Objective: You will be able to list the positives and negatives of genetic engineering

Do Now:

Read “Increasing variation” which starts on p. 320 and ends on page 321

Give one example of a new bacteria that was reproduced

Give one example of a new plant that was reproduced

Genetic Engineering

• This is a new technology used to change the genetic instructions in individuals

Why would you want to change the genetic instructions in an organism?

• To allow the organism to do something new– Ex. Insert a gene into crops to allow them to

make a protein to fight of a fungus

• For gene therapy– A defective gene is replaced with a “good”

gene

Objective: You will be able to describe how DNA is removed from one cell and added to another cell.

Do Now: Read all of p. 327 Define transformation What is a plasmid?

1. Copy the following series of DNA nucleotides onto a sheet of paper.

GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA

2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once.

3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find?

Section 13-2

Interest Grabber continued

Recognition sequences

Section 13-2

Restriction Enzymes

Recognition sequences are the places on the DNA where an enzyme will cut it

Recognition sequences

Sticky end

Section 13-2

Restriction Enzymes

Human Cell

Gene for human growth hormone

Recombinant DNA

Gene for human growth hormone

Sticky ends

DNA recombination

DNA insertion

Bacterial Cell

Plasmid

Bacterial chromosome

Bacterial cell for containing gene for human growth hormone

Section 13-3

Figure 13-9 Making Recombinant DNA

Mixed DNA

• When you combine DNA from two individuals, we call it recombinant DNA

Figure 17.5 A tobacco plant expressing a firefly gene

Objective: You will be able to explain how gel electrophoresis separates pieces of DNA.

• Read the section named “The tools of molecular Biology” on p. 322-323

• How is DNA cut?

• How is DNA separated?

Use of Restriction Enzymes

• Restriction enzymes cut DNA whenever they see a specific sequence of bases.

• The pieces of cut DNA are called restriction fragments

• Each person has a different DNA sequence

• So restriction enzymes will cut each person’s DNA into different sized pieces.

We can use a process called gel electrophoresis to separate the pieces

Figure 20.x1a Laboratory worker reviewing DNA band pattern

Gel Electrophoresis• Moves DNA because it is negative

• Separates DNA fragments based on size

• The smaller the fragment the farther it will move

• Can compare DNA from individuals

Figure 20.17 DNA fingerprints from a murder case

Figure 20.9 Using restriction fragment patterns to distinguish DNA from different alleles

Objective: You will be able to explain how selective breeding can be used to improve offspring.

Do Now• Read all of page 310• Define selective breeding• Define hybridization

The tomatoes in your salad and the dog in your backyard are a result of selective breeding.

Interest Grabber

Labrador retriever

Poodle

Labradoodles?

Goldendoodle?

Can you think of some selective breeding examples

Objective: You will be able to describe the process of cloning.

• How can a sheep that is 12 years old have a twin that is 4 years old?

Cloning

Section 13-4

Flowchart

A body cell is taken from a donor animal.

An egg cell is taken from a donor animal.

The fused cell begins dividing, becoming an embryo.

The nucleus is removed from the egg.

The body cell and egg are fused by electric shock.

The embryo is implanted into the uterus of a foster mother.

The embryo develops into a cloned animal.

A donor cell is taken from a sheep’s udder.

Donor Nucleus

These two cells are fused using an electric shock.

Fused Cell

The fused cell begins dividing normally.

Embryo

The embryo is placed in the uterus of a foster mother.

Foster MotherThe embryo

develops normally into a lamb—Dolly

Cloned Lamb

Egg Cell

An egg cell is taken from an adult female

sheep.

The nucleus of the egg cell is removed.

Section 13-4