Okara, Soybean Residue, Prevents Obesity

in a Diet-Induced Murine Obesity Model

Kenji MATSUMOTO,y Yutaka WATANABE, and Shin-ichiro YOKOYAMA

Gifu Prefectural Research Institute for Bioengineering, Department of Applied Microbiology,

3481-2 Kamihachiya, Hachiya, Minokamo, Gifu 505-0004, Japan

Received October 11, 2006; Accepted November 28, 2006; Online Publication, March 7, 2007

[doi:10.1271/bbb.60563]

We examined the effect of okara on the prevention of

obesity in mice. A modified AIN-76 diet with a high fat

content (14.1% of crude fat) was used as a basal diet.

Male ICR mice were fed ad libitum with the basal diet or

a dried okara-supplemented basal diet (10, 20, or 40%)

for 10 weeks. The okara intake dose-dependently sup-

pressed the development of body weight and epididymal

white adipose tissue (EWAT), and prevented an increase

of plasma lipids, including total cholesterol, LDL

cholesterol, and non-esterified fatty acid. The okara

intake also prevented steatosis in the liver. Real-time

RT-PCR revealed that the okara intake induced down-

regulation of the fatty acid synthetase gene and up-

regulation of the cholesterol 7 alpha-hydroxylase

(CYP7A1) gene in the liver. We also found that the

okara intake caused a marked reduction in the expres-

sion of leptin and TNF-alpha genes in EWAT. Our

results suggest that okara is beneficial in preventing

obesity.

Key words: okara; soybean residue; obesity; hepatocyte

steatosis; lipid disorder

Soybean, a legume, contains high-quality proteins,dietary fiber, and phytochemicals, all of which exertbeneficial effects on human health.1,2) Soy proteinhas been especially well examined with regard to itsimplication in diseases mediated by lipid disorders andobesity.1–5) Okara is the residue obtained from soybeansafter extracting soymilk, and is also thought to containbeneficial health components. Okara has traditionallybeen used as a food for humans and animals and as afertilizer, although its disposal has become a significantproblem in recent years.6) Attempts, therefore, are beingmade to find a use for this potentially beneficial extract,and many trials have been reported on its fermenta-tion,7–9) extraction,10) and digestion.11) However, the useof okara itself has yet to be examined in detail.

An increasing prevalence of obesity has recently beenreported worldwide in both developed12–14) and devel-

oping15,16) countries. Obesity can induce many serioushealth problems and appears to lessen life expect-ancy,17,18) and its prevention should therefore be aworldwide priority. Okara contains a large amount ofcrude fiber composed of cellulose, hemicellulose, andlignin, and about 25% soy protein.6) A dietary fiberintake is generally known to result in body fat loss,19,20)

and soy protein is also known to be effective in pre-venting obesity,1–5) suggesting that okara would alsoexert a beneficial effect on preventing obesity and/orlipid disorders. The aim of this study, therefore, is toinvestigate the possible effects of an okara intake on theprevention of obesity.

Materials and Methods

Diets and animals. Dried okara was purchased fromMamehiko (Yokohama, Kanagawa, Japan). Its nutri-tional data were analyzed by Japan Food ResearchCenter (Nagoya, Japan; analysis number 306080656-002). A modified AIN-76 diet with a high fat content(14.1% of crude fat) was used as the basal diet (CLEAJapan, Tokyo, Japan), its ingredients being shown inTable 1. A dried okara-supplemented basal diet at aconcentration of 10, 20, or 40% was used as the okaradiet. A commercially purchased general diet (CE-2,CLEA Japan) was used to evaluate the efficacy of the

Table 1. Ingredients of the Basal Diet

Constituent Content (%)

Milk casein 28.24

DL-methionin 0.30

Corn oil 14.00

Sucrose 32.00

Corn starch 15.00

Cellulose powder 5.76

AIN-76 vitamin mix 1.00

AIN-76 mineral mix 3.50

Choline hydrogen tartrate 0.20

y To whom correspondence should be addressed. Tel: +81-574-25-3803; Fax: +81-574-25-3804; E-mail: matsumoto@bio.rd.pref.gifu.jp

Biosci. Biotechnol. Biochem., 71 (3), 720–727, 2007

induction of obesity with the basal diet. Nutritional datafor the basal diet, okara diets, and dried okara are shownin Table 2. Total calories were calculated accordingto the standard of nutrition indication announced byMinistry of Health, Labour and Welfare of Japan (2003).

Six-week-old male mice (ICR strain) were purchasedfrom CLEA Japan. They were randomly assigned to 5groups (6 mice per group), housed individually and fedon one of the foregoing diets ad libitum for 10 weeks.The mice fed on the basal diet are termed the controlmice, those fed on the diet supplemented with 10, 20,or 40% dried okara as O-10, O-20, and O-40 mice,respectively, and those fed on the CE-2 diet as theCE-2 mice. After anesthetization with CO2 gas withoutfasting, the mice were sacrificed and all organs weredissected for analysis. All experiments were performedin conformity with the International Guiding Principlesfor Biomedical Research Involving Animals.21)

Blood chemistry. The plasma total cholesterol, low-density lipoprotein (LDL) cholesterol, non-esterifiedfatty acid (NEFA), and triglyceride concentrations wererespectively analyzed by using cholesterol E, LDL-C,NEFA-C, and triglyceride-E kits (Wako Pure Chem-icals, Osaka, Japan).

Morphological analysis. The dissected liver sampleswere fixed overnight at 4 �C with 4% paraformaldehydein a 0.1 M sodium–phosphate buffer (pH 7.4) (PB),before being immersed in phosphate-buffered saline(PBS) containing 20% sucrose for 24 h at 4 �C. The fixedliver samples were embedded in TISSU MOUNT(Shiraimatsukiki, Osaka, Japan) and quickly frozen withliquid nitrogen. Frozen sections (7 mm thick) were

prepared with a cryostat, and then fixed with 4%paraformaldehyde in PB for 20min at room temperature.After rinsing the fixed sections in PBS, hematoxylin(Mayer’s Hematoxylin, Merck, Darmstadt, Germany)and eosin (Eosin Y, Merck) staining (HE staining) wascarried out for microscopic observation with a BX-51microscope (Olympus, Tokyo, Japan).

Oil red O staining for neutral lipid detection in theliver tissues. Sections prepared as for the morphologicalanalysis were immersed in 60% isopropanol for 1min,before being stained with 0.05% oil red O (Merck) in60% isopropanol for 20min at 37 �C. The sections werebriefly washed in 60% isopropanol and then rinsed indistilled water. After hematoxylin staining of the nucleiccounters, the stained sections were observed with theBX-51 microscope (Olympus).

Quantitative real-time RT-PCR. RNA extraction,cDNA synthesis and SYBR Green-based real-timePCR were conducted as previously described byMatsumoto et al.22) Briefly, total RNA samples wereisolated with a QuickPrep Total RNA extraction kit (GEHealthcare Bio-science, Piscataway, NJ, USA) fromliver tissues or with an RNeasy lipid tissue kit(QIAGEN, Cambridge, MA, USA) from epididymalwhite adipose tissues according to the manufacturer’sinstructions. To prepare cDNA, one microgram of eachtotal RNA sample was reverse-transcribed by usingSuper Script III Rnase H� reverse transcriptase (Invi-trogen, Carlsbad, CA, USA) and an oligo(dT) primer(Invitrogen). The prepared cDNA samples were purifiedwith a PCR Purification Kit (QIAGEN).Quantitative real-time PCR was performed on a

BioFlux LineGene (TOYOBO, Osaka, Japan), using aSYBR Green Real-time PCR Master Mix (TOYOBO)according to the manufacturer’s instructions. The house-keeping transcript, elongation factor-1� (EF-1�), wasused as an internal control because of its stableexpression in vivo.23) The primers used for each geneare summarized in Table 3. The PCR products wereevaluated by inspecting their melting curves (data notshown).

Statistics. A statistical analysis was conducted by one-way ANOVA and Fisher’s PLSD test with Stat Viewsoftware (SAS Institute, Cary, NC, USA).

Table 2. Nutritional Data for the Experimental Diets and Dried

Okara Used in This Study

Constituent Basal diet Dried okara O-10 O-20 O-40

Protein (%) 24.1 24.0 24.1 24.1 24.1

Fat (%) 14.1 15.2 14.2 14.3 14.5

NFE� (%) 50.0 5.1 45.5 41.0 32.0

Fiber (%) 5.6 42.8 9.3 13.0 20.5

Ash (%) 1.2 4.0 1.5 1.8 2.3

Moisture (%) 5.0 8.9 5.4 5.8 6.6

Energy (kcal/100 g) 434.5 338.8 424.9 415.4 396.2

�NFE, nitrogen-free extract (carbohydrates and others)

Table 3. Primers Used for Real-Time RT-PCR

Gene Forward (50!30) Reverse (50!30)

EF-1� CTCAGGTGATTATCCTGAACCATC AACAGTTCTGAGACCGTTCTTCCA

FAS GCACAGCTCTGCACTGTCTACTAC ATCCCAGAGGAAGTCAGATGATAG

HMGCR AAGGTGGTGAGAGAGGTGTTAAAG AATACAGTTTGAACTCCCCACATT

CYP7A1 GGATCAAGAGCAACTAAACAACCT GCTATGATGTCATCTTTTCGAATG

Leptin AGTGGGAATGAGAAATCACTTAGC GTGTATTGCTTTCCATCAAGTGTC

Adiponectin ACCTACGACCAGTATCAGGAAAAG ACTAAGCTGAAAGTGTGTCGACTG

TNF-� TCTTCTCAAAATTCGAGTGACAAG GAGAACCTGGGAGTAGACAAGGTA

Beneficial Effect of Okara in Preventing Obesity 721

Results

Effect of the okara diet on the body and internalorgan weights

All animals treated with the okara diets were in goodhealth throughout the experiment, and no side effectssuch as diarrhea were apparent (data not shown).

To examine the effect of okara on the prevention ofobesity, we fed the okara diet to ICR male mice for 10weeks. Although there were some differences in thenutritional contents of the experimental diets (Table 2),the average of the total energy intake during theexperimental period was almost the same in all groups(Table 4). The mice fed on the basal diet showedsignificantly greater body weight, body weight gain, anddevelopment of visceral white adipose tissues (WAT)than those fed on the commercially purchased CE-2 diet(Table 4), indicating that this basal diet could induceobesity. The addition of dried okara to the basal dietprevented the development of excessive body weight in

a dose–dependent manner (Fig. 1). Although a slighteffect was observed with the O-10 mice, the O-20 andO-40 mice showed a significant preventative effect. Thefinal body weight of the O-20 and O-40 mice was about15% lower (p < 0:01) than that of the control mice, and

Table 4. Effects of a 10-Week Treatment with the Okara Diet

Parameter Control O-10 O-20 O-40 CE-2

n 6 6 6 6 6

Intake (g/day) 3:76� 0:24 3:91� 0:29 3:87� 0:35 4:03� 0:28 4:45� 0:22��

Total energy intake (kcal) 888� 57 906� 67 878� 81 877� 60 863� 43

Body weight (g) 55:9� 3:7 53:2� 6:1 47:6� 4:5�� 48:1� 3:4�� 47:8� 3:4��

Body weight gain (g) 20:6� 3:7 17:9� 4:1 13:2� 3:8��� 12:1� 2:8��� 11:9� 2:5���

EWAT (mg/g�body weight) 46:7� 4:9 40:5� 11:2 37:6� 7:4� 34:5� 5:0�� 29:6� 6:8���

RWAT (mg/g�body weight) 15:6� 3:1 14:4� 3:8 14:0� 2:8 13:6� 2:3 9:53� 2:92��

Liver (mg/g�body weight) 49:0� 2:4 42:2� 5:6�� 44:3� 4:5� 38:5� 2:2��� 43:5� 1:6�

Kidney (mg/g�body weight) 14:1� 1:2 14:4� 2:5 15:8� 1:9 15:7� 0:9 17:4� 3:5�

Data are presented as the mean� SD.

Statistically significant compared with the control (�p < 0:05, ��p < 0:01, ���p < 0:001; Fisher’s PLSD test).

EWAT, epididymal white adipose tissue; RWAT, retroperitoneal white adipose tissue

Fig. 1. Body Weight Gain of the Mice during the 10-Week Study

Period.

Fig. 2. Hematoxylin and Eosin Staining of Liver Tissues of the Control Mice (A), O-10 Mice (B), O-20 Mice (C), and O-40 Mice (D).

CV, central vein. Magnification, �200; bar, 100 mm.

722 K. MATSUMOTO et al.

their final body weight gain was about 40% lower (p <0:001) than that of the control mice (Table 4).

The intake of the okara diet also influenced theincrease in various internal organ weights, including twodifferent WAT depots (Table 4). The weight of epidi-dymal WAT (EWAT) was markedly lower in the micefed on the okara diets than on the control mice (O-20,p < 0:05; O-40, p < 0:01). Moreover, although thedifference was not statistically significant, dried okaraintake also tended to prevent the development ofretroperitoneal WAT (RWAT) behind the kidneys.These results suggest that the total visceral WAT depotswere dose-dependently and markedly less in the micefed on the okara diets than in the control mice. Inaddition, the preventative effect on the increase inweight was particularly notable in the liver. The liverweights of all mice fed on the okara diets, even the O-10mice, were statistically lower than those of the controlmice (O-10, p < 0:01; O-20, p < 0:05; O-40, p <0:001). On the other hand, no difference was apparentin kidney weight among the control mice and the micefed on the okara diet, indicating that the difference inweight was presumably specific to the liver.

Histopathology of the liverTo identify the pathological basis for the difference in

liver weight, we performed HE staining of the livertissues of the mice tested (Fig. 2). No fibrosis orinflammation was apparent in any of the mice, buthepatocytes of the control mice were rich in unstainedcytoplasm (Fig. 2A). Unstained cytoplasmic regionswere less in the O-10 and O-20 mice (Fig. 2B and C),and scarcely apparent in the O-40 mice (Fig. 2D). Wefurther performed Oil red O staining, which is a stainingmethod used for neural lipid detection,24) of the livertissues (Fig. 3A–H). Many lipid droplets were apparentin the control mice (Fig. 3A and B), but were far fewerin the O-10 and O-20 mice (Fig. 3C–F). No lipiddroplets were apparent in the liver of the O-40 mice(Fig. 3G and H). These results indicate that the differ-ence in liver weight was due to the development of fattyliver.

To examine the alteration in synthesis of fatty acid inthe liver, we carried out real-time RT-PCR of the fattyacid synthase (FAS) gene which regulates lipogenesisand adipocyte differentiation (Fig. 3I).25) Although thedifference was not statistically significant, FAS expres-sion in the O-10 and O-20 mice was about 30% lowerthan that in the control mice. Moreover, the expressionlevel in the O-40 mice was significantly lower at about40% of the level in the control mice (p < 0:001).

Prevention of elavated plasma lipids by the okaraintake

To investigate the effect on plasma lipid disorders, weexamined the concentrations of plasma total cholesterol,LDL cholesterol, NEFA, and triglyceride (Fig 4), in-creases of which level lead to lipid disorders. Since the

plasma samples were prepared from the mice withoutany fasting, some scatter were apparent in the data,especially in the triglyceride concentration. Total cho-lesterol, LDL cholesterol, and NEFA tended to besuppressed by the okara intake in a dose-dependentmanner (Fig. 4A, B and C). Although there was no dose-dependence, triglyceride was also significantly sup-pressed in the O-40 mice (p < 0:05, Fig. 4D).Cholesterol biosynthesis and the conversion of cho-

lesterol to bile acids in the liver play important roles inwhole body cholesterol homeostasis.26,27) To examinethe effect of an okara intake on cholesterol homeostasis,we carried out real-time RT-PCR in the liver tissuesfor HMG-CoA reductase (HMGCR), the rate-limitingenzyme in cholesterol biosynthesis,26) and cholesterol7 alpha-hydroxylase (CYP7A1), the initial and rate-limiting enzyme in bile acid biosynthesis.27) Although

Fig. 3. Neutral Lipids Detection by Oil Red O Staining in the Liver

Tissues of the Control Mice (A, B), O-10 Mice (C, D), O-20 Mice

(E, F), and O-40 Mice (G, H).

CV, central vein. A, C, E, G, magnification, �200; bar, 100 mm;

B, D, F, H, �400; bar, 50 mm. Expression of the FAS gene in the

liver was compared by real-time RT-PCR (I). The housekeeping

transcript, elongation factor-1� (EF-1�), was used as a control to

standardize the efficiency of each reaction. Each result is themean�SE (n ¼ 6). �P < 0:01 compared with control mice.

Beneficial Effect of Okara in Preventing Obesity 723

the HMGCR gene expression was not changed, theCYP7A1 gene was dose-dependently up-regulated bythe okara intake (O-40, p < 0:05) (Fig. 5A and B).

Expression changes of adipocytokines in EWATAdipocytokines are bio-active substances secreted

from adipocytes,28) secretion disorders of which havebeen reported with obesity and obesity-related diseases;

for example, hypersecretion of leptin and tumor necrosisfactor (TNF)-� and hyposecretion of adiponectin.28–30)

We therefore examined their gene expression in EWATby using real-time RT-PCR (Fig. 6). Although there wasno difference in adiponectin expression (Fig. 6B), theokara intake significantly suppressed the expression ofleptin (O-10, p < 0:05; O-20 and O-40, p < 0:005;Fig. 6A) and TNF-� (O-20 and O-40, p < 0:05;Fig. 6C).

Discussion

Soybean has become noteworthy in recent yearsbecause of its anti-obesity property, and many studieshave been reported on the beneficial components ofsoybean such as protein, phytochemicals, and pep-tides.1–5) Merritt has reviewed the beneficial effects ofsoy protein and soybean phytoestrogens on the preven-tion of metabolic syndrome,2) in which visceral whiteadipose tissue accumulation has been shown to play acrucial role in the development of cardiovascular diseaseand in the development of obesity-related disorders suchas diabetes mellitus, hyperlipidemia and hypertension.31)

Its residue, okara, also contains these components, andwe have shown here the beneficial effects of an okaraintake on the prevention of obesity, hepatocyte steatosis,and lipid disorders by using a mice model.As shown in Table 2, dried okara contains 24%

protein which corresponds to about 70% of the soybeanprotein content, indicating that the beneficial propertiesof soy protein can also be expected with okara. Ascencioet al. have reported that the replacement of casein withsoy protein prevented fatty liver, reduced the hepaticFAS gene expression, and up-regulated the hepaticCYP7A1 gene.32) These effects were actually observedfrom the okara intake in this study. We also found that

Fig. 4. Plasma Biochemical Values of Total Cholesterol (A), Low-Density Lipoprotein (LDL) Cholesterol (B), Non-Esterified Fatty Acid (C), and

Triglyceride (D) in the Mice.

Means values are shown as bars (n ¼ 6). �P < 0:05, ��P < 0:001 compared with control mice.

Fig. 5. Gene Expression Analysis of HMG-CoA Reductase (A) and

CYP7A1 (B) in the Liver by Real-Time RT-PCR.

Elongation factor-1� (EF-1�) was used as a control to standardize

the efficiency of each reaction. Each result is the mean� SE

(n ¼ 6). �P < 0:05 compared with control mice.

724 K. MATSUMOTO et al.

the okara intake suppressed the development of visceralwhite adipose tissues and reduced the leptin geneexpression in EWAT. The main effect of leptin is theregulation of energy homeostasis, and leptin in thecirculating serum is usually proportional to the totaladipose tissue mass.30) Tovar et al. have indicated thatdietary soy protein promoted the conversion of largeadipocytes to smaller ones,33) suggesting that the soyprotein in okara might have affected the development ofadipose tissues and the expression of the leptin gene. Inaddition, okara is rich in dietary fiber.6) It has beenreported that some types of dietary fiber exerted a serumcholesterol-lowering effect by increasing fecal bile acidexcretion.34–36) An increase in fecal bile acid excretioninduces the conversion of cholesterol to bile acids,resulting in a decrease in the serum cholesterol level.Conversion of cholesterol to bile acids therefore playsan important role in cholesterol homeostasis.27) We havedemonstrated in this study a dose-dependent increase inCYP7A1, the initial and rate-limiting enzyme on the bileacid biosynthetic pathway, resulting from the okaraintake, suggesting that the dietary fiber in okara mightaccelerate fecal bile acid excretion and the subsequentincrease in conversion of cholesterol to bile acid, finallyresulting in a decrease in the plasma cholesterol levels.

Epidemiological studies also support a dietary fiberintake preventing obesity, and a fiber intake is knownto be inversely associated with body weight and bodyfat.19,20) Although the functional constituents were notrevealed in this study, one or more components in okara,including soy protein and dietary fiber, may haveexerted beneficial effects singly, synergistically, oradditively. Therefore, okara also seems to be asbeneficial as soybean.The relationship between diet, gene expression, and

health has recently been actively studied in what iscalled nutrigenomics.37) Nutrigenomics has helped iden-tify the evidence-based relevance of functional food andpromote an increased understanding of how nutritioninfluences health control. We investigated here theexpression changes in genes related to fatty acidsynthesis and obesity in the liver and EWAT, andrevealed that an okara intake suppressed gene expressionof FAS in the liver and of leptin and TNF-� in EWAT.We also detected up-regulation of the CYP7A1 gene inthe liver. Moreover, these genetic changes were closelycorrelated with pathological features. The expression ofFAS was correlated with an accumulation of lipids in theliver, and that of leptin was correlated with the amountof visceral WAT. FAS is known to regulate fatty acidsynthesis and lipogenesis,25) and the FAS pathway couldbe a common molecular target for central appetitive andperipheral metabolic regulation.38) On the other hand,TNF-� has been implicated in insulin resistance,39)

indicating that an okara intake may also lead to theprevention of insulin resistance. Although a decrease ofadiponectin in WAT has been reported with obesity,28,30)

the okara intake did not influence adiponectin geneexpression in EWAT. These results indicate the anti-obesity effect of the okara intake from a nutrigenomicpoint of view. However, further studies on the proteinlevel and enzymatic activities are required to explore theeffect of the okara intake and are in current progress inour laboratory.In conclusion, we have shown in the present study

that okara was beneficial for the prevention of obesity,hepatocyte steatosis, and lipid disorders. Our resultsmight lead to the inclusion of okara in our diet,benefiting human health as well as the ecologicalproblem of its disposal.

References

1) Bhathena, S. J., and Velasquez, M. T., Beneficial role ofdietary phytoestrogens in obesity and diabetes. Am. J.Clin. Nutr., 76, 1191–1201 (2002).

2) Merritt, J. C., Metabolic syndrome: soybean foods andserum lipids. J. Natl. Med. Assoc., 96, 1032–1041(2004).

3) Banz, W. J., Davis, J., Peterson, R., and Iqbal, M. J.,Gene expression and adiposity are modified by soyprotein in male Zucker diabetic fatty rats. Obes. Res., 12,1907–1913 (2004).

4) Tovar, A. R., Torre-Villalvazo, I., Ochoa, M., Elias, A.

Fig. 6. Gene Expression of Leptin (A), Adiponectin (B), and TNF-�(C) in the Epididymal White Adipose Tissue Determined by Real-

Time RT-PCR.

Elongation factor-1� (EF-1�) was used as a control to standardize

the efficiency of each reaction. Each result is the mean� SE

(n ¼ 6). �P < 0:05, ��P < 0:005 compared with control mice.

Beneficial Effect of Okara in Preventing Obesity 725

L., Ortiz, V., Aguilar-Salinas, C. A., and Torres, N., Soyprotein reduces hepatic lipotoxicity in hyperinsulinemicobese Zucker fa/fa rats. J. Lipid Res., 46, 1823–1832(2005).

5) Torres, N., Torre-Villalvazo, I., and Tovar, A. R.,Regulation of lipid metabolism by soy protein and itsimplication in diseases mediated by lipid disorders.J. Nutr. Biochem., 17, 365–373 (2006).

6) O’ Toole, D. K., Characteristics and use of okara, thesoybean residue from soy milk production—a review.J. Agric. Food Chem., 47, 363–371 (1999).

7) Matsuo, M., In vivo antioxidant activity of Okara Koji, afermented okara, by Aspergillus oryzae. Biosci. Bio-technol. Biochem., 61, 1968–1972 (1997).

8) Jiang, W. Z., Kitamura, Y., and Li, B., Improvingacidogenic performance in anaerobic degradation ofsolid organic waste using a rotational drum fermentationsystem. Biores. Technol., 96, 1537–1543 (2005).

9) Mizumoto, S., Hirai, M., and Shoda, M., Production oflipopeptide antibiotic iturin A using soybean curdresidue cultivated with Bacillus subtilis in solid-statefermentation. Appl. Microbiol. Biotechnol., 72, 869–875(2006).

10) Quitain, A. T., Oro, K., Katoh, S., and Moriyoshi, T.,Recovery of oil components of okara by ethanol-modified supercritical carbon dioxide extraction. Biores.Technol., 97, 1509–1514 (2006).

11) Kasai, N., Murata, A., Inui, H., Sakamoto, T., and Kahn,R. I., Enzymatic high digestion of soybean milk residue(okara). J. Agric. Food Chem., 52, 5709–5716 (2004).

12) Visscher, T. L., Kromhout, D., and Seidell, J. C., Long-term and recent time trends in the prevalence of obesityamong Dutch men and women. Int. J. Obes. Relat.Metab. Disord., 26, 1218–1224 (2002).

13) Mokdad, A. H., Ford, E. S., Bowman, B. A., Dietz, W.H., Vinicor, F., Bales, V. S., and Marks, J. S., Prevalenceof obesity, diabetes, and obesity-related health riskfactors. JAMA, 289, 76–79 (2003).

14) Bendixen, H., Holst, C., Sorensen, T. I., Raben, A.,Bartels, E. M., and Astrup, A., Major increase inprevalence of overweight and obesity between 1987and 2001 among Danish adults. Obes. Res., 12, 1464–1472 (2004).

15) Monteiro, C. A., D’A Benicio, M. H., Conde, W. L., andPopkin, B. M., Shifting obesity trends in Brazil. Eur. J.Clin. Nutr., 54, 342–346 (2000).

16) Salazar-Martinez, E., Allen, B., Fernandez-Ortega, C.,Torres-Mejia, G., Galal, O., and Lazcano-Ponce, E.,Overweight and obesity status among adolescents fromMexico and Egypt. Arch. Med. Res., 37, 535–542 (2006).

17) Willett, W. C., Dietz, W. H., and Colditz, G. A.,Guidelines for healthy weight. N. Engl. J. Med., 341,427–434 (1999).

18) Fontaine, K. R., Redden, D. T., Wang, C., Westfall, A.O., and Allison, D. B., Years of life lost due to obesity.JAMA, 289, 187–193 (2003).

19) Roberts, S. B., McCrory, M. A., and Saltzman, E., Theinfluence of dietary composition on energy intake andbody weight. J. Am. Coll. Nutr., 21, 140S–145S (2002).

20) Slavin, J. L., Dietary fiber and body weight. Nutrition,21, 411–418 (2005).

21) Council for International Organizations of MedicalSciences, International Guiding Principles for Biomed-

ical Research Involving Animals, Geneva, Switzerland(1985).

22) Matsumoto, K., Kwon, O. Y., Kim, H., and Akao, Y.,Expression of rck/p54, a DEAD-box RNA helicase, ingametogenesis and early embryogenesis of mice. Dev.Dyn., 233, 1149–1156 (2005).

23) Matsumoto, K., Hiraiwa, N., Yoshiki, A., Ohnishi, M.,and Kusakabe, M., PDGF receptor-alpha deficiency inglomerular mesangial cells of tenascin-C knockout mice.Biochem. Biophys. Res. Commun., 290, 1220–1227(2002).

24) Haimovici, R., Gantz, D. L., Rumelt, S., Freddo, T. F.,and Small, D. M., The lipid composition of drusen,Bruch’s membrane, and sclera by hot stage polarizinglight microscopy. Invest. Ophthalmol. Vis. Sci., 42,1592–1599 (2001).

25) Paulauskis, J. D., and Sul, H. S., Cloning and expressionof mouse fatty acid synthase and other specific mRNAs.Developmental and hormonal regulation in 3T3-L1 cells.J. Biol. Chem., 263, 7049–7054 (1988).

26) Kleemann, R., and Kooistra, T., HMG-CoA reductaseinhibitors: effects on chronic subacute inflammation andonset of atherosclerosis induced by dietary cholesterol.Curr. Drug Targets Cardiovasc. Haematol. Disord., 5,441–453 (2005).

27) Cheema, S. K., Cikaluk, D., and Agellon, L. B., Dietaryfats modulate the regulatory potential of dietary choles-terol on cholesterol 7�-hydroxylase gene expression.J. Lipid Res., 38, 315–323 (1997).

28) Matsuzawa, Y., White adipose tissue and cardiovasculardisease. Best Pract. Res. Clin. Endocrinol. Metab., 19,637–647 (2005).

29) Koerner, A., Kratzsch, J., and Kiess, W., Adipocyto-kines: leptin—the classical, resistin—the controversial,adiponectin—the promising, and more to come. BestPract. Res. Clin. Endocrinol. Metab., 19, 525–546(2005).

30) Housa, D., Housova, J., Vernerova, Z., and Haluzik, M.,Adipocytokines and cancer. Physiol. Res., 55, 233–244(2006).

31) Zimmet, P., Magliano, D., Matsuzawa, Y., Alberti, G.,and Shaw, J., The metabolic syndrome: a global publichealth problem and a new definition. J. Atheroscler.Thromb., 12, 295–300 (2005).

32) Ascencio, C., Torres, N., Isoard-Acosta, F., Gomez-Perez, F. J., Hernandez-Pando, R., and Tovar, A. R., Soyprotein affects serum insulin and hepatic SREBP-1mRNA and reduces fatty liver in rats. J. Nutr., 134, 522–529 (2004).

33) Tovar, A. R., Torre-Villalvazo, I., Ochoa, M., Elias, A.L., Ortiz, V., Aguilar-Salinas, C. A., and Torres, N., Soyprotein reduces hepatic lipotoxicity in hyperinsulinemicobese Zucker fa/fa rats. J. Lipid Res., 46, 1823–1832(2005).

34) Andersson, M., Ellegard, L., and Andersson, H., Oatbran stimulates bile acid synthesis within 8 h asmeasured by 7alpha-hydroxy-4-cholesten-3-one. Am. J.Clin. Nutr., 76, 1111–1116 (2002).

35) Chau, C. F., and Huang, Y. L., Effects of the insolublefiber derived from Passiflora edulis seed on plasma andhepatic lipids and fecal output. Mol. Nutr. Food Res., 49,786–790 (2005).

36) van Bennekum, A. M., Nguyen, D. V., Schulthess, G.,

726 K. MATSUMOTO et al.

Hauser, H., and Phillips, M. C., Mechanisms ofcholesterol-lowering effects of dietary insoluble fibres:relationships with intestinal and hepatic cholesterolparameters. Br. J. Nutr., 94, 331–337 (2005).

37) Afman, L., and Muller, M., Nutrigenomics: from mo-lecular nutrition to prevention of disease. J. Am. Diet.Assoc., 106, 569–576 (2006).

38) Osei-Hyiaman, D., DePetrillo, M., Pacher, P., Liu, J.,Radaeva, S., Batkai, S., Harvey-White, J., Mackie, K.,Offertaler, L., Wang, L., and Kunos, G., Endocannabi-

noid activation at hepatic CB1 receptors stimulates fattyacid synthesis and contributes to diet-induced obesity.J. Clin. Invest., 115, 1298–1305 (2005).

39) Pietilainen, K. H., Kannisto, K., Korsheninnikova, E.,Rissanen, A., Kaprio, J., Ehrenborg, E., Hamsten, A.,and Yki-Jarvinen, H., Acquired obesity increases CD68and TNF-� and decreases adiponectin gene expression inadipose tissue. A study in monozygotic twins. J. Clin.Endocrinol. Metab., 91, 2776–2781 (2006).

Beneficial Effect of Okara in Preventing Obesity 727