nexin V-fluorescein isothiocyanate [FITC] Apoptosis Detec-tion Kit; Keygen, Nanjing, China) for 15 min in the dark. Thecells were immediately analyzed by fluorescence-activatedcell sorting (BD, Franklin Lakes, NJ) for PIþ, PI�, annexin Vþ,and annexin V� cells and duplicated for accuracy. The exper-iment was performed in quadruplicate to confirm the results.

Statistical analysis

Differences of hCLP46 expression in PBMC between thecontrols and the patients were assessed using the nonpara-metric Mann–Whitney test. hCLP46 expression between

PBMC of the control and cell lines was assessed using Dun-nett’s test. The differences of CDKN2A and CDKN2B expres-sion between two groups and hCLP46 expression in U937 cellstransfected with empty vector and siRNA expression vectorwere determined by a Student’s t-test. p< 0.05 was consideredstatistically significant.

Results

A real-time PCR-based assay for relative quantification

A real-time PCR-based assay was developed for thequantification of hCLP46, CDKN2A, and CDKN2B. Transcript

FIG. 1. mRNA expression of hCLP46 in AML, T-ALL, andthe control employing quantitative real-time PCR method.The expression levels shown were normalized to house-keeping transcript b-actin. The mean expression level of thecontrol group plus two SD (threshold for overexpression) isindicated by a dotted line. AML, acute myelogenous leuke-mia; hCLP46, human CAP10-like protein 46 KD; PCR, poly-merase chain reaction; SD, standard deviation; T-ALL,T-acute lymphoblastic leukemia.

FIG. 2. mRNA expression of hCLP46 in six cell lines and thecontrol measured by quantitative real-time PCR method. Theexpression levels shown were normalized to housekeepingtranscript b-actin. Mean� SD (n¼ 3). Statistical significancewas determined by Dunnett’s test:. *p< 0.01, statisticallysignificant difference compared with the control.

FIG. 3. hCLP46 expression alteration in U937 cells aftertransfection with pGPU6=GFP=Neo-siRNA6 expression vec-tor. Expression of hCLP46 in U937 cells was measuredby quantitative real-time PCR methodology. The expressionlevels shown were normalized to housekeeping transcriptb-actin. Mean� SD (n¼ 3). Statistical significance was de-termined by two-way Student’s t-test: *p< 0.01, statisticallysignificant difference compared with the control (transfectedwith empty vector).

OVEREXPRESSION OF HCLP46 IN ACUTE LEUKEMIA 129

levels were initially normalized to the housekeeping geneb-actin. Analysis of the amplification plots, the meltingcurves, the results of electrophoresis, and sequencing of am-plification fragments revealed equal amplification efficienciesand specific amplification for hCLP46 transcripts, the endog-enous control b-actin, and CDKN2A and CDKN2B (data notshown). This enabled application of the real-time PCR-basedassay for calculation of relative transcript levels.

Overexpression of hCLP46 in AML,T-ALL, and leukemic cell lines

Overexpression is defined as an mRNA level above themean of the control plus two standard deviation. hCLP46 wasoverexpressed in the majority of patients’ samples (5 of 12 inAML and 6 of 8 in T-ALL) (Fig. 1) and in most of the leukemiccell lines except for Raji-1 (Fig. 2). With regard to hCLP46,expression of two groups of leukemia samples and most of thecell lines (except for Raji-1) showed a highly statistically sig-

nificant difference when compared with that of control( p< 0.01 of all compare). hCLP46 was overexpressed inU937 cells, and its overexpression could promote cell prolif-eration in U937 cells (Teng et al., 2006). We, therefore, choseonly U937 cells for further investigation in this study.

hCLP46 did not alter expressionof CDKN2A and CDKN2B

Downregulated hCLP46 expression in U937 cells was achi-eved by transfection with pGPU6=GFP=Neo-siRNA6 expressionvector (U937 cells transfected with empty pGPU6=GFP=Neo-siRNA expression vector as a control). After transfection bypGPU6=GFP=Neo-siRNA6 expression vector, hCLP46 expres-sion decreased significantly to 5% of control (Fig. 3, p< 0.01).

The expression patterns of CDKN2A and CDKN2B inU937 cells were determined using real-time PCR techniqueand western blot when hCLP46 was downregulated. The re-sults of both real-time PCR and western blots showed that

FIG. 4. Expression of CDKN2A and CDKN2B in U937 cells when hCLP46 is downregulated. (A, B) Expression of CDKN2Aand CDKN2B in U937 cells when hCLP46 was downregulated was analyzed by quantitative real-time PCR method. Theexpression levels shown were normalized to housekeeping transcript b-actin. Mean� SD (n¼ 3). (C) Protein expression ofCDKN2A and CDKN2B in U937 cells was analyzed by western blotting. b-actin was used as a loading control. Representativeblot of each protein from three independent experiments that yielded similar results, respectively. (D) Protein expressionlevels of CDKN2A and CDKN2B when hCLP46 was downregulated were measured by western blotting. Densitometry datapresented in graphical form are fold change compared with control (transfected with empty vector) after normalization withrespective loading control (b-actin). Mean� SD (n¼ 3).

130 WANG ET AL.

expression of CDKN2A and CDKN2B in U937 cells did notalter when hCLP46 was downregulated (Fig. 4).

hCLP46 did not influence cell apoptosis

To determine the possible influence of hCLP46 on cell ap-optosis, the apoptosis of U937 cells treated with pGPU6=GFP=Neo-siRNA6 expression vector was analyzed by fluorescence-activated cell sorting. Figure 5 shows that no alteration ofapoptosis occurred when hCLP46 expression was down-regulated ( p> 0.05).

Discussion

We have developed a real-time PCR-based assay for thequantification of hCLP46. Our study demonstrated thathCLP46 was overexpressed in AML, T-ALL, and leukemic celllines and that downregulation of its overexpression affectedneither expression of CDKN2A and CDKN2B nor the apo-ptosis in U937 cells. The abnormal overexpression of hCLP46in AML, T-ALL, and leukemic cell lines is consistent with thesuggestion that hCLP46 possesses the ability of promoting cellproliferation (Teng et al., 2006) and that it might contribute tothe abnormal proliferation of leukemia cells.

CDKN2A (p16) and CDKN2B (p15) have roughly equiva-lent capacities of binding CDK4 and CDK6 and inhibit cellularproliferation by preventing entry into the S phase of the cellcycle (Serrano and Hannon, 1993; Nobori et al., 1994). Thisstudy demonstrated that downregulation of hCLP46 had noeffect on expression of CDKN2A and CDKN2B and suggestedthat hCLP46 might function through a pathway not involvingCDKN2A and CDKN2B.

Our studies showed that overexpression of hCLP46 wasassociated with AML and T-ALL, but the real function ofhCLP46 remained unclear until one of its homologs (Rumi)was recently mapped in D. melanogaster (Acar et al., 2008).hCLP46 has similar sequence, identical structure, and sub-

cellular location to Rumi, suggesting that hCLP46 might havesimilar activity as Rumi, responsible for adding glucose toserine residues in Notch EGF repeats.

The Notch pathway is an evolutionarily conserved mech-anism that plays a fundamental role in regulating cell-fatedecisions of various types of progenitors in both vertebratesand invertebrates (Greenwald 1998; Artavanis-Tsakonas et al.,1999). Numerous cellular functions and microenvironmentalcues associated with tumorigenesis are regulated by Notchsignaling, including proliferation, apoptosis, adhesion, epi-thelial–tomesenchymal transition, and angiogenesis (Leongand Karsan, 2006). It is well known that Notch signaling playsan important role in hematopoiesis (Milner and Bigas, 1999).Notch signaling is involved in the maintenance of a pool ofself-renewing hematopoietic stem cells (HSCs), is active inHSCs in vivo, and is downregulated as HSCs differentiate(Duncan et al., 2005). Considering its important role in normalhematopoiesis, Notch signaling must be precisely regulated,as dysregulation of Notch signaling can lead to the develop-ment of hematological malignancies. In humans, aberrantNOTCH1 expression is identified as a causative factor in thedevelopment of T-ALL. The t (7; 9) translocation can consti-tutively activate Notch, thus leading to leukemia (Ellisen et al.,1991). Activating mutations in NOTCH1 have been observedamong more than 50% of human T-ALL patients (Lee et al.,2005). Activating mutations in NOTCH1 are mostly restrictedto T-ALL and are rare in AML (Palomero et al., 2006), and bothNOTCH1 and Jagged1 (the ligands of Notch) are over-expressed in AML (Tohda and Nara, 2001; Chiaramonte et al.,2005).

Besides the aberrant expression and activated mutations ofNOTCH1, the disorders of posttranslational regulation, in-volving proteolytic processing, glycosylation, ubiquitination,and endocytic trafficking, could destroy the function ofNotch. Both the Notch receptors and ligands are single-passtransmembrane proteins with multiple tandem EGF-like

FIG. 5. Apoptosis of U937 cells when hCLP46 expression was downregulated. Apoptosis was measured by annexin-V andpropidium iodide (PI) double staining. The 1st fluorescence-fluorescein isothiocyanate (FL1-FITC) axis denotes annexin-V,while the FL3-PI axis denotes PI. The difference of apoptotic rate between hCLP46 downregulated group and control was notstatistically significant ( p> 0.05).

OVEREXPRESSION OF HCLP46 IN ACUTE LEUKEMIA 131

repeats required for ligand binding (Rebay et al., 1991; de Celiset al., 1993; Weinmaster, 1997). N-linked glycosylation iscommon in extracellular protein, but Notch is subject to twounusual types of O-linked glycosylation, O-glucosylation,and O-fucosylation (Moloney et al., 2000). O-fucosylation iscatalyzed by O-fucosyltransferase 1 (Ofut1), which is alsoan ER protein (Haines and Irvine, 2003). O-fucosylationis essential for Notch function in many contexts (Stanley,2007), and recently Zhou et al. (2008) reported that NotchO-fucosylation plays an important role in the suppression ofmyelogenesis, that is, unsweetened Notch leads to myelo-proliferation (Haltiwanger, 2008). O-glucosylation of Notchis catalyzed by hCLP46; however, the function of NotchO-glucosylation remains unclear. Our studies demonstratedthat overexpression of hCLP46 is associated with AML andT-ALL, possibly implying that excessive O-glucosylation ofNotch leads to myeloproliferation or cell fate decision. Giventhat both AML and T-ALL are usually considered to be dis-orders of HSC origin (Lapidot et al., 1994; Bonnet and Dick,1997; Cobaleda et al., 2000; Matsuoka et al., 2008), it is likelythat overexpression of hCLP46 might be one of the earlyevents in the pathogenesis of AML and T-ALL.

In summary, we demonstrated that hCLP46, a gene pos-sessing capability of modifying the Notch pathway, wasoverexpressed in AML and T-ALL. This finding extends thenotion of Notch pathway in hematopoiesis and suggests thatoverexpression of hCLP46 might be an early event in thepathogenesis of AML and T-ALL. In addition, hCLP46 mightturn out to be a useful biomarker for selected leukemias.

Acknowledgments

The authors thank Dr. Gilbert Shia for the language editingof this manuscript. The project was financially supported byBeijing Municipal Natural Science Foundation (5072007 andKZ200610025014), National Natural Science Foundation ofChina (30771193, 30670889, and 30600690), Doctoral Pro-gram of Higher Education of China (20050025002), MajorState Basic Research Program-973 of China (2005CB522804),and National High Technology Research and DevelopmentProgram-863 of China (2006AA02Z434).

Disclosure Statement

We declare that we have no conflict of interest.

References

Acar M, Jafar-Nejad H, Takeuchi H, et al. (2008) Rumi is a CAP10domain glycosyltransferase that modifies Notch and is re-quired for Notch signaling. Cell 132:247–258.

Artavanis-Tsakonas S, Rand MD, Lake RJ (1999) Notch signal-ing: cell fate control and signal integration in development.Science 284:770–776.

Bonnet D, Dick JE (1997) Human acute myeloid leukemia isorganized as a hierarchy that originates from a primitive he-matopoietic cell. Nat Med 3:730–737.

Chiaramonte R, Basile A, Tassi E, et al. (2005) A wide role forNOTCH1 signaling in acute leukemia. Cancer Lett 219:113–120.

Chiaramonte R, Calzavara E, Balordi F, et al. (2003) Differentialregulation of Notch signal transduction in leukemia andlymphoma cells in culture. J Cell Biochem 88:569–577.

Cobaleda C, Gutierrez-Cianca N, Perez-Losada J, et al. (2000) Aprimitive hematopoietic cell is the target for the leukemictransformation in human Philadelphia-positive acute lym-phoblastic leukemia. Blood 95:1007–1013.

de Celis JF, Barrio R, del Arco A, et al. (1993) Genetic andmolecular characterization of a Notch mutation in its Delta-and Serrate-binding domain in Drosophila. Proc Natl Acad SciU S A 90:4037–4041.

Drexler HG (1998) Review of alterations of the cyclin-dependentkinase inhibitor INK4 family genes p15, p16, p18 and p19 inhuman leukemia-lymphoma cells. Leukemia 12:845–859.

Duncan AW, Rattis FM, DiMascio LN, et al. (2005) Integration ofNotch and Wnt signaling in hematopoietic stem cell mainte-nance. Nat Immunol 6:314–322.

Ellisen LW, Bird J, West DC, et al. (1991) TAN-1, the humanhomolog of the Drosophila notch gene, is broken by chromo-somal translocations in T lymphoblastic neoplasms. Cell66:649–661.

Greenwald I (1998) LIN-12=Notch signaling: lessons fromworms and flies. Gene Dev 12:1751–1762.

Haines N, Irvine KD (2003) Glycosylation regulates notch sig-naling. Nat Rev Mol Cell Biol 4:786–797.

Haltiwanger RS (2008) Unsweetened Notch leads to myelopro-liferation. Blood 112:214–215.

Lapidot T, Sirard C, Vormoor J, et al. (1994) A cell initiatinghuman acute myeloid leukaemia after transplantation intoSCID mice. Nature 367:645–648.

Lee SY, Kumano K, Masuda S, et al. (2005) Mutations of theNotch1 gene in T-cell acute lymphoblastic leukemia: analysisin adults and children. Leukemia 19:1841–1843.

Leong KG, Karsan A (2006) Recent insights into the role of Notchsignaling in tumorigenesis. Blood 107:2223–2233.

Livak KJ, Schmittgen TD (2001) Analysis of relative gene ex-pression data using real-time quantitative PCR and the 2�DDCT

method. Methods 25:402–408.Matsuoka S, Oike Y, Onoyama I, et al. (2008) Fbxw7 acts as a

critical fail-safe against premature loss of hematopoietic stemcells and development of T-ALL. Gene Dev 22:986–991.

Milner LA, Bigas A (1999) Notch as a mediator of cell fate de-termination in hematopoiesis: evidence and speculation. Blood93:2431–2448.

Moloney DJ, Shair LH, Lu FM, et al. (2000) Mammalian Notch1 ismodified with two unusual forms of O-linked glycosylationfound on epidermal growth factor-like modules. J Biol Chem275:9604–9611.

Nobori T, Miura K, Wu DJ, et al. (1994) Deletions of the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers.Nature 368:753–756.

Palomero T, McKenna K, O-Neil J, et al. (2006) Activating mu-tations in NOTCH1 in acute myeloid leukemia and lineageswitch leukemias. Leukemia 20:1963–1966.

Rebay L, Fleming RJ, Fehon RG, et al. (1991) Artavanis-TsakonasS. Specific EGF repeats of Notch mediate interactions withDelta and Serrate: implications for Notch as a multifunctionalreceptor. Cell 67:687–699.

Rosu-Myles M, Wolff L (2008) p15Ink4b: dual function in mye-lopoiesis and inactivation in myeloid disease. Blood Cell MolDis 40:406–409.

Serrano M, Hannon GJ (1993) A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D=CDK4.Nature 366:704–707.

Sherr CJ (1996) Cancer cell cycles. Science 274:1672–1677.Stanley P (2007) Regulation of Notch signaling by glycosylation.

Curr Opin Struct Biol 17:530–535.

132 WANG ET AL.

Teng Y, Liu Q, Ma J, et al. (2006) Cloning, expression andcharacterization of a novel human CAP10-like gene hCLP46from CD34þ stem=progenitor cells. Gene 371:7–15.

Tohda S, Nara N (2001) Expression of Notch1 and Jagged1proteins in acute myeloid leukemia cells. Leuk Lymphoma42:467–472.

Weinmaster G (1997) The ins and outs of Notch signaling. MolCell Neurosci 9:91–102.

Zhou L, Li LW, Yan Q, et al. (2008) Notch-dependent control ofmyelopoiesis is regulated by fucosylation. Blood 112:308–319.

Address correspondence to:Wei Wang, M.D., Ph.D.

College of Life ScienceGraduate University of Chinese Academy of Sciences

Beijing 100049China

E-mail: wei6014@gucas.ac.cn

OVEREXPRESSION OF HCLP46 IN ACUTE LEUKEMIA 133