DOI: 10.1007/s10535-017-0714-y BIOLOGIA PLANTARUM 62 (1): 55-68, 2018

55

Overexpression of tomato WHIRLY protein enhances tolerance to drought stress and resistance to Pseudomonas solanacearum in transgenic tobacco S.-Y. ZHAO1, G.-D. WANG2, W.-Y. ZHAO1, S. ZHANG1, F.-Y. KONG1, X.-C. DONG1*, and Q.-W. MENG1*

College of Life Science, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai’an, Shandong 271018, P.R. China1 School of Biological Science, Jining Medical University, Rizhao, Shandong 276800, P.R. China2 Abstract WHIRLY transcription factors play critical roles in responses to biotic and abiotic stresses, but their other biological functions remain unclear. In this study, SlWHY2, a member of the WHIRLY family, was isolated from Solanum lycopersicum. The role of SlWHY2 was studied using transgenic tobacco plants. Real-time quantitative polymerase chain reaction analysis showed that SlWHY2 expression was induced by polyethylene glycol, NaCl, salicylic acid, hydrogen peroxide, and bacterial pathogens. SlWHY2 overexpression in tobacco caused enhanced tolerance to drought stress, as indicated by lower accumulation of malondialdehyde and relative electrolyte leakage, as well as higher relative water content and activities of superoxide dismutase and ascorbate peroxidase. Moreover, higher expression of cytochrome oxidase 1 (NtCOX1) and open reading frame 1 (NtORF1) were observed under drought in the transgenic lines. This suggested that overexpression of SlWHY2 enhanced tolerance to drought stress by regulating the transcription of mitochondrial genes and stabilizing mitochondrial function. Transgenic tobacco also displayed greater resistance to Pseudomonas solanacearum infection as evidenced by lower reactive oxygen species content and higher expression of defence-related genes. Overall, these findings suggest that SlWHY2 acts as a positive regulator in response to biotic and abiotic stresses.

Additional key words: ascorbate peroxidase, electrolyte leakage, malondialdehyde, proline, reactive oxygen species, relative water content, superoxide dismutase. Introduction Plants are often exposed to environmental stresses such as low temperature, drought, high soil salinity, and pathogen invasion. Such unfavourable environmental conditions can have adverse effects on plant growth, development, and yield. A common feature of plant responses to environmental stress is a burst of reactive oxygen species (ROS) in different cellular compartments, mainly chloroplasts, peroxisomes, and apoplastic spaces. A certain amount of ROS is essential for normal

physiological activities in plants, but excessive accumu-lation of ROS can induce damage to proteins, lipids, sugars, and DNA, and ultimately result in cell death. Plants contain several enzymatic and non-enzymatic antioxidants that scavenge ROS to protect cells. Plants have evolved sophisticated molecular networks to cope with adverse environmental factors, which act by inducing physiological and morphological changes. Gene regulation by transcription factors plays an important role

Submitted 29 February 2016, last revision 22 October 2016, accepted 11 November 2016. Abbreviations: A - absorbance; AOX - alternative oxidase; APX - ascorbate peroxidase; cfu - colony forming units; COX - cytochrome oxidase; DAB - 3,3'-diaminobenzidine; MDA - malondialdehyde; MS - Murashige and Skoog; NBT - nitroblue tetrazolium; O2

− - superoxide anion; ORF - open reading frame; PCD - programmed cell death; PBS - phosphate buffer saline; PEG 6000 - polyethylene glycol; PFD - photon flux density; PR - pathogenesis-related; REL - relative electrolyte leakage; ROS - reactive oxygen species; RWC - relative water content; SA - salicylic acid; SOD - superoxide dismutase; WT - wild-type. Acknowledgements: This work was supported by the State Key Basic Research and Development Plan of China (2015CB150105), the Natural Science Foundation of China (31171474, 31371553), the Doctor Foundation of Shandong (2014BSB01031). The first two authors contributed equally to this work. * Corresponding authors; fax: (+86) 538 8226399, e-mails: sspp@sdau.edu.cn; qwmeng@sdau.edu.cn

S.-Y. ZHAO et al.

56

in stress response, usually by binding to the cis-acting elements of the target genes (Casaretto and Ho 2003). WHIRLY proteins have been thought to function as transcription factors in the nucleus. The first member of the WHIRLY family of proteins was identified in potato (Desveaux et al. 2000) and it was the potato nuclear factor PBF-2/StWHY1 (PR-10a binding factor 2/whirly1), which is a single-strand DNA binding factor that appears to play a role in the activation of expression of pathogenesis related gene PR-10a by binding to the single-strand form of the elicitor response element. The WHIRLY family was named from the whirligig appearance of the quaternary structure of the gene in Solanum tuberosum (Desveaux et al. 2002). Proteins of this family share a highly conserved WHIRLY domain, especially the residues KGKAAL, YDW, Lys188, which indicate a similar mechanism of single strand DNA-binding protein (SSB) activity. In Arabidopsis thaliana, AtWHY1 is a protein located in the chloroplast and nucleus, whereas AtWHY2 is located in the mitochondria (Krause et al. 2005). Maize mutants with severely reduced levels of the WHIRLY1 protein are impaired in chloroplast development due to greatly diminished levels of ribosomal RNA (Prikryl et al. 2008). Krupinska et al. (2014) found that WHIRLY1 belongs to the group of plastid and nucleus associated proteins (ptNAP) that compact a subpopulation of chloroplast nucleoids and thereby affect DNA replication in barley. The DNA-binding proteins identified so far in plant mitochondria, including WHIRLY2, likely participate in genomic

maintenance by affecting substoichiometric shifting, stoichiometric transmission, genomic stability, and DNA repair (Cappadocia et al. 2010). Recently, it has been shown that AtWHY2 is associated with mitochondrial DNA and, upon overexpression, causes the development of dysfunctional mitochondria (Maréchal et al. 2008). Furthermore, AtWHY2 overexpression in pollen has been shown to cause elevation of mitochondrial DNA copy number and altered respiration and pollen tube growth (Cai et al. 2015). The invasion of pathogens induces numerous cellular signals that are integrated in the nucleus by a diverse set of transcription factors, leading to massive transcriptional reprogramming (Glazebrook et al. 2003). Salicylic acid (SA) plays a crucial role in plant defence against a broad spectrum of pathogens (Király et al. 2008. Pathogenesis-related (PR) genes are among the best characterised genes in pathogenesis (Walter et al. 1996). Desveaux et al. (2002) found that SA can activate AtWHY1 expression and participate in SA-dependent resistance. Considering the diverse roles of WHIRLY trans-cription factors under different environmental conditions, clarifying the functions of WHIRLY members is an important goal. However, uncovering the functions of some WHIRLY members in abiotic stress responses has remained a challenge. In addition, whether WHIRLY confers drought tolerance by reducing ROS accumulation is yet to be determined in tomato. In this study, we isolated the SlWHY2 gene from tomato and developed transgenic tobacco plants.

Materials and methods Plant growth and stress treatments: Tomato (Solanum lycopersicum Mill. cv. Zhongshu 6) wild-type (WT) and tobacco (Nicotiana tabacum L. cv. NC 89) WT and T2 transgenic plants were grown in quartz sand under a 16-h photoperiod, a photon flux density (PFD) of 200 μmol m-2 s-1, day/night temperatures of 25/20 °C, and a relative humidity of 60 %. The plants were irrigated with Hoagland nutrient solution once a week. Eight-week-old WT tomato seedlings were subjected to various stress treatments. For osmotic stress and salt stress, the seedlings were irrigated with 20 % (m/v) polyethylene glycol (PEG 6000) and 200 mM NaCl, respectively. For SA and hydrogen peroxide treatments, plant leaves were sprayed with 100 μM SA or 20 mM H2O2. For pathogen treatment, Pseudomonas solanacearum at concentration 1 × 108 colony forming units (cfu) cm-3 was carefully used to infect the leaves of tomato plants. The control was watered with Hoagland's solution without additives. The leaves of plants under various treatments were harvested at the appropriate time, frozen in liquid nitrogen, and stored at -80 °C. Eight-week-old WT and transgenic tobacco plants were subjected to drought stress applied by adding 5 %

(m/v) PEG-6000 to Hoagland's solution once a day for 4 d. Control groups received equal amount of Hoagland's solution. Their capacity to defend themselves against diseases was assessed by inoculating six-week-old plant leaves with P. solanacearum (1 × 108 cfu cm-3). Functional leaf samples were then collected. Isolation and sequencing of SlWHY2: Total RNA was extracted from WT tomato leaves using the RNA simple total RNA kit (Tiangen, Beijing, China) following the manufacturer’s instructions. The full-length coding sequence of SlWHY2 was amplified from the cDNA obtained using a pair of primers (forward TCCTTACTGCGACGATGT and reverse TCATCTATC CCACTCCGCCT) based on the sequence obtained from GenBank (accession No. XM_010314783) by reverse transcription polymerase chain reaction (RT-PCR). The PCR amplification products were cloned into a pMD-19T vector and sequenced. All primers were synthesized by Jinan Invertrangen Limited Company (Jinan, China). Plant transformation and transgenic tobacco plant identification: We inserted the open reading frame of

OVEREXPRESSION OF TOMATO WHIRLY PROTEIN 

57

SlWHY2 into the pBI121-expression vector between BamHI and SalI and obtained a recombinant plastid that was transformed into Agrobacterium tumefaciens strain LBA4404. The Agrobacterium-mediated leaf disc method was used to generate transgenic tobacco plants. After obtaining T0 kanamycin-resistant plants, DNA was extracted from these and WT plants. The target gene was amplified using 100 ng of DNA via PCR with a specific cauliflower mosaic virus (CaMV) 35S forward primer (TACGCAGCAGGTCTCTCAAGACGAT) and SlWHY2 reverse primer (TCATCTATCCCACTCCGCCT). Plants that produced progenies in the T2 generation with 100 % kanamycin resistance were considered homozygous and used in subsequent studies. Germination assay of seedlings under drought stress: A total of 30 surface-sterilised seeds of WT and T2 transgenic plants were grown on Murashige and Skoog (MS) medium with 0, 100, 150 and 200 mM mannitol and under a day/night temperatures of 25/20 °C, a 16-h photoperiod, and a PFD of 200 µmol m-2 s-1. Germination rates were counted after 10 d, and photographs were taken. Transgenic and WT seedlings grown on MS medium for a week were administered with 400 mM mannitol in MS for further 7 d simulating drought stress. Then the length of roots was measured. These experiments were repeated thrice with similar results. Histochemical detection and measurements of O2

− and H2O2: Superoxide anion and H2O2 accumulation were monitored by nitroblue tetrazolium (NBT) and 3,3'-diaminobenzidine (DAB) staining methods, respectively, as described by Ramel et al. (2009). For in situ detection of O2

−, plantlets were immersed and incubated under vacuum with 0.5 mg cm-3 NBT solution in phosphate buffer saline (PBS, 25 mM). After incubation for 20 h in the dark, stained plantlets were boiled in solution of acetic acid + glycerol + ethanol (1:1:3, v/v/v) for 10 min. After cooling, the leaves were extracted with fresh ethanol at room temperature until O2

− was visualised as a blue-coloured formazan produced by NBT reduction. For in situ detection of H2O2, detached leaves (5 mg) were incubated with 10 cm3 DAB solution (pH 3.8) overnight in the dark. Subsequent steps were the same as that for NBT staining. The content of H2O2 was measured as described by Ma et al. (2013). Leaves (0.5 g) were homogenized with 3 cm3 cold PBS (50 mM, pH 6.8). The homogenate was centrifuged at 6 000 g for 15 min. After centrifugation, 3 cm3 of supernatant and 1 cm3 of 0.1 % titanium sulphate in 20 % (m/v) H2SO4 were added into a new tube, mixed, and then centrifuged again at 6 000 g for 15 min. The absorbance was measured at 410 nm. H2O2 content was calculated based on the standard curve plotted with known concentrations of H2O2. Content of O2

− was measured as described by Jiang and Zhang (2001). Leaves (0.5 g) were transferred to a centrifuge

tube after grinding in a mortar along with 3 cm3 of 50 mM cold PBS (pH 7.8). The homogenate was centri-fuged at 5 000 g and 4 °C for 10 min. The supernatant with PBS (pH 7.8) and 10 mM hydroxylammonium chloride was incubated at 25 °C for 20 min, followed by the addition of 17 mM p-aminobenzene sulfonic acid and 7 mM α-naphthylamine. The mixture was then incubated at 25 °C for 20 min and then centrifuged at 1 500 g for 5 min. Finally, ethyl ether was added to the mixture. The water phase was used to determine the absorbance at 530 nm. Measurements of different physiological parameters: Relative water content (RWC) was measured as described by Zhou et al. (2012). Fresh mass (FM) of plants was immediately recorded after leaf excision. The plants were soaked for 12 h in distilled water at room temperature and the water saturated mass (WSM) was recorded. After drying for 24 h at 80 °C, dry mass (DM) was recorded. RWC was calculated as follows: RWC [%] = [(FM - DM)/(WSM - DM)] × 100. Malondialdehyde (MDA) content in the leaves was determined as described by Loreto and Velikova (2001). About 0.5 g of tissue was homogenised in 5 cm3 of 10 % (m/v) trichloroacetic acid (TCA) and the homogenate was centrifuged at 10 000 g and room temperature for 10 min. The supernatant was mixed with equal volume of 0.5 % (m/v) thiobarbituric acid in 10 % TCA, and the mixture was boiled at 100 °C for 15 min, followed by centri-fugation at 3 500 g for 10 min to clarify the solution. Absorbance was measured at 450, 532, and 600 nm. MDA content was calculated using a standard curve relating MDA concentrations to absorbance. Relative electrolyte leakage (REL) in the leaves was measured as described by Cao et al. (2007). To measure initial electric conductivity (S1), 10 leaf disks (0.8 cm) from each line were placed into 20 cm3 of distilled water, placed in a vacuum for 30 min, and then shaken for 3 h. After S1 was measured, the materials were boiled for 30 min and cooled to room temperature to measure final electric conductivity (S2). Distilled water was regarded as a blank control and its electric conductivity (S0) was measured. REL was calculated using the formula: REL [%] = [(S1 - S0)/(S2 -S0)] × 100. Proline content in the leaves was measured as described by Irigoyen et al. (1992). Firstly, 0.2 g of tissue was mixed with 5 cm3 of 3 % (m/v) sulfosalicylic acid solution in a test tube with plug and boiled for 10 min and allowed to cool to room temperature. After centrifugation at 3 000 g for 5 min, 2 cm3 of supernatant was mixed with 2 cm3 of glacial acetic acid and 3 cm3 acidic ninhydrin solutions (2.5 %, 0.625 g ninhydrin was dissolved in 15 cm3 of glacial acetic acid and 10 cm3 of phosphoric acid). The mixture was boiled for 15 min at 100 °C, allowed to cool to room temperature, and then mixed with 5 cm3 of toluene. After shaking the test tube, it was left on a benchtop until layers were formed, and

S.-Y. ZHAO et al.

58

the absorbance of upper layer was measured at 520 nm. Mn-superoxide dismutase (MnSOD) activity was measured according to the method described by Li et al. (2003) with minor modifications. The extraction protocol was identical to that used in the O2

− assay. To measure MnSOD activity, supernatant with 13 mM methionine, 75 μM NBT, 10 μM Na2EDTA, and 2 μM riboflavin was used. The mixtures were reacted under irradiance of 100 μmol m-2 s-1 for 20 - 30 min and absorbance was measured at 560 nm. One unit of MnSOD activity was calculated as the concentration of sample required to decrease the rate of reaction by 50 %. Ascorbate peroxidase (APX) activity in the leaves was assayed according to the method reported by Zong et al. (2009). Total APX activity was determined spectrophoto-metrically by measuring the oxidation of ascorbic acid at 290 nm. Pathogenicity assays: Pseudomonas solanacearum was cultured in a liquid beef extract peptone medium at 37 °C. Eight-week-old WT control and transgenic plants were inoculated with P. solanacearum bacterial suspensions (1×108 cfu cm-3, A600 = 0.1) on the abaxial surface of leaves using a 1 cm3 syringe without a needle. Two weeks after injection with P. solanacearum,

appearance of symptoms was assessed. After 12 h, cell death was detected in leaves injected with P. solanacearum by trypan blue staining, as previously described by Stone et al. (2000). Infected leaves were sampled at the indicated time points after inoculation and stained with lactophenol-trypan blue solution (10 cm3 of lactic acid, 10 cm3 of glycerol, 10 g of phenol, and 10 mg of trypan blue dissolved in 10 cm3 distilled water). Whole leaves were boiled for approximately 2 h in the staining solution and then decolourised in chloral hydrate (2.5 g of chloral hydrate dissolved in 1 cm3 of distilled water). They were mounted in 60 % glycerol (v/v) and representative phenotypes were photographed using a camera fitted to a light microscope. The same P. solanacearum bacterial suspensions were sprayed on the leaf surface of both transgenic and WT plants with a small watering can. After 2 d, H2O2 content was detected in leaves sprayed with P. solanacearum by DAB staining. Real-time quantitative PCR: Total RNA extraction and reverse transcription were performed as previously described. Real-time qPCR was performed on a CFX96TM system (Bio-Rad, Hercules, USA) using SYBR Real Master Mix Plus (Tiangen) according to the

Fig. 1. Characterization and sequence analysis of SlWHY2. Alignment of SlWHY2 with other homolog proteins. All sequences werealigned using the DNAMAN software. The numbers on the right side indicate amino acid position. Greek numerals (β1-β8 and α1) denote the major structural domains of WHIRLY2, α2 and α3 were connected with self-regulatory region. The gene names and GenBank acc. Nos. are as follows: StWHY2 (ADI77438), AtWHY2 (NP_177282), BdWHY2 (XP_003574931), SbWHY2(XP_002453336), VvWHY2 (CBI16990), OsWYH2 (EEE56344), ZmWHY2 (ADX60190), and SlWHY2 (XP_010313085).

OVEREXPRESSION OF TOMATO WHIRLY PROTEIN 

59

supplier’s protocols. NtUbiquitin (GenBank acc. No. U66264.1) and EF-1α (acc. No. LOC544055) were used as reference. Three biological replicates (each with three technical replicates) were used for each sample. The standard curve method was used for analysis. The primers are shown in Table 1 Suppl.

Statistical analyses were performed using the software SigmaPlot 10.5, Excel, and SPSS v. 13.0 (Chicago, IL, USA). Means ± SD of at least three replicates are presented, and significant differences relative to the control were evaluated at P < 0.05 and P < 0.01, respectively.

Results To evaluate the similarity of SlWHY2 with homologs in other plant species, multiple sequence alignment was performed (Fig. 1). Results revealed that the predicted SlWHY2 amino acid sequence contained a fragment with strong similarity to the conserved domain of WHIRLY2 subunits from a range of plant species. Conservation was found to be notably high in the residues KGKAAL, YDW, and K (Fig. 1), which suggests that the WHIRLY family members share a similar single-stranded DNA binding mechanism (Desveaux et al. 2005). Based on the phylogenetic analysis of SlWHY2 and other WHIRLY proteins, SlWHY2 is related to SbWHY2 (Fig. 2). However, the function of SbWHY2 has not been studied

so far. Additionally, SlWHY2 was predicted to localize in the mitochondria by the program Target P 1.1 (Table 2 Suppl.). To investigate the potential role of SlWHY2, we evaluated its expression profiles in different tissues of tomato by real-time qPCR (Fig. 3A). The expression of SlWHY2 was the highest in the leaf and the lowest in the fruit. Real-time qPCR was also performed to analyze the transcription of SlWHY2 under PEG 6000, NaCl, SA, H2O2, and P. solanacearum treatments in WT tomato plants (Fig. 3B-F). SlWHY2 expression was 2.8 times higher than that of the control after exposure to drought stress for 9 h and 1.9 times higher after NaCl stress for

Fig. 2. The phylogenetic relationship of the SlWHY2 with other WHIRLY transcription factors from tomato and other plant species. SlWHY2 is underlined. The unrooted phylogenetic tree of various WHIRLY-proteins was generated with the ClustalW2 program using the neighbor-joining method in MEGA v. 5.1. Bootstrap analyses were computed with 1 000 replicates, and percentages > 80 are shown on the branches. The gene names and GenBank acc. Nos. are as follows: AtWHY1 (AAC05348), AtWHY2 (NP_177282),AtWHY3 (AEC05619), BdWHY1 (XP_003557198), BdWHY2 (XP_003574931), CaWHY1 (XP_004514779), CaWHY2(XP_004494755), CsWHY1 (XP_011657483), CsWHY2 (XP_00414520), CsWHY3 (XP_010425045), MtWHY3 (AES96560),OsWHY1 (BAD68418), OsWYH2 (EEE56344), SbWHY1 (XP_002436467), SbWHY2 (XP_002453336), SlWHY2(XP_010313085), StWHY1 (AAF91282), StWHY2 (ADI77438), VvWHY1 (XP_002277278), VvWHY2 (CBI16990), ZmWHY1 (NP_001123589), ZmWHY2 (ADX60190).

S.-Y. ZHAO et al.

60

9 h. SA- and H2O2- induced SlWHY2 expression reached maximum at 12 and 9 h after treatment. SlWHY2 expression was 2.9 times higher than that of the control after exposure to P. solanacearum injection for 2 h. These results suggest that SlWHY2 may participate in biotic and abiotic stress responses. To further estimate the function of SlWHY2 in response to drought and biotic stresses, full-length SlWHY2 was cloned into the plant binary vector pBI121 under the control of 35S promoter and transformed into tobacco. A total of 7 individual kanamycin-resistant tobacco transgenic lines were generated and screened by PCR (data not shown). Seven T2 lines were selected by real-time qPCR (Fig. 4) and all seven transgenic lines exhibited SlWHY2 overexpression, and no expression of SlWHY2 was detected in the WT plant. Of the seven transgenic lines, T-1, T-3, and T-5 were selected for subsequent experiments.

On MS plates without mannitol, no obvious difference in germination was observed between WT and transgenic lines. However, transgenic lines showed significantly higher germination rate on medium containing 100, 150, and 200 mM mannitol compared to WT lines (Fig. 5A,C). Next, the sensitivity of seedling growth to drought stress was assayed. Root length was identical in all lines on MS plate without mannitol. Under 400 mM mannitol, the root length in WT, T-1, T-3 and T-5 decreased by 50.6, 12.7, 25, and 13.1 %, respectively (Fig. 5B,D). These results indicate that SlWHY2 over-expression in tobacco enhanced the tolerance to drought stress during periods of seed germination and seedling growth. To investigate whether SlWHY2 overexpression in mature tobacco also exhibited tolerance to drought stress, WT and transgenic lines were exposed to drought stress

Fig. 3. Relative expression of tomato SlWHY2 in different tissues and expression of SlWHY2 in whole plants under different stresses and hormone treatments analyzed by real-time qPCR. A - Tissue-specific expression of SlWHY2 in different organs of adult plants;B - effect of Pseudomonas solanacearum infection (1×108 cfu cm-3); C - effect of drought (20 % PEG-6000); D - effect of 200 mM NaCl; E - effect of 20 mM H2O2; and F - effect of 100 μM salicylic acid. The control was watered with Hoagland's solutionwithout additives. Error bars represent the SDs of triplicate reactions; *, ** - indicate significant differences from control at P 0.05 and 0.01, respectively.

OVEREXPRESSION OF TOMATO WHIRLY PROTEIN 

61

for 4 d (Fig. 6A). Leaves of WT plants wilted faster compared to those of transgenic lines. Under control conditions, transgenic and WT plants had similar REL, RWC, MDA, and proline content (Fig. 6B-E). However, drought-induced stress resulted in higher REL in WT proline content (Fig. 6B-E). However, drought-induced stress resulted in higher REL in WT plants than in transgenic lines. In addition, REL increased by about 41.89, 35.23, 32.8, and 35.2 in the WT, T-1, T-3, and T-5 lines, respectively, after 4 d of drought treatment (Fig. 6B) and the MDA content increased by 12.79, 6.63, 4 and 6.17 μmol g-1 (f.m.) in WT, T-1, T-3, and T-5 lines, respectively (Fig. 6C). On the other hand, RWC decreased by 44.3, 20.4, 23.7, and 19.4 % in WT, T-1, T-3 and T-5 lines, respectively, after drought treatment (Fig. 6D), and the content of proline in the WT, T-1, T-3 and T-5 lines increased by 18.52, 109.39, 186.37, and 150.93 μg g-1 (f.m.), respectively (Fig. 6E). These results suggested that, as in seedlings, SlWHY2 overexpression

in mature tobacco conferred tolerance to drought stress. Intracellular localization of H2O2 and O2

− in the leaves of WT and transgenic plants was analyzed by

Fig. 4. Identification of transgenic plants by real-time qPCR. The transcription of SlWHY2 was normalised to EF-1α expression. Error bars represent the SDs of triplicate reactions. The experiment was repeated three times with similar results.

Fig. 5. Seed germination and seedling growth of transgenic tobacco under drought stress. A - Seed germination of WT and transgeniclines in the medium containing 0, 100, 150, and 200 mM mannitol; B - the seedlings of tobacco lines transferred to MS mediumsupplemented with 400 mM mannitol; C - Germination rate under different concentrations of mannitol; D - root length under 0 and 400 mM mannitol. Means SDs, n = 3, ** and * indicate significant differences relative to the control at P < 0.01 and 0.05, respectively.

S.-Y. ZHAO et al.

62

DAB and NBT staining and under control conditions, no significant difference in accumulations of H2O2 and O2

− were detected between WT and transgenic lines. After drought treatment, H2O2 and O2

− accumulations increased. The colour was deeper in WT plants than in transgenic lines (Fig. 7A,B). Under control conditions, the content of H2O2 between WT and transgenic plants exhibited almost no difference (Fig. 7C). However, after 4 d of drought treatment, the content of H2O2 in WT, T-1, T-3, and T-5 lines increased by 4.95, 2.78, 2.46, and 3.1 μmol g-1(f.m.), and that of O2

− increased by 4, 2.31, 2.44, and 2.86 μmol g-1(f.m.) min-1, respectively (Fig. 7D). Since antioxidative enzymes play important roles in plant response to oxidative stress, we analyzed SOD and APX activities under drought treatment. Under normal conditions, these two antioxidant enzymes exhibited no

obvious difference in activities. After drought treatment, the activities of MnSOD, the form of SOD found in mitochondria, increased to 82.11, 134.59, 112.09, and 123.47 U g-1(f.m.), and those of APX increased to 95, 156.13, 138.1, and 152.49 μmol(acorbic acid) g-1(f.m.) min−1 (Fig. 8A,B) in the WT, T-1, T-3, and T-5 lines, respectively. To investigate the reason why transgenic plants showed higher enzyme activities, the expression of the genes encoding these enzymes (NtMnSOD, NtAPX) were analyzed by real-time qPCR. After exposure to drought stress, the expression of these genes were higher in the transgenic lines compared to the WT line (Fig. 8C,D). This suggests that SlWHY2 overexpression alleviated ROS accumulation in transgenic plants possibly by inducing expression of target antioxidative genes to retain higher enzyme activities. Since the SlWHY2 protein is predicted to be located in the

Fig. 6. Analysis of the drought tolerance in WT and transgenic tobacco lines T-1, T-3, and T-5. A - Phenotype; B - relative electrolyte leakage (REL), C - malondialdehyde (MDA) content; D - relative water content (RWC), and E - proline content of tobacco lines afterdrought treatment for 0 and 4 d. Means SDs, n = 3, ** and * indicate significant differences compared with the control at P < 0.01 and 0.05, respectively.

OVEREXPRESSION OF TOMATO WHIRLY PROTEIN 

63

mitochondria, we also examined the expression of alternative oxidase (AOX) gene. The transcription of AOX1a in the over-expression lines was approximately 5 times higher than that of the WT line after drought treatment (Fig. 9A). To further investigate the mechanisms by which SlWHY2 enhances tolerance to drought stress, real-time qPCR was conducted to detect the expression of some other mitochondrial genes (NtCOX1 and NtORF1). COX and ORF families are the key genes that encode cytochrome oxidase and ATP synthase in mitochondria. In contrast to control plants, SlWHY2-overexpressing plants showed higher expression of NtCOX1 and NtORF1 in response to drought stress. This suggests that elevated expression of these mitochondrial genes may account at least in part for enhancement of drought resistance in SlWHY2-overexpressing plants. Two weeks after inoculation with P. solanacearum, the leaves of transgenic plants exhibited only mild or partial signs of disease (Fig. 10A). The average sizes of lesions in the WT, T-1, T-3, and T-5 lines were 1.99, 1.02, 0.99 and 0.84 cm, respectively (Fig. 10D). Thus, transgenic lines had significantly reduced bacterial

growth compared to WT lines (Fig. 10E). Trypan blue staining of the inoculated leaves indicated that cell death was more prominent in transgenic lines compared to WT line following 12 h of inoculation (Fig. 10B). H2O2 accumulation, determined by DAB staining, was much more pronounced in WT lines than in transgenic lines after 2 d of inoculation with P. solanacearum (Fig. 10C). The transcriptions of known defence-related genes (NtPR1 and NtPR2) were investigated by real-time qPCR in tobacco lines before and 12 h after inoculation with P. solanacearum. Before inoculation, there were no significant differences in expressions of the two genes between transgenic and WT plants. Upon inoculation, PR1 expressions were 6.23, 5.4, and 7.16 times higher in transgenic plants than that in WT plants, and PR2 expression levels were about 3.76, 3.63 and 4.05 times higher in transgenic plants than that in WT plants (Fig. 10F,G). Taken together, these data showed that SlWHY2 overexpression in transgenic tobacco plants affected transcriptional expression of the two tested defence-related genes in response to P. solanacearum infection.

Fig. 7. The accumulation of H2O2 and O2

− in WT and transgenic tobacco lines T-1, T-3, and T-5. DAB staining (A) and NBT staining (B) of one-week-old transgenic and WT seedlings after drought treatment for 0 and 5 d. H2O2 content (C) and O2

− content

(D) of tobacco plants after drought treatment for 0 and 4 d. Means SDs, n = 3, ** and * indicate significant differences comparedwith the control at P < 0.01 and 0.05, respectively. Discussion Transcription factors regulate the expression of a series of stress-responsive genes by binding specifically to motifs in promoters and so modulate resistance to stresses such as dehydration and salinity. WHIRLY genes comprise a

small family of transcription factors that play an important role in modulating telomere stability, plastid genome repair, and plastid genome expression. However, the physiological function of WHIRLY proteins in

S.-Y. ZHAO et al.

64

tomato under drought stress remains poorly understood. In this study, SlWHY2 was found to be triggered not only by drought, salt, and pathogen attack but also by SA and H2O2 (Fig. 3). This indicates that SlWHY2 responds to biotic and abiotic stresses and might also be involved in ROS scavenging. Constitutive expression of SlWHY2 in tobacco plants resulted in neither growth retardation nor visible phenotypic alterations in transgenic plants. However, transgenic plants constitutively expressing AtWHY2 have been reported to develop dark green and distorted leaves that go on to exhibit signs of early senescence in

Arabidopsis (Maréchal et al. 2008). Based on this report and the results of our current study, we infer that growth abnormalities do not occur universally in WHIRLY-transgenic plants. Instead, such abnormalities may be specific to the source of the gene being overexpressed, the promoter it binds to, its target genes, as well as host plant species and its growth stage. Likewise, fewer target genes could be activated by AtWHY2 in tobacco than in Arabidopsis, which may explain the weaker negative effect on plant growth observed in tobacco. Reduced water loss is one of the major factors contributing to drought tolerance in plants. Under drought

Fig. 8. Analysis of enzyme activities and expression of their respective genes before and after drought stress. Superoxide dismutase (MnSOD; A) and ascorbate peroxidase (APX; B) activities in transgenic and WT plants after drought treatment for 0 and 4 d.Expression of NtMnSOD (C) and NtAPX (D) after drought treatment for 0 and 4 d in transgenic and WT plants. Means SDs, n = 3, ** and * indicate significant differences compared with the control at P < 0.01 and 0.05, respectively. stress, plants accumulate several metabolites such as proline and a variety of sugars and sugar alcohols to prevent detrimental changes. It has been reported that abiotic stress causes lipid peroxidation, leading to MDA accumulation. MDA content could be used as a measure of the damage caused by abiotic stresses (Sathiyaraj et al. 2011). Our results showed that overexpression of SlWHY2 in tobacco remarkably improved drought tolerance. Transgenic lines showed better growth than WT tobacco when plants were grown in MS medium with mannitol (Fig. 5) and in soil under natural drought (Fig. 6). After drought treatment, the transgenic plants showed better growth, higher RWC and proline content, lower MDA accumulation and REL (Fig. 6). These results suggest that constitutive overexpression of SlWHY2 might lead to induction of several genes responsible for maintaining osmotic adjustment in transgenic plants and enabling them to thrive.

Exposure of plants to drought stress causes rapid generation and accumulation of ROS, which are highly reactive and toxic to cells. SlWHY2 overexpresson in transgenic plants resulted in lower H2O2 and O2

− accumulation compared to WT plants under drought stress (Fig. 7). In addition, overexpression of SlWHY2 reduced cellular injuries caused by ROS in transgenic seedlings. Thus, we inferred that overexpression of SlWHY2 in tobacco confers drought stress tolerance by reducing ROS accumulation. Changes in antioxidant enzyme activities have been reported to occur widely in plants in response to drought stress. Further analysis showed that overexpression of SlWHY2 alleviated ROS accumulation by maintaining high activities of the ROS-scavenging enzymes MnSOD and APX. In addition, the expression of NtMnSOD and NtAPX genes were also upregulated in the transgenic lines after drought treatment (Fig. 8). These results suggest that SlWHY2 underlies an

OVEREXPRESSION OF TOMATO WHIRLY PROTEIN 

65

efficient detoxification system to counteract oxidative stress under drought stress. Mitochondrial dysfunction also involves the generation of excess ROS (Fleury et al. 2002). AOX, a mitochondrial inner membrane protein that functions as a part of the electron transport chain, catalyzes O2

− dependent oxidation of ubiquinol, producing ubiquinone and water. Our findings are also consistent with the report by Cai et al. (2015) that AOX1a

and AOX1d transcription increases in the pollen grains of AtWHY2-overexpressing plants (Fig. 9). The excessive ROS is harmful to plants, thus the cellular mechanism involved in reducing ROS amount is stimulated under stress. Therefore, we speculated that one of the mechanisms by which SlWHY2 mediates drought tolerance is by alleviating ROS accumulation under drought stress.

Fig. 9. Expressions of mitochondrial genes encoding alternative oxidase (AOX), cytochrome oxidase (COX), and open reading frame(ORF1) analyzed by real-time qPCR. A - NtAOX1a, B - NtAOX1b, C - NtCOX1, and D - NtORF1. Means SDs, n = 3, ** and * indicate significant differences compared with the control at P < 0.01 and 0.05, respectively. Cytochrome oxidase and ATP synthase are very important protein complexes in the mitochondrial electron transport chain, and are necessary for mitochondrial function. Maréchal et al. (2008) reported that AtWHY2-overexpression inhibits expression of mitochondrial genes COX1, COX2, COX3, and ORF240a, and perturbs mitochondrial function. In contrast, SlWHY2-overexpressing plants were found to have higher expression of NtCOX1 and NtORF1 in response to drought stress (Fig. 9). Thus, a possible mechanism by which SlWHY2-overexpression enhanced tolerance to drought stress in tobacco is by regulating the expression of mitochondrial genes and stabilizing mitochondrial function. Pathogen invasion is often followed by production of ROS, which are important determinants of hypersensitive response (HR) in incompatible pathogen-plant interactions. Low content of ROS can act as signal mediating the activation of defence genes in response to pathogen infection (Nanda, et al. 2010). Massive ROS accumulation can induce lipid peroxidation and damage cellular structures, leading to oxidative stress and disease

susceptibility (Sathiyaraj et al. 2011, Wi et al. 2012). Controlling ROS accumulation is important in disease resistance. In pathogen resistance assays, PR genes are widely used as molecular markers and their induction is correlated with enhanced disease resistance in many cases (Shi et al. 2014). In this study, we found that expression of PR genes was higher in the transgenic lines than in the WT plants, and that disease resistance was significantly higher in the transgenic plants (Fig. 10F,G). Notably, NtPR1 and NtPR2 are marker genes for SA signalling (Seo et al. 2008). Therefore, we speculated that SlWHY2-dependent activation of PR genes and plant-defence genes played a pivotal role in the resistance of transgenic lines to pathogens, and that this resistance might be related to SA-dependent defence pathways. Desveaux et al. (2004) found that SA can activate AtWHY1 expression and participate in SA-dependent resistance response. The molecular mechanisms that underlie the activities of SlWHY2 in pathogen defence comprise multiple signalling pathways that function together and need to be explored in further studies. In summary, SlWHY2, a novel tomato WHIRLY gene,

S.-Y. ZHAO et al.

66

was isolated and cloned in this study. Our results strongly indicate that SlWHY2 mediates responses to multiple stresses. SlWHY2 overexpression enhanced tolerance to drought stress, possibly via transcriptional regulation of mitochondrial genes and stabilization of mitochondrial function. In addition, SlWHY2 enhanced resistance to biotrophic pathogens, which may be due to upregulated

expression of PR genes related to SA-dependent defence pathways and expression of antioxidant genes related to ROS-scavenging pathways. Further studies are needed for insights into the molecular regulatory mechanism underlying response to drought and pathogen in SlWHY2-overexpressing transgenic tomato.

Fig. 10. SlWHY2 overexpression improved transgenic tobacco resistance to the pathogen Pseudomonas solanacearum. A - Phenotype of tobacco plants after injection with P. solanacearum for two weeks. Trypan blue staining (B) and DAB staining (C) of tobacco plants after 12 h and 2 d, respectively, of infection with P. solanacearum. The diameter of lesions on tobacco leaves (D) and the bacterial populations in tobacco plants after infiltration with a suspension of P. solanacearum for 1, 3 and 6 d (E). The relative expression of pathogenesis-related genes NtPR1 (F) and NtPR2 (G) in WT and transgenic lines after incubation withP. solanacearum for 12 h. Means SDs, n = 3, ** and * indicate significant differences compared with the control at P < 0.01 and 0.05, respectively.

References Cai, Q., Guo, L., Shen, Z.R., Wang, D.Y., Zhang, Q.,

Sodmergen, S.: Elevation of pollen mitochondrial DNA copy number by WHIRLY2: altered respiration and pollen

tube growth in Arabidopsis. - Plant Physiol. 169: 660-673, 2015.

Cao, W.H., Liu, J., He, X.J., Mu, R.L., Zhou, H.L., Chen, S.Y.,

OVEREXPRESSION OF TOMATO WHIRLY PROTEIN 

67

Zhang, J.S.: Modulation of ethylene responses affects plant salt-stress responses. - Plant Physiol. 143: 707-719, 2007.

Cappadocia, L., Marechal, A., Parent, J.S., Lepage, E., Sygusch, J., Brisson, N.: Crystal structures of DNA-Whirly complexes and their role in Arabidopsis organelle genome repair. - Plant Cell 22: 1849-1867, 2010.

Casaretto, J., Ho, T.D.: The transcription factors HvABI5 and HvVP1 are required for the abscisic acid induction of gene expression in barley aleurone cells. - Plant Cell 15: 271-284, 2003.

Desveaux, D., Allard, J., Brisson, N., Sygusch, J.: A new family of plant transcription factors displays a novel ssDNA-binding surface. - Nat. Struct. Biol. 9: 512-517, 2002.

Desveaux, D., Després, C., Joyeux, A., Subramaniam, R., Brisson, N.: PBF-2 is a novel single-stranded DNA binding factor implicated in PR-10a gene activation in potato. - Plant Cell 12: 1477-1490, 2000.

Desveaux, D., Maréchal, A., Brisson, N.: Whirly transcription factors: defense gene regulation and beyond. - Trends Plant Sci. 10: 95-102, 2005.

Desveaux, D., Subramaniam, R., Després, C., Mess, J.N., Lévesque, C., Fobert, P.R., Dangl, J.L., Brisson, N.: A “Whirly” transcription factor is required for salicylic acid-dependent disease resistance in Arabidopsis. - Dev. Cell 6: 229-240, 2004.

Fleury, C., Mignotte, B., Vayssière J.: Mitochondrial reactive oxygen species in cell death signaling. - Biochimie 84:131-141, 2002.

Glazebrook, J., Chen, W.Q., Estes, B., Chang, H.S., Nawrath, C., Métraux, J.P., Zhu, T., Katagiri, F.: Topology of the network integrating salicylate and jasmonate signal transduction derived from global gene expression phenotyping. - Plant J. 34: 217-228, 2003.

Irigoyen, J.J., Emerich, D.W., Sánchez-Díaz, M.: Water stress induced changes in concentrations of proline and total soluble sugars in nodulated alfalfa (Medkago sativa) plant. - Physiol. Plant. 84: 55-60, 1992.

Jiang, M.Y., Zhang, J.H.: Effect of abscisic acid on active oxygen species, antioxidative defence system and oxidative damage in leaves of maize seedlings. - Plant Cell Physiol. 42: 1265-1273, 2001.

Király, L., Hafez, Y.M., Fodor, J., Király, Z.: Suppression of tobacco mosaic virus-induced hypersensitive-type necrotization in tobacco at high temperature is associated with downregulation of NADPH oxidase and superoxide and stimulation of dehydroascorbate reductase. - J. gen.Virol. 89: 799-808, 2008.

Krause, K., Kilbienskia, I., Mulischb, M., Rödigerc, A., Schäfera, A., Krupinska, K.: DNA-binding proteins of the Whirly family in Arabidopsis thaliana are targeted to the organelles. - FEBS Lett. 579: 3707-3712, 2005.

Krupinska, K., Oetke, S., Desel, C., Mulisch, M., Schäfer, A., Hollmann, J., Kumlehn, J., Hensel, G.: WHIRLY1 is a major organizer of chloroplast nucleoids. - Front. Plant Sci. 5: 432, 2014.

Li, X.G., Meng, Q.W., Jiang, G.Q., Zou, Q.: The susceptibility of cucumber and sweet pepper to chilling under low irradiance is related to energy dissipation and water-water cycle. - Photosynthetica 41: 259-265, 2003.

Liu, X., Wang, Z., Wang, L., Wu, R., Phillips, J., Deng, X.: LEA4 group genes from the resurrection plant Boea hygrometrica confer dehydration tolerance in transgenic tobacco. - Plant Sci. 176: 90-98, 2009.

Loreto, F., Velikova, V.: Isoprene produced by leaves protects the photosynthetic apparatus against ozone damage, quenches ozone products and reduces lipid peroxidation of cellular membranes. - Plant Physiol. 127: 1781-1787, 2001.

Ma, H.L., Zhou, H.L., Zhang, H.Y., Zhao, J.: Cloning and expression analysis of an AP2/ERF gene and its responses to phytohormones and abiotic stresses in rice. - Rice Sci. 17: 1-9, 2010.

Ma, N.N., Zuo, Y.Q., Liang, X.Q., Yin, B., Wang, G.D., Meng, Q.W.: The multiple stress-responsive transcription factor SlNAC1 improves the chilling tolerance of tomato. - Physiol. Plant. 149: 474-486, 2013.

Maréchal, A., Parent, J.S., Sabar, M., Veronneau-Lafortune, F., Abou-Rached, C., Brisson, N.: Overexpression of mtDNA-associated AtWhy2 compromises mitochondrial function. - BMC Plant Biol. 8: 42, 2008.

Mittler, R., Vanderauwera, S., Gollery, M., Van Breusegem, F.V.: Reactive oxygen gene network of plants. - Trends Plant Sci. 9: 490-498, 2004.

Murik, O., Elboher, A., Kaplan, A.: Dehydroascorbate: a possible surveillance molecule of oxidative stress and programmed cell death in the green alga Chlamydomonas reinhardtii. - New Phytol. 202: 471-484, 2014.

Nanda, A.K., Andrio, E., Marino, D., Pauly, N., Dunand, C.: Reactive oxygen species during plant-microorganism early interactions. - J. Integr. Plant Biol. 52: 195-204, 2010.

Prikryl, J., Watkins, K. P., Friso, G., Van Wijk, K. J., Barkan, A.: A member of the Whirly family is a multifunctional RNA- and DNA-binding protein that is essential for chloroplast biogenesis. - Nucl. Acids Res. 36: 5152-5165, 2008.

Ramel, F., Sulmon, C., Gouesbet, G., Couée, I.: Natural variation reveals relationships between pre-stress carbohydrate nutritional status and subsequent responses to xenobiotic and oxidative stress in Arabidopsis thaliana. - Ann. Bot. 104: 1323-1337, 2009.

Sathiyaraj, G., Lee, O.R., Parvin, S., Khorolragchaa, A., Kim, Y.J., Yang, D.C.: Transcript profiling of antioxidant genes during biotic and abiotic stresses in Panax ginseng C.A. Meyer. - Mol. Biol. Rep. 38: 2761-2769, 2011.

Seo, P.J., Lee, A.K., Xiang, F., Park, C.M.: Molecular and functional profiling of Arabidopsis pathogenesis-related genes: insights into their roles in salt response of seed germination. - Plant Cell Physiol. 49: 334-344, 2008.

Shi, W.N., Hao, L.L., Li, J., Liu, D.D., Guo, X.Q., Li, H.: The Gossypium hirsutum WRKY gene GhWRKY39-1 promotes pathogen infection defense responses and mediates salt stress tolerance in transgenic Nicotiana benthamiana. - Plant Cell Rep. 33: 483-498, 2014.

Stone, J.M., Heard, J.E., Asai, T., Ausubel, F.M.: Simulation of fungal-mediated cell death by fumonisin B1 and selection of fumonisin B1-resistant (fbr) Arabidopsis mutants. - Plant Cell 12: 1811-1822, 2000.

Walter, M.H., Liu, J.W., Wünn, J., Hess, D.: Bean ribonuclease-like pathogenesis-related protein genes (Ypr10) display complex patterns of developmental, dark-induced and exogenous-stimulus-dependent expression. - FEBS J. 239: 281-293, 1996.

Wi, S.J., Ji, N.R., Park, K.Y.: Synergistic biosynthesis of biphasic ethylene and reactive oxygen species in response to hemibiotrophic Phytophthora parasitica in tobacco plants. - Plant Physiol. 159: 251-265, 2012.

Yang, A., Dai, X.Y., Zhang, W.H.: A R2R3-type MYB gene,

S.-Y. ZHAO et al.

68

OsMYB2, is involved in salt, cold, and dehydration tolerance in rice. - J. exp. Bot. 63: 2541-2556, 2012.

Zhou, S.Y., Hu, W., Deng, X.M., Ma, Z.B., Chen, L.H., Huang, C., Wang, C., Wang, J., He, Y.Z., Yang, G.X., He, G.Y.: Overexpression of the wheat aquaporin gene, TaAQP7, enhances drought tolerance in transgenic tobacco. - PloS

ONE 7: e52439, 2012. Zong, X.J., Li, D.P., Gu, L.K., Li, D.Q.,Liu, L.X., Hu, X.L.:

Abscisic acid and hydrogen peroxide induce a novel maize group C MAP kinase gene, ZmMPK7, which is responsible for the removal of reactive oxygen species. - Planta 229: 485-495, 2009.